METHOD FOR PRODUCING 3-HYDROXYPROPIONIC ACID
20230340547 · 2023-10-26
Inventors
Cpc classification
C12N15/70
CHEMISTRY; METALLURGY
C12Y102/01004
CHEMISTRY; METALLURGY
C12N9/0008
CHEMISTRY; METALLURGY
C12R2001/01
CHEMISTRY; METALLURGY
International classification
Abstract
Provided is a two-step production method for 3-HP, comprising: a first step of culturing cells at a high concentration; and a second step of producing 3-HP using the high concentration-cultured cells as a catalyst, in which during the two-step culture, the energy and/or coenzyme balance are adjusted to produce 3-HP and/or improve the productivity of 3-HP. The productivity and yield of 3-HP can be improved.
Claims
1. A method of producing 3-hydroxypropionic acid (3-HP), comprising (1) inoculating cells having 3-hydroxypropionic acid (3-HP) production ability into a production medium; and (2) producing 3-HP by culturing the inoculated cells, wherein the production medium comprises glycerol as a carbon source, and the culturing is performed under (i) a condition of maintaining dissolved oxygen (DO) in the production medium at a level of 50% or less, (ii) a condition of adding glucose when the dissolved oxygen in the medium is 0.1% or more, or (iii) both (i) and (ii).
2. The method according to claim 1, wherein in step (2) of producing 3-HP, proliferation of cells does not occur.
3. The method according to claim 1, wherein the producing medium in which the cells are inoculated in step (1) does not comprise glucose as a carbon source.
4. The method according to claim 1, wherein the maintaining the dissolved oxygen of the condition (i) is performed by adjusting the stirring speed.
5. The method according to claim 1, wherein the concentration of the glucose added in the condition (ii) is 0.01 to 3 g/L.
6. The method according to claim 1, wherein the cells having 3-hydroxypropionic acid production ability and inoculated into the production medium in step (1) are isolated from a growth medium after high concentration culture in the growth medium.
7. The method according to claim 6, wherein the cells having production ability of 3-HP comprise a gene encoding at least one protein selected from the group consisting of glycerol dehydratase and aldehyde dehydrogenase.
8. The method according to claim 6, wherein the growth medium does not comprise glycerol as a carbon source.
9. The method according to claim 6, the cell concentration measured by the OD600 value after the high concentration culture is 50 or more.
10. A culture of a strain producing 3-hydroxypropionic acid (3-HP), comprising 3-hydroxypropionic acid at a concentration of 60 g/L or more.
11. The culture according to claim 10, having one or more characteristics selected from the following: acetate concentration of 0.2% (w/v) or less, lactate concentration of 0.1% (w/v) or less, PDO (1,3-propanediol) concentration of 0.2% (w/v) or less, and glycerol concentration of 0.3% (w/v) or less.
12. A composition for producing 3-hydroxypropionic acid comprising the culture of claim 10.
13. A composition for producing 3-hydroxypropionic acid comprising the culture of claim 11.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0087]
[0088]
EXAMPLES
[0089] Hereinafter, the present invention will be described in more detail by examples. However, the following examples are intended to illustrate the content of the present invention only, but the scope of the present invention is not limited by the following examples.
[0090] Unless otherwise specified in the present description, all temperatures are based on degrees Celsius, and nucleic acid sequences are described from the 5′ end to the 3′ end unless otherwise specified.
Example 1. Preparation of 3-HP Producing Strain
[0091] A recombinant vector in which a gene encoding glycerol dehydratase and aldehyde dehydrogenase known to produce 3-hydroxypropionic acid (3-HP) using glycerol as a substrate was introduced was prepared. A 3-HP producing strain was produced by introducing the prepared recombinant vector into E. coli W3110 strain.
[0092] Specifically, a gene encoding glycerol dehydratase (dhaB), a gene encoding aldehyde dehydrogenase (aldH) and a gene encoding dehydratase reactivase (gdrAB) were cloned into a plasmid pCDF to produce a recombinant vector for producing 3HP (pCDF_J23101_dhaB_gdrAB_J23100_aldH).
[0093] The pCDFDuetJ23 vector used for production of the recombinant vector was a vector in which the promoter portion of the pCDFDuet-1 vector (Novagen, USA) was substituted with J23101 and J23100 promoters. The dhaB (U30903.1; about 2.7 kb; including dhaB1, dhaB2 and dhaB3) and gdrAB genes (about 2.2 kb; gdrA, gdrB) inserted into the vector were amplified in the chromosome of Klebsiella pneumonia (ATCC 25955) using the primers of Table 1 below. Since the dhaB123 and gdrA genes were located side by side on the chromosome of Klebsiella pneumonia, they were amplified together, and since gdrB was located in the opposite direction to dhaB123 and gdrA, only gdrB was amplified separately.
