COMPOUNDS AND METHODS FOR MODULATING PMP22

Abstract

Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of PMP22 RNA in a cell or animal, and in certain instances reducing the amount of PMP22 protein in a cell or animal. Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a neurodegenerative disease. Such symptoms and hallmarks include demyelination, progressive axonal damage and/or loss, weakness and wasting of foot and lower leg muscles, foot deformities, and weakness and atrophy in the hands. Such neurodegenerative diseases include Charcot-Marie-Tooth disease.

Claims

1.-120. (canceled)

121. An oligomeric duplex comprising: a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 29 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 352; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

122. The oligomeric duplex of claim 121, wherein at least one nucleoside of the first modified oligonucleotide comprises a modified sugar moiety.

123. The oligomeric duplex of claim 122, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety.

124. The oligomeric duplex of claim 123, wherein the non-bicyclic modified sugar moiety is a 2′-MOE sugar moiety, a 2′-OMe sugar moiety, or a 2′-F sugar moiety.

125. The oligomeric duplex of claim 121, wherein at least one modified internucleoside linkage of the first modified oligonucleotide is a phosphorothioate internucleoside linkage.

126. The oligomeric duplex of claim 121, wherein each internucleoside linkage of the first modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

127. The oligomeric duplex of claim 121, wherein the first oligomeric compound comprises a terminal group.

128. The oligomeric duplex of claim 127, wherein the terminal group comprises a 5′-vinylphosphonate.

129. The oligomeric duplex of claim 121, wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 663.

130. The oligomeric duplex of claim 121, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.

131. The oligomeric duplex of claim 130, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety.

132. The oligomeric duplex of claim 131, wherein the non-bicyclic modified sugar moiety is a 2′-MOE sugar moiety, a 2′-OMe sugar moiety, or a 2′-F sugar moiety.

133. The oligomeric duplex of claim 121, wherein at least one modified internucleoside linkage of the second modified oligonucleotide is a phosphorothioate internucleoside linkage.

134. The oligomeric duplex of claim 121, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

135. The oligomeric duplex of claim 121, wherein the second oligomeric compound comprises a conjugate group.

136. The oligomeric duplex of claim 135, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

137. The oligomeric duplex of claim 136, wherein the conjugate moiety is a lipophilic group.

138. The oligomeric duplex of claim 136, wherein the conjugate moiety comprises a C16 alkyl group.

139. The oligomeric duplex of claim 135, wherein the conjugate group is attached to the second modified oligonucleotide at the 3′-end.

140. The oligomeric duplex of claim 121, wherein the internucleoside linkage motif of the first modified oligonucleotide is ssooooooooooooooooooss and the internucleoside linkage motif of the second modified oligonucleotide is ssooooooooooooooooss, wherein each “o” represents a phosphodiester internucleoside linkage and each “s” represents a phosphorothioate internucleoside linkage.

141. The oligomeric duplex of claim 121, wherein the first modified oligonucleotide consists of 23 linked nucleosides.

142. The oligomeric duplex of claim 121, wherein the second modified oligonucleotide consists of 21 linked nucleosides.

143. An oligomeric duplex comprising: a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 14 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 352; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 12 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 663.

144. The oligomeric duplex of claim 143, wherein at least one nucleoside of the first modified oligonucleotide and at least one nucleoside of the second modified oligonucleotide each independently comprises a modified sugar moiety selected from a 2′-OMe sugar moiety and a 2′-F sugar moiety.

145. The oligomeric duplex of claim 143, wherein each internucleoside linkage of the first modified oligonucleotide and each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

146. The oligomeric duplex of claim 143, wherein the second oligomeric compound comprises a conjugate group comprising a conjugate moiety.

147. The oligomeric duplex of claim 146, wherein the conjugate moiety comprises a C16 alkyl group.

148. The oligomeric duplex of claim 143, wherein the internucleoside linkage motif of the first modified oligonucleotide is ssooooooooooooooooooss and the internucleoside linkage motif of the second modified oligonucleotide is ssooooooooooooooooss, wherein each “o” represents a phosphodiester internucleoside linkage and each “s” represents a phosphorothioate internucleoside linkage.

149. The oligomeric duplex of claim 143, wherein the first oligomeric compound comprises a terminal group.

150. The oligomeric duplex of claim 149, wherein the terminal group comprises a 5′-vinylphosphonate.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0007] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/of” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included,” is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

[0008] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank, ENSEMBL, and NCBI reference sequence records, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety.

Definitions

[0009] Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety.

[0010] Unless otherwise indicated, the following terms have the following meanings:

Definitions

[0011] As used herein, “2′-deoxynucleoside” means a nucleoside comprising a 2′-H(H) deoxyfuranosyl sugar moiety. In certain embodiments, a 2′-deoxynucleoside is a 2′-β-D-deoxynucleoside and comprises a 2′-$3-D-deoxyribosyl sugar moiety, which has the β-D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2′-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

[0012] As used herein, “2′-MOE” means a 2′-OCH.sub.2CH.sub.2OCH.sub.3 group in place of the 2′-OH group of a furanosyl sugar moiety. A “2′-MOE sugar moiety” means a sugar moiety with a 2′-OCH.sub.2CH.sub.2OCH.sub.3 group in place of the 2′-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2′-MOE sugar moiety is in the p-D-ribosyl configuration. “MOE” means O-methoxyethyl.

[0013] As used herein, “2′-MOE nucleoside” means a nucleoside comprising a 2′-MOE sugar moiety.

[0014] As used herein, “2′-OMe” means a 2′-OCH.sub.3 group in place of the 2′-OH group of a furanosyl sugar moiety. A “2′-O-methyl sugar moiety” or “2′-OMe sugar moiety” means a sugar moiety with a 2′-OCH.sub.3 group in place of the 2′-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2′-OMe sugar moiety is in the $-D-ribosyl configuration.

[0015] As used herein, “2′-OMe nucleoside” means a nucleoside comprising a 2′-OMe sugar moiety.

[0016] As used herein, “2′-substituted nucleoside” means a nucleoside comprising a 2′-substituted sugar moiety. As used herein, “2′-substituted” in reference to a sugar moiety means a sugar moiety comprising at least one 2′-substituent group other than H or OH.

[0017] As used herein, “5-methyl cytosine” means a cytosine modified with a methyl group attached to the 5 position. A 5-methyl cytosine is a modified nucleobase.

[0018] As used herein, “administering” means providing a pharmaceutical agent to a subject.

[0019] As used herein, “antisense activity” means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.

[0020] As used herein, “antisense compound” means an oligomeric compound capable of achieving at least one antisense activity. An antisense compound comprises an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group.

[0021] As used herein, “sense compound” means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.

[0022] As used herein, “antisense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity. Antisense oligonucleotides include but are not limited to antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.

[0023] As used herein, “sense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of a sense compound, that is capable of hybridizing to an antisense oligonucleotide. Sense oligonucleotides include but are not limited to sense RNAi oligonucleotides.

[0024] As used herein, “antisense agent” means an antisense compound and optionally one or more additional features, such as a sense compound.

[0025] As used herein, “ameliorate” in reference to a treatment means improvement in at least one symptom relative to the same symptom in the absence of the treatment. In certain embodiments, amelioration is the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom. In certain embodiments, the symptom or hallmark is demyelination, progressive axonal damage and/or loss, weakness and wasting of foot and lower leg muscles, foot deformities, and weakness and atrophy in the hands.

[0026] As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety.

[0027] As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms of the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

[0028] As used herein, “cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.

[0029] As used herein, “complementary” in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof and the nucleobases of another nucleic acid or one or more portions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. As used herein, complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine (mC) and guanine (G). Complementary oligonucleotides and/or target nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary” or “100% complementary” in reference to an oligonucleotide, or portion thereof, means that the oligonucleotide, or a portion thereof, is complementary to another oligonucleotide or target nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.

[0030] As used herein, “conjugate group” means a group of atoms that is directly or indirectly attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

[0031] As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

[0032] As used herein, “conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

[0033] As used herein, “contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.

[0034] As used herein, “cEt” means a 4′ to 2′ bridge in place of the 2′OH-group of a ribosyl sugar moiety, wherein the bridge has the formula of 4′-CH(CH.sub.3)—O-2′, and wherein the methyl group of the bridge is in the S configuration. A “cEt sugar moiety” is a bicyclic sugar moiety with a 4′ to 2′ bridge in place of the 2′OH-group of a ribosyl sugar moiety, wherein the bridge has the formula of 4′-CH(CH.sub.3)—O-2′, and wherein the methyl group of the bridge is in the S configuration. “cEt” means constrained ethyl.

[0035] As used herein, “cEt nucleoside” means a nucleoside comprising a cEt sugar moiety. As used herein, “chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.

[0036] As used herein, “chirally controlled” in reference to an internucleoside linkage means chirality at that linkage is enriched for a particular stereochemical configuration.

[0037] As used herein, “deoxy region” means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides are 2′-β-D-deoxynucleosides. In certain embodiments, each nucleoside is selected from a 2′-β-D-deoxynucleoside, a bicyclic nucleoside, and a 2′-susbstituted nucleoside. In certain embodiments, a deoxy region supports RNase H activity. In certain embodiments, a deoxy region is the gap or internal region of a gapmer.

[0038] As used herein, “gapmer” means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.” The internal region is a deoxy region. The positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5′-end of the internal region. Unless otherwise indicated, “gapmer” refers to a sugar motif. In certain embodiments, each nucleoside of the gap is a 2′-β-D-deoxynucleoside. In certain embodiments, the gap comprises one 2′-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2′-β-D-deoxynucleosides. As used herein, the term “MOE gapmer” indicates a gapmer having a gap comprising 2′-β-D-deoxynucleosides and wings comprising 2′-MOE nucleosides. As used herein, the term “mixed wing gapmer” indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified internucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.

[0039] As used herein, “hotspot region” is a range of nucleobases on a target nucleic acid that is amenable to oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.

[0040] As used herein, “hybridization” means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

[0041] As used herein, “internucleoside linkage” means the covalent linkage between contiguous nucleosides in an oligonucleotide. As used herein, “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. “Phosphorothioate internucleoside linkage” or “PS internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.

[0042] As used herein, “linker-nucleoside” means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.

[0043] As used herein, “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

[0044] As used herein, “mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned.

[0045] As used herein, “motif” means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.

[0046] As used herein, “neurodegenerative disease” means a condition marked by progressive loss of function or structure, including loss of motor function and death of neurons. In certain embodiments, the neurodegenerative disease is a peripheral neuropathy. In certain embodiments, the neurodegenerative disease is Charcot-Marie-Tooth disease. In certain embodiments, the neurodegenerative disease is CMT1A. In certain embodiments, the neurodegenerative disease is CMT1E. In certain embodiments, the disease is Dejerine-Sottas Syndrome.

[0047] As used herein, “nucleobase” means an unmodified nucleobase or a modified nucleobase. As used herein an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. A “5-methyl cytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, “nucleobase sequence” means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.

[0048] As used herein, “nucleoside” means a compound or a fragment of a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. As used herein, “modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase. “Linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).

[0049] As used herein, “oligomeric compound” means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired. A “singled-stranded oligomeric compound” is an unpaired oligomeric compound. The term “oligomeric duplex” means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”

[0050] As used herein, “oligonucleotide” means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.

[0051] As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to a subject. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject.

[0052] In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.

[0053] As used herein, “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

[0054] As used herein, “pharmaceutical composition” means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines.

[0055] As used herein, “prodrug” means a therapeutic agent in a form outside the body that is converted to a different form within a subject or cells thereof. Typically, conversion of a prodrug within the subject is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.

[0056] As used herein, “reducing the amount or activity” refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.

[0057] As used herein, “RNA” means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.

[0058] As used herein, “RNAi compound” means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to the antisense compound of double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid. The term RNAi compound excludes antisense compounds that act through RNase H.

[0059] As used herein, “RNAi agent” means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may comprise conjugate groups and/or terminal groups. In certain embodiments, an RNAi agent modulates the amount and/or activity, of a target nucleic acid. The term RNAi agent excludes antisense agents that act through RNase H.

[0060] As used herein, “RNase H agent” means an antisense agent that acts through RNase H to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. In certain embodiments, RNase H agents are single-stranded. In certain embodiments, RNase H agents are double-stranded. RNase H compounds may comprise conjugate groups and/or terminal groups. In certain embodiments, an RNase H agent modulates the amount and/or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act principally through RISC/Ago2.

[0061] As used herein, “self-complementary” in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.

[0062] As used herein, “standard in vivo assay” means the assay described in any of Example 3 and reasonable variations thereof.

[0063] As used herein, “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate intemucleoside linkage.

[0064] As used herein, “subject” means a human or non-human animal.

[0065] As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2′-OH(H) $-D-ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2′-H(H) β-D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1′, 3′, and 4′ positions, an oxygen at the 3′ position, and two hydrogens at the 5′ position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.

[0066] As used herein, “sugar surrogate” means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.

[0067] As used herein, “symptom or hallmark” means any physical feature or test result that indicates the existence or extent of a disease or disorder. In certain embodiments, a symptom is apparent to a subject or to a medical professional examining or testing said subject. In certain embodiments, a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests.

[0068] As used herein, “target nucleic acid” and “target RNA” mean a nucleic acid that an antisense compound is designed to affect.

[0069] As used herein, “target region” means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0070] As used herein, “terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

[0071] As used herein, “therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount improves a symptom or hallmark of a disease.

CERTAIN EMBODIMENTS

[0072] The present disclosure provides the following non-limiting numbered embodiments: [0073] Embodiment 1. An oligomeric compound, comprising [0074] a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 50 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of a PMP22 RNA, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar, a sugar surrogate, and a modified internucleoside linkage. [0075] Embodiment 2. An oligomeric compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, or 16 nucleobases of any of SEQ ID NOs: 18-321. [0076] Embodiment 3. The oligomeric compound of any of embodiments 1-2, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to any of the nucleobase sequences of SEQ ID NOs: 1-8 when measured across the entire nucleobase sequence of the modified oligonucleotide. [0077] Embodiment 4. The oligomeric compound of any of embodiments 1-3, wherein the modified oligonucleotide comprises at least one modified nucleoside. [0078] Embodiment 5. The oligomeric compound of embodiment 4, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety. [0079] Embodiment 6. The oligomeric compound of embodiment 5, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety. [0080] Embodiment 7. The oligomeric compound of embodiment 6, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2′-4′ bridge, wherein the 2′-4′ bridge is selected from —O—CH.sub.2—; and —O—CH(CH.sub.3)—. [0081] Embodiment 8. The oligomeric compound of any of embodiments 5-7, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety. [0082] Embodiment 9. The oligomeric compound of embodiment 8, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety comprising a 2′-MOE modified sugar moiety or 2′-OMe modified sugar moiety. [0083] Embodiment 10. The oligomeric compound of any of embodiments 5-9, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate. [0084] Embodiment 11. The oligomeric compound of embodiment 10, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from morpholino and PNA. [0085] Embodiment 12. The oligomeric compound of any of embodiments 1-11, wherein the modified oligonucleotide has a sugar motif comprising: [0086] a 5′-region consisting of 1-5 linked 5′-region nucleosides; [0087] a central region consisting of 6-10 linked central region nucleosides; and [0088] a 3′-region consisting of 1-5 linked 3′-region nucleosides; wherein [0089] each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a modified sugar moiety and [0090] each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety. [0091] Embodiment 13. The oligomeric compound of embodiment 12, wherein the modified oligonucleotide has [0092] a 5′-region consisting of 3 linked 5′-region nucleosides; [0093] a central region consisting of 10 linked central region nucleosides; and [0094] a 3′-region consisting of 3 linked 3′-region nucleosides; wherein [0095] each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a cEt sugar moiety and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety. [0096] Embodiment 14. The oligomeric compound of any of embodiments 1-13, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage. [0097] Embodiment 15. The oligomeric compound of embodiment 14, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage. [0098] Embodiment 16. The oligomeric compound of embodiment 14 or 15 wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage. [0099] Embodiment 17. The oligomeric compound of any one of embodiments 14, 15, or 16 wherein at least one internucleoside linkage is a methoxypropyl phosphonate internucleoside linkage. [0100] Embodiment 18. The oligomeric compound of any of embodiment 14, 16, or 17 wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage. [0101] Embodiment 19. The oligomeric compound of any of embodiments 14, 16, 17, or 18, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate intemucleoside linkage, or a methoxypropyl phosphonate internucleoside linkage. [0102] Embodiment 20. The oligomeric compound of any of embodiments 1-19, wherein the modified oligonucleotide comprises a modified nucleobase. [0103] Embodiment 21. The oligomeric compound of embodiment 20, wherein the modified nucleobase is a 5-methyl cytosine. [0104] Embodiment 22. The oligomeric compound of any one of embodiments 1-21, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20,14-18, 14-20, 15-17, 15-25, 16-20, 18-22 or 18-20 linked nucleosides. [0105] Embodiment 23. The oligomeric compound of any one of embodiments 1-22, wherein the modified oligonucleotide consists of 16 linked nucleosides. [0106] Embodiment 24. The oligomeric compound of any one of embodiments 1-23, consisting of the modified oligonucleotide and the conjugate group. [0107] Embodiment 25. The oligomeric compound of any one of embodiments 1-24, wherein the conjugate group comprises a conjugate moiety and a conjugate linker. [0108] Embodiment 26. The oligomeric compound of embodiment 25, wherein the conjugate moiety is a lipophilic group. [0109] Embodiment 27. The oligomeric compound of embodiment 25, wherein the conjugate moiety is selected from a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl. C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. [0110] Embodiment 28. The oligomeric compound of embodiment 25, wherein the conjugate moiety is a 6-palmitamidohexyl conjugate moiety. [0111] Embodiment 29. The oligomeric compound of any of embodiments 25-28, wherein the conjugate linker is a phosphodiester linker. [0112] Embodiment 30. The oligomeric compound of any one of embodiments 1-29, wherein the conjugate group has the following structure:

##STR00001## [0113] Embodiment 31. The oligomeric compound of any one of embodiments 25-28, wherein the conjugate linker consists of a single bond. [0114] Embodiment 32. The oligomeric compound of embodiments 25-28, wherein the conjugate linker is cleavable. [0115] Embodiment 33. The oligomeric compound of embodiments 25-28, wherein the conjugate linker comprises 1-3 linker-nucleosides. [0116] Embodiment 34. The oligomeric compound of any of embodiments 25-33, wherein the conjugate group is attached to the modified oligonucleotide at the 5′-end of the modified oligonucleotide. [0117] Embodiment 35. The oligomeric compound of any of embodiments 25-33, wherein the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide. [0118] Embodiment 36. The oligomeric compound of any of embodiments 1-35, comprising a terminal group. [0119] Embodiment 37. The oligomeric compound of any of embodiments 1-36 wherein the oligomeric compound is a singled-stranded oligomeric compound. [0120] Embodiment 38. The oligomeric compound of any one of embodiments 1-32 or 34-37, wherein the oligomeric compound does not comprise linker-nucleosides. [0121] Embodiment 39. An oligomeric duplex comprising an oligomeric compound of any one of embodiments 1-23, 25-36, or 38. [0122] Embodiment 40. An oligomeric compound according to the following chemical structure:

##STR00002## [0123] Embodiment 41. The oligomeric compound of embodiment 39, which is the sodium salt or the potassium salt. [0124] Embodiment 42. An oligomeric compound according to the following chemical structure:

