VIRAL DETECTION SYSTEM AND METHODS OF USING SAME
20230358735 · 2023-11-09
Assignee
Inventors
- Lia Stanciu-Gregory (West Lafayette, IN, US)
- Winston Yen-Yu Chen (Los Altos, CA, US)
- Amit Kumar Barui (West Lafayette, IN, US)
- Ana Maria Ulloa Gomez (Lafayette, IN, US)
Cpc classification
B82Y15/00
PERFORMING OPERATIONS; TRANSPORTING
International classification
G01N33/543
PHYSICS
Abstract
A biosensing device and methods for detecting the SARS-CoV-2 virus sequence in a biological fluid. The device includes an interdigitated electrode, a supporting flexible membrane and an electrode material that is disposed on the interdigitated electrode and supporting flexible membrane. The electrode material is selected from (i) two-dimensional and layered MXenes and (2) printable graphene, wherein the electrode material is functionalized with ssDNA primers specific to the SARS-CoV-2 virus sequence to be detected. The device also includes a sensor that reads an electrical resistance change across the interdigitated electrode after a target DNA sequence is applied to the electrode material.
Claims
1. A biosensing device for detecting the SARS-CoV-2 virus sequence in a biological fluid, comprising: an interdigitated electrode; a supporting flexible membrane; an electrode material that is disposed on the interdigitated electrode and supporting flexible membrane, wherein the electrode material is selected from (i) two-dimensional and layered MXenes and (2) printable graphene, wherein the electrode material is functionalized with ssDNA primers specific to the SARS-CoV-2 virus sequence to be detected; and a sensor that reads an electrical resistance change across the interdigitated electrode after a target DNA sequence is applied to the electrode material.
2. The device of claim 1, wherein the interdigitated electrode is made from gold or silver.
3. The device of claim 1, wherein the supporting flexible membrane is a Kapton membrane.
4. The device of claim 1, wherein the DNA functionalized two-dimensional and layered MXenes are of the form M.sub.n+1X.sub.nT.sub.x, wherein M comprises an early transition metal, X comprises carbon or nitrogen, and T.sub.x comprises surface functional groups that are functionalized with viral RNA or DNA.
5. The device of claim 1, wherein the DNA functionalized two-dimensional and layered MXenes are functionalized by nucleic acid sequences complementary to viral RNA.
6. The device of claim 1, wherein the printable graphene is disposed on the interdigitated electrode at ambient temperature, and then cured at a temperature of about 300° C. for about 13 hours.
7. A method for detecting the SARS-CoV-2 virus sequence in a biological fluid, comprising: disposing a biological fluid sample within a sensing device, comprising: an interdigitated electrode; a supporting flexible membrane; an electrode material that is disposed on the interdigitated electrode and supporting flexible membrane, wherein the electrode material is selected from (i) two-dimensional and layered MXenes and (2) printable graphene, wherein the electrode material is functionalized with ssDNA primers specific to the SARS-CoV-2 virus sequence to be detected; and a sensor that reads an electrical resistance change across the interdigitated electrode after a target DNA sequence is applied to the electrode material; waiting for a residence time; and reading an electrical signal from the sensor.
8. The method of claim 7, wherein the interdigitated electrode is made from gold or silver.
9. The method of claim 7, wherein the supporting flexible membrane is a Kapton membrane.
10. The method of claim 7, wherein the DNA functionalized two-dimensional and layered MXenes are of the form M.sub.n+1X.sub.nT.sub.x, wherein M comprises an early transition metal, X comprises carbon or nitrogen, and T.sub.x comprises surface functional groups that are functionalized with viral RNA or DNA.
11. The method of claim 7, wherein the DNA functionalized two-dimensional and layered MXenes are functionalized by nucleic acid sequences complementary to viral RNA.
