EX-SITU SEQUENCING OF RCA PRODUCT GENERATED IN-SITU

Abstract

The invention is directed to a method for obtaining the sequence information of a target sequence from a tissue comprising at least one RNA or c-DNA strand comprising two-fold RCA.

Claims

1. A method for obtaining the sequence information of a target sequence from a tissue comprising at least one RNA or c-DNA strand comprising the steps: (a) providing at least one first oligonucleotide comprising 50-1000 nucleic acids having a 5′ and a 3′ end; (b) hybridizing the first oligonucleotide with its 5′ and 3′ ends to complementary parts of the at least one RNA or c-DNA strand; (c) combining the 3′ and 5′ end of the hybridized first oligonucleotide with each other thereby obtaining a first single strand circular template; (d) multiplying the first single strand circular template by a polymerase capable of rolling circle amplification into a plurality of concatemers thereby obtaining primary rolonies; (e) removing the primary rolonies from the sample; (f) fragmenting the primary rolonies into a plurality of second oligonucleotides and hybridizing a first PCR primer and a second PCR primer at the 3 and 5′ ends of the second oligonucleotides thereby obtaining third oligonucleotides; (g) multiplying the third oligonucleotides by a polymerase capable of polymer chain reaction (PCR); (h) ligating the first PCR primer to the second PCR primer of the multiplied third oligonucleotides thereby obtaining second single strand circular templates; (i) multiplying the second single strand circular templates by a polymerase capable of rolling circle amplification into a plurality of concatemers thereby obtaining secondary rolonies; and (j) determining the sequence of the secondary rolonies thereby obtaining the sequence information of the target sequence.

2. The method of claim 1 characterized in that the 5′ and the 3′ ends of the first oligonucleotides are hybridized adjacent to complementary parts of the at least one RNA or c-DNA strand thereby obtaining the first single strand circular templates by direct ligation of the 5′ and the 3′ ends of the first oligonucleotides with each other.

3. The method of claim 1 characterized in that the 5′ and the 3′ ends of the first oligonucleotides are hybridized to complementary parts of the at least one RNA or c-DNA strand with a gap of 2 to 100 nucleotides between the 5′ and the 3′ ends of the first oligonucleotides and obtaining the first single strand circular templates by filling the gap with nucleotides complementary to the RNA or c-DNA strand.

4. The method of claim 1 characterized in that the first PCR primer is ligated to the second PCR primer by providing splint DNA.

5. The method of claim 1 characterized in that the rolling circle amplifications (RCA) are activated by light and/or heat.

6. The method of claim 1 characterized in that the first oligonucleotide comprises a fragmentation sequence allowing the primary rolonies to be fragmented by a restriction enzyme or chemically.

7. The method of claim 1 characterized in that the first rolonies are decorated with at least one fluorescently labelled oligonucleotide.

8. The method of claim 7 characterized in that the spatial location of the first rolonies on the tissue is determined by imaging emission radiation of the at least one fluorescently labelled oligonucleotide bound to the first rolonies.

9. The method of claim 7 characterized in that the first oligonucleotide comprises a identification region comprised of a UMI sequence and or a barcode sequence to which the at least one fluorescently labelled oligonucleotide binds.

10. The method of claim 1 characterized in that the sequence information of the target sequence is used to quantify a gene expression profile.

11. The method of claim 1 characterized in that the sequence information of the target sequence is used to confirm the efficacy of a hybridization oligonucleotide and the target sequence selection.

Description

DESCRIPTION OF DRAWINGS

[0033] FIG. 1 shows the design of circular or padlock probe used in this method. The circle/padlock may contain a barcode or UMI identifier. The circle/padlock is hybridized to a tissue section which expressed the mRNA or genomic DNA of interest. Once hybridized, the padlock is ligation with SplintR Ligase to generate a circle. The circle can then be used to perform rolling circle amplification (RCA) to generate a detectable RCA product on the tissue.

[0034] FIG. 2 shows the strategy to PCR amplify the region of interest of the RCA produced from a circle/padlock. The PCR primers with P1 and P2 adaptors hybridize to the flanking regions of the region of interest so that it can be amplified and sequenced.

[0035] FIGS. 3A and 3B shows a successful ex-situ sequencing of 4 gene transcripts from padlocks extracted from tissue. Every one of the padlocks, designed to detect the transcript of interest, was unambiguously identified by sequencing the targeted region of interest.

DETAILED DESCRIPTION

[0036] Ex-situ sequencing of the RCA performed directly on tissue consists of a six step process. (1) RCA generation on tissue. (2) Retrieval of RCA rolonies and extraction of DNA from rolonies from a tissue section. (3) Targeted PCR amplification of the region of interest. The region of interest can be either a Barcode/UMI or a nucleotide change/variant in the target sequence. (4) Circularization of the PCR product. (5) RCA or the circle. (6) NGS Sequencing.

[0037] In FIG. 1, two types of padlocks which hybridizes to an mRNA (dotted line) are depicted with a specific region of interest may be used. The region of interest can contain either a nucleotide position in the region which hybridizes to the mRNA with base mutation or variant, or a barcode of UMI in the padlock backbone region. The circle generated followed by ligation can serve as a substrate to generate RCA rolonies directly on tissue (Step 1 in FIG. 1).

[0038] In a first embodiment, the 5′ and the 3′ ends of the first oligonucleotides are hybridized adjacent to complementary parts of the at least one RNA or c-DNA strand thereby obtaining the first single strand circular templates by direct ligation of the 5′ and the 3′ ends of the first oligonucleotides with each other.

