Hypoimmunogenic Cells and Uses Thereof in Immune Responses
20230338533 · 2023-10-26
Inventors
Cpc classification
A61K39/215
HUMAN NECESSITIES
International classification
Abstract
Hypoimmunogenic cell lines useful in enhancing, invoking and/or stimulating an immune response and methods for their use and production are provided.
Claims
1. A composition comprising a cell modified to be hypoimmunogenic and to express one or more foreign molecules.
2. The composition of claim 1 wherein the foreign molecule is a protein, carbohydrate, nucleotide, cytokines, chemokine, antibody or lectin.
3. The composition of claim 2 wherein the protein is antigenic.
4. The composition of claim 3 wherein the antigenic protein is a viral antigen or an antigen against tumor epitopes.
5. The composition of claim 2 wherein the foreign molecule is an antibody.
6. The composition of claim 1 wherein the cell is modified to be hypoimmunogenic by eliminating or lowering expression of Class I epitopes and Class II epitopes.
7. The composition of claim 1 wherein the cell is a mesenchymal stem cell.
8. A vaccine comprising the composition of claim 1 and a pharmaceutically acceptable carrier.
9. The vaccine of claim 8 further comprising an additional activation agent.
10. The vaccine of claim 9 wherein the activation agent is foreign viral DNA or Poly I:C (Polyinosinic:polycytidylic acid).
11. A method for inducing an immune response against a foreign antigen in a mammal, said method comprising administering to the mammal the composition of claim 1.
12. A method for protecting a mammal from a disease or infection relating to a foreign antigen, said method comprising administering to the mammal the composition of claim 1.
13. A method for producing a vaccine against a foreign antigen, said method comprising modifying a cell to be hypoimmunogenic and to express the foreign antigen.
14. The method of claim 13 wherein the cell is modified to be hypoimmunogenic by eliminating or lowering expression of Class I epitopes and Class II epitopes.
15. A vaccine comprising a cell modified to be hypoimmunogenic and an antigenic peptide or protein.
16. The vaccine of claim 15 wherein the cell is modified to be hypoimmunogenic by eliminating or lowering expression of Class I epitopes and Class II epitopes.
17. A method for enhancing an immune response to an antigenic peptide or protein in a mammal, said method comprising administering to the mammal the vaccine of claim 15.
18. A method for inducing an immune response against a foreign antigen in a mammal, said method comprising administering to the mammal the vaccine of claim 8.
19. A method for protecting a mammal from a disease or infection relating to a foreign antigen, said method comprising administering to the mammal the vaccine of claim 8.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0032]
[0033]
DETAILED DESCRIPTION
[0034] Disclosed herein are cell lines modified to be hypoimmunogenic and to enhance, invoke and/or stimulate an immune response. Such cells are protected from the adaptive immune response initially, thus allowing for survival for a longer period in vivo and a prolonged time period for presentation of foreign molecules expressed by the cells. Further, as the cells will eventually be recognized as foreign by the innate immune response and will be attacked by NK cells, they will undergo apoptosis sending inflammatory signals to the professional antigen presenting cells (APC) which will pick up the foreign molecules along with other possible antigens such as would happen in an immune response to a viral or parasitic infection. This interaction between killing of cells via the innate pathway and the presentation of antigens by professional APC is considered critical to generation of antibodies to pathogens. It is expected that these hypoimmunogenic cells will be useful as vaccines generating sufficient levels of antibodies against foreign antigenic proteins, carbohydrates or nucleotides expressed by the cells thereby protecting an individual against a disease or infection relating to the foreign antigenic protein. Further, initial protection of such cells modified to express foreign molecules such as, but not limited to, cytokines, chemokines, antibodies and lectins, makes them useful in enhancing, invoking and/or stimulating an immune response.
[0035] By the term “hypoimmunogenic cell” as used herein it is meant to encompass any cell modified to be protected initially from the adaptive immune response, thus allowing for survival for a longer period in vivo and a prolonged time period for foreign antigen presentation but which is eventually recognized as foreign by the innate immune response and attacked, thereby undergoing so that antibodies are generated against antigens expressed by or administered with the cells.
[0036] In one nonlimiting embodiment of the present invention, the hypoimmunogenic cell line is an iPSC or an immortalized line. In one nonlimiting embodiment, the hypoimmunogenic cells are HLA Class I and Class II null cells. A nonlimiting example is HLA Class I and II KO (HLA-null) mesenchymal stem cells (MSC). In this nonlimiting example, most of the antigens presented are similar to other endogenous human proteins so they will not elicit an immune response and no antibodies should be raised against them. However, the foreign highly immunogenic epitopes specifically expressed by HLA-null MSC will be targeted by the immune system for an enhanced and focused immune response with the development of both memory cells and antibodies to the target epitope. The co-opting of the normal innate immune pathway leading to antibody development against infectious agents of HLA-null MSC of the present invention is different from the mechanism of action of unmodified MSC where activation and overexpression of MHC class I and II receptors that is provoked with proinflammatory cytokines to enhance antigen delivery and cytokine activation of the immune system. See Tomchuck et al. Frontiers in Cellular and Infection Microbiology 2012 2(140):1-8.