12. The method of claim 7, wherein the printable graphene is disposed on the interdigitated electrode at ambient temperature, and then cured at a temperature of about 300° C. for about 13 hours.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0009] So that the manner in which the above recited features of the present invention can be understood in detail, a more particular description of the invention, briefly summarized above, may be had by reference to embodiments, some of which are illustrated in the appended drawings. It is to be noted, however, that the appended drawings illustrate only typical embodiments of this invention and are, therefore, not to be considered limiting of its scope, for the invention may admit to other equally effective embodiments. It is emphasized that the figures are not necessarily to scale and certain features and certain views of the figures can be shown exaggerated in scale or in schematic for clarity and/or conciseness.
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
DETAILED DESCRIPTION
[0054] A biosensing device and method for detecting the SARS-CoV-2 virus sequence in a biological fluid are provided. In one embodiment, the device has an interdigitated electrode; a supporting flexible membrane; and an electrode material that is disposed on the interdigitated electrode and supporting flexible membrane. The device also has a sensor that reads an electrical resistance change across the interdigitated electrode after a target RNA sequence is applied to the electrode material.
[0055] The sensing mechanism is based on the principle of binding single-stranded (ss) ligand DNA with the viral RNA directly released by enveloped viruses after heating at a specific temperature and time. The specific time/temperature combination for both sensor manufacturing and testing are key outcomes and parameters of the project.
[0056] In one or more embodiments, the sensor utilizes flexible electronics with graphene inks 103 printed on flexible polymeric substrates and cured, as well as electrode geometries. The 2D layered structure, electrode coating geometry, and the specific curing conditions together, enable functionalization with ssDNA primers that are binding to the graphene layers, and coming together in the construction of DNA sensor for the direct detection of enveloped RNA viruses. This printed graphene flexible electrode-DNA primer device can be used with biosensing systems for the highly specific detection of this and other enveloped RNA viruses’ nucleic acids without PCR amplification. It is important to repeat that all the fine details of the ssDNA ligand-graphene electrodes design, including curing at very specific temperatures and durations are key for the construction of DNA biosensors that are portable and can detect enveloped RNA viruses at the point of care within minutes.
[0057] The interdigitated electrode 101 can be or can include any suitable metal or other material containing one or more metals, including metal alloys. In a preferred embodiment, the interdigitated electrode 101 can be constructed from gold, silver, platinum, copper, or any combination of these metals.
[0058] The supporting flexible membrane 102 can be or can include any other polymeric film that can withstand heating in the 300-400° C. range without significant degradation of its properties. In a preferred embodiment, the supporting flexible membrane 102 can be a Kapton (polyimide film developed by Dupont) membrane.
[0059] The graphene 103 can be printed using any inkjet electronic printer or inkjet printers for materials and devices, as is known in the art.
[0060] The printable graphene ink 103 can be disposed via inkjet printing on the interdigitated electrode 101 at ambient temperatures, followed by drying at 60° C. and an essential curing step a temperature of at least 300° C. but lower than 400° C. for at least 13 hours.
[0061] In one or more embodiments, the method for detecting the SARS-CoV-2 virus sequence in a biological fluid can include disposing a biological fluid sample within the sensing device described herein.
[0062] After the biological fluid sample is located or otherwise disposed within the sensing device, the fluid sample allowed to sit or rest for a predetermined residence time. Suitable residence times are 500 sec to 1000 sec, more preferably 500 seconds.
[0063] An electrical signal, such as electrical resistance change, can be transmitted from the sensing device using any known and commercially available potentiostat.