##STR00003## [0125] Embodiment 43. An oligomeric comprising a modified oligonucleotide and conjugate group according to the following chemical notation: (6-palmitamidohexyl) Aks Aks Aks Tds Ads .sup.mCds Gds Ads Tds .sup.mCds Tds Tds .sup.mCds Tks Gks Gk (SEQ ID NO:239), wherein: [0126] A=an adenine nucleobase, [0127] mC=a 5-methyl cytosine nucleobase, [0128] G=a guanine nucleobase, [0129] T=a thymine nucleobase, [0130] k=a cEt sugar moiety, [0131] d=a 2′-β-D-deoxyribosyl sugar moiety, and [0132] s=a phosphorothioate intemucleoside linkage. [0133] Embodiment 44. An antisense compound comprising or consisting of an oligomeric compound of any of embodiments 1-36 or an oligomeric duplex of embodiment 37. [0134] Embodiment 45. A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-38 or 40-44 or an oligomeric duplex of embodiment 39 or 44 and a pharmaceutically acceptable carrier or diluent. [0135] Embodiment 46. The pharmaceutical composition of embodiment 45, wherein the pharmaceutically acceptable diluent is phosphate buffered saline. [0136] Embodiment 47. The pharmaceutical composition of embodiment 45, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and phosphate buffered saline. [0137] Embodiment 48. A method comprising administering to an animal a pharmaceutical composition of any of embodiments 45-47. [0138] Embodiment 49. A method of treating a disease associated with PMP22 comprising administering to an individual having or at risk for developing a disease associated with PMP22 a therapeutically effective amount of a pharmaceutical composition according to any of embodiments 45-47; and thereby treating the disease associated with PMP22. [0139] Embodiment 50. The method of embodiment 49, wherein the PMP22-associated disease is Dejerine-Sottas Syndrome. [0140] Embodiment 51. The method of embodiment 49, wherein the PMP22-associated disease is Charcot-Marie-Tooth disease. [0141] Embodiment 52. The method of embodiment 51, wherein the Charcot-Marie-Tooth disease is CMT1A. [0142] Embodiment 53. The method of embodiment 51, wherein the Charcot-Marie-Tooth disease is CMT1E. [0143] Embodiment 54. The method of any of embodiments 49-53, wherein at least one symptom or hallmark of the PMP22-associated disease is ameliorated. [0144] Embodiment 55. The method of embodiment 54, wherein the symptom or hallmark is demyelination, progressive axonal damage and/or loss, weakness and wasting of foot and lower leg muscles, foot deformities, and weakness and atrophy in the hands. [0145] Embodiment 56. An oligomeric compound, comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of a PMP22 RNA, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar, a sugar surrogate, and a modified internucleoside linkage. [0146] Embodiment 57. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, or 16 nucleobases of any of SEQ ID NOs: 19, 193-197, 199-205, 207-218, 220-226, or 238-239. [0147] Embodiment 58. The oligomeric compound of embodiment 56 or 57, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to any of the nucleobase sequences of SEQ ID NO: 1-8 when measured across the entire nucleobase sequence of the modified oligonucleotide. [0148] Embodiment 59. The oligomeric compound of any one of embodiments 56-58, wherein the modified oligonucleotide comprises at least one modified nucleoside. [0149] Embodiment 60. The oligomeric compound of embodiment 59, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety. [0150] Embodiment 61. The oligomeric compound of embodiment 60, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety. [0151] Embodiment 62. The oligomeric compound of embodiment 61, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2′-4′ bridge, wherein the 2′-4′ bridge is selected from —O—CH.sub.2—; and —O—CH(CH.sub.3)—. [0152] Embodiment 63. The oligomeric compound of any one of embodiments 59-62, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety. [0153] Embodiment 64. The oligomeric compound of embodiment 63, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety comprising a 2′-MOE modified sugar or 2′-OMe modified sugar. [0154] Embodiment 65. The oligomeric compound of any one of embodiments 59-64, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate. [0155] Embodiment 66. The oligomeric compound of embodiment 65, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from morpholino and PNA. [0156] Embodiment 67. The oligomeric compound of any one of embodiments 56-66, wherein the modified oligonucleotide has a sugar motif comprising: [0157] a 5′-region consisting of 1-5 linked 5′-region nucleosides; [0158] a central region consisting of 6-10 linked central region nucleosides; and [0159] a 3′-region consisting of 1-5 linked 3′-region nucleosides; wherein [0160] each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety. [0161] Embodiment 68. The oligomeric compound of embodiment 67, wherein the modified oligonucleotide has [0162] a 5′-region consisting of 3 linked 5′-region nucleosides; [0163] a central region consisting of 10 linked central region nucleosides; and [0164] a 3′-region consisting of 3 linked 3′-region nucleosides; wherein [0165] each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a cEt sugar moiety and each of the central region nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety. [0166] Embodiment 69. The oligomeric compound of any one of embodiments 56-68, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage. [0167] Embodiment 70. The oligomeric compound of embodiment 69, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage. [0168] Embodiment 71. The oligomeric compound of embodiment 69 or 70 wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage. [0169] Embodiment 72. The oligomeric compound of embodiment 69 or 70 wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage. [0170] Embodiment 73. The oligomeric compound of any one of embodiments 69, 71, or 72, wherein each internucleoside linkage is independently selected from a phosphodiester intemucleoside linkage or a phosphorothioate internucleoside linkage. [0171] Embodiment 74. The oligomeric compound of any one of embodiments 56-73, wherein the modified oligonucleotide comprises a modified nucleobase. [0172] Embodiment 75. The oligomeric compound of embodiment 74, wherein the modified nucleobase is a 5-methyl cytosine. [0173] Embodiment 76. The oligomeric compound of any one of embodiments 56-75, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20,14-18, 14-20, 15-17, 15-25, 16-20, 18-22 or 18-20 linked nucleosides. [0174] Embodiment 77. The oligomeric compound of any one of embodiments 56-76, wherein the modified oligonucleotide consists of 16 linked nucleosides. [0175] Embodiment 78. The oligomeric compound of any one of embodiments 56-77, consisting of the modified oligonucleotide. [0176] Embodiment 79. The oligomeric compound of any one of embodiments 56-77, further comprising a conjugate group. [0177] Embodiment 80. The oligomeric compound of embodiment 79, wherein the conjugate group comprises a conjugate moiety and a conjugate linker. [0178] Embodiment 81. The oligomeric compound of embodiment 80, wherein the conjugate linker consists of a single bond. [0179] Embodiment 82. The oligomeric compound of embodiments 80-81, wherein the conjugate linker is cleavable. [0180] Embodiment 83. The oligomeric compound of embodiments 80 or 82, wherein the conjugate linker comprises 1-3 linker-nucleosides. [0181] Embodiment 84. The oligomeric compound of any one of embodiments 80-83, wherein the conjugate group is attached to the modified oligonucleotide at the 5′-end of the modified oligonucleotide. [0182] Embodiment 85. The oligomeric compound of any one of embodiments 80-83, wherein the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide. [0183] Embodiment 86. The oligomeric compound of any one of embodiments 56-85, further comprising a terminal group. [0184] Embodiment 87. The oligomeric compound of any one of embodiments 56-86 wherein the oligomeric compound is a singled-stranded oligomeric compound. [0185] Embodiment 88. The oligomeric compound of any one of embodiments 56-82 or 84-87, wherein the oligomeric compound does not comprise linker-nucleosides. [0186] Embodiment 89. An oligomeric duplex comprising an oligomeric compound of any one of embodiments 56-78, 80-86, or 88. [0187] Embodiment 90. An antisense compound comprising or consisting of an oligomeric compound of any one of embodiments 56-88 or an oligomeric duplex of embodiment 89. [0188] Embodiment 91. A pharmaceutical composition comprising an oligomeric compound of any one of embodiments 56-88 or an oligomeric duplex of embodiment 89 and a pharmaceutically acceptable carrier or diluent. [0189] Embodiment 92. The pharmaceutical composition of embodiment 91, wherein the pharmaceutically acceptable diluent is phosphate buffered saline. [0190] Embodiment 93. The pharmaceutical composition of embodiment 92, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and phosphate buffered saline. [0191] Embodiment 94. A method comprising administering to an animal a pharmaceutical composition of any one of embodiments 91-93. [0192] Embodiment 95. A method of treating a disease associated with PMP22 comprising administering to an individual having or at risk for developing a disease associated with PMP22 a therapeutically effective amount of a pharmaceutical composition according to any one of embodiments 91-93; and thereby treating the disease associated with PMP22. [0193] Embodiment 96. The method of embodiment 95, wherein the PMP22-associated disease is Dejerine-Sottas Syndrome. [0194] Embodiment 97. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of a PMP22 nucleic acid, and wherein the modified oligonucleotides comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. [0195] Embodiment 98. The oligomeric compound of embodiment 97, wherein the PMP22 nucleic acid has the nucleobase sequence of any of SEQ ID NOs: 1-8. [0196] Embodiment 99. The oligomeric compound of embodiment 97 or embodiment 98, wherein the nucleobase sequence of the modified oligonucleotide is at least 95% or is 100% complementary to an equal length portion of the PMP22 nucleic acid. [0197] Embodiment 100. An oligomeric compound, wherein the oligomeric compound comprises a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or 16, contiguous nucleobases of any of the nucleobase sequences of any of SEQ ID NOs: 18-321. [0198] Embodiment 101. An oligomeric compound, wherein the oligomeric compound comprises a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of any of the nucleobase sequences of any of SEQ ID NOs: 322-632. [0199] Embodiment 102. The oligomeric compound of embodiment 100, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of any of SIDs 18-321. [0200] Embodiment 103. The oligomeric compound of embodiment 101, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of any of SIDs 322-632. [0201] Embodiment 104. The oligomeric compound of embodiment 100, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of any of SIDs 18-321. [0202] Embodiment 105. The oligomeric compound of embodiment 101, wherein the nucleobase sequence of the modified oligonucleotide consists of nucleobase sequence of any of SIDs 322-632. [0203] Embodiment 106. The oligomeric compound of any of embodiments 101-105, wherein the nucleobase sequence of the modified oligonucleotide is at least 90%, at least 95%, or 100% complementary to an equal length portion of a PMP22 nucleic acid, wherein the PMP22 nucleic acid has the nucleobase sequence of any of SEQ ID NOs: 1-8. [0204] Embodiment 107. The oligomeric compound of any of embodiments 97-106, wherein the modified oligonucleotide consists of 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides. [0205] Embodiment 108. The oligomeric compound of any of embodiments 97-107, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety. [0206] Embodiment 109. The oligomeric compound of embodiment 108, wherein the modified sugar moiety comprises a bicyclic sugar moiety. [0207] Embodiment 110. The oligomeric compound of embodiment 109, wherein the bicyclic sugar moiety comprises a 2′-4′ bridge, wherein the 2′-4′ bridge is selected from —O—CH.sub.2—; and —O—CH(CH.sub.3)—. [0208] Embodiment 111. The oligomeric compound of embodiment 108, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety. [0209] Embodiment 112. The oligomeric compound of embodiment 111, wherein the non-bicyclic modified sugar moiety is a 2′-MOE sugar moiety, a 2′-OMe sugar moiety, or a 2′-F sugar moiety. [0210] Embodiment 113. The oligomeric compound of any of embodiments 97-112, wherein at least one nucleoside of the modified oligonucleotide comprises a sugar surrogate. [0211] Embodiment 114. The oligomeric compound of embodiment 113, wherein the sugar surrogate is selected from morpholino and PNA. [0212] Embodiment 115. The oligomeric compound of any of embodiments 97-114, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage. [0213] Embodiment 116. The oligomeric compound of embodiment 115, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage. [0214] Embodiment 117. The oligomeric compound of embodiment 115, wherein at least one modified internucleoside linkage is a methoxy propyl internucleoside linkage. [0215] Embodiment 118. The oligomeric compound of embodiment 115, wherein each internucleoside linkage is a modified internucleoside linkage. [0216] Embodiment 119. The oligomeric compound of embodiment 119, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage. [0217] Embodiment 120. The oligomeric compound of any of embodiments 97-116, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage. [0218] Embodiment 121. The oligomeric compound of any of embodiments 97-116, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage and a mesyl phosphoramidate internucleoside linkage. [0219] Embodiment 122. The oligomeric compound of any of embodiments 97-116, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, and a methoxy propyl internucleoside linkage. [0220] Embodiment 123. The oligomeric compound of any of embodiments 97-116, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a methoxy propyl internucleoside linkage. [0221] Embodiment 124. The oligomeric compound of any of embodiments 97-116, wherein the modified oligonucleotide has a backbone motif selected from sssssssssssssss, ssssqssssssssss, sssssqsssssssss, or ssssssqssssssss wherein “s” is a phosphorothioate internucleoside linkage and “q” is a methoxypropyl internucleoside linkage. [0222] Embodiment 125. The oligomeric compound of any of embodiments 97-124, wherein the modified oligonucleotide comprises at least one modified nucleobase. [0223] Embodiment 126. The oligomeric compound of embodiment 125, wherein the modified nucleobase is 5-methylcytosine. [0224] Embodiment 127. The oligomeric compound of embodiment 126, wherein each cytosine is a 5-methylcytosine. [0225] Embodiment 128. The oligomeric compound of any of embodiment 97-127, wherein the modified oligonucleotide comprises a deoxy region consisting of 5-12 contiguous 2′-deoxynucleosides. [0226] Embodiment 129. The oligomeric compound of embodiment 128, wherein each nucleoside of the deoxy region is a 2′-β-D-deoxynucleoside. [0227] Embodiment 130. The oligomeric compound of embodiment 128 or 129, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides. [0228] Embodiment 131. The oligomeric compound of any of embodiments 128-130, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety. [0229] Embodiment 132. The oligomeric compound of any of embodiments 128-131, wherein the deoxy region is flanked on the 5′-side by a 5′-region consisting of 1-6 linked 5′-region nucleosides and on the 3′-side by a 3′-region consisting of 1-6 linked 3′-region nucleosides; wherein the 3′-most nucleoside of the 5′ external region comprises a modified sugar moiety; and the 5′-most nucleoside of the 3′ external region comprises a modified sugar moiety. [0230] Embodiment 133. The oligomeric compound of embodiment 132, wherein each nucleoside of the 3′ external region comprises a modified sugar moiety. [0231] Embodiment 134. The oligomeric compound of embodiment 132 or 133, wherein each nucleoside of the 5′ external region comprises a modified sugar moiety. [0232] Embodiment 135. The oligomeric compound of any of embodiments 128-134, wherein the modified oligonucleotide has: [0233] a 5′ external region consisting of 1-6 linked nucleosides; [0234] a deoxy region consisting of 6-10 linked nucleosides; and [0235] a 3′ external region consisting of 1-6 linked nucleosides; [0236] wherein each of the 5′ external region nucleosides and each of the 3′ external region nucleosides is a cEt nucleoside or a 2′-MOE nucleoside; and each of the deoxy region nucleosides is a 2′-β-D-deoxynucleoside. [0237] Embodiment 136. The oligomeric compound of any of embodiments 128-134, wherein the modified oligonucleotide has: [0238] a 5′ external region consisting of 3 linked nucleosides; [0239] a deoxy region consisting of 10 linked nucleosides; and [0240] a 3′ external region consisting of 3 linked nucleosides; [0241] wherein each of the 5′ external region nucleosides and each of the 3′ external region nucleosides is a cEt nucleoside and each of the deoxy region nucleosides is a 2′-β-D-deoxynucleoside. [0242] Embodiment 137. The oligomeric compound of any of embodiments 128-134, wherein the modified oligonucleotide has: [0243] a 5′ external region consisting of 3-4 linked nucleosides; [0244] a deoxy region consisting of 8-10 linked nucleosides; and [0245] a 3′ external region consisting of 3-4 linked nucleosides; [0246] wherein each of the 5′ external region nucleosides and each of the 3′ external region nucleosides is a cEt nucleoside or a 2′-MOE nucleoside; and each of the deoxy region nucleosides is a 2′-β-D-deoxynucleoside. [0247] Embodiment 138. The oligomeric compound of any of embodiments 128-134, wherein the modified oligonucleotide has a sugar motif comprising: [0248] a 5′ external region consisting of 3-6 linked nucleosides; [0249] a deoxy region consisting of 7-8 linked nucleosides; and [0250] a 3′ external region consisting of 3-6 linked nucleosides; wherein [0251] each of the 3′ external region nucleosides is selected from a 2′-MOE nucleoside and a cEt nucleoside, and the 5′ external region has the following formula:

(Nk)n(Nd)(Nx) [0252] wherein each Nk is a bicyclic nucleoside, Nx 2′-OMe nucleoside and Nd is a 2′-β-D-deoxynucleoside; and n is from 1-4. [0253] Embodiment 139. The oligomeric compound of any of embodiments 128-134, wherein the modified oligonucleotide has a sugar motif comprising: [0254] a 5′ external region consisting of 5 linked nucleosides; [0255] a deoxy region consisting of 8 linked nucleosides; and [0256] a 3′ external region consisting of 3 linked nucleosides; wherein [0257] each of the 3′ external region nucleosides is a cEt nucleoside, and the 5′ external region has the following formula:

(Nk)n(Nd)(Nx) [0258] wherein each Nk is a cEt nucleoside, Nx 2′-OMe nucleoside and Nd is a 2′-β-D-deoxynucleoside; [0259] and n is from 3; [0260] and wherein each of the deoxy region nucleosides is a 2′-β-D-deoxynucleoside. [0261] Embodiment 140. An oligomeric compound of any of embodiments 97-142, wherein the modified oligonucleotide has a sugar motif (5′ to 3′) selected from: kkkddddddddddkkk, ekkddddddddddkke, ekkddddddddddkkk, ekkddddddddddkkk, ekkkdddddddddkkk, kekddddddddddkkk, kkeddddddddddkkk, kkkddddddddddekk, kkkddddddddddkek, kkkdddddddddkkke, kkkddydddddddkkk, or kkkdddddddddekkk, wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, each “y” represents a 2′-OMe sugar moiety, each “e” represents a 2′-MOE sugar moiety, and each “k” represents a cEt sugar moiety. [0262] Embodiment 141. The oligomeric compound of any one of embodiments 97-140, wherein the oligomeric compound comprises a conjugate group. [0263] Embodiment 142. The oligomeric compound of embodiment 141, wherein the conjugate group comprises a conjugate moiety and a conjugate linker. [0264] Embodiment 143. The oligomeric compound of embodiment 142, wherein the conjugate moiety is a lipophilic group. [0265] Embodiment 144. The oligomeric compound of embodiment 143, wherein the conjugate moiety is selected from a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl. C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. [0266] Embodiment 145. The oligomeric compound of embodiment 144, wherein the conjugate moiety is a 6-palmitamidohexyl conjugate moiety. [0267] Embodiment 146. The oligomeric compound of any of embodiments 142-145, wherein the conjugate linker consists of a single bond. [0268] Embodiment 147. The oligomeric compound of any of embodiments 142-145, wherein the conjugate linker is cleavable. [0269] Embodiment 148. The oligomeric compound of embodiment 147, wherein the conjugate linker comprises a phosphodiester linkage. [0270] Embodiment 149. The oligomeric compound of any of embodiments 142-148, wherein the conjugate linker comprises 1-3 linker nucleosides. [0271] Embodiment 150. The oligomeric compound of any of embodiments 142-148, wherein the conjugate linker does not comprise any linker nucleosides. [0272] Embodiment 151. The oligomeric compound of any one of embodiments 142-148, wherein the conjugate group has the following structure:

##STR00004## [0273] Embodiment 152. The oligomeric compound of any of embodiments 142-151, wherein the conjugate group is attached to the modified oligonucleotide at the 5′-end of the modified oligonucleotide. [0274] Embodiment 153. The oligomeric compound of any of embodiments 142-151, wherein the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide. [0275] Embodiment 154. The oligomeric compound of any of embodiments 142-153, wherein the conjugate group comprises a cell-targeting moiety. [0276] Embodiment 155. The oligomeric compound of any of embodiments 142-154, comprising a terminal group. [0277] Embodiment 156. An oligomeric compound comprising a modified oligonucleotide and a conjugate group according to the following chemical notation: (6-palmitamidohexyl) Aks Aks Aks Tds Ads .sup.mCds Gds Ads Tds .sup.mCds Tds Tds .sup.mCds Tks Gks Gk (SEQ ID NO:239), wherein: [0278] A=an adenine nucleobase, [0279] .sup.mC=a 5-methyl cytosine nucleobase, [0280] G=a guanine nucleobase, [0281] T=a thymine nucleobase, [0282] k=a cEt sugar moiety, [0283] d=a 2′-β-D-deoxyribosyl sugar moiety, and [0284] s=a phosphorothioate internucleoside linkage. [0285] Embodiment 157. An oligomeric compound according to the following chemical structure:

##STR00005## [0286] Embodiment 158. The oligomeric compound of embodiment 157, which is the sodium salt or the potassium salt. [0287] Embodiment 159. An oligomeric compound according to the following chemical structure:

##STR00006## [0288] Embodiment 160. An oligomeric duplex, comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound of any of embodiments 97-159. [0289] Embodiment 161. The oligomeric duplex of embodiment 160, wherein the second oligomeric compound comprises a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide. [0290] Embodiment 162. An oligomeric duplex comprising: [0291] a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 29 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 322-632; and [0292] a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide. [0293] Embodiment 163. An oligomeric duplex comprising: [0294] a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 29 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 944; and [0295] a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 12 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide. [0296] Embodiment 164. An oligomeric duplex comprising: [0297] a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides and has a nucleobase sequence of consisting of the nucleobase sequence of any of SEQ ID NOs: 322-632; and [0298] a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the second modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any of SEQ ID NOs: 633-943, and wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide. [0299] Embodiment 165. An oligomeric duplex comprising: [0300] a first oligomeric compound comprising a first modified oligonucleotide consisting of 22 linked nucleosides and has a nucleobase sequence of consisting of the nucleobase sequence of SEQ ID NO: 944; and [0301] a second oligomeric compound comprising a second modified oligonucleotide consisting of 20 linked nucleosides, wherein the second modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of SEQ ID NO: 945. [0302] Embodiment 166. The oligomeric duplex of any of embodiments 160-165, wherein the modified oligonucleotide of the first oligomeric compound comprises a 5′-stabilized phosphate group. [0303] Embodiment 167. The oligomeric duplex of embodiment 166, wherein the 5′-stabilized phosphate group comprises a cyclopropyl phosphonate or a vinyl phosphonate. [0304] Embodiment 168. The oligomeric duplex of any of embodiments 160-167, wherein the modified oligonucleotide of the first oligomeric compound comprises a glycol nucleic acid (GNA) sugar surrogate. [0305] Embodiment 169. The oligomeric duplex of any of embodiments 160-168, wherein the modified oligonucleotide of the first oligomeric compound comprises a 2′-NMA sugar moiety. [0306] Embodiment 170. The oligomeric duplex of any of embodiments 160-169, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety. [0307] Embodiment 171. The oligomeric duplex of embodiment 170, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety. [0308] Embodiment 172. The oligomeric duplex of embodiment 171, wherein the bicyclic sugar moiety of the second modified oligonucleotide comprises a 2′-4′ bridge selected from —O—CH.sub.2— and —O—CH(CH.sub.3)—. [0309] Embodiment 173. The oligomeric duplex of embodiment 170, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety. [0310] Embodiment 174. The oligomeric duplex of embodiment 173, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2′-MOE sugar moiety, a 2′-F sugar moiety, or 2′-OMe sugar moiety. [0311] Embodiment 175. The oligomeric duplex of any of embodiments 160-174, wherein at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate. [0312] Embodiment 176. The oligomeric duplex of any of embodiments 160-175, wherein the second modified oligonucleotide comprises at least one modified internucleoside linkage. [0313] Embodiment 177. The oligomeric duplex of embodiment 176, wherein at least one modified internucleoside linkage of the second modified oligonucleotide is a phosphorothioate internucleoside linkage. [0314] Embodiment 178. The oligomeric duplex of any of embodiments 160-177, wherein the second modified oligonucleotide comprises at least one phosphodiester internucleoside linkage. [0315] Embodiment 179. The oligomeric duplex of any of embodiments 160-178, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester or a phosphorothioate internucleoside linkage. [0316] Embodiment 180. The oligomeric duplex of any of embodiments 160-179, wherein the internucleoside linkage motif of the first modified oligonucleotide is ssooooooooooooooooooss and the internucleoside linkage motif of the second modified oligonucleotide is ssooooooooooooooooss, wherein each “o” represents a phosphodiester internucleoside linkage and each “s” represents a phosphorothioate internucleoside linkage. [0317] Embodiment 181. The oligomeric duplex of any of embodiments 160-180, wherein the second modified oligonucleotide comprises at least one modified nucleobase. [0318] Embodiment 182. The oligomeric duplex of embodiment 181, wherein the modified nucleobase of the second modified oligonucleotide is 5-methylcytosine. [0319] Embodiment 183. The oligomeric duplex of any of embodiments 160-182, wherein the second modified oligonucleotide comprises a conjugate group. [0320] Embodiment 184. The oligomeric duplex of embodiment 183, wherein the conjugate group comprises a conjugate linker and a conjugate moiety. [0321] Embodiment 185. The oligomeric duplex of embodiment 183 or 184, wherein the conjugate group is attached to the second modified oligonucleotide at the 5′-end of the second modified oligonucleotide. [0322] Embodiment 186. The oligomeric duplex of embodiment 183 or 184, wherein the conjugate group is attached to the second modified oligonucleotide at the 3′-end of the modified oligonucleotide. [0323] Embodiment 187. The oligomeric duplex of any of embodiments 183-186, wherein the conjugate group comprises a C22 alkyl, C20 alkyl. C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl. C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl. C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. [0324] Embodiment 188. The oligomeric duplex of any of embodiments 183-187, wherein the conjugate moiety is a 6-palmitamidohexyl conjugate moiety. [0325] Embodiment 189. The oligomeric duplex of any of embodiments 183-190, wherein the conjugate group has the following structure:

##STR00007## [0326] Embodiment 190. The oligomeric duplex of any of embodiments 183-192, wherein the conjugate group comprises a cell-targeting moiety. [0327] Embodiment 191. The oligomeric duplex of any of embodiments 160-190, wherein the second modified oligonucleotide comprises a terminal group. [0328] Embodiment 192. The oligomeric duplex of embodiment 191, wherein the terminal group is an abasic sugar moiety. [0329] Embodiment 193. The oligomeric duplex of any of embodiments 160-192, wherein the second modified oligonucleotide consists of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides. [0330] Embodiment 194. The oligomeric duplex of any of embodiments 160-193, wherein the first modified oligonucleotide consists of 23 linked nucleosides and the second modified oligonucleotide consists of 21 linked nucleosides. [0331] Embodiment 195. The oligomeric duplex of embodiments 194, wherein the modified oligonucleotide of the first oligomeric compound has a sugar motif (from 5′ to 3′) of: yfyfyfyfyfyfyfyfyyy and the second modified oligonucleotide has a sugar motif (from 5′ to 3′) of: fyfyfyfyfyfyfyfyfyfyf, wherein each “y” represents a 2′-OMe sugar moiety and each “f” represents a 2′-F sugar moiety. [0332] Embodiment 196. The oligomeric duplex of any of embodiments 160-195, wherein the first modified oligonucleotide is at least 80% complementary to: [0333] an equal length portion of nucleobases 765-1043 of SEQ ID NO: 1 or [0334] an equal length portion of nucleobases 1753-1859 of SEQ ID NO: 1. [0335] Embodiment 197. The oligomeric compound of any of embodiments 160-195, wherein the first modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 contiguous nucleobases of a sequence selected from: [0336] SEQ ID NOs: 555, 558-619, 623, 624; or [0337] SEQ ID NOs: 353-375. [0338] Embodiment 198. An antisense agent comprising an antisense compound, wherein the antisense compound is the oligomeric compound of any of embodiments 94-159. [0339] Embodiment 199. An antisense agent, wherein the antisense agent is the oligomeric duplex of any of embodiments 160-197. [0340] Embodiment 200. The antisense agent of embodiment 198 or 199, wherein the antisense agent is: an RNase H agent capable of reducing the amount of PMP22 nucleic acid through activation of RNase H; or an RNAi agent capable of reducing the amount of PMP22 nucleic acid through activation of RISC/Ago2; [0341] Embodiment 201. A chirally enriched population of oligomeric compounds of any of embodiments 97-159 or oligomeric duplexes of embodiments 160-197, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having a particular stereochemical configuration. [0342] Embodiment 202. The chirally enriched population of embodiment 201 wherein the population is enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage. [0343] Embodiment 203. The chirally enriched population of embodiment 201, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages. [0344] Embodiment 204. The chirally enriched population of embodiment 201, wherein the population is enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configurations, in the 5′ to 3′ direction. [0345] Embodiment 205. A population of oligomeric compounds comprising modified oligonucleotides of any of embodiments 94-159, or a population of oligomeric duplexes comprising modified oligonucleotides of any of embodiments 160-164, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom. [0346] Embodiment 206. A pharmaceutical composition comprising the oligomeric compound of any of embodiments 94-159, the oligomeric duplex of any of embodiments 160-197, the population of any of embodiments 201-205, or the antisense agent of any of embodiments 198-200, and a pharmaceutically acceptable diluent or carrier. [0347] Embodiment 207. The pharmaceutical composition of embodiment 206, wherein the pharmaceutically acceptable diluent is phosphate buffered saline. [0348] Embodiment 208. The pharmaceutical composition of embodiment 207, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and phosphate buffered saline. [0349] Embodiment 209. A method comprising administering to an animal a pharmaceutical composition of any of embodiments 206-208. [0350] Embodiment 210. A method of treating a disease associated with PMP22 comprising administering to an individual having or at risk for developing a disease associated with PMP22 a therapeutically effective amount of a pharmaceutical composition according to any of embodiments 206-208; and thereby treating the disease associated with PMP22. [0351] Embodiment 211. The method of embodiment 210, wherein the PMP22-associated disease is Dejerine-Sottas Syndrome. [0352] Embodiment 212. The method of embodiment 210, wherein the PMP22-associated disease is Charcot-Marie-Tooth disease. [0353] Embodiment 213. The method of embodiment 212, wherein the Charcot-Marie-Tooth disease is CMT1A. [0354] Embodiment 214. The method of embodiment 212, wherein the Charcot-Marie-Tooth disease is CMT1E. [0355] Embodiment 215. The method of any of embodiments 210-214, wherein at least one symptom or hallmark of the PMP22-associated disease is ameliorated. [0356] Embodiment 216. The method of embodiment 215, wherein the symptom or hallmark is demyelination, progressive axonal damage and/or loss, weakness and wasting of foot and lower leg muscles, foot deformities, and weakness and atrophy in the hands.

I. Certain Oligonucleotides

[0357] In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage.

[0358] A. Certain Modified Nucleosides

[0359] Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.

[0360] 1. Certain Sugar Moieties

[0361] In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

[0362] In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2′, 4′, and/or 5′ positions. In certain embodiments one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched. Examples of 2′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2′-F, 2′-OCH.sub.3 (“OMe” or “O-methyl”), and 2′-O(CH.sub.2).sub.2OCH.sub.3 (“MOE” or “O-methoxyethyl”). In certain embodiments, 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF.sub.3, OCF.sub.3, O—C.sub.1-C.sub.10 alkoxy, O—C.sub.1-C.sub.10 substituted alkoxy, O—C.sub.1-C.sub.10 alkyl, O—C.sub.1-C.sub.11 substituted alkyl, S-alkyl, N(R.sub.m)-alkyl, O-alkenyl, S-alkenyl, N(R.sub.m)-alkenyl, O-alkynyl, S-alkynyl, N(R.sub.m)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.20N(R.sub.m)(R.sub.n) or OCH.sub.2C(═O)—N(R.sub.m)(R.sub.n), where each R.sub.m and R.sub.1 is, independently, H, an amino protecting group, or substituted or unsubstituted C.sub.1-C.sub.10 alkyl, and the 2′-substituent groups described in Cook et al., U.S. Pat. No. 6,531,584; Cook et al., U.S. Pat. No. 5,859,221; and Cook et al., U.S. Pat. No. 6,005,087. Certain embodiments of these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5-methyl (R or S), 5′-vinyl, and 5′-methoxy. In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836.