[0094] The aldH gene was amplified and separated from the genome of E. coli K12 MG1655 strain using the promoter pair consisting of the nucleic acid sequences of SEQ ID NO: 5 and SEQ ID NO: 6 of Table 1 below. In Table 1 below, the nucleic acid sequences of the primers used for amplification of each gene were shown, and among names, ‘-F’ refers to a forward promoter, and ‘-R’ refers to a reverse promoter.
TABLE-US-00001 TABLE 1 SEQ ID NO Name Nucleic acid sequence (5′>3′) 1 dhaB- GAATTCATGAAAAGATCAAAACGATTTGCAGTCCT gdrA-F 2 dhaB- AAGCTTGATCTCCCACTGACCAAAGCTGG gdrA-R 3 gdrB-F AAGCTTAGAGGGGGCCGTCATGTCGCTTTCACCGCCAG 4 gdrB-R CTTAAGTCAGTTTCTCTCACTTAACGGC 5 aldH-F ggtaccatgaattttcatcatctggc 6 aldH-R catatgtcaggcctccaggcttat
[0095] After amplification of each gene, the dhaB123 and gdrA genes, and the gdrB gene were cloned downstream of the J23101 promoter of the pCDFDuetaJ23 vector using restriction enzymes EcoRI and HindIII, and the restriction enzymes HindIII and AflII, respectively. The aldH was cloned under the J23108 promoter using restriction enzymes KpnI and NdeI. The cloning method of each gene was performed by a method known in the art. The plasmid was introduced into E. coli W3110 (KCCM 40219) by electroporation to prepare a 3HP producing strain.
Preparation Example 1. Two-Step Cell Culture for 3-HP Production
1-1. High Concentration Culture of Cells (Step 1 Culture)
[0096] For the prepared 3-HP producing strain, high concentration cell culture was performed by a fed-batch culture method with a 5 L fermenter (Working volume 2 L).
[0097] Specifically, glucose 20 g/L, and an antibiotic (streptomycin) for selection 25 mg/L, were added to an MR medium (KH.sub.2PO.sub.4 6.67 g, (NH.sub.4).sub.2HPO.sub.4 4 g, MgSO.sub.4.Math.7H.sub.2O 0.8 g, citric acid 0.8 g, and trace metal solution 5 mL per 1 L; herein, Trace metal solution was 5M HCl 5 mL, FeSO.sub.4.Math.7H.sub.2O 10 g, CaCl.sub.2 2 g, ZnSO.sub.4.Math.7H.sub.2O 2.2 g, MnSO.sub.4.Math.4H.sub.2O 0.5 g, CuSO.sub.4.Math.5H.sub.2O 1 g, (NH.sub.4).sub.6Mo.sub.7O.sub.2.Math.4H.sub.2O 0.1 g, and Na.sub.2B.sub.4O.sub.2.Math.10H.sub.2O 0.02 g per 1 L) to use as the cell culture medium, and the temperature of 35° C. was maintained. pH was maintained by 6.95 using ammonia water, and the dissolved oxygen (DO) was maintained at 20%, raising the stirring speed up to 900 rpm in stages, and aeration was maintained at 1 vvm.
[0098] For the fed-batch culture, a pH-stat feeding method was used, and glucose was added at 3 g/L.
[0099] Cell concentration was measured by measuring optical density (OD) using a UV-Spectrometer according to the lapse of incubation time. At 20 hours after initiation of culture, OD600 was shown to be about 120 (dry cell weight 30 g/L).
[0100] After completing the high concentration cell culture, the cell culture solution was centrifuged at 6,000 rpm at 4° C. for 10 minutes to recover cells. The recovered cells were suspended with PBS (phosphate-buffered saline) and used in the following step.
1-2. 3-JP Production Using Cells High Concentration Cultured (Step 2 Culture)
[0101] The medium for producing 3-HP was prepared by adding glycerol 70 g/L and vitamin B12 50 μM in M9 medium without glucose. The cell suspension prepared in the Preparation example 1-1 was inoculated into the medium for producing 3-HP to be the cell inoculum 5 g/L (based on the dry cell weight), and the 3-HP producing step was performed in a 5 L fermenter (Working volume 2 L).
[0102] The culture condition for 3-HP production was maintained at the temperature of 35° C. and stirring speed of 300 rpm, and the aeration was maintained at 1 vvm and the pH was maintained at 7.0 using Ca(OH).sub.2.
Example 2. Glucose Supply Condition for Activation of Electron Transport System (Step 2 Culture+Glucose Addition)
[0103] It is known that ATP is consumed to transport 3-HP synthesized in the cell out of the cell. This ATP synthesis is mainly performed in the electron transport system and ATP synthesis is also possible through substrate-level phosphorylation of glucose. Accordingly, the productivity improving effect of 3-HP was confirmed when ATP was continuously supplied by adding a small amount of glucose.
[0104] Specifically, the strain for producing 3-HP isolated after step 1 high concentration culture by the method of Preparation example 1-1 (strain prepared in Preparation example 1), was inoculated under the same condition as the step 2 culture of Preparation example 1-2 to perform culture. However, the culture condition was set to add a glucose solution with a concentration of 700 g/L to be 0.3 g/L when the dissolved oxygen (DO) during the step 2 culture (in the medium) was measured and it exceeded 20% or more.