Example 1
[0064] The parameters of the working electrode manufacturing include three major components (1) temperature resistant polyimide substrate 101; (2) interdigitated gold electrode 102 (3) inkjet printable graphene 103. Kapton substrate with interdigitated electrodes (101) can be obtained from PCBway, China. After cleaning of the IDEs with ethanol using a moistened lint free wipe, the graphene layer was inkjet printed. The graphene ink for inkjet printing was commercially purchased. The ink contains ethyl cellulose in cyclohexanone and terpineol, inkjet printable. The product identification can be found on Sigma Aldrich, Cat No 793663. Dimatix inkjet printer was used for printing of the graphene. Based on the dimension of the IDEs obtained 6 sq. mm graphene was printed on the interdigitated fingers of the IDEs. (
TABLE-US-00001 Table 1. Graphene inkjet printing parameters Inkjet printer: Dimatix DMP 2850 Printhead: DMC-11610, 10 pL Print resolution: 847 dpi Number of layers: 3 Time between layers: minutes, no drying between Platen temperature: 40ºC Ink cartridge temp: 31ºC Thickness: 600 microns, Jets: 3 Print origin: X = -250 .Math.m, Y = 400 .Math.m
[0065] The curing of the graphene 103 was performed at 300° C. for 13 h in ambient atmosphere. This temperature/time profile was identified as ideal for obtaining optimal DNA primer loading and is critical for sensor performance. Graphene-based flexible electrodes are cured at 300° C. for 13 h for the purpose of burning off the ink fillers, while protecting the polymeric substrate. Notably, if using whole printed sheets of electrodes, rather than individually cut electrodes, there is a very large variation in sensor performance noted. One hypothesis is that having excess polymeric substrate available during electrode curing may lead to impurities being deposited on the working sensing area, which then leads to false results and lack of reproducibility.
[0066] Different generations of sensors were built and tested with the aim of discovering the exact manufacturing parameters that would translate into a workable biosensor for SARS-CoV-2 RNA and that will also be suitable for industrial production. Generation (Gen) 1 sensor were made of CVD graphene on PET substrate with e-beam deposited gold electrodes. Gen 2 120 sensors are made of inkjet print gold IDEs on Kapton (Dupont) with inkjet print graphene layer. Gen 3 130 sensors are flex PCB from PCB Way on a generic polyimide film (flex-circuit) 0.13 mm thick with 5 sq. mm graphene layer. Gen 4 140 sensors have IDE fingers rotated in 90° compared to Gen 3 130. Gen 5 150 sensors are miniaturized version of Gen 3 130. Here it is to be noted that Gen 3 130 electrodes, individually cut, offered consistent and repeatable detection of the SARS-CoV-2 virus over multiple trials, as it will be further described in the report.
[0067] Regardless of electrode generation or manufacturing method, the prepared electrodes were cleaned with nuclease free water (NFW) before deposition of the ligand ssDNA. The ligand ssDNA is specifically binding to the SARS-CoV2 RNA and can be commercially purchased. The deposition can be followed by drying of the sensors in an oven at 60° C. for 30 min. The resistance of the sensing graphene layer between the counter and working electrode is measured and recorded. This will be considered as the baseline resistance of the sensors. 100 .Math.L NFW can be used to clean the sensors, 3 times at least (dispense the water on WE and allow it there for 2 min). Compressed nitrogen gas was used to remove the water from the sensor surface. The resistance of the electrode can also be measured before and after sensor functionalization.
[0068] The sensors were dried at 60° C. for 30 min in an oven followed by drying under vacuum to ensure complete removal of liquid. The resistance of the graphene layer between the counter and working electrode can be measured and recorded.
[0069] The stock solution of DNA (10 .Math.M) was prepared in IDTE buffer, pH 8.0. The DNA ligand stock solution was thawed on ice and desired concentration of the DNA ligand was prepared. IDTE buffer was used for preparing all the dilution. The prepared DNA ligand solution were heated on a heating block at 95° C. for 3 min to melt the DNA ligand. After melting the DNA ligand solution was placed on ice to snap cool for 5 min. 50 .Math.L of the prepared ligand DNA was drop casted on the sensor and immediately dried in an oven at 60° C. With loading of the ligand DNA on the sensor the resistance of the sensor increases. The increase in resistance can be recorded.
[0070] The method for detecting SARS-CoV-2 genomic RNA included placing a small (10 .Math.L) volume of saliva on a biosensing device, wherein said biosensing device can be pre-loaded with specific nucleic acid ligand probe. Upon introduction of sample, the ligand nucleic acid probe can be diffused freely from the sensor surface to bind with the target RNA, wherein the biosensor device can be configured to measure changes in current flow to an applied voltage.