[0363] In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, NH.sub.2, N.sub.3, OCF.sub.3, OCH.sub.3, O(CH.sub.2).sub.3NH.sub.2, CH.sub.2CH═CH.sub.2, OCH.sub.2CH═CH.sub.2, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.20N(R.sub.m)(R.sub.n), O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and N-substituted acetamide (OCH.sub.2C(═O)—N(R.sub.m)(R˜)), where each R.sub.m and R.sub.n is, independently, H, an amino protecting group, or substituted or unsubstituted C.sub.1-C.sub.10 alkyl.

[0364] In certain embodiments, a 2′-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCF.sub.3, OCH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.20N(CH.sub.3).sub.2, O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and OCH.sub.2C(═O)—N(H)CH.sub.3 (“NMA”).

[0365] In certain embodiments, a 2′-substituted nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCH.sub.3, and OCH.sub.2CH.sub.2OCH.sub.3.

[0366] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration. For example, a 2′-deoxyfuranosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described in, e.g., WO 2019/157531, incorporated by reference herein. A 2′-modified sugar moiety has an additional stereocenter at the 2′-position relative to a 2′-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations. 2′-modified sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified.

[0367] Certain modifed sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms. Examples of such 4′ to 2′ bridging sugar substituents include but are not limited to: 4′-CH.sub.2-2′, 4′—(CH.sub.2).sub.2-2′, 4′—(CH.sub.2).sub.3-2′, 4′-CH.sub.2—O-2′ (“LNA”), 4′-CH.sub.2—S-2′, 4′—(CH.sub.2).sub.2—O-2′ (“ENA”), 4′-CH(CH.sub.3)—O-2′ (referred to as “constrained ethyl” or “cEt”), 4′-CH.sub.2—O—CH.sub.2-2′, 4′-CH.sub.2—N(R)-2′, 4′—CH(CH.sub.2OCH.sub.3)—O-2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 7,399,845, Bhat et al., U.S. Pat. No. 7,569,686, Swayze et al., U.S. Pat. No. 7,741,457, and Swayze et al., U.S. Pat. No. 8,022,193), 4′-C(CH.sub.3)(CH.sub.3)—O-2′ and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283), 4′-CH.sub.2—N(OCH.sub.3)-2′ and analogs thereof (see, e.g., Prakash et al., U.S. Pat. No. 8,278,425), 4′-CH.sub.2—O—N(CH.sub.3)-2′ (see, e.g., Allerson et al., U.S. Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745), 4′-CH.sub.2—C(H)(CH.sub.3)-2 ′ (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4′-CH.sub.2—C(═CH.sub.2)-2′ and analogs thereof (see e.g., Seth et al., U.S. Pat. No. 8,278,426), 4′-C(R.sub.aR.sub.b)—N(R)—O-2′, 4′—C(R.sub.aR.sub.b)—O—N(R)-2′, 4′-CH.sub.2—O—N(R)-2′, and 4′-CH.sub.2—N(R)—O-2′, wherein each R, R.sub.a, and R.sub.b is, independently, H, a protecting group, or C.sub.1-C.sub.12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672).

[0368] In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(R.sub.a)(R.sub.b)].sub.n—, —[C(R.sub.a)(R.sub.b)].sub.n—O—, —C(R.sub.a)═C(R.sub.b)—, —C(R.sub.a)═N—, —C(═NR.sub.a)—, —C(═O)—, —C(═S)—, —O—, —Si(R.sub.a).sub.2—S(═O).sub.x—, and —N(R.sub.a)—; [0369] wherein: [0370] x is 0, 1, or 2; [0371] n is 1,2,3, or 4; [0372] each R.sub.a and R.sub.b is, independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C.sub.5—C, alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O).sub.2-J.sub.1), or sulfoxyl (S(═O)-J.sub.1); and [0373] each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.

[0374] Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Wengel et al., U.S. Pat. No. 7,053,207; Imanishi et al., U.S. Pat. No. 6,268,490; Imanishi et al. U.S. Pat. No. 6,770,748; Imanishi et al., U.S. RE44,779; Wengel et al., U.S. Pat. No. 6,794,499; Wengel et al., U.S. Pat. No. 6,670,461; Wengel et al., U.S. Pat. No. 7,034,133; Wengel et al., U.S. Pat. No. 8,080,644; Wengel et al., U.S. Pat. No. 8,034,909; Wengel et al., U.S. Pat. No. 8,153,365; Wengel et al., U.S. Pat. No. 7,572,582; Ramasamy et al., U.S. Pat. No. 6,525,191: Torsten et al., WO 2004/106356; Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. Pat. No. 7,547,684; Seth et al., U.S. Pat. No. 7,666,854; Seth et al., U.S. Pat. No. 8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth et al., U.S. Pat. No. 8,030,467; Seth et al., U.S. Pat. No. 8,268,980; Seth et al., U.S. Pat. No. 8,546,556; Seth et al., U.S. Pat. No. 8,530,640; Migawa et al., U.S. Pat. No. 9,012,421; Seth et al., U.S. Pat. No. 8,501,805; and U.S. Patent Publication Nos. Allerson et al., US2008/0039618 and Migawa et al., US2015/0191727.

[0375] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the R-D configuration.

##STR00008## [0376] α-L-methyleneoxy (4′-CH.sub.2—O-2′) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified.

[0377] In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).

[0378] In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2′-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5′ position.

[0379] In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:

##STR00009##

(“F-HNA”, see e.g. Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; Swayze et al., U.S. Pat. No. 8,796,437; and Swayze et al., U.S. Pat. No. 9,005,906; F-HNA can also be referred to as a F-THP or 3′-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:

##STR00010##

wherein, independently, for each of the modified THP nucleosides: [0380] Bx is a nucleobase moiety; [0381] T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′-terminal group;
q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each, independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted C.sub.2-C.sub.6 alkynyl; and [0382] each of R.sub.1 and R.sub.2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(═X)J.sub.1, OC(═X)NJ.sub.1J.sub.2, NJ.sub.3C(═X)NJ.sub.1J.sub.2, and CN, wherein X is O, S or NJ.sub.1, and each J.sub.1, J.sub.2, and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.

[0383] In certain embodiments, modified THP nucleosides are provided wherein q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R.sub.1 and R.sub.2 is F. In certain embodiments, R.sub.1 is F and R.sub.2 is H, in certain embodiments, R.sub.1 is methoxy and R.sub.2 is H, and in certain embodiments, R.sub.1 is methoxyethoxy and R.sub.2 is H.

[0384] In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:

##STR00011##

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modifed morpholinos.”

[0385] In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.

[0386] Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.

[0387] 2. Certain Modified Nucleobases

[0388] In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.

[0389] In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C≡C—CH.sub.3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil). 4-thioumcil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzovlcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443.

[0390] Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manoharan et al., US2003/0158403; Manoharan et al., US2003/0175906; Dinh et al., U.S. Pat. No. 4,845,205; Spielvogel et al., U.S. Pat. No. 5,130,302; Rogers et al., U.S. Pat. No. 5,134,066; Bischofberger et al., U.S. Pat. No. 5,175,273; Urdea et al., U.S. Pat. No. 5,367,066; Benner et al., U.S. Pat. No. 5,432,272; Matteucci et al., U.S. Pat. No. 5,434,257; Gmeiner et al., U.S. Pat. No. 5,457,187; Cook et al., U.S. Pat. No. 5,459,255; Froehler et al., U.S. Pat. No. 5,484,908; Matteucci et al., U.S. Pat. No. 5,502,177; Hawkins et al., U.S. Pat. No. 5,525,711; Haralambidis et al., U.S. Pat. No. 5,552,540; Cook et al., U.S. Pat. No. 5,587,469; Froehler et al., U.S. Pat. No. 5,594,121; Switzer et al., U.S. Pat. No. 5,596,091; Cook et al., U.S. Pat. No. 5,614,617; Froehler et al., U.S. Pat. No. 5,645,985; Cook et al., U.S. Pat. No. 5,681,941; Cook et al., U.S. Pat. No. 5,811,534; Cook et al., U.S. Pat. No. 5,750,692; Cook et al., U.S. Pat. No. 5,948,903; Cook et al., U.S. Pat. No. 5,587,470; Cook et al., U.S. Pat. No. 5,457,191; Matteucci et al., U.S. Pat. No. 5,763,588; Froehler et al., U.S. Pat. No. 5,830,653; Cook et al., U.S. Pat. No. 5,808,027; Cook et al., 6,166,199; and Matteucci et al., U.S. Pat. No. 6,005,096.

[0391] 3. Certain Modified Internucleoside Linkages

[0392] In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any intemucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphodiesters, which contain a phosphodiester bond (“P(O.sub.2)═O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P(O.sub.2)═S”), and phosphorodithioates (“HS—P═S”). Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (—CH.sub.2—N(CH.sub.3)—O—CH.sub.2—), thiodiester, thionocarbamate (—O—C(═O)(NH)—S—); siloxane (—O—SiH.sub.2—O—); and N,N′-dimethylhydrazine (—CH.sub.2—N(CH.sub.3)—N(CH.sub.3)—). Modified internucleoside linkages, compared to naturally occurring phosphodiester internucleoside linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.

[0393] Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkage in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, apopulation of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

##STR00012##

Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

[0394] Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH.sub.2—N(CH.sub.3)—O-5′), amide-3 (3′-CH.sub.2—C(═O)—N(H)-5′), amide-4 (3′-CH.sub.2—N(H)—C(═O)-5′), formacetal (3′-O—CH.sub.2—O-5′), methoxypropyl (MOP), and thioformacetal (3′-S—CH.sub.2—O-5′). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH.sub.2 component parts.

[0395] B. Certain Motifs

[0396] In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).

[0397] 1. Certain Sugar Motifs

[0398] In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or portion thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.

[0399] In certain embodiments, modified oligonucleotides have a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.” The three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3′-most nucleoside of the 5′-wing and the 5′-most nucleoside of the 3′-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5′-wing differs from the sugar motif of the 3′-wing (asymmetric gapmer).

[0400] In certain embodiments, the wings of a gapmer comprise 1-6 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least four nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least five nucleosides of each wing of a gapmer comprises a modified sugar moiety.

[0401] In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer comprises a 2′-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of the gap of a gapmer comprises a 2′-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a 2′-OMe sugar moiety.

[0402] In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, the nucleosides on the gap side of each wing/gap junction comprise 2′-deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing/gap junction comprise modified sugar moieties. In certain embodiments, each nucleoside of the gap comprises a 2′-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, one nucleoside of the gap comprises a modified sugar moiety and each remaining nucleoside of the gap comprises a 2′-deoxyribosyl sugar moiety.

[0403] In certain embodiments, modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif, wherein each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises the same 2′-modification.

[0404] Herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5′-wing]-[# of nucleosides in the gap]-[# of nucleosides in the 3′-wing]. Thus, a 5-10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprises a 2′-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2′-MOE nucleosides in the 5′-wing, 10 linked a 2′-β-D-deoxynucleosides in the gap, and 5 linked 2′-MOE nucleosides in the 3′-wing. A 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5′-wing, 10 linked 2′-β-D-deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3′-wing. A 5-8-5 gapmer consists of 5 linked nucleosides comprising a modified sugar moiety in the 5′-wing, 8 linked a 2′-β-D-deoxynucleosides in the gap, and 5 linked nucleosides comprising a modified sugar moiety in the 3′-wing. A 5-8-5 or 5-8-4 mixed wing gapmer has at least two different modified sugar moieties in the 5′- and/or the 3′-wing.

[0405] In certain embodiments, modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 BNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 LNA gapmers.

[0406] In certain embodiments, modified oligonucleotides have a sugar motif selected from the following (5′ to 3′): ekkddddddddddkke, ekkddddddddddkkk, ekkddddddddddkkk, ekkkdddddddddkkk, kekddddddddddkkk, kkeddddddddddkkk, kkeddddddddddkkk, kkkddddddddddekk, kkkddddddddddkek, kkkdddddddddkkke, or kkkddydddddddkkk, wherein ‘d’ represents a 2′-deoxyribosyl sugar moiety, ‘e’ represents a 2′-MOE sugar moiety, ‘k’ represents a cEt sugar moiety, and ‘y’ represents a 2′-OMe sugar moiety.

[0407] 2. Certain Nucleobase Motifs

[0408] In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or portion thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines. In certain embodiments, all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0409] In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3′-end of the oligonucleotide. In certain embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5′-end of the oligonucleotide.

[0410] In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2′-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.

[0411] 3. Certain Internucleoside Linkage Motifs

[0412] In certain embodiments, oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or portion thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P(O.sub.2)═O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P(O.sub.2)═S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, all of the internucleoside linkages are either phosphodiester internucleoside linkages or phosphorothioate internucleoside linkages, and the chiral motif is (5′ to 3′): Sp-o-o-o-Sp-Sp-Sp-Rp-Sp-Sp-Rp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp or Sp-o-o-o-Sp-Sp-Sp-Rp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp-Sp, wherein each ‘Sp’ represents a (Sp) phosphorothioate internucleoside linkage, each ‘Rp’ is a Rp internucleoside linkage, and each ‘o’ represents a phosphodiester intemucleoside linkage. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs.

[0413] In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of sooosssssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5′ to 3′): sooooossssssssssoss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5′ to 3′): sssosssssssssssosss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an intemucleoside linkage motif of (5′ to 3′): sssosssssssssoss, wherein each “s” represents a phosphorothioate internucleoside linkage and each “o” represents a phosphodiester internucleoside linkage.

[0414] C. Certain Lengths

[0415] It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target nucleic acid in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target nucleic acid, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.

[0416] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

[0417] D. Certain Modified Oligonucleotides

[0418] In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif. Likewise, such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.

[0419] E. Certain Populations of Modified Olionucleotides

[0420] Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for β-D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for both β-D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration.

[0421] F. Nucleobase Sequence

[0422] In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain such embodiments, a portion of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a portion or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.

[0423] II. Certain Oligomeric Compounds

[0424] In certain embodiments, provided herein are oligomeric compounds, which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3′ and/or 5′-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3′-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5′-end of oligonucleotides.

[0425] Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

[0426] A. Certain Conjugate Groups

[0427] In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N. Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).

[0428] In certain embodiments, the present disclosure provides oligomeric compounds comprising a modified oligonucleotide and a conjugate group, wherein the conjugate group enhances delivery of the modified oligonucleotide.

[0429] In certain embodiments, conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl. C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0430] In certain embodiments, conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.

[0431] In some embodiments, the conjugate group comprises a 6-palmitamidohexyl conjugate moiety and a conjugate linker. In some embodiments, the conjugate group comprises a 6-palmitamidohexyl conjugate moiety having the following structure:

##STR00013##

and a phosphodiester conjugate linker. In some embodiments, the conjugate comprises a 6-palmitamidohexyl conjugate moiety and a phosphodiester conjugate linker, wherein the 6-palmitamidohexyl conjugate moiety is attached to the 5′-OH of the modified oligonucleotide via the phosphodiester conjugate linker.

[0432] In some embodiments, the conjugate group comprises the following structure:

##STR00014##

In some embodiments, the conjugate group is attached to the modified oligonucleotide at the 5′-end of the modified oligonucleotide. In some embodiments, the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide. In some embodiments, the conjugate group is a 6-palmitamidohexyl phosphate conjugate group attached to the 5′-OH of the modified oligonucleotide.

[0433] 1. Conjugate Moieties

[0434] Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0435] In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. In certain embodiments, conjugate moieties impart a new property on the attached oligonucleotide, which may alter the oligonucleotides distribution or pharmacokinetic profile. For example, certain conjugate moieties selected from among lipids, vitamins, steroids, C.sub.5-C.sub.30 saturated alkyl groups, C.sub.5-C.sub.30 unsaturated alkyl groups, fatty acids, or lipophilic groups may increase the distribution of an oligonucleotide to various tissues or organs within a subject. In certain embodiments, certain conjugate moieties selected from among lipids, vitamins, steroids, C.sub.5-C.sub.30 saturated alkyl groups, C.sub.5-C.sub.30 unsaturated alkyl groups, fatty acids, or lipophilic groups increase affinity for an oligonucleotide with one or more serum proteins, such as albumin. In certain embodiments, certain conjugate moieties selected from among lipids, vitamins, steroids, C.sub.5-C.sub.30 saturated alkyl groups, C.sub.5-C.sub.30 unsaturated alkyl groups, fatty acids, or lipophilic groups increase affinity for an oligonucleotide to an extra-hepatic tissue. In some embodiments, the conjugate moiety is a 6-palmitamidohexyl conjugate moiety having the following structure:

##STR00015##

[0436] 2. Conjugate Linkers

[0437] Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.

[0438] In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

[0439] In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0440] Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C.sub.1-C.sub.10 alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl or substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0441] In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

[0442] Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.

[0443] In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

[0444] In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate or phosphodiester linkage between an oligonucleotide and a conjugate moiety or conjugate group.

[0445] In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2′-deoxynucleoside that is attached to either the 3′ or 5′-terminal nucleoside of an oligonucleotide by a phosphodiester internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2′-deoxyadenosine.

[0446] 3. Cell-Targeting Moieties

[0447] In certain embodiments, a conjugate group comprises a cell-targeting moiety. In certain embodiments, a conjugate group has the general formula:

##STR00016## [0448] wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.

[0449] In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.

[0450] In certain embodiments, conjugate groups comprise cell-targeting moieties that have at least one tethered ligand. In certain embodiments, cell-targeting moieties comprise two tethered ligands covalently attached to a branching group. In certain embodiments, cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.

[0451] B. Certain Terminal Groups

[0452] In certain embodiments, oligomeric compounds comprise one or more terminal groups. In certain such embodiments, oligomeric compounds comprise a stabilized 5′-phosphate. Stabilized 5′-phosphates include, but are not limited to 5′-phosphonates, including, but not limited to 5′-vinylphosphonates. In certain embodiments, terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides. In certain embodiments, terminal groups comprise one or more 2′-linked nucleosides. In certain such embodiments, the 2′-linked nucleoside is an abasic nucleoside.

III. Oligomeric Duplexes

[0453] In certain embodiments, oligomeric compounds described herein comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid. In certain embodiments, an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex. Such oligomeric duplexes comprise a first oligomeric compound having a portion complementary to a target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group. The oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.

[0454] In certain embodiments, an oligomeric duplex comprises:

a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 29 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 322-632; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide. In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0455] In certain embodiments, an oligomeric duplex comprises:

a first oligomeric compound comprising a first modified oligonucleotide consisting of 19 to 29 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 322-632; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 633-943, wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

[0456] In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0457] In certain embodiments, an oligomeric duplex comprises:

a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 322-632; and
a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides wherein the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 633-943, wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to an equal length portion of the first modified oligonucleotide.
In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.

[0458] In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a modified sugar moiety. Examples of suitable modified sugar moieties include, but are not limited to, a bicyclic sugar moiety, such as a 2′-4′ bridge selected from —O—CH.sub.2—; and —O—CH(CH.sub.3)—, and a non-bicyclic sugar moiety, such as a 2′-MOE sugar moiety, a 2′-F sugar moiety, a 2′-OMe sugar moiety, or a 2′-NMA sugar moiety. In certain embodiments, at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and/or the second modified oligonucleotide comprises a modified sugar moiety selected from 2′-F and 2′-OMe.

[0459] In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a sugar surrogate. Examples of suitable sugar surrogates include, but are not limited to, morpholino, peptide nucleic acid (PNA), glycol nucleic acid (GNA), and unlocked nucleic acid (UNA). In certain embodiments, at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate, which can be a GNA.

[0460] In any of the oligomeric duplexes described herein, at least one internucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a modified internucleoside linkage. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage. In certain embodiments, at least one of the first, second, or third internucleoside linkages from the 5′ end and/or the 3′ end of the first modified oligonucleotide comprises a phosphorothioate linkage. In certain embodiments, at least one of the first, second, or third internucleoside linkages from the 5′ end and/or the 3′ end of the second modified oligonucleotide comprises a phosphorothioate linkage.

[0461] In any of the oligomeric duplexes described herein, at least one internucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can comprise a phosphodiester internucleoside linkage. In any of the oligomeric duplexes described herein, each internucleoside linkage of the first modified oligonucleotide and/or the second modified oligonucleotide can be independently selected from a phosphodiester or a phosphorothioate internucleoside linkage.

[0462] In any of the oligomeric duplexes described herein, the internucleoside linkage motif of the second modified oligonucleotide can be ssooooooooooooooooss or, wherein each “o” represents a phosphodiester internucleoside linkage and each “s” represents a phosphorothioate internucleoside linkage.

In any of the oligomeric duplexes described herein, at least one nucleobase of the first modified oligonucleotide and/or the second modified oligonucleotide can be modified nucleobase. In certain embodiments, the modified nucleobase is 5-methylcytosine.

[0463] In any of the oligomeric duplexes described herein, the first modified oligonucleotide can comprise a stabilized phosphate group attached to the 5′ position of the 5′-most nucleoside. In certain embodiments, the stabilized phosphate group comprises a cyclopropyl phosphonate or an (E)-vinyl phosphonate.

In any of the oligomeric duplexes described herein, the first modified oligonucleotide can comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 5′-end of the first modified oligonucleotide. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 3′-end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetyl galactosamine. In certain embodiments, the conjugate group comprises a cell-targeting moiety having an affinity for transferrin receptor (TfR), also known as TfR1 and CD71. In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. In certain embodiments, conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.

[0464] In any of the oligomeric duplexes described herein, the second modified oligonucleotide can comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 5′-end of the second modified oligonucleotide. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 3′-end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetyl galactosamine. In certain embodiments, the conjugate group comprises a cell-targeting moiety having an affinity for transferrin receptor (TfR), also known as TfR1 and CD71. In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. In certain embodiments, conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.

[0465] In certain embodiments, an antisense agent comprises an antisense compound, which comprises an oligomeric compound or an oligomeric duplex described herein. In certain embodiments, an antisense agent, which can comprise an oligomeric compound or an oligomeric duplex described herein, is an RNAi agent capable of reducing the amount of PMP22 nucleic acid through the activation of RISC/Ago2.

[0466] Certain embodiments provide an oligomeric agent comprising two or more oligomeric duplexes. In certain embodiments, an oligomeric agent comprises two or more of any of the oligomeric duplexes described herein. In certain embodiments, an oligomeric agent comprises two or more of the same oligomeric duplex, which can be any of the oligomeric duplexes described herein. In certain embodiments, the two or more oligomeric duplexes are linked together. In certain embodiments, the two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of two or more oligomeric duplexes are covalently linked together at their 3′ ends. In certain embodiments, the two or more oligomeric duplexes are covalently linked together by a glycol linker, such as a tetraethylene glycol linker.

IV. Antisense Activity

[0467] In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when they reduce the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.

[0468] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.

[0469] In certain antisense activities, an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid by Argonaute. Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).

[0470] In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.

[0471] Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or subject.

V. Certain Target Nucleic Acids

[0472] In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a portion that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target nucleic acid is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron.

[0473] A. Complementarity/Mismatches to the Target Nucleic Acid

[0474] It is possible to introduce mismatch bases without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, and 28 and 42 nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides.

[0475] In certain embodiments, oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a portion that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the portion of full complementarity is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleobases in length.

[0476] In certain embodiments, oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain embodiments selectivity of the oligonucleotide is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 from the 5′-end of the gap region. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, or 6 from the 5′-end of the 5′ wing region or the 3′ wing region.

[0477] B. PMP22

[0478] In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is PMP22. In certain embodiments, PMP22 nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NM_000304.3), SEQ ID NO: 2 (GENBANK Accession No. NC_000017.11 truncated from nucleotides 15227001 to 15268000), SEQ ID NO: 3 (GENBANK Accession No. NM_153321.2), SEQ ID NO: 4 (GENBANK Accession No. NM_001281455.1), SEQ ID NO: 5 (GENBANK Accession No. NM_001281456.1), SEQ ID NO: 6 (GENBANK Accession No. NR_104017.1), SEQ ID NO:7 (GENBANK Accession No. NR_104018.1), or SEQ ID NO: 8 (GENBANK Accession No. AK300690.1).

[0479] In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1. SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6. SEQ ID NO: 7, or SEQ ID NO: 8 reduces the amount of PMP22 RNA, and in certain embodiments reduces the amount of PMP22 protein. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8 results in reduced demyelination and/or reduced axonal damage and/or loss. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide and a conjugate group.

[0480] C. Certain Target Nucleic Acids in Certain Tissues

[0481] In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissues are the cells and tissues that comprise the peripheral nervous system. Such tissues include the sciatic, tibial, peroneal, sural, radial, median, and ulnar nerves.

VI. Certain Pharmaceutical Compositions

[0482] In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0483] In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0484] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compound and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.

[0485] In certain embodiments, oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0486] In certain embodiments, pharmaceutical compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide, upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.

[0487] Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid, such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.

[0488] In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.

[0489] In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents comprising an oligomeric compound provided herein to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.

[0490] In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80™ and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.

[0491] In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intraneural, perineural, etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0492] Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or salt thereof” expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with a cation. In certain instances, one or more specific cation is identified.

[0493] In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HCl to achieve a desired pH.