[0039] In a second embodiment, the 5′ and the 3′ ends of the first oligonucleotides are hybridized to complementary parts of the at least one RNA or c-DNA strand with a gap of 2 to 100 nucleotides between the 5′ and the 3′ ends of the first oligonucleotides and obtaining the first single strand circular templates by filling the gap with nucleotides complementary to the RNA or c-DNA strand.

[0040] Preferable, the first oligonucleotide comprises a fragmentation sequence allowing the primary rolonies to be fragmented by a restriction enzyme or chemically.

[0041] Extraction of DNA from RCA performed method to retrieve RCA product from a tissue section is described (Step 1 and 2 in FIG. 2). First, tissue digestion is performed on the tissue section containing the RCA product by heating the sample in the presence of lysis buffer and Proteinase K.

[0042] The sample may be removed from the heat source and incubated with solid phase reversible immobilization (SPRI) beads and by using a magnet, the beads containing the nucleic acid can be easily washed.

[0043] Preferable, the eluant solution is added to the SPRI beads and after washing three times, a magnet is used to remove the SPRI bead and the supernatant is transferred to a tube. This tube contains the extracted RCA DNA eluant.

[0044] The extracted nucleic acid may be quantified using Nanodrop or Qubit.

[0045] Targeted PCR amplification is performed on the retrieved RCA product which contains the padlock junction region of interest with a nucleotide change/variant is described. Once the RCA DNA were extracted and quantified, the RCA DNA is used as a template for a PCR reaction using primer set (first PCR and second PCR primer) specific for the region flanking the region of interest (Step 3 in FIG. 2).

[0046] For example, the sequence of the first PCR primer can be ACACGACGCTCTTCCGATCTAAGGATACTCCGACGCGGCCGCA (SEQ ID NO: 1) and the second PCR primer can be GACGTGTGCTCTTCCGATCTACCCTTTACAAACACA (SEQ ID NO: 2). The bold face type sequence hybridizes to the region flanking the region of interest is shown in Step 3 of FIG. 2 (AAGGATACTCCGACGCGGCCGCA; SEQ ID NO: 3 and ACCCTTTACAAACACA; SEQ ID NO: 4). P1 and P2 adapter portions are unique sequences which may be used for circularization in later step.

[0047] The PCR is performed for 25 cycles.

[0048] PCR product is purified using QiaQuick PCR product purification column, the DNA was quantified using Qubit assay.

[0049] The resulting PCR product with P1 and P2 adapters are circularized using a splint oligonucleotide which brings the two ends together (Step 4 in FIG. 2). Preferable, the first PCR primer is ligated to the second PCR primer by providing splint DNA.

[0050] The circle is RCA amplified (Step 5 in FIG. 2) and Rolonies are formed.

[0051] NGS sequencing can be performed with sequencing primer which binds to either P1 or P2 adaptor region (Step 5 in FIG. 2).

[0052] NGS sequencing can determine either a mutation/nucleotide variant exist is the target region of interest, and by sequencing the padlock ID region, the location of the rolonies on the substrate can later on be correlated with the original position of the tissue. That means that the location of the gene on the tissue can be determined as well as the presence of a mutation or not via sequencing. In addition the gene expression profile can also be shown by the quantification of the sequencing read counts obtained.

[0053] Further, the spatial location of the first rolonies on the tissue is determined by imaging emission radiation of the at least one fluorescently labelled oligonucleotide bound to the first rolonies.

[0054] To this end, the first rolonies may be obtained by decorating (binding) the first rolonies with at least one fluorescently labelled oligonucleotide.

[0055] Further, the first oligonucleotide comprises a identification region comprised of a UMI sequence and or a barcode sequence to which the at least one fluorescently labelled oligonucleotide binds.

EXAMPLES

[0056] Four mouse genes were study for which five different padlocks oligonucleotides probes were designed to be complementary to a portion of the corresponding mRNA transcripts. A total of 20 probes (four genes times 5 probes each) were hybridized against their respective targets in a mouse tissue section. The probes were provided in excess. The padlocks probes were then ligated enzymatically and RCA was performed directly on the tissue (in situ). The gene specific generated rolonies were detected by hybridizing fluorescently labelled oligonucleotides to the padlock identification region containing a UMI and or barcode sequences. As described in Step 1 above, the RCA rolonies were then extracted from the tissue and fragmented randomly. As described in Step 2, PCR reactions were performed using primers where one portion is complementary to the regions flanking the region of interest and the other portion contains generic sequences (P1 & P2). The resulting linear product with P1 and P2 adapters are circularized using a splint oligonucleotide which brings the two ends together. The circle is RCA amplified and secondary rolonies are formed.

[0057] The region of interest of RCA product are finally sequenced using an NGS Sequencer compatible with rolonies. Each sequence generated can be aligned and mapped to the four targeted gene transcripts.

[0058] As shown in FIGS. 3A and 3B below, sequencing reads for all four genes were unambiguously detected with different read counts. These results shows that this method can be used as a tool to quantify the number of specific RCA products (rolonies) from the tissue that it was extracted from. In addition, and contrary to any other method, the efficacy of hybridization of the various padlock probes targeting the same transcript can be evaluated by quantifying the individual sequencing read counts of each individual probe. For example, for Gene 1, some probes are hybridizing more efficiently and therefore the design of the probes can be improved by looking at the sequencing read counts. It can also be used to quantify the gene expression profile as indicated in the graph of FIG. 3 and confirm the hybridization approach performed using fluorescently labelled oligonucleotide on the primary rolonies generated on tissue