[0071] The developed sensing platform utilizes specific ssDNA probes immobilized onto the graphene (deposited on to the inkjet-printed interdigitated gold electrodes) to detect SARS-CoV-2. Graphene can be used for the sensor development, as a 2D material with higher surface area. The increased surface area provides more ssDNA probes to be immobilized on the graphene to achieve a highly sensitive sensor platform. To build a sensor system and measure the sensor response, inkjet printed inter-digitated gold electrodes were produced at the Roll-to-Roll lab. Thereafter graphene was inkjet printed on the electrodes sensing area, followed by functionalization of the surface with the probe ssDNA strands. The design of the Sensor can be described in detail in
[0072] In order to develop a highly specific assay with low false negative and false positive results negative and positive control samples were tested using a quadruplex sensor system including four individual sensors, respectively. The sensor response for all four sensors were recorded simultaneously using MultiPalmSens4 from PalmSens BV. To interpret the results, sensor response from all four sensor were analyzed and best of four sensor response determines if the test result can be true negative or positive, respectively. A decrease in current response can be reported as true negative, whereas increase in current response can be reported as true positive.
[0073] The cross reactivity of the sensor was tested with SARS-CoV and MARS-CoV virus spiked artificial saliva samples. Briefly, SARS-CoV and MARS-CoV RNA was procured from ATCC. The artificial saliva sample was spiked with the above-mentioned viral RNA to a final concentration of 10.sup.5 copies/.Math.L. Ten microliters of the prepared spiked saliva sample was used as the test sample and the sensor response was recorded. Quadruplex sensor array as mentioned above, was used to determine the cross reactivity of the sensors. The sensors show a no cross-reactivity with the SARS-CoV and MARS-CoV spiked samples when analyzed as a quadruplex sensor array (
[0074] The applied positive bias for the developed sensor was causing the sensor to heat up. Therefore, a range of positive biases (0.1-1.1 V) were applied to the sensor. As shown in
[0075] Preparation of 72 bp long DNA using PCR. SARS-CoV-2 specific 72 nucleotide long PCR product was prepared by PCR amplification. The parameters used for the PCR amplification are listed in Tables 2 and 3. Forward primer sequence: 5′-GACCC CAAAA TCAGC GAAAT-3′. Reverse primer sequence: 5′-TCTGG TTACT GCCAG TTGAA TCTG-3′.
TABLE-US-00002 Table 2. PCR Reaction for Amplification of DNA Component Concentration Volume (.Math.L) PCR buffer 10x 5 Forward primer 10 .Math.M 1 Reverse primer 10 .Math.M 1 dNTP mix 25 mM of each 0.4 DNA template 200000copies/ .Math.L 1 Taq Polymerase 5 U/.Math.L 0.5 Volume made 50 .Math.L with nuclease free water
[0076] The prepared ligand DNA was used to functionalize the electrodes. Various (1, 2, 3 .Math.M) concentrations of the ligand DNA were tested (
TABLE-US-00003 Table 3. PCR amplification conditions Program Name Temp. Time Initial denaturation 98° C. 30 sec Denaturation 98° C. 10 sec 35x Annealing 60° C. 15 sec Extension 72° C. 30 sec Final Extension 72° C. 10 min Cooling 4° C. Cont.
[0077] To determine the effect of print direction, Gen 3 130 (
[0078] The graphene electrodes were dip coated using ssDNA primer solution prepared in IDTE buffer. Testing of this group of sensors gave false negative response. This can be due to the insufficient ligand DNA loading on the sensor surface by dip coating method. Tables 4 and 5 show the measured electrode resistance after primer functionalization via drop casting (Table 4) and dip coating (Table 5). Sensors functionalized using drop casting of ssDNA ligand on the sensor show a higher increase in resistance after primer functionalization, which indicates that this method provides a higher yield than the dip coating method. The loading of DNA was measured by recording the change in resistance before and after loading of DNA on the sensor.