[0494] Herein, certain specific doses are described. A dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of a modified oligonucleotide or an oligomeric compound in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As described above, in aqueous solution, the free acid is in equilibrium with anionic and salt forms. However, for the purpose of calculating dose, it is assumed that the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid. For example, where a modified oligonucleotide or an oligomeric compound is in solution comprising sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or fully de-protonated and in association with Na+ ions. However, the mass of the protons are nevertheless counted toward the weight of the dose, and the mass of the Na+ ions are not counted toward the weight of the dose. Thus, for example, a dose, or dosage unit, of 10 mg of Compound No. 1089870 equals the number of fully protonated molecules that weighs 10 mg. This would be equivalent to 10.57 mg of solvent-free, sodium-acetate free, anhydrous sodiated Compound No. 1089870. When an oligomeric compound comprises a conjugate group, the mass of the conjugate group is included in calculating the dose of such oligomeric compound. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose.

VII. Certain Compositions

[0495] 1. Compound No. 1089870

[0496] In certain embodiments, Compound No. 1089870 is characterized as an oligomeric compound consisting of a conjugate group and a modified oligonucleotide, wherein the conjugate group is a 6-palmitamidohexyl phosphate conjugate group attached to the 5′-OH of the modified oligonucleotide, wherein the 6-palmitamidohexyl phosphate conjugate group is represented by the following structure:

##STR00017##

and the modified oligonucleotide is a 3-10-3 cEt gapmer, having a sequence of (from 5′ to 3′) of AAATACGATCTTCTGG (SEQ ID NO: 239); wherein each of nucleosides 1-3 and 14-16 (from 5′ to 3′) comprise a cEt sugar moiety, and each of nucleosides 4-13 are 2′-β-D-deoxynucleosides; wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage; and wherein each cytosine is a 5-methyl cytosine.

[0497] In certain embodiments, Compound No. 1089870 is represented by the following chemical notation: (6-palmitamidohexyl)o Aks Aks Aks Tds Ads .sup.mCds Gds Ads Tds .sup.mCds Tds Tds .sup.mCds Tks Gks Gk (SEQ ID NO: 239), wherein: [0498] A=an adenine nucleobase, [0499] .sup.mC=a 5-methyl cytosine nucleobase, [0500] G=a guanine nucleobase, [0501] T=a thymine nucleobase, [0502] k=a cEt sugar moiety, [0503] d=a 2′-β-D-deoxyribosyl sugar moiety, [0504] o=a phosphodiester linkage, and [0505] s=a phosphorothioate intemucleoside linkage.

[0506] In certain embodiments, Compound No. 1089870 is represented by the following chemical structure:

##STR00018##

[0507] Structure 1. Compound No. 1089870

[0508] In certain embodiments, the sodium salt of Compound No. 1089870 is represented by the following chemical structure:

##STR00019##

[0509] Structure 2. The Sodium Salt of Compounds No. 1089870

VIII. Certain Hotspot Regions

[0510] In certain embodiments, nucleobases in the ranges specified below comprise a hotspot region of PMP22 nucleic acid. In certain embodiments, oligomeric duplexes comprising modified oligonucleotides that are complementary within a hotspot region of PMP22 nucleic acid achieve an average of more than 60% reduction of PMP22 RNA in vitro in the standard cell assay. In certain embodiments, such oligomeric duplexes are RNAi agents.

[0511] 1. Nucleobases 765-1043 of SEO ID NO: 1

[0512] In certain embodiments, nucleobases 765-1043 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric duplexes comprise modified oligonucleotides that are complementary within nucleobases 765-1043 of SEQ ID NO: 1. In certain embodiments, oligomeric duplexes comprise a first oligomeric compound comprising a first modified oligonucleotide and a second oligomeric compound comprising a second modified oligonucleotide.

[0513] In certain embodiments, the first oligomeric compound comprises a first modified oligonucleotide that is 23 nucleobases in length. In certain embodiments, the second oligomeric compound comprises a second modified oligonucleotide that is 21 nucleobases in length. In certain embodiments, the second modified oligonucleotide is 100% complementary over its length to the first modified oligonucleotide.

[0514] The nucleobase sequences of SEQ ID Nos: 353-375 are complementary within nucleobases 765-1043 of SEQ ID NO: 1.

[0515] The nucleobase sequence of Compound Nos.: 1579683-1579687, 1579700-1579706, 1579720-1579723, 1579736-1579741 are complementary within nucleobases 765-1043 of SEQ ID NO: 1.

[0516] In certain embodiments, oligomeric duplexes comprising modified oligonucleotides complementary within nucleobases 765-1043 of SEQ ID NO: 1 achieve at least 37% reduction of PMP22 RNA in vitro in the standard cell assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 765-1043 of SEQ ID NO: 1 achieve an average of 70% reduction of PMP22 RNA in vitro in the standard cell assay.

[0517] 2. Nucleobases 1753-1859 of SEO ID NO: 1

[0518] In certain embodiments, nucleobases 1753-1859 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, oligomeric duplexes comprise modified oligonucleotides that are complementary within nucleobases 1753-1859 of SEQ ID NO: 1. In certain embodiments, oligomeric duplexes comprise a first oligomeric compound comprising a first modified oligonucleotide and a second oligomeric compound comprising a second modified oligonucleotide.

[0519] In certain embodiments, the first oligomeric compound comprises a first modified oligonucleotide that is 23 nucleobases in length. In certain embodiments, the second oligomeric compound comprises a second modified oligonucleotide that is 21 nucleobases in length. In certain embodiments, the second modified oligonucleotide is 100% complementary over its length to the first modified oligonucleotide.

[0520] The nucleobase sequences of SEQ ID Nos: 1555, 558-619, 623, 624 are complementary within nucleobases 1753-1859 of SEQ ID NO: 1.

[0521] The nucleobase sequence of Compound Nos.: 1580287, 1580290, 1580303-1580308, 1580321-1580326, 1580339-1580344,1580357-1580362, 1580375-1580380,1580393-1580398, 1580411-1580416,1580429-1580434, 1580447-1580452, 1580465-1580470, 1580483, 1580487, 1580488 are complementary within nucleobases 1753-1859 of SEQ ID NO: 1.

[0522] In certain embodiments, oligomeric duplexes comprising modified oligonucleotides complementary within nucleobases 1753-1859 of SEQ ID NO: 1 achieve at least 37% reduction of PMP22 RNA in vitro in the standard cell assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 1753-1859 of SEQ ID NO: 1 achieve an average of 64% reduction of PMP22 RNA in vitro in the standard cell assay.

IX. Certain Comparator Compositions

[0523] In certain embodiments, Compound No. 684267, a 3-10-3 cEt gapmer having a sequence (from 5′ to 3′) of ATCTTCAATCAACAGC (SEQ ID NO: 18), wherein each internucleoside linkage is a phosphorothioate intemucleoside linkage, each cytosine is a 5-methyl cytosine, and wherein each of nucleosides 1-3 and 14-16 comprise a cEt modified sugar, which was previously described in WO2017156242, incorporated herein by reference, is a comparator compound.

[0524] In certain embodiments, Compound No. 684394, a 3-10-3 cEt gapmer having a sequence (from 5′ to 3′) of ATTATTCAGGTCTCCA (SEQ ID NO: 19), wherein each internucleoside linkage is a phosphorothioate internucleoside linkage, each cytosine is a 5-methyl cytosine, and wherein each of nucleosides 1-3 and 14-16 comprise a cEt modified sugar, which was previously described in WO2017156242, incorporated herein by reference, is a comparator compound.

[0525] As demonstrated in Example 2, Compound No. 684394 is more efficacious in vivo in transgenic mice than Compound No. 684267. For example, as provided in Table 4 Compound No. 684394 achieved an expression level of 29% control in a multi-dose study (three weekly doses of 50 mg/kg) in C.sub.22 transgenic mice, while Compound No. 684267 achieved an expression level of 64% control in a multi-dose study in C.sub.22 transgenic mice. Therefore, Compound No. 684394 is an appropriate comparator compound for in vivo efficacy in C.sub.22 transgenic mice.

[0526] In certain embodiments, compounds described herein are superior relative to Compound No. 684394, because they demonstrate one or more improved properties, such as in vivo efficacy.

Nonlimiting Disclosure and Incorporation by Reference

[0527] Each of the literature and patent publications listed herein is incorporated by reference in its entirety.

[0528] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.

[0529] Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2′-OH in place of one 2′-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of an uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “ATmCGAUCG,” wherein .sup.mC indicates a cytosine base comprising a methyl group at the 5-position.

[0530] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as α or β such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise. Likewise, tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.

[0531] The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the .sup.1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: .sup.2H or .sup.3H in place of .sup.1H, .sup.13C or .sup.14C in place of .sup.12C, .sup.15N in place of .sup.14N, .sup.17O or .sup.18O in place of .sup.16O, and .sup.33S, .sup.34S, .sup.35S, or .sup.36S in place of .sup.32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.

[0532] Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphodiester linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or a salt thereof” expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with a cation. In certain instances, one or more specific cation is identified.

[0533] In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HCl to achieve a desired pH.

[0534] Herein, certain specific doses are described. A dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of a modified oligonucleotide or an oligomeric compound in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As described above, in aqueous solution, the free acid is in equilibrium with anionic and salt forms. However, for the purpose of calculating dose, it is assumed that the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid. For example, where a modified oligonucleotide or an oligomeric compound is in solution comprising sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or fully de-protonated and in association with Na+ ions. However, the mass of the protons are nevertheless counted toward the weight of the dose, and the mass of the Na+ ions are not counted toward the weight of the dose. Thus, for example, a dose, or dosage unit, of 10 mg of Compound No. 1089870, equals the number of fully protonated molecules that weighs 10 mg. This would be equivalent to 10.57 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1089870. When an oligomeric compound comprises a conjugate group, the mass of the conjugate group is included in calculating the dose of such oligomeric compound. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose.

EXAMPLES

[0535] The following examples illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.

Example 1: Design of Modified Oligonucleotides Complementary to a Human PMP22 Nucleic Acid

[0536] Modified oligonucleotides complementary to a human PMP22 nucleic acid were designed, as described in the tables below.

[0537] The modified oligonucleotides in Table 1 are 3-10-3 cEt gapmers conjugated to a 6-palmitamidohexyl phosphate conjugate group attached to the 5′-OH of the oligonucleotide. The structure for the conjugate group is:

##STR00020##

The gapmers are 16 nucleosides in length, wherein the central gap segment consists of ten 2′-β-D-deoxynucleosides and the 5′ and 3′ wings each consists of three cEt nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety; and ‘k’ represents a cEt sugar moiety. Each internucleoside linkages is a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.

[0538] “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the Tables below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NM_000304.3), or SEQ ID NO: 2 (GENBANK Accession No. NC_000017.11 truncated from nucleotides 15227001 to 15268000). ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

TABLE-US-00001 TABLE 1 6-Palmitamidohexyl conjugated 3-10-3 cEt gapmers with PS internucleoside linkages complementary to human PMP22 SEQ SEQ SEQ SEQ ID ID ID ID NO: NO: NO: NO: Com- 1 1 2 2 SEQ pound Start Stop Start Stop Sequence ID ID Site Site Site Site (5′ to 3′) NO  884288  864  879 37227 37242 ATCTTCAATCAACAGC  18 1054937 1489 1504 37852 37867 ATTATTCAGGTCTCCA  19  938327  230  245  7265  7280 GGAGCATTCTGGCGGC  20  938329  254  269  7289  7304 GGACGATGATACTCAG  21  938330  257  272  7292  7307 GGAGGACGATGATACT  22  938333 1012 1027 37375 37390 GGATTATACTGTTAGG  23  938336 N/A N/A  4156  4171 CCGTTATATGCCAAGC  24  938337 N/A N/A  4169  4184 GCATTTACAGTGCCCG  25  938340 N/A N/A 11265 11280 AGTTAAATGGTTCGCA  26  938341 N/A N/A 12664 12679 TGTAAATAGGTGTAGG  27  938348 N/A N/A 31457 31472 GTAGATTTCACATCCC  28  955917 N/A N/A  3978  3993 AGGAAATAGTAATGCC  29  955918 N/A N/A 19600 19615 GTCAAGGTATTCCAGC  30  955919 N/A N/A 28928 28943 GCACATCAGGGCCATT  31  955920 N/A N/A 30905 30920 CGCTTTTACATTCGGA  32  955921 N/A N/A 32372 32387 GGATTAGGGACAGTTT  33  955922 N/A N/A 34301 34316 CCAAGATAAGTGAGAC  34  955924 N/A N/A 35056 35071 CCGTGATAAGCAGTAA  35  955927 N/A N/A 23258 23273 CGTATAGACATCCACA  36  955929 N/A N/A 25154 25169 GAAATGATGTAGGCTC  37  955930 N/A N/A 28834 28849 CTGATTATGTGTCCAG  38  955931 N/A N/A 36829 36844 GACAATTGCTGGGTAG  39  955932 N/A N/A 29157 29172 TTAAGGAGACCTCTCA  40  955934 N/A N/A 14943 14958 CATTCAATAGCAGGGC  41  955935 N/A N/A 21602 21617 TGGATTCGACATGCAA  42  955936 N/A N/A 30679 30694 GATGTAATGATGTTGC  43  955938 1228 1243 37591 37606 TCGGGCAGCGGCTGTT  44  955943 N/A N/A 19981 19996 TCTCAGTATGAATGTC  45  955944 N/A N/A 21350 21365 GTAGAACTTATGTTGA  46  955945 N/A N/A 25057 25072 CCAGATAATTCCTCGG  47  955946 N/A N/A 28581 28596 AAACTAATCATTCCGC  48  955948  891  906 37254 37269 GTTTTATAAACCGGAG  49  955949 N/A N/A 15955 15970 TCTCATAAGAGCCTGT  50  955950 N/A N/A 19976 19991 GTATGAATGTCATTCC  51  955951 N/A N/A 21349 21364 TAGAACTTATGTTGAG  52  955955 N/A N/A 28801 28816 GTTGATACGCCTGGCT  53  955956 N/A N/A 35191 35206 GAGATACCAGATTCCA  54  955960 N/A N/A 30277 30292 CATTTATCCTCTGGTG  55  955961 N/A N/A 15721 15736 GCGATGATAGGAGACC  56  955962 N/A N/A 16719 16734 TCCATTGGATCACCCT  57  955963 N/A N/A 19979 19994 TCAGTATGAATGTCAT  58  955964 N/A N/A  3548  3563 ACAACATACTCAGGAC  59  955966 N/A N/A 17751 17766 GACAATATCTCCTGGC  60  955967 N/A N/A 23722 23737 TGGATAATATCAGCAG  61  955969 N/A N/A 26833 26848 GCACAACATATGCTTC  62  955974 N/A N/A  2967  2982 GTCAATTCCAACACAA  63  955976 N/A N/A 30174 30189 AACAAGGTTTGAGCGA  64  955977 N/A N/A 32576 32591 TCCTTTTAGGTCTGTG  65  955978 N/A N/A 17355 17370 CGTAGAGTCATCTAGA  66  955980 N/A N/A 12856 12871 GGACTTATGGAACTGC  67  955982 N/A N/A 23200 23215 ATTGATGTCAGTGGGT  68  955983 N/A N/A 17121 17136 CATCATGTCCAGTCTG  69  955986 N/A N/A  4790  4805 GGATAGCATGGTCTGG  70  955988 N/A N/A  2880  2895 AGCATAGGCACACATC  71  955990 N/A N/A  3552  3567 GATCACAACATACTCA  72  955992  248  263  7283  7298 TGATACTCAGCAACAG  73  955994 N/A N/A  7811  7826 TGCCATAAAGCCGACA  74  955995 N/A N/A 10456 10471 CAGTAGCGAGTACGGA  75  955996 N/A N/A 10740 10755 TCCAACGGCAGAAGAC  76  955998 N/A N/A 11254 11269 TCGCAATGAGCATAGT  77  955999 N/A N/A 16002 16017 ACACATTCCGTCCTCT  78  956000 N/A N/A 16551 16566 ACATAGGACAGGCTCA  79  956001 N/A N/A 18421 18436 GCAAAGAGAGAGCGGC  80  956002 N/A N/A 23148 23163 GGTCAAGAAGCCTTTC  81  956003 N/A N/A 28705 28720 TCCCAAGTTCTAAGAC  82  956004  628  643 36991 37006 GGCGAAACCGTAGGAG  83  956005 N/A N/A 17261 17276 CCCTAGCTAAGCCACC  84  956007 N/A N/A 14434 14449 GGTCTAAGGAAATCAC  85  956009 N/A N/A 30823 30838 GCAAGAGTGGATTAGT  86  956010 N/A N/A  3501  3516 ATATCTAACTCAGGGT  87  956011 N/A N/A 19498 19513 CTGCACTTTGACATCC  88  956012  144  159  2787  2802 GCCAAATGCAAGGGAT  89  956013 N/A N/A  3503  3518 GCATATCTAACTCAGG  90  956014 N/A N/A  3550  3565 TCACAACATACTCAGG  91  956015 N/A N/A  4360  4375 TGTCATAGAAGCTCAT  92  956017 N/A N/A  7588  7603 TCTGAAGTTACTTGGC  93  956019 N/A N/A  9487  9502 CTGGATTAAGGACCCC  94  956021 N/A N/A 13849 13864 GTAGATTCCGATGGGC  95  956022 N/A N/A 16117 16132 GACTATAGATTCCAGG  96  956023 N/A N/A 16404 16419 GGCTCGATGGGATAGG  97  956024 N/A N/A 16467 16482 GGTAATAAGTTCCCCA  98  956026 N/A N/A 18995 19010 GGTTTAGGAGGAATTC  99  956027 N/A N/A 19080 19095 ACGGGAAAGGCAGTTG 100  956028 N/A N/A 19092 19107 CCATAGAAAATGACGG 101  956029 N/A N/A 19267 19282 GTGCATTGTACGATGA 102  956030 N/A N/A 27592 27607 GGACAACCCGTATTTT 103  956031 N/A N/A 27704 27719 GGTAAAGATCACGGGA 104  956032 N/A N/A 29566 29581 TGACAACCAACTCAGA 105  956034 N/A N/A 32724 32739 ACACATTTGACTTGAG 106  956035 N/A N/A 32847 32862 TGCTCTATAGCTATAT 107  956039 N/A N/A  3019  3034 GAGTATATATCCACCT 108  956045 N/A N/A  3564  3579 CAACACTTATGTGATC 109  956047 N/A N/A  5018  5033 CTAATAGAGGGCAGCG 110  956048 N/A N/A  9567  9582 CCCTTAATTTGACCCT 111  956050 N/A N/A 10211 10226 CCAATAGGACTGGGAC 112  956051 N/A N/A 16792 16807 TCTAAATCTCAGACCA 113  956053 N/A N/A 26705 26720 AGCATAGAGGTTCTTC 114  956054 N/A N/A 30611 30626 GAAGATGAAGGTACTG 115  956055 N/A N/A 30636 30651 GCCGAAACAGCTCAGC 116  956058 1139 1154 37502 37517 TTCTAAATGAGGTGGA 117  956059 1709 1724 38072 38087 CAATACAAGTCATTGC 118  985154 N/A N/A  7575  7590 GGCTTAAATAGAGACC 119  985156 N/A N/A  9722  9737 TCTTAACATCAATCGC 120  985158 N/A N/A 11251 11266 CAATGAGCATAGTTCA 121  985161 N/A N/A 11268 11283 ACAAGTTAAATGGTTC 122  985165 N/A N/A 15752 15767 GATAAACAAGTCTGGG 123  985174 N/A N/A 21491 21506 GTCAATTACAAACCTG 124  985175 N/A N/A 22444 22459 GTCATAATGATCAAAC 125  985176 N/A N/A 30065 30080 CATATTATCTTGAGGG 126  985177 N/A N/A 31231 31246 CACGATAAGGGAACCA 127  985178 N/A N/A  8597  8612 ACGATTATGTGCAGAG 128  985180 N/A N/A  9500  9515 GAAATACGATCTTCTG 129  985181 N/A N/A  9502  9517 GAGAAATACGATCTTC 130  985182 N/A N/A  9723  9738 CTCTTAACATCAATCG 131  985183 N/A N/A  9845  9860 AGCTGTATTTCCGTGG 132  985186 N/A N/A 11350 11365 ACAAATCGATGTCAAT 133  985188 N/A N/A 12357 12372 CTCTTATACACAATCA 134  985190 N/A N/A 19085 19100 AAATGACGGGAAAGGC 135  985191 N/A N/A 19266 19281 TGCATTGTACGATGAA 136  985194 N/A N/A 21533 21548 AATGATTCGAGTTCAG 137  985197 N/A N/A 26072 26087 GCATTAAGATAGTAAG 138  985198 N/A N/A 27616 27631 ATAGGTATGGAAATCA 139  985201 N/A N/A 30525 30540 TTATAGTACAGGCTTG 140  985203 N/A N/A  8998  9013 AACGACATTCTGGCTT 141  985206 N/A N/A 14221 14236 CCGAGATGTTCATATG 142  985208 N/A N/A 19261 19276 TGTACGATGAAGGATA 143  985209 N/A N/A 19405 19420 GATAATAGTAAGCTGT 144  985211 N/A N/A 19408 19423 CTGGATAATAGTAAGC 145  985213 N/A N/A 19728 19743 ACAAAGGCGATGAAGG 146  985215 N/A N/A 21244 21259 CAATATCCAACCTTGG 147  985216 N/A N/A 21432 21447 GCTAAACTATAGATTA 148  985222 N/A N/A 30163 30178 AGCGAGGCACATCTCA 149  985224 N/A N/A 33291 33306 ATCCATAATCATCCGT 150  985228 N/A N/A 10236 10251 GACAAGATTAAGCACT 151  985230 N/A N/A  3018  3033 AGTATATATCCACCTT 152  985231 N/A N/A  3416  3431 CATATATTGGGTGCTA 153  985232 N/A N/A  4170  4185 TGCATTTACAGTGCCC 154  985233 N/A N/A  5764  5779 TCTTATAGACCATAAA 155  985236 N/A N/A  6970  6985 AAACAAGCGGTTCGCA 156  985238 N/A N/A  9179  9194 GTCGATATTTTTTTCA 157  985239 N/A N/A  9888  9903 GAACATATATACTGGA 158  985240 N/A N/A 10027 10042 GTATTACTGGGTACTG 159  985241 N/A N/A 12699 12714 CCCAAGGCCGAATGAC 160  985242 N/A N/A 14557 14572 GAAAATATACCGATGC 161  985244 N/A N/A 31814 31829 ACCTAATGCAATCAAG 162  985248 N/A N/A  3799  3814 CACTAAAGTAGCTTGT 163  985249 N/A N/A  3787  3802 TTGTAACTCTGATAGG 164  985250 N/A N/A  9709  9724 CGCTATGGCCTACCCA 165  985251 N/A N/A  4736  4751 ACCGAATAAGCTCTAG 166  985252 N/A N/A  7741  7756 TCCTAAAAGGGTGTTT 167  985253 N/A N/A 10237 10252 AGACAAGATTAAGCAC 168  985255 N/A N/A 15753 15768 TGATAAACAAGTCTGG 169  985256 N/A N/A 15892 15907 AGCCACGAAGATTTTA 170  985257 N/A N/A 15917 15932 GTAGAGATTATGGGTT 171  985258 N/A N/A 18921 18936 ACGCATTATGGAAATG 172  985260 N/A N/A 20005 20020 ACACAGATCGCCATTT 173  985263 N/A N/A 25197 25212 GACTATAAGGGCAACA 174  985264 N/A N/A 27620 27635 CTCTATAGGTATGGAA 175  985265 N/A N/A 34231 34246 TCAATATAGTTCGATG 176 1083583 1471 1486 37834 37849 CTATCTTATGTTGTAA 177 1083584 1476 1491 37839 37854 CCATTCTATCTTATGT 178 1083585 1478 1493 37841 37856 CTCCATTCTATCTTAT 179 1083586 1492 1507 37855 37870 AGAATTATTCAGGTCT 180 1083587 1488 1503 37851 37866 TTATTCAGGTCTCCAT 181 1083588 1490 1505 37853 37868 AATTATTCAGGTCTCC 182 1083589 N/A N/A 23195 23210 TGTCAGTGGGTTCCCC 183 1083590 N/A N/A 28712 28727 TTCTAAGTCCCAAGTT 184 1083591 N/A N/A 31450 31465 TCACATCCCATGAGTG 185 1083592 N/A N/A 19083 19098 ATGACGGGAAAGGCAG 186 1083593 N/A N/A 19084 19099 AATGACGGGAAAGGCA 187 1083594 N/A N/A 19090 19105 ATAGAAAATGACGGGA 188 1083595 N/A N/A 23201 23216 AATTGATGTCAGTGGG 189 1083596 N/A N/A 23206 23221 TGTCAAATTGATGTCA 190 1083597 1491 1506 37854 37869 GAATTATTCAGGTCTC 191 1083598 1493 1508 37856 37871 CAGAATTATTCAGGTC 192 1083599 1494 1509 37857 37872 ACAGAATTATTCAGGT 193 1083600 1495 1510 37858 37873 CACAGAATTATTCAGG 194 1083601 1496 1511 37859 37874 ACACAGAATTATTCAG 195 1083602 1498 1513 37861 37876 TTACACAGAATTATTC 196 1083603 1500 1515 37863 37878 TATTACACAGAATTAT 197 1083604 1501 1516 37864 37879 ATATTACACAGAATTA 198 1083605 1502 1517 37865 37880 TATATTACACAGAATT 199 1083606 1503 1518 37866 37881 TTATATTACACAGAAT 200 1083607 1504 1519 37867 37882 TTTATATTACACAGAA 201 1083608 1505 1520 37868 37883 ATTTATATTACACAGA 202 1083609 1506 1521 37869 37884 CATTTATATTACACAG 203 1083610 1507 1522 37870 37885 CCATTTATATTACACA 204 1083611 1508 1523 37871 37886 ACCATTTATATTACAC 205 1083612 1509 1524 37872 37887 AACCATTTATATTACA 206 1083613 1473 1488 37836 37851 TTCTATCTTATGTTGT 207 1083614 1470 1485 37833 37848 TATCTTATGTTGTAAA 208 1083615 1469 1484 37832 37847 ATCTTATGTTGTAAAA 209 1083616 N/A N/A 31459 31474 TTGTAGATTTCACATC 210 1083617 N/A N/A 31455 31470 AGATTTCACATCCCAT 211 1083618 N/A N/A 31452 31467 TTTCACATCCCATGAG 212 1083619 N/A N/A 23202 23217 AAATTGATGTCAGTGG 213 1083620 N/A N/A 23204 23219 TCAAATTGATGTCAGT 214 1083621 N/A N/A 23205 23220 GTCAAATTGATGTCAG 215 1083622 N/A N/A 19086 19101 AAAATGACGGGAAAGG 216 1083623 N/A N/A 19087 19102 GAAAATGACGGGAAAG 217 1083624 N/A N/A 19088 19103 AGAAAATGACGGGAAA 218 1083625 N/A N/A 19089 19104 TAGAAAATGACGGGAA 219 1083626 N/A N/A 19079 19094 CGGGAAAGGCAGTTGC 220 1083627 N/A N/A 19078 19093 GGGAAAGGCAGTTGCA 221 1083628 N/A N/A 19077 19092 GGAAAGGCAGTTGCAA 222 1083629 N/A N/A 28698 28713 TTCTAAGACACATACA 223 1083630 N/A N/A 28697 28712 TCTAAGACACATACAG 224 1083631 N/A N/A 28696 28711 CTAAGACACATACAGG 225 1083632 N/A N/A 28695 28710 TAAGACACATACAGGT 226 1083641 1021 1036 37384 37399 TACTGAGCTGGATTAT 227 1083642 1180 1195 37543 37558 AGGGCTTTTGGACATT 228 1083643 1229 1244 37592 37607 TTCGGGCAGCGGCTGT 229 1083644 1232 1247 37595 37610 AGGTTCGGGCAGCGGC 230 1083645 N/A N/A 12574 12589 GAATCATGGATGAGAT 231 1083646 N/A N/A 12811 12826 GTATGATTGGGTATGG 232 1083647 N/A N/A 14212 14227 TCATATGGCTGGCTCC 233 1083648 N/A N/A 19678 19693 GGGTATTTTAGCTAGA 234 1083649 N/A N/A 32384 32399 AACCTTACAGTGGGAT 235 1089867 N/A N/A  9497  9512 ATACGATCTTCTGGAT 236 1089868 N/A N/A  9538  9553 TTCCATATCTCACAAG 237 1089869 N/A N/A  9498  9513 AATACGATCTTCTGGA 238 1089870 N/A N/A  9499  9514 AAATACGATCTTCTGG 239 1089871 N/A N/A  9501  9516 AGAAATACGATCTTCT 240 1089872 N/A N/A  9505  9520 GAGGAGAAATACGATC 241 1089873 N/A N/A  9566  9581 CCTTAATTTGACCCTC 242 1089874 N/A N/A  9503  9518 GGAGAAATACGATCTT 243 1089876 N/A N/A  9508  9523 ACAGAGGAGAAATACG 244 1089877 N/A N/A  9509  9524 GACAGAGGAGAAATAC 245 1089878 N/A N/A  9510  9525 GGACAGAGGAGAAATA 246 1089879 N/A N/A  9512  9527 GAGGACAGAGGAGAAA 247 1089880 N/A N/A  9515  9530 GCTGAGGACAGAGGAG 248 1089883 N/A N/A  9496  9511 TACGATCTTCTGGATT 249 1089884 N/A N/A  9492  9507 ATCTTCTGGATTAAGG 250 1089885 N/A N/A  9483  9498 ATTAAGGACCCCAAGG 251 1089886 N/A N/A  9482  9497 TTAAGGACCCCAAGGC 252 1089887 N/A N/A  9480  9495 AAGGACCCCAAGGCTT 253 1120838 N/A N/A 28790 28805 TGGCTTGGGTGGGGAC 254 1120839 N/A N/A  9178  9193 TCGATATTTTTTTCAA 255 1120840 N/A N/A  9177  9192 CGATATTTTTTTCAAT 256 1120841 N/A N/A  9176  9191 GATATTTTTTTCAATC 257 1120842 N/A N/A  9175  9190 ATATTTTTTTCAATCA 258 1120843 N/A N/A  9174  9189 TATTTTTTTCAATCAC 259 1120844 N/A N/A  9173  9188 ATTTTTTTCAATCACA 260 1120845 N/A N/A  9172  9187 TTTTTTTCAATCACAA 261 1120846 N/A N/A  9171  9186 TTTTTTCAATCACAAA 262 1120847 N/A N/A  9170  9185 TTTTTCAATCACAAAA 263 1120848 N/A N/A  9169  9184 TTTTCAATCACAAAAA 264 1120849 N/A N/A  9180  9195 GGTCGATATTTTTTTC 265 1120853 N/A N/A  9184  9199 CCCAGGTCGATATTTT 266 1120854 N/A N/A  9185  9200 TCCCAGGTCGATATTT 267 1120863 1472 1487 37835 37850 TCTATCTTATGTTGTA 268 1120865 N/A N/A  9506  9521 AGAGGAGAAATACGAT 269 1120873 N/A N/A  9495  9510 ACGATCTTCTGGATTA 270 1120875 N/A N/A  9493  9508 GATCTTCTGGATTAAG 271 1120877 N/A N/A  9490  9505 CTTCTGGATTAAGGAC 272 1120881 1497 1512 37860 37875 TACACAGAATTATTCA 273 1120882 1499 1514 37862 37877 ATTACACAGAATTATT 274 1120890 1475 1490 37838 37853 CATTCTATCTTATGTT 275 1120892 N/A N/A 31460 31475 CTTGTAGATTTCACAT 276 1120894 N/A N/A 31462 31477 CGCTTGTAGATTTCAC 277 1120895 N/A N/A 31463 31478 ACGCTTGTAGATTTCA 278 1120896 N/A N/A 31464 31479 CACGCTTGTAGATTTC 279 1120897 N/A N/A 31465 31480 GCACGCTTGTAGATTT 280 1120898 N/A N/A 31466 31481 TGCACGCTTGTAGATT 281 1120899 N/A N/A 31467 31482 ATGCACGCTTGTAGAT 282 1263229  873  888 37236 37251 ATTATATACATCTTCA 283 1263254 N/A N/A 29769 29784 GTATTGAAATGTTGTA 284 1263256 N/A N/A 10283 10298 CGTAATTTCTGGGATG 285 1263258 N/A N/A 14985 15000 GATATTTGGATCTTGG 286 1263259 N/A N/A 10058 10073 TTTATAATGCTTCAGC 287 1263261 N/A N/A 22457 22472 ATTTTATTGGGTTGTC 288 1263271 N/A N/A 29880 29895 GCATAATTAGTCATTT 289 1263272 N/A N/A  8628  8643 GTAAATGGAGAAGTTC 290 1263275 N/A N/A 21538 21553 AAAATAATGATTCGAG 291 1263277 N/A N/A 23272 23287 AAACTATGTAATTGCG 292 1263280 N/A N/A 30803 30818 ATACTTAAATCGCAAT 293 1263281 N/A N/A 25304 25319 ATAGATTACATAAGAG 294 1263282 N/A N/A 24037 24052 GATAATACACAACATC 295 1263304 N/A N/A 29898 29913 TAGAAATGATATCTCC 296 1263305 N/A N/A 26239 26254 CATAAGTTATTTCTCG 297 1263308 N/A N/A 13009 13024 TTACTTATACCTGGAG 298 1263312 N/A N/A 30068 30083 ATCCATATTATCTTGA 299 1263317 N/A N/A 27055 27070 AGAATTTTAAGGGTGC 300 1263332 N/A N/A 23950 23965 TAAATCTCTAGTTCGC 301 1263334 N/A N/A 23419 23434 ATTATGGTATATCCTC 302 1263362 N/A N/A 11267 11282 CAAGTTAAATGGTTCG 303 1263363 N/A N/A 27054 27069 GAATTTTAAGGGTGCA 304 1263365 N/A N/A 14986 15001 TGATATTTGGATCTTG 305 1263368 N/A N/A 29744 29759 TTAATGAGAAGTGGTT 306 1263369 N/A N/A 19186 19201 TCAAAACTTAGTGTCT 307 1263370 N/A N/A 22456 22471 TTTTATTGGGTTGTCA 308 1263378 N/A N/A 19570 19585 TTATTCAATGAACTGC 309 1263380 N/A N/A 29745 29760 TTTAATGAGAAGTGGT 310 1263381 N/A N/A 15612 15627 ATTGATAGTCATGAGT 311 1263382 N/A N/A 12372 12387 TCATTTGAAGATGTTC 312 1263384 N/A N/A 32285 32300 CTATTAAATGAGAGTC 313 1263385 N/A N/A 27604 27619 ATCAATTTGCTTGGAC 314 1263386 N/A N/A 29454 29469 ATGAATTTGGACCACA 315 1263390 N/A N/A 23162 23177 ACGAAGAAGAGTTTGG 316 1263400 N/A N/A 19168 19183 CAAACGGATTTATCAG 317 1263768 N/A N/A 32561 32576 GTCTAGATTAATTTCT 318 1263770 N/A N/A 12239 12254 GTATTGACTTAAATCC 319 1263771 N/A N/A 29770 29785 AGTATTGAAATGTTGT 320