[0037] In one nonlimiting embodiment, the hypoimmunogenic cells are modified via methods such as, but not limited to, antisense or miRNA to lower the cell's HLA expression.
[0038] In one nonlimiting embodiment, Class I and/or Class II knockout cell lines of the present invention, such as, but not limited to, B2M and CTIIA cell lines, are created which express a foreign antigen. Foreign antigen expression can be created using either a safe harbor locus integration (targeted integration) or via random integration for expressing one or more foreign antigens.
[0039] In one nonlimiting embodiment of the present invention, knocking out the Class I locus is achieved by knocking out B2M gene which is a component of the Class I molecules. In another nonlimiting embodiment, knocking out the Class I locus is achieved by knocking out genes (HLA-A, HLA-B and HLA-C) individually. In another nonlimiting embodiment, inhibiting expression of Class I antigens is achieved by knocking out processing enzymes such as, but not limited to, tapasin, which prevent surface expression of the Class I antigens.
[0040] In one nonlimiting embodiment, knocking out the Class II locus is achieved by knocking out a master transcription factor such as the RFANX or CIITA gene that is required for Class II gene expression.
[0041] In some nonlimiting embodiments, the hypoimmunogenic cells are further modified to express a foreign molecule such as, but not limited to, proteins, carbohydrates, nucleotides, cytokines, chemokines, antibodies and lectins. In one nonlimiting embodiment, the cells are modified to express a foreign antigenic protein. Nonlimiting examples of foreign antigens expressed by the hypoimmunogenic cells include viral antigens and other pathogens and antigens against tumor epitopes.
[0042] Nonlimiting examples of other molecules expressed by the cells include carbohydrates, nucleotides, cytokines, chemokines, antibodies and lectins. In one nonlimiting embodiment, the hypoimmunogenic cells are modified to express a monoclonal antibody. In one nonlimiting embodiment, the hypoimmunogenic cells are modified to express a therapeutic monoclonal antibody.
[0043] As carbohydrates, lipids and mixed structures are oftentimes carried on a protein scaffold to generate antigens to which many antibodies are targeted, expressing these foreign molecules in mammalian cells as in the present invention is advantageous as the carbohydrates, lipids and mixed structures are maintained as compared to other species.
[0044] Most of the antigens presented upon apoptosis of these modified cells are similar to other endogenous human proteins so they will not elicit an immune response and no antibodies should be raised against them. However, any foreign highly immunogenic epitopes specifically expressed by the engineered cells of the present invention will be targeted by the immune system thus producing an enhanced and focused immune response with the development of both memory cells and antibodies to the target epitope.
[0045] A nonlimiting example of a master design of generating HLA-KO cells expressing one or more foreign antigens for vaccines is set forth in
[0046] Modified cells of the present invention can be administered to a mammal to induce an immune response against a foreign antigen expressed by the cell. In addition, the cells can be administered as a vaccine further comprising a pharmaceutically acceptable ingredient to a mammal to protect the mammal from a disease or infection relating to the foreign antigen.
[0047] Any mode of administration routinely used for vaccines can be used. Examples include, but are not limited to, subcutaneous, intramuscular or intravenous injection as well as oral, sublingual or nasal administration.
[0048] By “mammal”, as used herein, it is meant to include, but is not limited to, humans, primates, dogs, cats, rodents, horses, pigs, sheep, lagomorphs and cows.
[0049] Vaccine formulations of the present invention may be further enhanced by using additional activation agents such as foreign viral DNA or Poly I:C (Polyinosinic:polycytidylic acid) by simply expressing them in cells prior to administration or by delivering them in the vaccine formulation.
[0050] Further, while RNA and DNA vaccines suffer from the issue of delivery of sufficient material to cells for appropriate and persistent expression, such vaccines can be delivered ex-vivo to the HLA null cells of the present invention to enhance delivery by a log order and to enhance the antibody production process.
[0051] Hypoimmunogenic cells of the present invention can also be used to deliver molecules such as, but not limited to, cytokines, chemokines, antibodies and lectins expressed by the cells to enhance, invoke and/or stimulate an immune an immune response and as adjuvants with delivery of antigenic proteins or peptides antigens to enhance the inflammatory response. In one nonlimiting embodiment, the hypoimmunogenic cells are used to deliver a monoclonal antibody, more preferably a therapeutic monoclonal antibody expressed by the cell.
[0052] Various methods for producing these hypoimmunogenic cell lines can be used. Nonlimiting examples include safe harbor insertion and random integration by lentivirus and Piggy-Bac and sleeping beauty technologies.