TABLE-US-00004 Table 4. Resistance measurements for drop casted ligand DNA. Drop Casting Before (Ω) After 0.5 .Math.M ligand (Ω) Before (Ω) After 0.7 .Math.M ligand (Ω) Minimum 53.80 112.0 35.90 69.80 Maximum 82.80 143.2 84.50 158.0 Mean 64.48 121.0 60.84 112.5 SD 9.588 10.47 14.72 26.90
TABLE-US-00005 Table 5. Resistance values after DNA primer loading with dip coating process Dip coating Before (Ω) After 0.5 .Math.M ligand (Ω) After 2.5 .Math.M ligand (Ω) Minimum 41.70 51.40 56.40 Maximum 63.50 72.60 79.10 Mean 48.04 59.82 64.04 SD 6.294 7.233 8.210
[0079] In order to provide information on various parameters to be considered to mass manufacturing, the possibility of using inkjet printing of the DNA primers was tested. This method has not been extensively reported in literature but holds promise for improving the repeatability of the primer functionalization procedure. The optimized parameters for inkjet printing of DNA are found in Table 6.
TABLE-US-00006 Table 6. Parameters of Inkjet Printing of DNA Temperature (plate and cartridge): 25-27° C. Filtration of the DNA solution: sterile 0.22 .Math.m filter Voltage: ~20 mV Frequency: 5 Hz Resolution: 847 dpi Drop size: 30 .Math.m DNA concentration: 10 .Math.M No. of Layers: 10
[0080] After the inkjet printing of the DNA primers, the resistance of the electrodes was measured in an effort to estimate the level of primer loading on the electrode surface.
[0081] The graphene sensor was imaged using 32 different excitation wavelengths. Graphene sensors have highest intrinsic/background fluorescence at 472 and 544 and 635 nm wavelength (
[0082] PCR amplification of the SARS-CoV-2 N gene was performed to produce various dsDNA ligand. The produced ligands are of 72 bp, 466 bp, and 944 bp long. The optimized annealing temperature for the 72 (
[0083] The effect of plasma treatment on the surface hydrophobicity of the graphene sensors was determined in this experiment. It was observed that after plasma treatment of the graphene sensors makes it more hydrophilic. Additionally, it was observed that Gen 3 130 sensors’ surface can be more hydrophilic than the Gen 3 130 sensors.
Example 2
[0084] In one or more embodiments, this disclosure describes non-obvious viral nucleic acid biosensing configurations that include two-dimensional (2D) transition-metal layered carbides and nitrides (“MXenes”) with a general formula of Mn.sup.+1X.sub.nT.sub.x, where M is an early transition metal, A is an A group element, X is carbon and/or nitrogen, and T.sub.x represents surface functional groups such as —O, —OH and/or —F and that are functionalized with DNA primers for specificity for the viral target. The new 2D layered structure specifically enables functionalization with DNA primers that are binding in between the layers of material, thus enabling the construction of viral nucleic acid electrochemical biosensors for the detection of pathogens. The novel MXene-DNA primer sensing material 103 can be incorporated into biosensing systems for detection of pathogens, such as viruses and bacteria in saliva and nasal swabs at the lowest detection limit reported to date.
[0085] The DNA primer-MXene coating 103 presents with a higher surface area than other electrode materials, afforded by the layered structure, and can be functionalized on, which is necessary and indispensable for the construction of DNA biosensors, such as those that are able to detect infectious diseases induced by viruses and bacteria, with electrochemical characteristics enabling field deployability and point-of-care diagnostics by customizing the electrode resistance to a level that is low enough (in the range 1-8 kOhm) to be read by portable resistance readers. The electrical properties of the new MXene-DNA nanofilm 103 deposited on metallic electrodes supported by flexible substrate allows coupling with viral or bacterial DNA specific for the detection of infectious diseases, as specified above.
[0086] The DNA-functionalized Ti.sub.3C.sub.2T.sub.x biosensor was successfully developed for a highly sensitive, selective, and rapid detection of N gene from SARS-CoV-2. The sensor response of ssDNA/Ti.sub.3C.sub.2T.sub.x increases with the concentration of the added target DNA. A clear differentiable response in N gene of SARS-CoV-2 with the ssDNA/Ti.sub.3C.sub.2T.sub.x sensors can be performed at a concentration as low as 100 copies/.Math.L, indicating ultrahigh selectivity of ssDNA/Ti.sub.3C.sub.2T.sub.x sensors for detecting SARS-CoV-2 N gene. The ssDNA/Ti.sub.3C.sub.2T.sub.x also demonstrates a sound performance on detecting SARS-CoV-2 N gene in saliva samples. The detection mechanism of N gene from SARS-CoV-2 for DNA-functionalized Ti.sub.3C.sub.2T.sub.x is proposed as being dominated by the hybridization of highly selective DNA probes on Ti.sub.3C.sub.2T.sub.x surfaces with SARS-CoV-2 N gene. Under the current COVID-19 outbreak, this study shows the feasibility of developing real-time and highly reliable diagnosis device for clinical tests based on DNA-functionalized Ti.sub.3C.sub.2T.sub.x MXenes.