[0539] Modified oligonucleotides complementary to a human PMP22 nucleic acid were designed as described in Table 2. The modified oligonucleotides in Table 2 are 16-mer gapmers with mixed sugar motifs as indicated, wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety; ‘e’ represents a 2′-MOE sugar moiety; ‘k’ represents to a cEt sugar moiety; and ‘y’ represents a 2′-OMe sugar moiety. All internucleoside linkages are phosphorothioate internucleoside linkages. Each cytosine residues is a 5-methylcytosine. Modified oligonucleotides in Table 2 are conjugated to a 6-palmitamidohexyl phosphate conjugate group attached to the 5′-OH of the modified oligonucleotide. The structure for the conjugate group is:

TABLE-US-00002 TABLE 2 6-Palmitamidohexyl conjugated 3-10-3 mixed sugar gapmers with uniform PS internucleoside  linkages complementary to human PMP22 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 Compound Start Stop Start Stop Sugar Motif SEQ ID ID Site Site Site Site Sequence (5′ to 3′) (5′ to 3′) NO 1182273 1489 1504 37852 37867 ATTATUCAGGTCTCCA kkkddydddddddkkk 321 1421291 N/A N/A  9498  9513 AATACGATCTTCTGGA ekkddddddddddkkk 238 1421292 N/A N/A  9499  9514 AAATACGATCTTCTGG ekkddddddddddkkk 239 1421296 N/A N/A  9499  9514 AAATACGATCTTCTGG kekddddddddddkkk 239 1421314 N/A N/A  9498  9513 AATACGATCTTCTGGA kkeddddddddddkkk 238 1421315 N/A N/A  9499  9514 AAATACGATCTTCTGG kkeddddddddddkkk 239 1421318 N/A N/A  9498  9513 AATACGATCTTCTGGA kkkddddddddddekk 238 1421329 N/A N/A  9499  9514 AAATACGATCTTCTGG kkkddddddddddkek 239 1421336 N/A N/A  9498  9513 AATACGATCTTCTGGA ekkddddddddddkke 238 1421341 N/A N/A  9499  9514 AAATACGATCTTCTGG ekkkdddddddddkkk 239 1421345 N/A N/A  9499  9514 AAATACGATCTTCTGG kkkdddddddddkkke 239

##STR00021##

[0540] Modified oligonucleotides complementary to a human PMP22 nucleic acid were designed as described in Table 3. The modified oligonucleotides in Table 3 are 3-10-3 cEt gapmers conjugated to a 6-palmitamidohexyl phosphate conjugate group attached to the 5′-OH of the oligonucleotide. The structure for the conjugate group is:

##STR00022##

The gapmers are 16 nucleosides in length, wherein the central gap segment consists of ten 2′-β-D-deoxynucleosides and the 5′ and 3′ wings each consists of three cEt nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety; and ‘k’ represents a cEt sugar moiety. The intemucleoside linkage motifs for the gapmers are described in the table below, wherein ‘s’ refers to a phosphorothioate internucleoside linkage; and ‘q’ refers to a methoxypropyl phosphonate (MOP) internucleoside linkage. Each cytosine residues is a 5-methylcytosine.

TABLE-US-00003 TABLE 3 6-Palmitamidohexyl conjugated 3-10-3 cEt gapmers with mixed PS/MOP internucleoside linkages complementary to human PMP22 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 Compound Start Stop Start Stop Sugar Motif SEQ ID ID Site Site Site Site Sequence (5′ to 3′) (5′ to 3′) NO 1182269 1489 1504 37852 37867 ATTATTCAGGTCTCCA ssssqssssssssss  19 1182270 1489 1504 37852 37867 ATTATTCAGGTCTCCA sssssqsssssssss  19 1182271 1489 1504 37852 37867 ATTATTCAGGTCTCCA ssssssqssssssss  19 1182285 N/A N/A  9499  9514 AAATACGATCTTCTGG ssssqssssssssss 239 1182286 N/A N/A  9499  9514 AAATACGATCTTCTGG sssssqsssssssss 239 1182287 N/A N/A  9499  9514 AAATACGATCTTCTGG ssssssqssssssss 239

Example 2: Effect of Modified Oligonucleotides on Human PMP22 in Transgenic Mice

[0541] C22 mice, described in Huxley et al., Human Molecular Genetics, 5, 563-569 (1996) and Verhamme et al., Journal of Neuropathology and Experimental Neurology, 70, 386-398 (2011), express endogenous mouse PMP22 and overexpress a human PMP22 transgene. The effect of modified oligonucleotides on human PMP22 RNA was tested in symptomatic C22 mice.

[0542] C22 mice were divided into groups of 1-4 mice each and administered 50 mg/kg of modified oligonucleotide by subcutaneous injection once a week for a total of three injections. A group of 1-4 mice was administered subcutaneous injections of PBS once a week for a total of three injections. This group serves as the control group to which other groups were compared. The number of mice in a treatment group in each experiment is noted in each experimental table below as the “n” number. Mice were sacrificed 72 hours after the final injection and total RNA was isolated from the sciatic nerve for analysis. Levels of human PMP22 RNA were measured by quantitative real-time RTPCR using human primer probe set RTS4579 (forward sequence CTTGCTGGTCTGTGCGTGAT, designated herein as SEQ ID NO: 9; reverse sequence ACCGTAGGAGTAATCCGAGTTGAG, designated herein as SEQ ID NO: 10; probe sequence CATCTACACGGTGAGGCACCCGG, designated herein as SEQ ID NO: 11). Results are presented as percent human PMP22 RNA relative to PBS control, normalized to mouse cyclophilin A. Cyclophilin A was amplified using mouse primer probe set mcyclo24 (forward sequence TCGCCGCTTGCTGCA, designated herein as SEQ ID NO: 12; reverse sequence ATCGGCCGTGATGTCGA, designated herein as SEQ ID NO: 13; probe sequence CCATGGTCAACCCCACCGTGTTC, designated herein as SEQ ID NO: 14). The values marked with the symbol “I” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.

TABLE-US-00004 TABLE 4 Reduction of human PMP22 in C22 transgenic mice, n = 4 PMP22 RNA (% Compound Control) ID RTS4579 PBS 100 684267 64 684394 29 938327 71 938329 78 938330 84 938333 78 938336 89 938340 96 938341 82 955917 92 955918 97 955919 86 955920 84 955921 91 955922 95 955924 104 955927 101 955929 113 955930 99 955931 102 955932 111 955934 80 955935 86

TABLE-US-00005 TABLE 5 Reduction of human PMP22 in C22 transgenic mice, n = 4 PMP22 RNA (% Compound Control) ID RTS4579 PBS 100 684267  76 684394  38 955943  94 955944  77 955946  89 955948  79 955949  86 955950  75 955951  83 955990  91 955996  92 955998  83 955999  74 956000  85 956004  77.sup.≠ 956007  79

TABLE-US-00006 TABLE 6 Reduction of human PMP22 in C22 transgenic mice, n = 4 PMP22 RNA (% Compound Control) ID RTS4579 PBS 100 684267  82 684394  57 955936  84 955945  90 955955  61 955960  84 955964  68 955966  80 955967†  61 955974  72 955976  79 955986  76 955988  68 955994  81 955995  89 956002  81 956003  55 956010  79 956012  76 956013  74 956014†  97 956015  89 956017†  70 956021 109 956022  83 956023  88 956024  80 956028  79 956029  80 956030  74 956031  78 956034  61.sup.≠ 956035  99 †Group had fewer than 3 animals at end of study

TABLE-US-00007 TABLE 7 Reduction of human PMP22 in C22 transgenic mice, n = 4 PMP22 RNA (% Compound Control) ID RTS4579 PBS 100 684267 70 684394 37 938337 77 938348 48 955961 79 955962 81 955963 72 955969† 61 955977 62 955978 71 955980 70 955982 63 955983 62 956005 54 956009 77 956011 77 956019 73 956026† 77 956027 60 956032 75 956045 86 956047 94 956048 87 956050 80 956051 91 956053 70 956054 83 956055 97 956058 70 956059† 92 †Group had fewer than 3 animals at end of study

TABLE-US-00008 TABLE 8 Reduction of human PMP22 in C22 transgenic mice, n = 1 Compound PMP22 ID RNA (% Control) RTS4579 PBS 100 684394 52 955956 49 955992 74 956001 89 956039 79 985154 78 985156 64 985158 76 985161 74 985165 79 985174 97 985175 77 985176 87 985177 64 985178 80 985180 38 985181 83 985182 84 985183 80 985186 92 985188 72 985191 75 985194 87 985197 75 985198 86 985201 68 985203 73 985206 87 985208 77 985209 93 985211 80 985213 81 985215 86 985216 87 985222 66 985224 88 985228 66 985230 77 985231 75 985232 76 985233 94 985236 101 985238 59 985239 78 985240 73 985241 92 985242 69 985244 77 985248 84 985249 84 985250 77 985251 83 985252 82 985253 82 985255 79 985256 90 985257 72 985258 93 985260 85 985263 70 985264 81 985265 71

TABLE-US-00009 TABLE 9 Reduction of human PMP22 in C22 transgenic mice, n = 3 PMP22 RNA (% Compound Control) ID RTS4579 PBS 100 684394 52 985156 87 985180 44 985201 86 985238 90 985263 102

TABLE-US-00010 TABLE 10 Reduction of human PMP22 in C22 transgenic mice, n = 1 PMP22 RNA (% Compound Control) ID RTS4579 PBS 100 955938 64 1083641 83 1083642 82 1083643 75 1083644 84 1083645 89 1083646 76 1083647 67 1083648 83 1083649 84

Example 3: Effect of Modified Oligonucleotides on Human PMP22 in Transgenic Mice

[0543] C22 mice, described in Huxley et al., Human Molecular Genetics, 5, 563-569 (1996) and Verhamme et al., Journal of Neuropathology and Experimental Neurology, 70, 386-398 (2011), express endogenous mouse PMP22 and overexpress a human PMP22 transgene. The effect of modified oligonucleotides on human PMP22 RNA was tested in symptomatic C22 mice.

[0544] C22 mice were divided into groups of 1-3 mice each and administered a single dose of 50 mg/kg of modified oligonucleotide by intravenous injection. A group of 1-3 mice was administered a single dose of PBS by intravenous injection. This group serves as the control group to which other groups were compared. Mice were sacrificed 17 days post treatment. The number of mice in a treatment group in each experiment is noted in each experimental table below as the “n” number. Total RNA was isolated from the sciatic nerve for analysis. Levels of human PMP22 RNA were measured by quantitative real-time RTPCR using human primer probe set RTS4579 (described herein above). Results are presented as percent human PMP22 RNA relative to PBS control, normalized to mouse cyclophilin A. Cyclophilin A was amplified using mouse primer probe set mcyclo24 (described herein above).

[0545] The values marked with the symbol “‡” indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region. In such instances, an additional qRTPCR assay using human primer probe set RTS35670 (forward sequence AGAAATCTGCTTGGAAGAAGGG, designated herein as SEQ ID NO: 15; reverse sequence ACGTGGAGGACGATGATACT, designated herein as SEQ ID NO: 16; probe sequence AGCAACAGGAGGAGCATTCTGGC, designated herein as SEQ ID NO: 17) was used to measure the potency and efficacy of such modified oligonucleotides.

TABLE-US-00011 TABLE 11 Reduction of human PMP22 in C22 transgenic mice, n = 3, 50 mpk for 17 days Compound ID PMP22 PMP22 RNA (% RNA (% Control) Control) RTS4579 RTS35670 PBS 100 100 1054937  15 22  938348  75 83  955955  50 62  955956  83 91  955967  77 85  955982  66 73  955983†  85 88  956003  38 35  956005  80 87  956027  80 79  956034  82.sup.≠ 86  985180  61 69  985201  84 89  985238  56 61 †Group had less than 3 animals at end of study

TABLE-US-00012 TABLE 12 Reduction of human PMP22 in C22 transgenic mice, n = 1, 50 mpk, 17 days Compound PMP22 ID RNA (% Control) RTS4579 PBS 100  985190 84 1083583 65 1083584 65 1083585 78 1083586 150 1083587 99 1083588 106 1083589 111 1083590 89 1083591 63 1083592 34 1083593 65 1083594 71 1083595 94 1083596 72 1083597 108 1083598 63 1083599 107 1083600 80 1083601 80 1083602 65 1083603 61 1083604 48 1083605 65 1083606 59 1083607 72 1083608 70 1083609 64 1083610 53 1083611 56 1083612 69 1083613 52 1083614 62 1083615 76 1083616 63 1083617 59 1083618 87 1083619 66 1083620 115 1083621 68 1083622 80 1083623 84 1083624 81 1083625 74 1083626 46 1083627 41 1083628 79 1083629 75

TABLE-US-00013 TABLE 13 Reduction of human PMP22 in C22 transgenic mice, n = 1, 50 mpk, 17 days PMP22 RNA (% Compound Control) ID RTS4579 PBS 100 955938 80 1083641 108 1083643 84 1083644 69 1083645 86 1083646 102 1083647 89 1083648 76 1083649 91 1083630 120 1083631 106 1083632 122

TABLE-US-00014 TABLE 14 Reduction of human PMP22 in C22 transgenic mice, n = 1, 50 mpk, 17 days PMP22 RNA (% Compound Control) ID RTS4579 PBS 100 956048 93 985181 95 1089867 90 1089868 89 1089869 33 1089870 22 1089871 94 1089872 78 1089873 87 1089874 98 1089876 97 1089877 78 1089878 114 1089879 86 1089880 96 1089883 95 1089884 82 1089885 114 1089886 87 1089887 77

TABLE-US-00015 TABLE 15 Reduction of human PMP22 in C22 transgenic mice, n = 3, 50 mpk, 17 days PMP22 RNA (% Compound Control) ID RTS4579 PBS 100 1083584 76 1083592 66 1083593 94 1083594† 75 1083595 82 1083596 94 1083597 67 1083598 81 1083599 81 1083600 94 1083601 93 1083602 93 1083603 85 1083604 48 1083605 45 1083606 84 1083607 92 1083608 100 1083609 84 1083610 92 1083611† 91 1083612 38 1083613 86 1083615 97 1083616 106 1083621 90 1083624 85 1083627 78 1083629 99 1089869 31 1089870 17 †Group had fewer than 3 animals at end of study

TABLE-US-00016 TABLE 16 Reduction of human PMP22 in C22 transgenic mice, n = 3, 50 mpk, 17 days PMP22 RNA (% Compound Control) ID RTS4579 PBS 100 1083644 71 1083645 83 1083646 73 1083647 65 1083648 72 1089884 81 1089886 68 1089887 93

TABLE-US-00017 TABLE 17 Reduction of human PMP22 in C22 transgenic mice, n = 3, 50 mpk, 17 days PMP22 RNA (% Compound Control) ID RTS4579 PBS 100 1120849 73 1120853 91 1120854 98 1120863† 84 1120894 80 1120895 90 1120896 87 1120897 89 1120898 90 1120899 93 †Group had fewer than 3 animals at end of study

TABLE-US-00018 TABLE 18 Reduction of human PMP22 in C22 transgenic mice, n = 3, 50 mpk, 17 days PMP22 PMP22 RNA (% RNA (% Compound Control) Control) ID RTS4579 RTS35670 PBS 100 100 884288 85 99 955922† 84 83 955948† 78 97 955955 48 58 956003 86 89 956004† 85‡ 112 956055† 91 110 956058† 86 99 985176† 64 80 985177† 84 105 985180 45 62 985181 70 89 985222† 82 103 1083592 75 98 1083604 83 110 1083605 65 93 1083612 59 88 1083626 38 54 1089869 17 24 1089870 16 21 1089871 88 100 †treatment groups of n = 1

Example 4: Effect of cEt Modified Oligonucleotides on Human PMP22 in Transgenic Mice

[0546] C22 mice, described in Huxley et al., Human Molecular Genetics, 5, 563-569 (1996) and Verhamme et al., Journal of Neuropathology and Experimental Neurology, 70, 386-398 (2011), express endogenous mouse PMP22 and overexpress a human PMP22 transgene. The effect of modified oligonucleotides on human PMP22 RNA was tested in symptomatic C22 mice.

[0547] Groups containing 1-2 C22 mice each were administered a single dose of 50 mg/kg of modified oligonucleotide by intravenous injection. A group of 1-2 C22 mice was administered a single dose of PBS by intravenous injection. This mouse serves as the control group to which other groups were compared. Mice were sacrificed 14 days post treatment. The number of mice in a treatment group in each experiment is noted in each experimental table below as the “n” number. Total RNA was isolated from the sciatic nerve for analysis. Levels of human PMP22 RNA were measured by quantitative real-time RTPCR using human primer probe set RTS4579 (described herein above). Results are presented as percent human PMP22 RNA relative to PBS control, normalized to mouse cyclophilin A. Cyclophilin A was amplified using mouse primer probe set mcyclo24 (described herein above).