[0105] As a control group (Comparative example), only the steps of Preparation examples 1-1 to 1-2 were performed and the cell culture and 3-HP production were performed.
Example 3. Air Supply Controlling Condition for Activation of Electron Transport System (Step 2 Culture+DO Control)
[0106] Biosynthesis of 3-HP using glycerol is achieved by glycerol dehydratase converting glycerol to 3-HPA and then aldehyde dehydrogenase converting 3-HPA to 3-HP (
[0107] Specifically, the strain for producing 3-HP isolated after step 1 culture by the method of Preparation example 1-1, was inoculated under the same condition as the step 2 culture of Preparation example 1-2 and culture was performed. However, in 2 hours after inoculation in the step 2 culture, the culture condition was set to maintain the dissolved oxygen (DO) at 5% by adjusting the stirring speed (rpm). In the present example, the initial stirring speed was started at 300 rpm and after 2 hours, the DO was adjusted by gradually increasing the stirring speed so that the DO was 5%. In other words, when the DO was 5% or less, the stirring speed was increased by 1-2 RPM and when it was 5% or more, the DO was maintained at 5% while lowering it by 1-2 RPM.
[0108] As a control group (Comparative example 1), only the steps of Preparation examples 1-1 to 1-2 were performed and the cell culture and 3-HP production were performed. In case of the control group, the initial DO right after inoculation was 0% and at the end of the step 2 culture (40 hours), oxygen consumption was stopped and the DO was increased to 100%.
Example 4. Comparison of 3-HP Production by Each Culture Condition
[0109] While producing 3-HP by the methods of Examples 2 to 3 and the methods of Preparation examples 1-1 to 1-2 (Comparative example 1), the production (g/L) of 3-HP according to the lapse of the step 2 culture time was measured, and the result was shown in
[0110] As can be seen in
Example 5. Comparison of 3-HP Production According to Glucose Addition in the Step 1 Culture and Step 2 Culture
[0111] 3-HP production of the case of step 2 culture where glucose was set to be added when DO exceeded 20% during step 2 culture as Example 2 and the case of step 1 culture where glucose was added (Comparative example 2) was compared.
[0112] The Comparative example 2 was prepared as follows: At first, cell growth and 3HP production were simultaneously progressed by adding glucose required for cell growth and a substrate, glycerol to a medium at the same time. The recombinant strain prepared in Example 1 was used, and except for adding glucose and glycerol at the same time, the procedure was the same as Preparation example 1-1 (glucose was added by a fed-batch method and glycerol was added at once during culture). Glucose was additionally added by 1 g/L each time the pH reached 7.0 or higher when all of the initially added glucose was consumed, and 70 g/L glycerol was added at 20 and 48 hours of culture.
[0113] Culture condition of Comparative example 2: temperature 35° C., pH maintained at 6.95 using ammonia water, stirring speed 500 rpm, Air 1 vvm input
[0114] The 3-HP production (g/L) and productivity (g/L/h) of step 1 culture (Example 2) or step 1 culture (Comparative example 2) in Example 2 and Comparative example 2 were measured and shown in Table 2 below:
TABLE-US-00002 TABLE 2 3-HP production Productivity Fermentation method (g/L) (g/L/h) Step 1 + glucose addition 56 1.5 Step 2 + glucose addition 80 2.1
[0115] (The results in Table 2 are results measured at 38 hours of the step 2 culture (production step) in Example 2 and at 48 hours of the step 1 culture in Comparative example 2, respectively).
[0116] As shown in Table 2, in case of Example 2, compared to Comparative example 2, the 3-HP production and productivity were increased. This result shows that the 3-HP production increasing effect according to glucose addition in the step 2 culture was shown much higher.
Example 6. Comparison of Production of Impurities in Culture
[0117] The content of impurities (acetate, lactate, PDO (1,3-propanediol), and remaining glycerol) in the cultures obtained in Example 2 (step 2 culture+glucose addition) and Example 3 (step 3 culture+DO control) was measured, and it was compared with the case of producing 3-HP by performing only Preparation example 1-1 (step 1 production).
[0118] The obtained result was shown in Table 3 below:
TABLE-US-00003 TABLE 3 Step 1 Impurity production Example 2 Example 3 Acetate 3 g/L 1 g/L or less 1 g/L or less Lactate 2 g/L no no PDO 3 g/L 0.5 g/L or less 0.5 g/L or less Remaining glycerol 5 g/L or more 1 g/L or less 1 g/L or less
[0119] (The results in Table 3 are results measured at 38 hours of the step 2 culture (production step) and at 48 hours of the step 1 culture in Example 2 and Example 3, respectively).
[0120] As shown in Table 3, in case of Examples 2 and 3, compared to the case of step 1 production, it could be confirmed that the content of impurities such as acetate, lactate, PDO, and remaining glycerol was significant low or did not exist.