[0087] The electrode material 103 can be or can include any suitable DNA functionalized two-dimensional material from the MXene family of materials. In one particular example, the DNA functionalized MXene can include M.sub.n+1X.sub.nT.sub.x, where M is an early transition metal, X is carbon and/or nitrogen, and T.sub.x represents surface functional groups such as —O, —OH and/or —F and that are functionalized with DNA primers for specificity for the viral target. In a preferrable example, the DNA functionalized MXene can include M.sub.n+1X.sub.nT.sub.x, where M is Ti, X is carbon, and T.sub.x represents surface functional groups such as —O, —OH and/or —F and that are functionalized with DNA primers for specificity for the viral target.
[0088] In one or more embodiments, the method for detecting the SARS-CoV-2 virus sequence in a biological fluid can include disposing a biological fluid sample within the sensing device described herein.
[0089] After the biological fluid sample is located or otherwise disposed within the sensing device, the fluid sample allowed to sit or rest for a predetermined residence time. Suitable residence times are 400 sec to 1000 sec, more preferably 500 seconds.
[0090] An electrical signal, such as electrical resistance change, can be transmitted from the sensing device using any known and commercially available potentiostat.
[0091]
[0092]
[0093] The element composition and bonding configuration of ssDNA functionalized Ti.sub.3C.sub.2T.sub.x was further investigated by X-ray photoelectron spectroscopy (XPS). Evidenced by the high-resolution XPS results, the signals of Ti 2p, C 1 s, and N 1 s from ssDNA/ Ti.sub.3C.sub.2T.sub.x film suggests the presence of DNA probes on Ti.sub.3C.sub.2T.sub.x MXene after surface functionalization (
[0094]
[0095] In accordance with US Centers for Disease Control and Prevention (CDC) guidelines, two specific sequences from SARS-CoV-2 were selected here: 2019-nCoV_N-F and 2019-nCoV_N-R. Recognition probes were integrated with 2D MXenes for the development of the COVID-19 sensors. To validate the presence of the ssDNA probes on the Ti.sub.3C.sub.2T.sub.x surface, the current-voltage (IV) curves of the fabricated Ti.sub.3C.sub.2T.sub.x before and after probe DNA functionalization were recorded. As shown in
[0096] The selectivity of ssDNA/ Ti.sub.3C.sub.2T.sub.x sensors were validated by prepared and tested the oligonucleotide sequences from closely related N genes of SARS-CoV-2, SARS-CoV and MERS-CoV, all having a concentration of 100 copies/.Math.L. As demonstrated in
[0097] The detection of clinically relevant materials is essential and important for practical diagnostic development. Thus, the detection of N gene from severe acute respiratory syndrome-related coronavirus 2 (SARS-CoV-2) strain 2019-n-CoV/USA-WA1/2020 using ssDNA/ Ti.sub.3C.sub.2T.sub.x sensors was performed (
[0098] Materials: The Ti.sub.3AlC.sub.2 (2 g, particle size < 40 .Math.m) was purchased from Carbon-Ukraine. Conductive gold ink (UTDAu25) was purchased from UT Dots (Champaign, IL, US). The plasmid controls of the viruses contain the complete nucleocapsid gene from 2019-nCoV, SARS and MERS virus, were synthesized from Integrated DNA Technologies (IDT, Skokie, IL, US). The selected oligonucleotide probes were approved by the US Centers for Disease Control and Prevention (CDC) and given in Table 7: nCOV-N Forward Probe, 5′-GACCCCAAAATCAGCGAAAT-3′, nCOV-N Reverse Probe, 5′-TCTGGTTACTGCCAGTTGAATCTG-3′. The artificial saliva was purchased from Pickering Laboratories (Mountain View, CA, US). Heat-inactivated SARS-CoV-2 (strain: 2019-nCoV/USA-WA1/2020, ATCC® VR-1986HK™) was purchased from American Type Culture Collection (ATCC, VA, US). All other chemical reagents were of analytical reagent grade and used without further purification. Ultrapure water (> 18.3 MW) was used throughout the experiment.