TABLE-US-00019 TABLE 19 Reduction of human PMP22 in C22 transgenic mice, n = 1, 50 mpk, 14 days PMP22 RNA (% Compound Control) ID RTS4579 PBS 100 1054937 17 1120838 90 1120839 84 1120840 95 1120841 100 1120842 88 1120843 117 1120844 88 1120845 90 1120846 74 1120847 79 1120848 95 1120849 65 1120853 75 1120854 89 1120863 101 1120865 80 1120873 75 1120875 73 1120877 91 1120881 81 1120882 95 1120890 78 1120892 91 1120894 54 1120895 81 1120896 82 1120897 68 1120898 74 1120899 87 938348 49 955955 96 956003 77 985180 98 985238 81

TABLE-US-00020 TABLE 20 Reduction of human PMP22 in C22 transgenic mice, n = 2, 50 mpk, 14 days PMP22 RNA (% Compound Control) ID RTS4579 PBS 100 923867 42 1421291 33 1421292 46 1421296 16 1421314 25 1421315 21 1421318 61 1421329 58 1421336 77 1421341 66 1421345 57

Example 5: Effect of Modified Oligonucleotides on Human PMP22 in Transgenic Mice

[0548] C22 mice, described in Huxley et al., Human Molecular Genetics, 5, 563-569 (1996) and Verhamme et al., Journal of Neuropathology and Experimental Neurology, 70, 386-398 (2011), express endogenous mouse PMP22 and overexpress a human PMP22 transgene. The effect of modified oligonucleotides on human PMP22 RNA was tested in symptomatic C22 mice.

[0549] C22 mice were divided into groups of 1-3 mice each and administered a single dose of 30 mg/kg of modified oligonucleotide by intravenous injection. A group of 1-3 mice was administered a single dose of PBS by intravenous injection. This group serves as the control group to which other groups were compared. Mice were sacrificed 14 days post treatment. The number of mice in a treatment group in each experiment is noted in each experimental table below as the “n” number. Total RNA was isolated from the sciatic nerve for analysis. Levels of human PMP22 RNA were measured by quantitative real-time RTPCR using human primer probe set RTS4579 (described herein above). Results are presented as percent human PMP22 RNA relative to PBS control, normalized to mouse cyclophilin A. Cyclophilin A was amplified using mouse primer probe set mcyclo24 (described herein above).

TABLE-US-00021 TABLE 21 Reduction of human PMP22 in C22 transgenic mice, n = 3, 30 mpk, 14 days PMP22 RNA (% Compound Control) ID RTS4579 PBS 100 684394 73 923867 34 1054937 63 1089870 32 1182269 84 1182270 95 1182271† 76 1182273 94 1182285 112 1182286† 118 1182287 106 1263229 96 1263254 97 1263256 94 1263258 74 1263259 87 1263261 90 1263271 96 1263272 78 †Group had fewer than 3 animals at end of study

TABLE-US-00022 TABLE 22 Reduction of human PMP22 in C22 transgenic mice, n = 3, 30 mpk, 14 days PMP22 RNA (% Compound Control) ID RTS4579 PBS 100 1054937 62 1263275 104 1263277 101 1263280 106 1263281 108 1263282 104 1263304 96 1263305 117 1263308 121 1263312 135 1263332 129 1263334 132

TABLE-US-00023 TABLE 23 Reduction of human PMP22 in C22 transgenic mice, n = 3, 30 mpk, 14 days PMP22 RNA (% Compound Control) ID RTS4579 PBS 100 1054937 56 1263317 91 1263362 84 1263363 67 1263365 85 1263368 79 1263369 60 1263370 80 1263378 76 1263380 91 1263381 86 1263382 102 1263384 101 1263385 105 1263386 81 1263390 95 1263400 99 1263768 96 1263770 98 1263771 93

Example 6: Effect of Modified Oligonucleotides on Human PMP22 in Transgenic Mice, Multiple Doses

[0550] C22 mice, described in Huxley et al., Human Molecular Genetics, 5, 563-569 (1996) and Verhamme et al., Journal of Neuropathology and Experimental Neurology, 70, 386-398 (2011), express endogenous mouse PMP22 and overexpress a human PMP22 transgene. The effect of modified oligonucleotides on human PMP22 RNA was tested in symptomatic C22 mice.

[0551] C22 mice were divided into groups of 3 mice each and administered a single dose of modified oligonucleotide by intravenous injection at the doses indicated in the table below. A group of 3 mice was administered a single dose of PBS by intravenous injection. This group serves as the control group to which other groups were compared. Mice were sacrificed 14-18 days post treatment. Total RNA was isolated from the sciatic nerve for analysis. Levels of human PMP22 RNA were measured by quantitative real-time RTPCR using human primer probe set RTS4579 (described herein above). Results are presented as percent human PMP22 RNA relative to PBS control, normalized to mouse cyclophilin A. Cyclophilin A was amplified using mouse primer probe set mcyclo24 (described herein above).

TABLE-US-00024 TABLE 24 Reduction of human PMP22 in C22 transgenic mice, multi-dose study, 14 days PMP22 RNA (% Dose Control) Compound ID (mg/kg) RTS4579 PBS 0 100 955936† 50 94 884288 50 90 150 64 1083612 50 102 150 74 †Group had fewer than 3 animals at end of study

TABLE-US-00025 TABLE 25 Reduction of human PMP22 in C22 transgenic mice, multi-dose study, 18 days PMP22 Compound Dose % control ID (mg/kg) RTS4579 ED50 PBS 0 100 684394 1.9 104 127 5.6 91 16.7 92 50 74 150 45 1054937 1.9 94 28 5.6 95 16.7 76 50 29 150 10

Example 7: Tolerability of Modified Oligonucleotides Targeting Human PMP22 in Balb/c Mice

[0552] Balb/c mice are a multipurpose mouse model frequently utilized for safety and efficacy testing. The mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

[0553] Groups of 2-3 female Balb/c mice were injected subcutaneously with a single dose of 150 mg/kg of modified oligonucleotides. One group of 2-4 female CD-1 mice was injected with PBS. Mice were euthanized 72-96 hours following treatment. The number of mice in a treatment group in each experiment is noted in each experimental table below as the “n” number.

[0554] To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of aspartate aminotransferase (AST), alanine aminotmnsferase (ALT) and blood urea nitrogen (BUN) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results are presented in the table below. Each table represents results from an individual experiment.

TABLE-US-00026 TABLE 26 Plasma chemistry markers in female Balb/c mice, n = 2, 72 hrs Plasma clinical chemistry Compound Dose ALT AST BUN No. (mpk) (U/L) (U/L) (mg/dL) PBS 39 136 22 1054937† 150 779 1096 15 1182269 150 42 138 22 1182270 150 47 102 18 1182271 150 23 112 21 1182273 150 31 109 23  884288† 150 1476 1178 20 1089870† 150 313 536 15 1182285 150 32 73 23 1182287 150 57 121 21 923867.sup.| 150 18 80 16 †groups with n = 3

TABLE-US-00027 TABLE 27 Plasma chemistry markers in female Balb/c mice, n = 2, 96 hrs Plasma clinical chemistry Compound Dose ALT AST BUN No. (mpk) (U/L) (U/L) (mg/dL) PBS 0 38 60 18 1263229 150 54 104 20 1263254 150 31 46 23 1263256 150 44 62 23 1263258 150 82 80 18 1263259 150 25 38 23 1263261 150 56 92 21 1263271 150 37 58 17 1263272 150 38 74 20

TABLE-US-00028 TABLE 28 Plasma chemistry markers in female Balb/c mice, n = 2, 96 hrs Plasma clinical chemistry Compound Dose ALT AST BUN No. (mpk) (U/L) (U/L) (mg/dL) PBS 0 37 80 24 1263275 150 42 109 22 1263277 150 42 79 28 1263280 150 36 93 21 1263281 150 24 76 22 1263282 150 89 115 28 1263304 150 50 100 25 1263305 150 92 189 30 1263308 150 33 93 20 1263312 150 50 105 24

TABLE-US-00029 TABLE 29 Plasma chemistry markers in female Balb/c mice, n = 2, 96 hrs Plasma clinical chemistry Compound Dose ALT AST BUN No. (mpk) (U/L) (U/L) (mg/dL) PBS 0 25 39 20 1263332 150 84 81 22 1263334 150 28 38 22 1263362 150 139 85 27 1263363 150 74 109 19 1263365 150 26 43 18 1263368 150 27 28 17 1263369 150 33 43 18 1263370 150 52 56 20

TABLE-US-00030 TABLE 30 Plasma chemistry markers in female Balb/c mice, n = 2, 96 hrs Plasma clinical chemistry Compound Dose ALT AST No. (mpk) (U/L) (U/L) PBS 0 31 59 1263317 150 39 74 1263378 150 35 71 1263380 150 40 103 1263381 150 70 81 1263382 150 45 68 1263384 150 23 44 1263385 150 33 55 1263386 150 106 133 1263390 150 25 63 1263400 150 21 52 1263768 150 13 49 1263770 150 35 74 1263771 150 55 110

TABLE-US-00031 TABLE 31 Plasma chemistry markers in female Balb/c mice, n = 2, 96 hrs Plasma clinical chemistry Compound Dose ALT AST No. (mpk) (U/L) (U/L) PBS 0 29 67 1421291 150 266 352 1421292 150 283 460 1421296 150 168 226 1421314 150 102 361 1421315 150 153 237 1421318 150 60 164 1421329 150 169 326 1421336 150 195 320 1421341 150 99 135 1421345 150 144 244

Example 8: Design of Modified Oligonucleotides Complementary to a Human PMP22 Nucleic Acid

[0555] Modified oligonucleotides complementary to a human PMP22 nucleic acid were designed, as described in the tables below.

[0556] The modified oligonucleotides in Table 32 are 3-10-3 cEt gapmers with phosphorothioate internucleoside linkages. The gapmers are 16 nucleosides in length, wherein the central gap segment consists of ten 2′-β-D-deoxynucleosides and the 5′ and 3′ wings each consists of three cEt nucleosides. The motif for the gapmers is (from 5′ to 3′): kkkddddddddddkkk; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and ‘k’ represents a cEt sugar moiety. Each cytosine residue is a 5-methyl cytosine.

[0557] “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the Tables below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NM_000304.3), or SEQ ID NO: 2 (GENBANK Accession No. NC_000017.11 truncated from nucleotides 15227001 to 15268000). ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

TABLE-US-00032 TABLE 32 3-10-3 cEt gapmers with PS internucleoside linkages complementary to human PMP22 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 Compound Start Stop Start Stop SEQ ID ID Site Site Site Site Sequence (5′ to 3′) NO 1078137 1494 1509 37857 37872 ACAGAATTATTCAGGT 193 1078138 1495 1510 37858 37873 CACAGAATTATTCAGG 194 1078139 1496 1511 37859 37874 ACACAGAATTATTCAG 195 1078141 1498 1513 37861 37876 TTACACAGAATTATTC 196 1078143 1500 1515 37863 37878 TATTACACAGAATTAT 197 1078145 1502 1517 37865 37880 TATATTACACAGAATT 199 1078146 1503 1518 37866 37881 TTATATTACACAGAAT 200 1078147 1504 1519 37867 37882 TTTATATTACACAGAA 201 1078148 1505 1520 37868 37883 ATTTATATTACACAGA 202 1078149 1506 1521 37869 37884 CATTTATATTACACAG 203 1078150 1507 1522 37870 37885 CCATTTATATTACACA 204 1078151 1508 1523 37871 37886 ACCATTTATATTACAC 205 1078161 1473 1488 37836 37851 TTCTATCTTATGTTGT 207 1078162 1470 1485 37833 37848 TATCTTATGTTGTAAA 208 1078163 1469 1484 37832 37847 ATCTTATGTTGTAAAA 209 1078911 N/A N/A 31459 31474 TTGTAGATTTCACATC 210 1078921 N/A N/A 31455 31470 AGATTTCACATCCCAT 211 1078924 N/A N/A 31452 31467 TTTCACATCCCATGAG 212 1078977 N/A N/A 23202 23217 AAATTGATGTCAGTGG 213 1078979 N/A N/A 23204 23219 TCAAATTGATGTCAGT 214 1078980 N/A N/A 23205 23220 GTCAAATTGATGTCAG 215 1079047 N/A N/A 19086 19101 AAAATGACGGGAAAGG 216 1079048 N/A N/A 19087 19102 GAAAATGACGGGAAAG 217 1079049 N/A N/A 19088 19103 AGAAAATGACGGGAAA 218 1079052 N/A N/A 19078 19093 GGGAAAGGCAGTTGCA 221 1079053 N/A N/A 19077 19092 GGAAAGGCAGTTGCAA 222 1079093 N/A N/A 28698 28713 TTCTAAGACACATACA 223 1079094 N/A N/A 28697 28712 TCTAAGACACATACAG 224 1079095 N/A N/A 28696 28711 CTAAGACACATACAGG 225 1079096 N/A N/A 28695 28710 TAAGACACATACAGGT 226

[0558] Modified oligonucleotides complementary to a human PMP22 nucleic acid were designed, as described in Table 33 below. The modified oligonucleotides in Table 33 are 16-mer gapmers with mixed sugar motifs as indicated in the table below, wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety; ‘e’ represents a 2′-MOE sugar moiety, ‘k’ represents a cEt sugar moiety; and ‘y’ represents a 2′-OMe sugar moiety. All internucleoside linkages are phosphorothioate internucleoside linkages. Each cytosine residue is a 5-methylcytosine, unless indicated by a bold underlined ‘C’, in which case, the cytosine is not methylated.

TABLE-US-00033 TABLE 33 Modified oligonucleotide gapmers with mixed sugar moieties and uniform PS internucleoside linkages complementary to human PMP22 SEQ ID SEQ ID SEQ ID SEQ ID NO: 1 NO: 1 NO: 2 NO: 2 Compound Start Stop Start Stop Sugar Motif SEQ ID ID Site Site Site Site Sequence (5′ to 3′) (5′ to 3′) NO 1421217 N/A N/A  9499  9514 AAATACGATCTTCTGG eekkddddddddkkee 239 1421216 N/A N/A  9498  9513 AATACGATCTTCTGGA eekkdddddddkdkee 238 1421268 1489 1504 37852 37867 ATTATTCAGGTCTCCA ekkddddddddddkke  19 1421270 N/A N/A  9498  9513 AATACGATCTTCTGGA ekkddddddddddkke 238 1421271 N/A N/A  9499  9514 AAATACGATCTTCTGG ekkddddddddddkke 239 1421219 1489 1504 37852 37867 ATTATTCAGGTCTCCA ekkddddddddddkkk  19 1421221 N/A N/A  9498  9513 AATACGATCTTCTGGA ekkddddddddddkkk 238 1421222 N/A N/A  9499  9514 AAATACGATCTTCTGG ekkddddddddddkkk 239 1421274 N/A N/A  9498  9513 AATACGATCTTCTGGA ekkkdddddddddkkk 238 1421275 N/A N/A  9499  9514 AAATACGATCTTCTGG ekkkdddddddddkkk 239 1421223 1489 1504 37852 37867 ATTATTCAGGTCTCCA kekddddddddddkkk  19 1421225 N/A N/A  9498  9513 AATACGATCTTCTGGA kekddddddddddkkk 238 1421226 N/A N/A  9499  9514 AAATACGATCTTCTGG kekddddddddddkkk 239 1421235 N/A N/A 19079 19094 CGGGAAAGGCAGTTGC kkeddddddddddkkk 220 1421236 N/A N/A  9498  9513 AATACGATCTTCTGGA kkeddddddddddkkk 238 1421237 N/A N/A  9499  9514 AAATACGATCTTCTGG kkeddddddddddkkk 239 1421240 N/A N/A  9498  9513 AATACGATCTTCTGGA kkkddddddddddekk 238 1421241 N/A N/A  9499  9514 AAATACGATCTTCTGG kkkddddddddddekk 239 1421244 N/A N/A  9498  9513 AATACGATCTTCTGGA kkkddddddddddkek 238 1421245 N/A N/A  9499  9514 AAATACGATCTTCTGG kkkddddddddddkek 239 1421266 N/A N/A  9498  9513 AATACGATCTTCTGGA kkkddddddddddkke 238 1421267 N/A N/A  9499  9514 AAATACGATCTTCTGG kkkddddddddddkke 239 1421284 1489 1504 37852 37867 ATTATTCAGGTCTCCA kkkdddddddddekkk  19 1421285 N/A N/A 19079 19094 CGGGAAAGGCAGTTGC kkkdddddddddekkk 220 1421286 N/A N/A  9498  9513 AATACGATCTTCTGGA kkkdddddddddekkk 238 1421287 N/A N/A  9499  9514 AAATACGATCTTCTGG kkkdddddddddekkk 239 1421276 1489 1504 37852 37867 ATTATTCAGGTCTCCA kkkdddddddddkkke  19 1421278 N/A N/A  9498  9513 AATACGATCTTCTGGA kkkdddddddddkkke 238 1421279 N/A N/A  9499  9514 AAATACGATCTTCTGG kkkdddddddddkkke 239 1421133 N/A N/A  9498  9513 AATACGATCTTCTGGA kkkdyddddddddkkk 238 1421134 N/A N/A  9499  9514 AAATACGATCTTCTGG kkkdyddddddddkkk 239 1421280 1489 1504 37852 37867 ATTATTCAGGTCTCCA kkkedddddddddkkk  19 1421281 N/A N/A 19079 19094 CGGGAAAGGCAGTTGC kkkedddddddddkkk 220 1421282 N/A N/A  9498  9513 AATACGATCTTCTGGA kkkedddddddddkkk 238 1421283 N/A N/A  9499  9514 AAATACGATCTTCTGG kkkedddddddddkkk 239

Example 9: Effect of Modified Oligonucleotides on Human PMP22 in Transgenic Mice

[0559] C22 mice, described in Huxley et al., Human Molecular Genetics, 5, 563-569 (1996) and Verhamme et al., Journal of Neuropathology and Experimental Neurology, 70, 386-398 (2011), express endogenous mouse PMP22 and overexpress a human PMP22 transgene. The effect of modified oligonucleotides on human PMP22 RNA was tested in symptomatic C22 mice.

[0560] C22 mice were divided into groups of 1-2 mice each and administered a single dose of 50 mg/kg of modified oligonucleotide by intravenous injection as indicated in the tables below. A group of 1-3 mice was administered a single dose of PBS by intravenous injection. This group serves as the control group to which other groups were compared. Mice were sacrificed 14-17 days post treatment. The number of mice in a treatment group in each experiment is noted in each experimental table below as the “n” number. Total RNA was isolated from the sciatic nerve for analysis. Levels of human PMP22 RNA were measured by quantitative real-time RTPCR using human primer probe set RTS4579 (forward sequence CTTGCTGGTCTGTGCGTGAT, designated herein as SEQ ID NO: 9; reverse sequence ACCGTAGGAGTAATCCGAGTTGAG, designated herein as SEQ ID NO: 10; probe sequence CATCTACACGGTGAGGCACCCGG, designated herein as SEQ ID NO: 11). Data were normalized to the control group and are presented in the table below.

TABLE-US-00034 TABLE 34 Reduction of human PMP22 in C22 transgenic mice, n = 1, 17 days PMP22 RNA (% Control) Compound ID RTS4579 PBS 100 1078137 123 1078138 117 1078139 116 1078141 90 1078143 100 1078145 123 1078146 173 1078147 112 1078148 131 1078149 103 1078150 107 1078151 112 1078161 105 1078162 116 1078163 95 1078911 101 1078921 86 1078924 94 1078977 99 1078979 113 1078980 108 1079047 105 1079048 197 1079049 120 1079053 171 1079093 87 1079094 103 1079095 82 1079096 106 1079052 103

TABLE-US-00035 TABLE 35 Reduction of human PMP22 in C22 transgenic mice, n = 2, 14 days PMP22 RNA (% Control) Compound ID RTS4579 PBS 100 1421133 106 1421134 106 1421216 92 1421217 95 1421219 103 1421221 80 1421222 71 1421223 86 1421225 77 1421226 68 1421235 115 1421236 76 1421237 45 1421240 71 1421241 62 1421244 71 1421245 63 1421266 70 1421267 49 1421268 86 1421270 86 1421271 83 1421274 100 1421275 50 1421276 91 1421278 71 1421279 66 1421280 90 1421281 85 1421282 93 1421283 36 1421284 63 1421285 91 1421286 41 1421287 39

Example 10: Design of Modified Oligonucleotides Complementary to a Human PMP22 Nucleic Acid

[0561] Modified oligonucleotides complementary to a human PMP22 nucleic acid were designed and synthesized. “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO:2 (described herein above).

[0562] The modified oligonucleotides in the table below are 16 nucleosides in length. The sugar motif for the modified oligonucleotides are described in the column labeled “Sugar Motif (5′ to 3′)” in the table below, wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, each “k” represents a cEt sugar moiety, and each “e” represents a 2′-MOE sugar moiety. The internucleoside linkage motifs for the modified oligonucleotides are described in the column labeled “Internucleoside Linkage Motif (5′ to 3′)” in the table below, wherein each “s” represents a phosphorothioate internucleoside linkage and each “z” represents a mesyl phosphoramidate internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

[0563] The modified oligonucleotides in the table below are conjugated to a 6-palmitamidohexyl phosphate conjugate group attached to the 5′-OH of the oligonucleotide. The structure for the conjugate group is:

##STR00023##

[0564] The modified oligonucleotides in the table below are 16 nucleosides in length. The sugar motifs for the modified oligonucleotides are described in the column labeled “Sugar Motif (5′ to 3′)” in the table below, wherein each “d” represents a 2′-β-D-deoxyribosyl sugar moiety, each “k” represents a cEt sugar moiety, and each “e” represents a 2′-MOE sugar moiety. The intemucleoside linkage motifs for the modified oligonucleotides are described in the column labeled “Intemucleoside Linkage Motif (5′ to 3′)” in the table below, wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “z” represents a mesyl phosphoramidate internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

TABLE-US-00036 TABLE 36 6-palmitamidohexyl phosphate conjugated 3-10-3 cEt or mixed cEt/MOE modified oligonucleotides with either uniform PS or mixed backbone internucleoside linkages complementary to human PMP22 SEQ ID SEQ ID NO: 2 NO: 2 Internucleoside Compound Antisense Sequence Antisense Antisense Sugar Motif Linkage Motif SEQ ID No. (5′ to 3′) Start Site Stop Site (5′ to 3′) (5′ to 3′) NO. 1089870 AAATACGATCTTCT 9499 9514 kkkdddddddddd sssssssssssssss 239 GG kkk 1421315 AAATACGATCTTCT 9499 9514 kkedddddddddd sssssssssssssss 239 GG kkk 1421353 AAATACGATCTTCT 9499 9514 kkkddddddddde sssssssssssssss 239 GG kkk

Example 11: Effect of Modified Oligonucleotides on Human PMP22 RNA In Vitro, Multiple Doses

[0565] Modified oligonucleotides selected from the example above were tested at various doses in A431 cells. Cultured A431 cells at a density of 10,000 cells per well were treated by free uptake with various concentrations of modified oligonucleotides specified in the table below. After a treatment period of approximately 72 hours, RNA was isolated from the cells and PMP22 RNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS4579 (described herein above) was used to measure RNA levels. PMP22 RNA levels were normalized to total RNA content, as measured by GAPDH (forward sequence GAAGGTGAAGGTCGGAGTC, designated herein as SEQ ID NO: 946; reverse sequence GAAGATGGTGATGGGATTTC, designated herein as SEQ ID NO: 947; probe sequence CAAGCTTCCCGTTCTCAGCCX, designated herein as SEQ ID NO: 948). Results are presented as percent PMP22 RNA relative to the amount in untreated control cells (% UTC).

TABLE-US-00037 TABLE 37 Dose-dependent reduction of human PMP22 RNA in A431 cells by modified oligonucleotides Compound Concentration PMP22 IC50 No. (nM) (% UTC) (μM) 923867 20000 5 0.11 8000 5 3200 6 1280 9 512 17 205 33 82 56 33 81 13 89 5 96 1089870 20000 5 0.20 8000 7 3200 11 1280 18 512 23 205 45 82 70 33 94 13 101 5 99 1421315 20000 7 0.15 8000 10 3200 13 1280 17 512 25 205 42 82 62 33 78 13 82 5 91 1421353 20000 3 0.14 8000 7 3200 9 1280 15 512 20 205 38 82 73 33 80 13 84 5 98

Example 12: Design of RNAi Compounds with Antisense RNAi Oligonucleotides Complementary to a Human PMP22 Nucleic Acid

[0566] RNAi compounds comprising antisense RNAi oligonucleotides complementary to a human PMP22 nucleic acid and sense RNAi oligonucleotides complementary to the antisense RNAi oligonucleotides were designed as follows.

[0567] “Start site” indicates the 5′-most nucleoside to which the antisense RNAi oligonucleotides is complementary in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. Each modified antisense RNAi oligonucleoside listed in the tables below is 100% complementary to SEQ ID NO: 1 (described herein above).