[0053] The present invention also provides nucleic acid constructs for insertion or integration into the hypoimmunogenic cell line comprising a gene encoding the foreign antigen. Expression of the gene product can be driven by an endogenous promoter when the insertion is in frame with an endogenous gene, or by an exogenous promoter such as CAG or EF-alpha or any other well-known exogenously supplied promoter with the limitation that this be expressed in the cell product to which it is being inserted or integrated. The construct may be inserted into a known safe harbor locus such as the AAVS1 site or the Chr13 site. In accordance with the present invention, the nucleic acid construct is inserted or integrated into a cell line in with Class I epitopes and Class II epitopes have been knocked out.
[0054] An hypoimmunogenic cell line produced in accordance with the present invention with Class I and II double knock-out, and expressing a foreign antigen was produced.
[0055] Gene RNA guide information used to produce this cell line is provided in Tables 1 and 2.
TABLE-US-00001 TABLE 1 Gene and RNA guide information for B2M gene Gene Name B2M Transcript ID ENST00000303088.8 Guide RNA 1 Sequence GGCCGAGAUGUCUCGCUCCG (SEQ ID NO: 1) Guide RNA 2 Sequence ACUCACGCUGGAUAGCCUCC (SEQ ID NO: 2) Guide RNA 3 Sequence CGGAGCGAGAGAGCACAGCG (SEQ ID NO: 3) PCR & Sequencing Primers: FOR primer (5′-3′) ACAGCAAACTCACCCAGTCTAG (SEQ ID NO: 4) REV Primer (5′-3′) CCAGTCTAAGGGAAGCAGAGC (SEQ ID NO: 5) GC Enhancer Used N/A Sequencing Primer Used AAACTCACCCAGTCTAGTGC (SEQ ID NO: 6)
TABLE-US-00002 TABLE 2 Gene and RNA guide information for CIITA gene Gene Name CIITA Transcript ID ENST00000324288.12 Guide RNA 1 Sequence CACAGCUGAGCCCCCCACUG (SEQ ID NO: 7) Guide RNA 2 Sequence GGCUCCUGGUUGAACAGCGC (SEQ ID NO: 8) Guide RNA 3 Sequence CCCCUAACAUACUGGGAAUC (SEQ ID NO: 9) PCR & Sequencing Primers: FOR primer (5′-3′) TGAGAGCTTGGGGTCCCTTA (SEQ ID NO: 10) REV Primer (5′-3′) CTGAGGCATGTTCTCTGCCA (SEQ ID NO: 11) GC Enhancer Used N/A Sequencing Primer Used GGTAGGGGCTTGGAGCTAAC (SEQ ID NO: 12)
[0056] Double KO of the B2M and CIITA genes in both alleles was confirmed by DNA sequencing. Assessment of the morphology of the HLA-KO iPSC culture showed pluripotency of the HLA-KO iPSC culture, a normal karyotype and validation of short-tandem repeat (STR) of the HLA-KO iPSC line
[0057] Additional nonlimiting examples of cell lines which can be created in accordance with the present invention include RCL-BC-2, an HLA Class I (B2M) and Class II (CIITA) double knock-out iPSC line produced using NCL2 as the parental line and RCL-BC-2-GFP, an iPSC line generated by knocking-out both HLA Class I (B2M) and Class II (CIITA) genes, and knocking-in a foreign antigen in a safe harbor on Chr 13 using RCL-BC-2 as the parental line.
[0058] In another nonlimiting embodiment, a floxed construct can be inserted in a safe harbor of a hypoimmunogenic cell to utilize cassette exchange to replace one antigen with another thereby producing multiple cell lines which express multiple epitopes. See
[0059] The following nonlimiting examples are provided to further illustrate the present invention.