TABLE-US-00007 Table 7. Selected sequences for SARS-CoV-2 detection Description Sequence (5′-3′) SARS-CoV-2-N primer-F GACCCCAAAATCAGCGAAAT SARS-CoV-2-N primer-R TCTGGTTACTGCCAGTTGAATCTG SARS-CoV primer-F CAAACATTGGCCGCAAATT SARS-CoV primer-R CAATGCGTGACATTCCAAAGA MERS-CoV primer-F GGCACTGAGGACCCACGTT MERS-CoV primer-R TTGCGACATACCCATAAAAGCA
[0099] Preparation of Ti.sub.3C.sub.2T.sub.x MXene: Ti.sub.3AlC.sub.2 powder was selective etched to remove Al layer in a premixed acid solution of 9 M HCl (20 mL) and LiF (3.2 g) and stirred for 200 rpm for 24 h at room temperature. The mixture was washed through several centrifugation cycles with ultrapure water until pH value of the supernatant reached approximately 6. The resulting Ti.sub.3C.sub.2T.sub.x sediment was collected and rewashed with ultrapure water by vacuum filtration using PVDF membrane with 0.22 .Math.m pore size and dried in vacuum at 80° C. for 24 h. To obtain delaminated Ti.sub.3C.sub.2T.sub.x dispersion, 100 mg of Ti.sub.3C.sub.2T.sub.x multilayer powder was sonicated in 20 ml of ultrapure water with ultrasonic bath (Branson, CPX2800H) for 1 h. The bath temperature was controlled at 4° C. to prevent restacking of the nanosheets caused by the thermal energy released during sonication. The delaminated Ti.sub.3C.sub.2T.sub.x nanoflakes were collected for fabricating SAR-CoV-2 biosensors.
[0100] Fabrication of ssDNA/ Ti.sub.3C.sub.2T.sub.x Sensors: First, nanogold ink was printed by a commercial inkjet printer (Dimatix DMP-2850, Fujifilm) on a polyimide substrate containing six pairs of gold interdigitated electrodes 101 with total active electrode area of 8 mm x 8 mm. Then, the Ti.sub.3C.sub.2T.sub.x solution (5 mg/ml) was sprayed onto the interdigitated electrodes 101 by using an airbrush (G-233, Master Airbrush) for 10 s. The spray conditions were achieved with an operating pressure of 80 psi, a 0.5 mm of nozzle size, an operating distance of 30 cm between spray nozzle and substrate, and a steady moving speed of 10 cm/s in all directions. The Ti.sub.3C.sub.2T.sub.x films were then functionalized by casting a 20 .Math.L drop of mixed probe DNA solution (5 × 10.sup.-6 M) and dried under vacuum.
[0101] Characterization and Real-time Sensing of SARS-CoV-2 Viral Sequences: The surface morphology and microstructure of the Ti.sub.3C.sub.2T.sub.x MXene were examined by scanning electron microscopy (SEM; S-4800, Hitachi), transmission electron microscopy (TEM; Talos 200X, FEI), high-angle annular dark-field scanning electron microscopy (HAADF-STEM), and X-ray diffractometry (XRD; X′Pert Pro, Panalytical) operated at 45 kV and 40 mA using Cu Ka. X-ray photoelectron spectroscopy (XPS; PHI 5000 Versaprobe, ULVAC-PHI) was conducted to investigate the chemical components and bonding structures. The electrical performance was measured using a source measure unit (Keithley 2400). The sensor response can be defined using the following formula; ΔI/I0 = (I-I.sub.0)/I.sub.0, where I and I.sub.0 represent the real-time current and the initial current of the sensors, respectively.