[0568] The RNAi compounds in the tables below consist of an antisense RNAi oligonucleotide and a sense RNAi oligonucleotide. In the table below, each antisense RNAi oligonucleotide is 23 nucleosides in length; has a sugar motif (from 5′ to 3′) of: yfyfyfyfyfyfyfyfyfyfyyy, wherein each “y” represents a 2′-O-Me sugar moiety, and each “f” represents a 2′-F sugar moiety; and has an intemucleoside linkage motif (from 5′ to 3′) of: ssooooooooooooooooooss, wherein each “o” represents a phosphodiester intemucleoside linkage, and each “s” represents a phosphorothioate intemucleoside linkage. Each sense RNAi oligonucleotide in the table below is 21 nucleosides in length; has a sugar motif (from 5′ to 3′) of: fyfyfyfyfyfyfyfyfyfyf, wherein each “y” represents a 2′-O—OMe sugar moiety, and each “f” represents a 2′-F sugar moiety; and has an intemucleoside linkage motif (from 5′ to 3′) of: ssooooooooooooooooss, wherein each “o” represents a phosphodiester intemucleoside linkage, and each “s” represents a phosphorothioate intemucleoside linkage. Each antisense RNAi oligonucleotide is complementary to the target nucleic acid (PMP22), and each sense RNAi oligonucleotide is complementary to the first of the 21 nucleosides of the antisense RNAi oligonucleotide (from 5′ to 3′) wherein the last two 3′-nucleosides of the antisense RNAi oligonucleotides are not paired with the sense RNAi oligonucleotide (are overhanging nucleosides).