EXAMPLES
Example 1: Nucleic Acid Construct for Foreign Antigen Expression of CoV219)
[0060] Details of a nonlimiting example of a construct for insertion/integration of a gene for the foreign antigen CoV219 are provided below:
TABLE-US-00003 Lox2272-CAG-Cov219 (codon optimized)-SV40pA- Lox511 (SEQ ID NO: 13) ataacttcgtataggatactttatacgaagttatatttaaatgacat tgattattgactagttattaatagtaatcaattacggggtcattagt tcatagcccatatatggagttccgcgttacataacttacggtaaatg gcccgcctggctgaccgcccaacgacccccgcccattgacgtcaata atgacgtatgttcccatagtaacgccaatagggactttccattgacg tcaatgggtggagtatttacggtaaactgcccacttggcagtacatc aagtgtatcatatgccaagtacgccccctattgacgtcaatgacggt aaatggcccgcctggcattatgcccagtacatgaccttatgggactt tcctacttggcagtacatctacgtattagtcatcgctattaccatgg tcgaggtgagccccacgttctgcttcactctccccatctcccccccc tccccacccccaattttgtatttatttattttttaattattttgtgc agcgatgggggcggggggggggggggcgcgcgccaggcggggcgggg cggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagc caatcagagcggcgcgctccgaaagtttctttttatggcgaggcggc ggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtc gctgcgttgccttcgccccgtgccccgctccgcgccgcctcgcgccg cccgccccggctctgactgaccgcgttactcccacaggtgagcgggc gggacggcccttctcctccgggctgtaattagcgcttggtttaatga cggctcgtttcttttctgtggctgcgtgaaagccttaaagggctccg ggagggccctttgtgcgggggggagcggctcggggggtgcgtgcgtg tgtgtgtgcgtggggagcgccgcgtgcggcccgcgctgcccggcggc tgtgagcgctgcgggcgcggcgcggggctttgtgcgctccgcgtgtg cgcgaggggagcgcggccgggggcggtgccccgcggtgcgggggggc tgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtg agcagggggtgtgggcgcggcggtcgggctgtaacccccccctgcac ccccctccccgagttgctgagcacggcccggcttcgggtgcggggct ccgtgcggggcgtggcgcggggctcgccgtgccgggcggggggtggc ggcaggtgggggtgccgggcggggcggggccgcctcgggccggggag ggctcgggggaggggcgcggcggcccccggagcgccggcggctgtcg aggcgcaggcgagccgcagccattgccttttatggtaatcgtgcgag agggcgcagggacttcctttgtcccaaatctgtgcggagccgaaatc tgggaggcgccgccgcaccccctctagcgggcgcggggcgaagcggt gcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcg ccgcgccgccgtccccttctccctctccagcctcggggctgtccgcg gggggacggctgccttcgggggggacggggcagggcggggttcggct tctggcgtgtgaccggcggctctagagcctctgctaaccatgttcat gccttcttctttttcctacaggtttacc(CoV219)aaacaaatata acttcgtataatgtatactatacgaagttat
Example 2: Production of COVID-19 Antigen iPSC Lines and MSC Derived Therefrom
[0061] Several COVID-19 antigen iPSC lines expressing SARS-CoV-2 spike protein, N protein and RNA polymerase were produced. In particular, 3 HLA-KO iPSC lines RCL-BC1-S, RCL-BC1-RNAPol and RCL-BC1-N, expressing SARS-CoV-2 spike protein, N protein and RNA polymerase and 3 control iPSC lines (paternal lines) NCL2-S, NCL2-RNAPol and NCL2-N, expressing SARS-CoV-2 spike protein, N protein and RNA polymerase were produced.
[0062] MSCs were then derived from the iPSC lines.
Example 3: In Vitro Experiments with MSC Derived from HLA-KO iPSC and its Parental iPSC Lines Expressing SARS-CoV-2 Spike Protein (RCL-BC1-S and NCL2-S)
[0063] The hypoimmunogenic status and activation of the innate immune response to the MSCs is confirmed.
[0064] ELISA-based and PCR-based assays are performed to confirm expression of antigen or antibody.
[0065] In vitro challenge assays using sera from immunized mice or expressed antibody using pseudo virus or competitive CFU assays are performed.
Example 4: In Vivo Experiments with MSC Derived from HLA-KO iPSC and its Parental iPSC Lines Expressing SARS-CoV-2 Spike Protein (RCL-BC1-S and NCL2-S)
[0066] The immune response to MSC engineered to express COVID antigens is assessed in mice. Antibody production in mice is tested by ELISA and CFU assays.
[0067] Mice (n=5/group) are injected as follows: [0068] Group 1: MSC derived from HLA-null iPSC line stably expressing spike protein; [0069] Group 2: MSC derived from HLA unmodified iPSC stably expressing spike protein; [0070] Group 3: HLA-null MSC transfected with SAM encoding spike protein gene; [0071] Group 4: Unmodified MSC transfected with SAM encoding spike protein gene; and [0072] Group 5: SAM encoding spike protein gene alone.
[0073] For these studies, an equal amount of male and female C57BL/6 mice, aged from six to eight weeks, are used. The mice are randomly divided into the above treatment groups. For intramuscular injection, the right hind leg of the mouse is sterilized with 75% alcohol and 1 million modified MSCs are injected through a 1 ml injector. For subcutaneous, a similar number of MSCs are injected into the side abdomen or neck locus.
Example 5: Additional Antigens
[0074] Vaccine tests will be expanded to an influenza vaccine project and determination of immune responses to cells expressing influenza antigen. Mice will be injected similarly to Example 4. Groups are as follows: [0075] HLA-null MSC transfected with SAM encoding hemagglutinin (HA) gene; [0076] Unmodified MSC transfected with SAM encoding HA gene; SAM encoding HA gene alone;