[0102] It is to be understood that the present disclosure describes several exemplary embodiments for implementing different features, structures, or functions of the invention. Exemplary embodiments of components, arrangements, and configurations are described to simplify the present disclosure; however, these exemplary embodiments are provided merely as examples and are not intended to limit the scope of the invention. Each of the appended claims defines a separate invention, which for infringement purposes is recognized as including equivalents to the various elements or limitations specified in the claims. Depending on the context, all references to the “invention” may in some cases refer to certain specific embodiments only. In other cases, it will be recognized that references to the “invention” will refer to subject matter recited in one or more, but not necessarily all, of the claims. Each of the appended claims defines a separate invention, which for infringement purposes is recognized as including equivalents to the various elements or limitations specified in the claims. Depending on the context, all references to the “invention” may in some cases refer to certain specific embodiments only. In other cases, it will be recognized that references to the “invention” will refer to subject matter recited in one or more, but not necessarily all, of the claims. Additionally, the present disclosure can repeat reference numerals and/or letters in the various embodiments and across the figures provided herein. This repetition is for the purpose of simplicity and clarity and does not in itself dictate a relationship between the various embodiments and/or configurations. Moreover, the exemplary embodiments presented can be combined in any combination of ways, i.e., any element from one exemplary embodiment can be used in any other exemplary embodiment, without departing from the scope of the disclosure.
[0103] Additionally, certain terms are used throughout the present description and claims to refer to particular components. As one skilled in the art will appreciate, various entities can refer to the same component by different names, and as such, the naming convention for the elements described herein is not intended to limit the scope of the invention, unless otherwise specifically defined herein. Further, the naming convention used herein is not intended to distinguish between components that differ in name but not function.
[0104] Furthermore, in the present discussion and in the claims, the terms “including” and “comprising” are used in an open-ended fashion, and thus should be interpreted to mean “including, but not limited to.”
[0105] The term “or” is intended to encompass both exclusive and inclusive cases, i.e., “A or B” is intended to be synonymous with “at least one of A and B,” unless otherwise expressly specified herein.
[0106] The indefinite articles “a” and “an” refer to both singular forms (i.e., “one”) and plural referents (i.e., one or more) unless the context clearly dictates otherwise. For example, embodiments using “an olefin” include embodiments where one, two, or more olefins are used, unless specified to the contrary or the context clearly indicates that only one olefin is used.
[0107] Unless otherwise indicated herein, all numerical values are “about” or “approximately” the indicated value, meaning the values take into account experimental error, machine tolerances and other variations that would be expected by a person having ordinary skill in the art. It should also be understood that the precise numerical values used in the specification and claims constitute specific embodiments. Efforts have been made to ensure the accuracy of the data in the examples. However, it should be understood that any measured data inherently contains a certain level of error due to the limitation of the technique and/or equipment used for making the measurement. Certain embodiments and features have been described using a set of numerical upper limits and a set of numerical lower limits. It should be appreciated that ranges including the combination of any two values, e.g., the combination of any lower value with any upper value, the combination of any two lower values, and/or the combination of any two upper values are contemplated unless otherwise indicated. Certain lower limits, upper limits and ranges appear in one or more claims below.
[0108] All patents and patent applications, test procedures (such as ASTM methods, UL methods, and the like), and other documents cited herein are fully incorporated by reference to the extent such disclosure is not inconsistent with this disclosure and for all jurisdictions in which such incorporation is permitted.
[0109] The foregoing has also outlined features of several embodiments so that those skilled in the art can better understand the present disclosure. Those skilled in the art should appreciate that they can readily use the present disclosure as a basis for designing or modifying other methods or devices for carrying out the same purposes and/or achieving the same advantages of the embodiments disclosed herein. Those skilled in the art should also realize that such equivalent constructions do not depart from the spirit and scope of the present disclosure, and that they can make various changes, substitutions, and alterations herein without departing from the spirit and scope of the present disclosure, and the scope thereof is determined by the claims that follow.