TABLE-US-00038 TABLE 38 RNAi compounds targeting human PMP22 SEQ ID NO: 1 SEQ ID SEQ ID NO: 1 NO: 1 Antisense SEQ Antisense Antisense Sense SEQ Compound Antisense Sequence ID Start Stop Sense  Sequence ID Number ID (5′ to 3′) NO. Site Site ID (5′ to 3′) NO. 1579592 1579604 CAAGAUCACAUA 322 684 706 1579603 GGUGUCAUCUA 633 GAUGACACCGC UGUGAUCUUG 1579593 1579609 GACACCGCUGAG 323 669 691 1579602 CUGGCCCUUCU 634 AAGGGCCAGGG CAGCGGUGUC 1579594 1579606 GGCCAGGGGGAA 324 654 676 1579598 UGGGUGGCCUU 635 GGCCACCCAGG CCCCCUGGCC 1579595 1579608 CACCCAGGCCAG 325 639 661 1579600 GCCUACAUCCU 636 GAUGUAGGCGA GGCCUGGGUG 1579596 1579605 GAGAUGCCACUC 326 594 616 1579599 AGGCACCCGGA 637 CGGGUGCCUCA GUGGCAUCUC 1579597 1579607 UCAUUCGCGUUU 327 699 721 1579601 AUCUUGCGGAA 638 CCGCAAGAUCA ACGCGAAUGA 1579610 1579627 GUAGGCGAAACC 328 624 646 1579619 UACUCCUACGG 639 GUAGGAGUAAU UUUCGCCUAC 1579611 1579622 AGCAAGAAUUUG 329 534 556 1579616 GGAAUCUUCCA 640 GAAGAUUCCAG AAUUCUUGCU 1579612 1579626 CAUCACGCACAG 330 549 571 1579617 CUUGCUGGUCU 641 ACCAGCAAGAA GUGCGUGAUG 1579613 1579623 GAUGGCCGCAGC 331 564 586 1579620 GUGAUGAGUGC 642 ACUCAUCACGC UGCGGCCAUC 1579614 1579625 GUGCCUCACCGU 332 579 601 1579618 GCCAUCUACAC 643 GUAGAUGGCCG GGUGAGGCAC 1579615 1579624 GGAGUAAUCCGA 333 609 631 1579621 CAUCUCAACUC 644 GUUGAGAUGCC GGAUUACUCC 1579628 1579643 GAUUCCAGUGAU 334 519 541 1579636 AGGUUUUACAU 645 GUAAAACCUGC CACUGGAAUC 1579629 1579640 GCUGAAGAUGAU 335 444 466 1579635 AUCCUGUCGAU 646 CGACAGGAUCA CAUCUUCAGC 1579630 1579641 GAACAGAGACAG 336 459 481 1579634 UUCAGCAUUCU 647 AAUGCUGAAGA GUCUCUGUUC 1579631 1579645 UUGGCAGAAGAA 337 474 496 1579638 CUGUUCCUGUU 648 CAGGAACAGAG CUUCUGCCAA 1579632 1579644 GGUGAGGGUGAA 338 489 511 1579639 UGCCAACUCUU 649 GAGUUGGCAGA CACCCUCACC 1579633 1579642 AAACCUGCCCCC 339 504 526 1579637 CUCACCAAGGG 650 CUUGGUGAGGG GGGCAGGUUU 1579646 1579659 CAGGAUCAUGGU 340 429 451 1579656 GUCCAGGCCAC 651 GGCCUGGACAG CAUGAUCCUG 1579647 1579663 GGAAGAGGUGCU 341 354 376 1579653 CAGAACUGUAG 652 ACAGUUCUGCC CACCUCUUCC 1579648 1579661 GUGGACAUUUCC 342 369 391 1579654 UCUUCCUCAGG 653 UGAGGAAGAGG AAAUGUCCAC 1579649 1579660 CUGGACAGACUG 343 414 436 1579657 GAAUGGCUGCA 654 CAGCCAUUCGU GUCUGUCCAG 1579650 1579658 UGAUGAGAAACA 344 384 406 1579652 GUCCACCACUG 655 GUGGUGGACAU UUUCUCAUCA 1579651 1579662 CCAUUCGUUUGG 345 399 421 1579655 UCAUCAUCACC 656 UGAUGAUGAGA AAACGAAUGG 1579664 1579677 GUUCUGCCAGAG 346 339 361 1579670 GCAACUGAUCU 657 AUCAGUUGCGU CUGGCAGAAC 1579665 1579676 GCUGACGAUCGU 347 294 316 1579671 UUCGUCUCCAC 658 GGAGACGAACA GAUCGUCAGC 1579666 1579680 GCCCACGAUCCA 348 309 331 1579673 GUCAGCCAAUG 659 UUGGCUGACGA GAUCGUGGGC 1579667 1579679 AGUUGCGUGUCC 349 324 346 1579672 GUGGGCAAUGG 660 AUUGCCCACGA ACACGCAACU 1579668 1579678 CAGCACCGCGAC 350 264 286 1579674 GUCCUCCACGU 661 GUGGAGGACGA CGCGGUGCUG 1579669 1579681 GACGAACAGCAG 351 279 301 1579675 GUGCUGGUGCU 662 CACCAGCACCG GCUGUUCGUC 1579682 1579694 GAGGACGAUGAU 352 249 271 1579690 UUGCUGAGUAU 663 ACUCAGCAACA CAUCGUCCUC 1579683 1579695 AUGUUUAUUUUA 353 1825 1847 1579688 AAGAUGCAUUA 664 AUGCAUCUUAG AAAUAAACAU 1579684 1579696 UCUGAUGUUUAU 354 1829 1851 1579689 UGCAUUAAAAU 665 UUUAAUGCAUC AAACAUCAGA 1579685 1579698 UGAGUUACUCUG 355 1837 1859 1579693 AAUAAACAUCA 666 AUGUUUAUUUU GAGUAACUCA 1579686 1579697 UUACUCUGAUGU 356 1833 1855 1579691 UUAAAAUAAAC 667 UUAUUUUAAUG AUCAGAGUAA 1579687 1579699 UUAUUUUAAUGC 357 1821 1843 1579692 GACUAAGAUGC 668 AUCUUAGUCCA AUUAAAAUAA 1579700 1579711 UUUAAUGCAUCU 358 1817 1839 1579704 UGUGGACUAAG 669 UAGUCCACACA AUGCAUUAAA 1579701 1579717 UAGUCCACACAG 359 1805 1827 1579708 UUAUACCAACU 670 UUGGUAUAAAA GUGUGGACUA 1579702 1579714 CCACACAGUUGG 360 1801 1823 1579712 GAUUUUAUACC 671 UAUAAAAUCAG AACUGUGUGG 1579703 1579716 AUCUUAGUCCAC 361 1809 1831 1579710 ACCAACUGUGU 672 ACAGUUGGUAU GGACUAAGAU 1579705 1579713 AUGCAUCUUAGU 362 1813 1835 1579709 ACUGUGUGGAC 673 CCACACAGUUG UAAGAUGCAU 1579706 1579715 ACAGUUGGUAUA 363 1797 1819 1579707 UUCUGAUUUUA 674 AAAUCAGAAAA UACCAACUGU 1579718 1579730 UUGGUAUAAAAU 364 1793 1815 1579724 CAUUUUCUGAU 675 CAGAAAAUGCA UUUAUACCAA 1579719 1579732 AAAUGCAAAGCA 365 1777 1799 1579725 UUUUGUUUUUG 676 AAAACAAAAGG CUUUGCAUUU 1579720 1579735 GCAAAGCAAAAA 366 1773 1795 1579729 GACCUUUUGUU 677 CAAAAGGUCUG UUUGCUUUGC 1579721 1579733 CAGAAAAUGCAA 367 1781 1803 1579728 GUUUUUGCUUU 678 AGCAAAAACAA GCAUUUUCUG 1579722 1579731 AAAUCAGAAAAU 368 1785 1807 1579726 UUGCUUUGCAU 679 GCAAAGCAAAA UUUCUGAUUU 1579723 1579734 UAUAAAAUCAGA 369 1789 1811 1579727 UUUGCAUUUUC 680 AAAUGCAAAGC UGAUUUUAUA 1579736 1579748 AGCAAAAACAAA 370 1769 1791 1579742 UCCAGACCUUU 681 AGGUCUGGAGU UGUUUUUGCU 1579737 1579749 AAAACAAAAGGU 371 1765 1787 1579743 AGACUCCAGAC 682 CUGGAGUCUUA CUUUUGUUUU 1579738 1579751 AGGUCUGGAGUC 372 1757 1779 1579746 UGAUGCUAAGA 683 UUAGCAUCAGA CUCCAGACCU 1579739 1579753 CAAAAGGUCUGG 373 1761 1783 1579744 GCUAAGACUCC 684 AGUCUUAGCAU AGACCUUUUG 1579740 1579752 AGUCUUAGCAUC 374 1749 1771 1579747 UGCCCUUCUGA 685 AGAAGGGCACC UGCUAAGACU 1579741 1579750 CUGGAGUCUUAG 375 1753 1775 1579745 CUUCUGAUGCU 686 CAUCAGAAGGG AAGACUCCAG 1579754 1579763 UUAGCAUCAGAA 376 1745 1767 1579760 AUGGUGCCCUU 687 GGGCACCAUAU CUGAUGCUAA 1579755 1579769 AGAAGGGCACCA 377 1737 1759 1579764 AUGUAUAUAUG 688 UAUAUACAUCU GUGCCCUUCU 1579756 1579768 CAUCAGAAGGGC 378 1741 1763 1579762 AUAUAUGGUGC 689 ACCAUAUAUAC CCUUCUGAUG 1579757 1579770 UAUAUACAUCUA 379 1725 1747 1579761 CACCAACUGUA 690 CAGUUGGUGGC GAUGUAUAUA 1579758 1579767 ACCAUAUAUACA 380 1729 1751 1579766 AACUGUAGAUG 691 UCUACAGUUGG UAUAUAUGGU 1579759 1579771 GGGCACCAUAUA 381 1733 1755 1579765 GUAGAUGUAUA 692 UACAUCUACAG UAUGGUGCCC 1579772 1579780 UACAUCUACAGU 382 1721 1743 1579776 UGGCCACCAAC 693 UGGUGGCCAAU UGUAGAUGUA 1579773 1579778 CAGUUGGUGGCC 383 1713 1735 1579775 ACUUGUAUUGG 694 AAUACAAGUCA CCACCAACUG 1579774 1579779 UCUACAGUUGGU 384 1717 1739 1579777 GUAUUGGCCAC 695 GGCCAAUACAA CAACUGUAGA 1579781 1579787 UGGUGGCCAAUA 385 1709 1731 1579784 AAUGACUUGUA 696 CAAGUCAUUGC UUGGCCACCA 1579782 1579791 AAUACAAGUCAU 386 1701 1723 1579785 UGUCUGGCAAU 697 UGCCAGACAGU GACUUGUAUU 1579783 1579795 UGCCAGACAGUC 387 1689 1711 1579786 GCCUCCAAGGA 698 CUUGGAGGCAC CUGUCUGGCA 1579788 1579798 GGCCAAUACAAG 388 1705 1727 1579792 UGGCAAUGACU 699 UCAUUGCCAGA UGUAUUGGCC 1579789 1579797 CAAGUCAUUGCC 389 1697 1719 1579793 GGACUGUCUGG 700 AGACAGUCCUU CAAUGACUUG 1579790 1579796 UCAUUGCCAGAC 390 1693 1715 1579794 CCAAGGACUGU 701 AGUCCUUGGAG CUGGCAAUGA 1579799 1579814 AGACAGUCCUUG 391 1685 1707 1579808 CUGUGCCUCCA 702 GAGGCACAGAA AGGACUGUCU 1579800 1579813 GAACAGCCUAGA 392 1665 1687 1579806 UUGGCUGGGUC 703 CCCAGCCAAGC UAGGCUGUUC 1579801 1579812 CACAGAACAGCC 393 1669 1691 1579807 CUGGGUCUAGG 704 UAGACCCAGCC CUGUUCUGUG 1579802 1579811 CUUGGAGGCACA 394 1677 1699 1579805 AGGCUGUUCUG 705 GAACAGCCUAG UGCCUCCAAG 1579803 1579816 AGUCCUUGGAGG 395 1681 1703 1579809 UGUUCUGUGCC 706 CACAGAACAGC UCCAAGGACU 1579804 1579815 GAGGCACAGAAC 396 1673 1695 1579810 GUCUAGGCUGU 707 AGCCUAGACCC UCUGUGCCUC 1579817 1579830 AGCCUAGACCCA 397 1661 1683 1579825 GAGCUUGGCUG 708 GCCAAGCUCUA GGUCUAGGCU 1579818 1579829 AGCUCUAGGAAC 398 1645 1667 1579824 GGACCGUGAGU 709 UCACGGUCCCA UCCUAGAGCU 1579819 1579831 GCCAAGCUCUAG 399 1649 1671 1579823 CGUGAGUUCCU 710 GAACUCACGGU AGAGCUUGGC 1579820 1579833 CCCAGCCAAGCU 400 1653 1675 1579826 AGUUCCUAGAG 711 CUAGGAACUCA CUUGGCUGGG 1579821 1579832 UAGACCCAGCCA 401 1657 1679 1579827 CCUAGAGCUUG 712 AGCUCUAGGAA GCUGGGUCUA 1579822 1579834 CUAGGAACUCAC 402 1641 1663 1579828 CUUGGGACCGU 713 GGUCCCAAGGA GAGUUCCUAG 1579835 1579848 GGUCCCAAGGAG 403 1629 1651 1579841 GCGUCUAGACU 714 UCUAGACGCUU CCUUGGGACC 1579836 1579847 UCACGGUCCCAA 404 1633 1655 1579842 CUAGACUCCUU 715 GGAGUCUAGAC GGGACCGUGA 1579837 1579851 GAACUCACGGUC 405 1637 1659 1579846 ACUCCUUGGGA 716 CCAAGGAGUCU CCGUGAGUUC 1579838 1579850 UCUAGACGCUUG 406 1617 1639 1579843 GCAUCAGAACA 717 UUCUGAUGCUC AGCGUCUAGA 1579839 1579852 GGAGUCUAGACG 407 1621 1643 1579845 CAGAACAAGCG 718 CUUGUUCUGAU UCUAGACUCC 1579840 1579849 CCAAGGAGUCUA 408 1625 1647 1579844 ACAAGCGUCUA 719 GACGCUUGUUC GACUCCUUGG 1579853 1579867 GACGCUUGUUCU 409 1613 1635 1579862 CGGAGCAUCAG 720 GAUGCUCCGAC AACAAGCGUC 1579854 1579866 GACCGUAAGAAA 410 1593 1615 1579860 UCCCACAUUUU 721 AAUGUGGGAGU UCUUACGGUC 1579855 1579865 CUCCGACCGUAA 411 1597 1619 1579859 ACAUUUUUCUU 722 GAAAAAUGUGG ACGGUCGGAG 1579856 1579870 UUCUGAUGCUCC 412 1605 1627 1579861 CUUACGGUCGG 723 GACCGUAAGAA AGCAUCAGAA 1579857 1579869 GAUGCUCCGACC 413 1601 1623 1579864 UUUUCUUACGG 724 GUAAGAAAAAU UCGGAGCAUC 1579858 1579868 CUUGUUCUGAUG 414 1609 1631 1579863 CGGUCGGAGCA 725 CUCCGACCGUA UCAGAACAAG 1579871 1579884 GUAAGAAAAAUG 415 1589 1611 1579880 UCACUCCCACA 726 UGGGAGUGAUG UUUUUCUUAC 1579872 1579886 AGUGAUGAAGGC 416 1573 1595 1579878 AAUCAUAAAGC 727 UUUAUGAUUUA CUUCAUCACU 1579873 1579882 UGGGAGUGAUGA 417 1577 1599 1579877 AUAAAGCCUUC 728 AGGCUUUAUGA AUCACUCCCA 1579874 1579887 AAUGUGGGAGUG 418 1581 1603 1579881 AGCCUUCAUCA 729 AUGAAGGCUUU CUCCCACAUU 1579875 1579885 GAAAAAUGUGGG 419 1585 1607 1579879 UUCAUCACUCC 730 AGUGAUGAAGG CACAUUUUUC 1579876 1579888 AUGAAGGCUUUA 420 1569 1591 1579883 AGUAAAUCAUA 731 UGAUUUACUCA AAGCCUUCAU 1579889 1579904 UUUAUGAUUUAC 421 1561 1583 1579897 CUAUAAUGAGU 732 UCAUUAUAGUA AAAUCAUAAA 1579890 1579905 UCAUUAUAGUAA 422 1549 1571 1579899 CUGCUAUUAUU 733 UAAUAGCAGCC ACUAUAAUGA 1579891 1579902 UAUAGUAAUAAU 423 1545 1567 1579896 UAGGCUGCUAU 734 AGCAGCCUAGC UAUUACUAUA 1579892 1579901 UGAUUUACUCAU 424 1557 1579 1579895 AUUACUAUAAU 735 UAUAGUAAUAA GAGUAAAUCA 1579893 1579903 AGGCUUUAUGAU 425 1565 1587 1579898 AAUGAGUAAAU 736 UUACUCAUUAU CAUAAAGCCU 1579894 1579906 UUACUCAUUAUA 426 1553 1575 1579900 UAUUAUUACUA 737 GUAAUAAUAGC UAAUGAGUAA 1579907 1579920 GUAAUAAUAGCA 427 1541 1563 1579914 UAGCUAGGCUG 738 GCCUAGCUAGG CUAUUAUUAC 1579908 1579919 AGCUAGGUACAA 428 1525 1547 1579913 UAACUGCUUUU 739 AAGCAGUUAUA GUACCUAGCU 1579909 1579921 GCCUAGCUAGGU 429 1529 1551 1579915 UGCUUUUGUAC 740 ACAAAAGCAGU CUAGCUAGGC 1579910 1579923 UAAUAGCAGCCU 430 1537 1559 1579916 UACCUAGCUAG 741 AGCUAGGUACA GCUGCUAUUA 1579911 1579924 AGCAGCCUAGCU 431 1533 1555 1579917 UUUGUACCUAG 742 AGGUACAAAAG CUAGGCUGCU 1579912 1579922 AGGUACAAAAGC 432 1521 1543 1579918 UUUAUAACUGC 743 AGUUAUAAACC UUUUGUACCU 1579925 1579939 ACAAAAGCAGUU 433 1517 1539 1579933 AUGGUUUAUAA 744 AUAAACCAUUU CUGCUUUUGU 1579926 1579938 UUUAUAUUACAC 434 1497 1519 1579936 AAUAAUUCUGU 745 AGAAUUAUUCA GUAAUAUAAA 1579927 1579937 ACCAUUUAUAUU 435 1501 1523 1579931 AUUCUGUGUAA 746 ACACAGAAUUA UAUAAAUGGU 1579928 1579942 AUAAACCAUUUA 436 1505 1527 1579932 UGUGUAAUAUA 747 UAUUACACAGA AAUGGUUUAU 1579929 1579941 AGUUAUAAACCA 437 1509 1531 1579934 UAAUAUAAAUG 748 UUUAUAUUACA GUUUAUAACU 1579930 1579940 AAGCAGUUAUAA 438 1513 1535 1579935 AUAAAUGGUUU 749 ACCAUUUAUAU AUAACUGCUU 1579943 1579957 UAUUACACAGAA 439 1493 1515 1579951 CCUGAAUAAUU 750 UUAUUCAGGUC CUGUGUAAUA 1579944 1579955 GUCUCCAUUCUA 440 1473 1495 1579952 AACAUAAGAUA 751 UCUUAUGUUGU GAAUGGAGAC 1579945 1579960 UCAGGUCUCCAU 441 1477 1499 1579954 UAAGAUAGAAU 752 UCUAUCUUAUG GGAGACCUGA 1579946 1579958 UUAUUCAGGUCU 442 1481 1503 1579953 AUAGAAUGGAG 753 CCAUUCUAUCU ACCUGAAUAA 1579947 1579956 AGAAUUAUUCAG 443 1485 1507 1579950 AAUGGAGACCU 754 GUCUCCAUUCU GAAUAAUUCU 1579948 1579959 ACACAGAAUUAU 444 1489 1511 1579949 GAGACCUGAAU 755 UCAGGUCUCCA AAUUCUGUGU 1579961 1579974 UGUAAAAUUGUU 445 1453 1475 1579967 AAUCCAAUUAA 756 AAUUGGAUUUC CAAUUUUACA 1579962 1579973 CCAUUCUAUCUU 446 1469 1491 1579968 UUACAACAUAA 757 AUGUUGUAAAA GAUAGAAUGG 1579963 1579975 AUGUUGUAAAAU 447 1457 1479 1579969 CAAUUAACAAU 758 UGUUAAUUGGA UUUACAACAU 1579964 1579978 UCUUAUGUUGUA 448 1461 1483 1579970 UAACAAUUUUA 759 AAAUUGUUAAU CAACAUAAGA 1579965 1579976 UCUAUCUUAUGU 449 1465 1487 1579971 AAUUUUACAAC 760 UGUAAAAUUGU AUAAGAUAGA 1579966 1579977 AAAUUGUUAAUU 450 1449 1471 1579972 UGGAAAUCCAA 761 GGAUUUCCAGU UUAACAAUUU 1579979 1579989 UUCCAGUGAGUU 451 1433 1455 1579983 CAUCUAAACAA 762 GUUUAGAUGAU CUCACUGGAA 1579980 1579991 AGUUGUUUAGAU 452 1425 1447 1579984 UCACUAAUCAU 763 GAUUAGUGAUA CUAAACAACU 1579981 1579990 AGUGAGUUGUUU 453 1429 1451 1579985 UAAUCAUCUAA 764 AGAUGAUUAGU ACAACUCACU 1579982 1579992 GGAUUUCCAGUG 454 1437 1459 1579986 UAAACAACUCA 765 AGUUGUUUAGA CUGGAAAUCC 1579987 1579996 UGUUAAUUGGAU 455 1445 1467 1579994 UCACUGGAAAU 766 UUCCAGUGAGU CCAAUUAACA 1579988 1579995 AAUUGGAUUUCC 456 1441 1463 1579993 CAACUCACUGG 767 AGUGAGUUGUU AAAUCCAAUU 1579997 1580009 GUUUAGAUGAUU 457 1421 1443 1580003 AUUAUCACUAA 768 AGUGAUAAUAA UCAUCUAAAC 1579998 1580014 AUAAUAAGGAAU 458 1405 1427 1580007 GGAUUUACCAU 769 GGUAAAUCCAU UCCUUAUUAU 1579999 1580012 AGUGAUAAUAAG 459 1409 1431 1580006 UUACCAUUCCU 770 GAAUGGUAAAU UAUUAUCACU 1580000 1580010 GAUUAGUGAUAA 460 1413 1435 1580004 CAUUCCUUAUU 771 UAAGGAAUGGU AUCACUAAUC 1580001 1580011 AGAUGAUUAGUG 461 1417 1439 1580005 CCUUAUUAUCA 772 AUAAUAAGGAA CUAAUCAUCU 1580002 1580013 UAAGGAAUGGUA 462 1401 1423 1580008 CUAUGGAUUUA 773 AAUCCAUAGCA CCAUUCCUUA 1580015 1580027 GAAUGGUAAAUC 463 1397 1419 1580024 GGUGCUAUGGA 774 CAUAGCACCAU UUUACCAUUC 1580016 1580032 CAUUUCAAAGAC 464 1377 1399 1580022 UGACAACAAGU 775 UUGUUGUCACU CUUUGAAAUG 1580017 1580029 GCACCAUUUCAA 465 1381 1403 1580021 AACAAGUCUUU 776 AGACUUGUUGU GAAAUGGUGC 1580018 1580030 CAUAGCACCAUU 466 1385 1407 1580026 AGUCUUUGAAA 777 UCAAAGACUUG UGGUGCUAUG 1580019 1580031 GGUAAAUCCAUA 467 1393 1415 1580023 AAAUGGUGCUA 778 GCACCAUUUCA UGGAUUUACC 1580020 1580028 AAUCCAUAGCAC 468 1389 1411 1580025 UUUGAAAUGGU 779 CAUUUCAAAGA GCUAUGGAUU 1580033 1580045 UCAAAGACUUGU 469 1373 1395 1580039 UCAGUGACAAC 780 UGUCACUGAUU AAGUCUUUGA 1580034 1580050 AUUUCUCAUUUA 470 1353 1375 1580041 UCACACAUCUA 781 GAUGUGUGACG AAUGAGAAAU 1580035 1580048 ACUGAUUUCUCA 471 1357 1379 1580042 ACAUCUAAAUG 782 UUUAGAUGUGU AGAAAUCAGU 1580036 1580046 UGUCACUGAUUU 472 1361 1383 1580040 CUAAAUGAGAA 783 CUCAUUUAGAU AUCAGUGACA 1580037 1580047 UUGUUGUCACUG 473 1365 1387 1580044 AUGAGAAAUCA 784 AUUUCUCAUUU GUGACAACAA 1580038 1580049 AGACUUGUUGUC 474 1369 1391 1580043 GAAAUCAGUGA 785 ACUGAUUUCUC CAACAAGUCU 1580051 1580067 CUCAUUUAGAUG 475 1349 1371 1580061 UUCGUCACACA 786 UGUGACGAAGA UCUAAAUGAG 1580052 1580063 AGAUACUCCACC 476 1329 1351 1580058 GCCCUUACAGG 787 UGUAAGGGCAA UGGAGUAUCU 1580053 1580068 ACGAAGAUACUC 477 1333 1355 1580062 UUACAGGUGGA 788 CACCUGUAAGG GUAUCUUCGU 1580054 1580064 UGUGACGAAGAU 478 1337 1359 1580057 AGGUGGAGUAU 789 ACUCCACCUGU CUUCGUCACA 1580055 1580065 GAUGUGUGACGA 479 1341 1363 1580060 GGAGUAUCUUC 790 AGAUACUCCAC GUCACACAUC 1580056 1580066 UUUAGAUGUGUG 480 1345 1367 1580059 UAUCUUCGUCA 791 ACGAAGAUACU CACAUCUAAA 1580069 1580085 ACUCCACCUGUA 481 1325 1347 1580080 ACUUGCCCUUA 792 AGGGCAAGUAU CAGGUGGAGU 1580070 1580084 CAAGUAUGCCAA 482 1309 1331 1580077 CUUGUGGCAUU 793 UGCCACAAGCC GGCAUACUUG 1580071 1580081 UAUGCCAAUGCC 483 1305 1327 1580079 ACGGCUUGUGG 794 ACAAGCCGUGU CAUUGGCAUA 1580072 1580086 AGGGCAAGUAUG 484 1313 1335 1580078 UGGCAUUGGCA 795 CCAAUGCCACA UACUUGCCCU 1580073 1580083 UGUAAGGGCAAG 485 1317 1339 1580076 AUUGGCAUACU 796 UAUGCCAAUGC UGCCCUUACA 1580074 1580082 CACCUGUAAGGG 486 1321 1343 1580075 GCAUACUUGCC 797 CAAGUAUGCCA CUUACAGGUG 1580087 1580100 UGCCACAAGCCG 487 1297 1319 1580094 GCAAAAACACG 798 UGUUUUUGCAA GCUUGUGGCA 1580088 1580101 UGUUUUUGCAAG 488 1285 1307 1580093 ACUGGAGCCCU 799 GGCUCCAGUUU UGCAAAAACA 1580089 1580099 GCCGUGUUUUUG 489 1289 1311 1580095 GAGCCCUUGCA 800 CAAGGGCUCCA AAAACACGGC 1580090 1580103 ACAAGCCGUGUU 490 1293 1315 1580098 CCUUGCAAAAA 801 UUUGCAAGGGC CACGGCUUGU 1580091 1580102 CCAAUGCCACAA 491 1301 1323 1580096 AAACACGGCUU 802 GCCGUGUUUUU GUGGCAUUGG 1580092 1580104 UUUGCAAGGGCU 492 1281 1303 1580097 CCAAACUGGAG 803 CCAGUUUGGGC CCCUUGCAAA 1580105 1580120 CAAGGGCUCCAG 493 1277 1299 1580112 AUGCCCAAACU 804 UUUGGGCAUUU GGAGCCCUUG 1580106 1580119 UUUUGUCCGUGU 494 1257 1279 1580111 UUUACGCGCAC 805 GCGCGUAAAGC ACGGACAAAA 1580107 1580117 UUUGGGCAUUUU 495 1265 1287 1580114 CACACGGACAA 806 GUCCGUGUGCG AAUGCCCAAA 1580108 1580121 GGCAUUUUGUCC 496 1261 1283 1580116 CGCGCACACGG 807 GUGUGCGCGUA ACAAAAUGCC 1580109 1580122 CCAGUUUGGGCA 497 1269 1291 1580113 CGGACAAAAUG 808 UUUUGUCCGUG CCCAAACUGG 1580110 1580118 GGCUCCAGUUUG 498 1273 1295 1580115 CAAAAUGCCCA 809 GGCAUUUUGUC AACUGGAGCC 1580123 1580135 GUCCGUGUGCGC 499 1253 1275 1580129 AAGCUUUACGC 810 GUAAAGCUUCA GCACACGGAC 1580124 1580134 UCACACAGAGGU 500 1233 1255 1580128 GCUGCCCGAAC 811 UCGGGCAGCGG CUCUGUGUGA 1580125 1580136 AGCUUCACACAG 501 1237 1259 1580130 CCCGAACCUCU 812 AGGUUCGGGCA GUGUGAAGCU 1580126 1580137 GUAAAGCUUCAC 502 1241 1263 1580131 AACCUCUGUGU 813 ACAGAGGUUCG GAAGCUUUAC 1580127 1580138 GCGCGUAAAGCU 503 1245 1267 1580132 UCUGUGUGAAG 814 UCACACAGAGG CUUUACGCGC 1580133 1580140 GUGUGCGCGUAA 504 1249 1271 1580139 UGUGAAGCUUU 815 AGCUUCACACA ACGCGCACAC 1580141 1580153 AGGUUCGGGCAG 505 1225 1247 1580147 AAACAGCCGCU 816 CGGCUGUUUCU GCCCGAACCU 1580142 1580154 UCGGGCAGCGGC 506 1221 1243 1580148 ACAGAAACAGC 817 UGUUUCUGUUG CGCUGCCCGA 1580143 1580157 ACAGAGGUUCGG 507 1229 1251 1580149 AGCCGCUGCCC 818 GCAGCGGCUGU GAACCUCUGU 1580144 1580156 UGUUUCUGUUGG 508 1209 1231 1580151 CCAGUGCAUCC 819 AUGCACUGGGU AACAGAAACA 1580145 1580158 CGGCUGUUUCUG 509 1213 1235 1580150 UGCAUCCAACA 820 UUGGAUGCACU GAAACAGCCG 1580146 1580155 GCAGCGGCUGUU 510 1217 1239 1580152 UCCAACAGAAA 821 UCUGUUGGAUG CAGCCGCUGC 1580159 1580176 UCUGUUGGAUGC 511 1205 1227 1580168 UGACCCAGUGC 822 ACUGGGUCACC AUCCAACAGA 1580160 1580175 ACCCACCAGAAA 512 1185 1207 1580165 AAAAGCCCUUU 823 AGGGCUUUUGG UCUGGUGGGU 1580161 1580173 GGUCACCCACCA 513 1189 1211 1580166 GCCCUUUUCUG 824 GAAAAGGGCUU GUGGGUGACC 1580162 1580171 AUGCACUGGGUC 514 1197 1219 1580167 CUGGUGGGUGA 825 ACCCACCAGAA CCCAGUGCAU 1580163 1580174 UUGGAUGCACUG 515 1201 1223 1580170 UGGGUGACCCA 826 GGUCACCCACC GUGCAUCCAA 1580164 1580172 ACUGGGUCACCC 516 1193 1215 1580169 UUUUCUGGUGG 827 ACCAGAAAAGG GUGACCCAGU 1580177 1580191 ACCAGAAAAGGG 517 1181 1203 1580188 GUCCAAAAGCC 828 CUUUUGGACAU CUUUUCUGGU 1580178 1580193 CAUUUGGGGUUU 518 1161 1183 1580186 UGUGGGUAGAA 829 CUACCCACACU ACCCCAAAUG 1580179 1580190 UGGACAUUUGGG 519 1165 1187 1580187 GGUAGAAACCC 830 GUUUCUACCCA CAAAUGUCCA 1580180 1580194 AGGGCUUUUGGA 520 1173 1195 1580185 CCCCAAAUGUC 831 CAUUUGGGGUU CAAAAGCCCU 1580181 1580192 CUUUUGGACAUU 521 1169 1191 1580184 GAAACCCCAAA 832 UGGGGUUUCUA UGUCCAAAAG 1580182 1580189 GAAAAGGGCUUU 522 1177 1199 1580183 AAAUGUCCAAA 833 UGGACAUUUGG AGCCCUUUUC 1580195 1580209 GUUUCUACCCAC 523 1153 1175 1580202 AACCAAAGUGU 834 ACUUUGGUUUU GGGUAGAAAC 1580196 1580207 ACUUUGGUUUUC 524 1141 1163 1580201 CCUCAUUUAGA 835 UAAAUGAGGUG AAACCAAAGU 1580197 1580212 CCACACUUUGGU 525 1145 1167 1580205 AUUUAGAAAAC 836 UUUCUAAAUGA CAAAGUGUGG 1580198 1580210 CUACCCACACUU 526 1149 1171 1580204 AGAAAACCAAA 837 UGGUUUUCUAA GUGUGGGUAG 1580199 1580211 UGGGGUUUCUAC 527 1157 1179 1580206 AAAGUGUGGGU 838 CCACACUUUGG AGAAACCCCA 1580200 1580208 UGGUUUUCUAAA 528 1137 1159 1580203 UCCACCUCAUU 839 UGAGGUGGACU UAGAAAACCA 1580213 1580225 UUUCUAAAUGAG 529 1133 1155 1580221 CCAGUCCACCU 840 GUGGACUGGGA CAUUUAGAAA 1580214 1580227 GGAGGGAGGUAU 530 1113 1135 1580220 UGAAAGAAGAU 841 CUUCUUUCAGA ACCUCCCUCC 1580215 1580226 ACUGGGAGGGAG 531 1117 1139 1580219 AGAAGAUACCU 842 GUAUCUUCUUU CCCUCCCAGU 1580216 1580228 UGAGGUGGACUG 532 1125 1147 1580223 CCUCCCUCCCAG 843 GGAGGGAGGUA UCCACCUCA 1580217 1580230 GUGGACUGGGAG 533 1121 1143 1580222 GAUACCUCCCU 844 GGAGGUAUCUU CCCAGUCCAC 1580218 1580229 UAAAUGAGGUGG 534 1129 1151 1580224 CCUCCCAGUCC 845 ACUGGGAGGGA ACCUCAUUUA 1580231 1580243 GGAGGUAUCUUC 535 1109 1131 1580238 CAUCUGAAAGA 846 UUUCAGAUGAA AGAUACCUCC 1580232 1580246 GAAAGGGAAGGG 536 1089 1111 1580239 CCAUCUCGCCCC 847 GCGAGAUGGAG UUCCCUUUC 1580233 1580248 AGAUGAAAGGGA 537 1093 1115 1580237 CUCGCCCCUUCC 848 AGGGGCGAGAU CUUUCAUCU 1580234 1580244 CUUCUUUCAGAU 538 1101 1123 1580241 UUCCCUUUCAU 849 GAAAGGGAAGG CUGAAAGAAG 1580235 1580247 UUUCAGAUGAAA 539 1097 1119 1580240 CCCCUUCCCUU 850 GGGAAGGGGCG UCAUCUGAAA 1580236 1580245 GUAUCUUCUUUC 540 1105 1127 1580242 CUUUCAUCUGA 851 AGAUGAAAGGG AAGAAGAUAC 1580249 1580266 AGGGGCGAGAUG 541 1081 1103 1580256 AGAUAACUCCA 852 GAGUUAUCUUA UCUCGCCCCU 1580250 1580263 UAUCUUAUUUCU 542 1065 1087 1580259 GUUUUACCCAG 853 GGGUAAAACAA AAAUAAGAUA 1580251 1580265 GAUGGAGUUAUC 543 1073 1095 1580257 CAGAAAUAAGA 854 UUAUUUCUGGG UAACUCCAUC 1580252 1580261 GAGUUAUCUUAU 544 1069 1091 1580260 UACCCAGAAAU 855 UUCUGGGUAAA AAGAUAACUC 1580253 1580264 GCGAGAUGGAGU 545 1077 1099 1580258 AAUAAGAUAAC 856 UAUCUUAUUUC UCCAUCUCGC 1580254 1580262 GGGAAGGGGCGA 546 1085 1107 1580255 AACUCCAUCUC 857 GAUGGAGUUAU GCCCCUUCCC 1580267 1580282 UUCUGGGUAAAA 547 1057 1079 1580277 UUUGUUUUGUU 858 CAAAACAAACA UUACCCAGAA 1580268 1580284 ACAAACAAAAAA 548 1037 1059 1580273 UUUGUUUUGUU 859 CAAAACAAAAA UUUUGUUUGU 1580269 1580279 CAAAACAAACAA 549 1045 1067 1580274 GUUUUUUGUUU 860 ACAAAAAACAA GUUUGUUUUG 1580270 1580283 AAAACAAAACAA 550 1049 1071 1580275 UUUGUUUGUUU 861 ACAAACAAAAA GUUUUGUUUU 1580271 1580281 GGGUAAAACAAA 551 1053 1075 1580276 UUUGUUUGUUU 862 ACAAACAAACA UGUUUUACCC 1580272 1580280 UUAUUUCUGGGU 552 1061 1083 1580278 UUUUGUUUUAC 863 AAAACAAAACA CCAGAAAUAA 1580285 1580302 AAAACAAAACAA 553 1029 1051 1580294 UCAGUAUUUUU 864 AAAUACUGAGC GUUUUGUUUU 1580286 1580300 CAAAACAAAAAU 554 1025 1047 1580291 CAGCUCAGUAU 865 ACUGAGCUGGA UUUUGUUUUG 1580287 1580297 AAAUACUGAGCU 555 1017 1039 1580293 GUAUAAUCCAG 866 GGAUUAUACUG CUCAGUAUUU 1580288 1580298 ACAAACAAACAA 556 1041 1063 1580292 UUUUGUUUUUU 867 AAAACAAAACA GUUUGUUUGU 1580289 1580299 ACAAAAAACAAA 557 1033 1055 1580296 UAUUUUUGUUU 868 ACAAAAAUAçU UGUUUUUUGU 1580290 1580301 ACAAAAAUACUG 558 1021 1043 1580295 AAUCCAGCUCA 869 AGCUGGAUUAU GUAUUUUUGU 1580303 1580319 ACUGAGCUGGAU 559 1013 1035 1580314 AACAGUAUAAU 870 UAUACUGUUAG CCAGCUCAGU 1580304 1580315 UAGGAUGUAAAG 560 993 1015 1580312 GCUAAGGAACU 871 UUCCUUAGCUA UUACAUCCUA 1580305 1580317 CUGUUAGGAUGU 561 997 1019 1580313 AGGAACUUUAC 872 AAAGUUCCUUA AUCCUAACAG 1580306 1580316 UAUACUGUUAGG 562 1001 1023 1580309 ACUUUACAUCC 873 AUGUAAAGUUC UAACAGUAUA 1580307 1580320 AGCUGGAUUAUA 563 1009 1031 1580310 UCCUAACAGUA 874 CUGUUAGGAUG UAAUCCAGCU 1580308 1580318 GGAUUAUACUGU 564 1005 1027 1580311 UACAUCCUAAC 875 UAGGAUGUAAA AGUAUAAUCC 1580321 1580337 AUGUAAAGUUCC 565 989 1011 1580331 AGUAGCUAAGG 876 UUAGCUACUUC AACUUUACAU 1580322 1580334 UUCUUUAAGGCU 566 969 991 1580329 CUCGUGUUGAG 877 CAACACGAGGC CCUUAAAGAA 1580323 1580333 CUACUUCUUUAA 567 973 995 1580327 UGUUGAGCCUU 878 GGCUCAACACG AAAGAAGUAG 1580324 1580336 UUAGCUACUUCU 568 977 999 1580328 GAGCCUUAAAG 879 UUAAGGCUCAA AAGUAGCUAA 1580325 1580335 UUCCUUAGCUAC 569 981 1003 1580330 CUUAAAGAAGU 880 UUCUUUAAGGC AGCUAAGGAA 1580326 1580338 AAAGUUCCUUAG 570 985 1007 1580332 AAGAAGUAGCU 881 CUACUUCUUUA AAGGAACUUU 1580339 1580351 UUAAGGCUCAAC 571 965 987 1580345 CAGCCUCGUGU 882 ACGAGGCUGAU UGAGCCUUAA 1580340 1580352 ACGAGGCUGAUG 572 953 975 1580346 UAUGUUGACCA 883 GUCAACAUAAA UCAGCCUCGU 1580341 1580353 GAUGGUCAACAU 573 945 967 1580347 UUGCUUUUUAU 884 AAAAAGCAAAC GUUGACCAUC 1580342 1580356 CAACACGAGGCU 574 957 979 1580350 UUGACCAUCAG 885 GAUGGUCAACA CCUCGUGUUG 1580343 1580354 GGCUCAACACGA 575 961 983 1580349 CCAUCAGCCUC 886 GGCUGAUGGUC GUGUUGAGCC 1580344 1580355 GGCUGAUGGUCA 576 949 971 1580348 UUUUUAUGUUG 887 ACAUAAAAAGC ACCAUCAGCC 1580357 1580371 GUCAACAUAAAA 577 941 963 1580366 UUGUUUGCUUU 888 AGCAAACAAUA UUAUGUUGAC 1580358 1580369 AACAAUACUAUG 578 925 947 1580363 AUAUAUGUACA 889 UACAUAUAUGU UAGUAUUGUU 1580359 1580372 UACAUAUAUGUA 579 913 935 1580367 AACACUUUUUA 890 AAAAGUGUUAU CAUAUAUGUA 1580360 1580374 AGCAAACAAUAC 580 929 951 1580364 AUGUACAUAGU 891 UAUGUACAUAU AUUGUUUGCU 1580361 1580373 AAAAAGCAAACA 581 933 955 1580368 ACAUAGUAUUG 892 AUACUAUGUAC UUUGCUUUUU 1580362 1580370 ACAUAAAAAGCA 582 937 959 1580365 AGUAUUGUUUG 893 AACAAUACUAU CUUUUUAUGU 1580375 1580389 AUACUAUGUACA 583 921 943 1580383 UUACAUAUAUG 894 UAUAUGUAAAA UACAUAGUAU 1580376 1580387 AAAAGUGUUAUA 584 901 923 1580382 AAACCUAUUUA 895 AAUAGGUUUUA UAACACUUUU 1580377 1580388 UGUAAAAAGUGU 585 905 927 1580381 CUAUUUAUAAC 896 UAUAAAUAGGU ACUUUUUACA 1580378 1580390 UAUAUGUAAAAA 586 909 931 1580384 UUAUAACACUU 897 GUGUUAUAAAU UUUACAUAUA 1580379 1580392 UAUGUACAUAUA 587 917 939 1580385 CUUUUUACAUA 898 UGUAAAAAGUG UAUGUACAUA 1580380 1580391 UAUAAAUAGGUU 588 893 915 1580386 GGUUUAUAAAA 899 UUAUAAACCGG CCUAUUUAUA 1580393 1580408 AUACAUCUUCAA 589 861 883 1580401 UGCUGUUGAUU 900 UCAACAGCAAC GAAGAUGUAU 1580394 1580406 GUGUUAUAAAUA 590 897 919 1580403 UAUAAAACCUA 901 GGUUUUAUAAA UUUAUAACAC 1580395 1580410 AAACCGGAGAUA 591 877 899 1580400 UGUAUAUAAUA 902 UUAUAUACAUC UCUCCGGUUU 1580396 1580409 AAUAGGUUUUAU 592 889 911 1580399 CUCCGGUUUAU 903 AAACCGGAGAU AAAACCUAUU 1580397 1580405 UUAUAAACCGGA 593 881 903 1580402 UAUAAUAUCUC 904 GAUAUUAUAUA CGGUUUAUAA 1580398 1580407 GGUUUUAUAAAC 594 885 907 1580404 AUAUCUCCGGU 905 CGGAGAUAUUA UUAUAAAACC 1580411 1580426 GAUAUUAUAUAC 595 869 891 1580422 AUUGAAGAUGU 906 AUCUUCAAUCA AUAUAAUAUC 1580412 1580424 UCAACAGCAACC 596 849 871 1580420 GGAGGUGGGGG 907 CCCACCUCCAC UUGCUGUUGA 1580413 1580425 AUCUUCAAUCAA 597 857 879 1580417 GGGUUGCUGUU 908 CAGCAACCCCC GAUUGAAGAU 1580414 1580427 UCAAUCAACAGC 598 853 875 1580418 GUGGGGGUUGC 909 AACCCCCACCU UGUUGAUUGA 1580415 1580428 CGGAGAUAUUAU 599 873 895 1580419 AAGAUGUAUAU 910 AUACAUCUUCA AAUAUCUCCG 1580416 1580423 UUAUAUACAUCU 600 865 887 1580421 GUUGAUUGAAG 911 UCAAUCAACAG AUGUAUAUAA 1580429 1580441 CAGCAACCCCCA 601 845 867 1580435 CAGUGGAGGUG 912 CCUCCACUGCU GGGGUUGCUG 1580430 1580445 AACCCCCACCUC 602 841 863 1580436 AAAGCAGUGGA 913 CACUGCUUUCU GGUGGGGGUU 1580431 1580444 CACUGCUUUCUG 603 829 851 1580437 CAAACCAAACA 914 UUUGGUUUGGU GAAAGCAGUG 1580432 1580443 CCCACCUCCACU 604 837 859 1580439 ACAGAAAGCAG 915 GCUUUCUGUUU UGGAGGUGGG 1580433 1580442 CCUCCACUGCUU 605 833 855 1580438 CCAAACAGAAA 916 UCUGUUUGGUU GCAGUGGAGG 1580434 1580446 GCUUUCUGUUUG 606 825 847 1580440 AAACCAAACCA 917 GUUUGGUUUGA AACAGAAAGC 1580447 1580463 UCUGUUUGGUUU 607 821 843 1580453 ACUCAAACCAA 918 GGUUUGAGUUU ACCAAACAGA 1580448 1580461 GGCUAGCUCUUU 608 789 811 1580457 ACAAAGAAAAA 919 UUUCUUUGUCU AGAGCUAGCC 1580449 1580460 UGAGUUUGGGAU 609 805 827 1580458 UAGCCCAAAAU 920 UUUGGGCUAGC CCCAAACUCA 1580450 1580464 GGUUUGAGUUUG 610 809 831 1580456 CCAAAAUCCCA 921 GGAUUUUGGGC AACUCAAACC 1580451 1580459 UUUGGUUUGGUU 611 817 839 1580455 CCAAACUCAAA 922 UGAGUUUGGGA CCAAACCAAA 1580452 1580462 GUUUGGUUUGAG 612 813 835 1580454 AAUCCCAAACU 923 UUUGGGAUUUU CAAACCAAAC 1580465 1580480 UUUGGGAUUUUG 613 801 823 1580473 GAGCUAGCCCA 924 GGCUAGCUCUU AAAUCCCAAA 1580466 1580478 UUUCUUUGUCUG 614 777 799 1580476 AACAGAAAGCA 925 CUUUCUGUUUU GACAAAGAAA 1580467 1580477 CUUUUUUCUUUG 615 781 803 1580475 GAAAGCAGACA 926 UCUGCUUUCUG AAGAAAAAAG 1580468 1580481 AGCUCUUUUUUC 616 785 807 1580474 GCAGACAAAGA 927 UUUGUCUGCUU AAAAAGAGCU 1580469 1580482 UUUGGGCUAGCU 617 793 815 1580471 AGAAAAAAGAG 928 CUUUUUUCUUU CUAGCCCAAA 1580470 1580479 GGAUUUUGGGCU 618 797 819 1580472 AAAAGAGCUAG 929 AGCUCUUUUUU CCCAAAAUCC 1580483 1580500 UUUGUCUGCUUU 619 773 795 1580490 GGAAAACAGAA 930 CUGUUUUCCCU AGCAGACAAA 1580484 1580498 CCUCCCUUCCCU 620 749 771 1580491 AGCGUACAUAG 931 AUGUACGCUCA GGAAGGGAGG 1580485 1580495 CCUUCCUCCCUU 621 753 775 1580489 UACAUAGGGAA 932 CCCUAUGUACG GGGAGGAAGG 1580486 1580497 UUUCCCUUCCUC 622 757 779 1580492 UAGGGAAGGGA 933 CCUUCCCUAUG GGAAGGGAAA 1580487 1580499 CUUUCUGUUUUC 623 765 787 1580494 GGAGGAAGGGA 934 CCUUCCUCCCU AAACAGAAAG 1580488 1580496 UCUGCUUUCUGU 624 769 791 1580493 GAAGGGAAAAC 935 UUUCCCUUCCU AGAAAGCAGA 1580501 1580517 CCUUCCCUAUGU 625 745 767 1580512 UCUGAGCGUAC 936 ACGCUCAGAGC AUAGGGAAGG 1580502 1580514 AGCCUCAGACAG 626 725 747 1580507 CCAGACGGUCU 937 ACCGUCUGGGC GUCUGAGGCU 1580503 1580515 UCAGAGCCUCAG 627 729 751 1580511 ACGGUCUGUCU 938 ACAGACCGUCU GAGGCUCUGA 1580504 1580518 AUGUACGCUCAG 628 737 759 1580509 UCUGAGGCUCU 939 AGCCUCAGACA GAGCGUACAU 1580505 1580516 ACGCUCAGAGCC 629 733 755 1580510 UCUGUCUGAGG 940 UCAGACAGACC CUCUGAGCGU 1580506 1580513 CCCUAUGUACGC 630 741 763 1580508 AGGCUCUGAGC 941 UCAGAGCCUCA GUACAUAGGG 1580520 1580526 CUGUUUUCCCUU 631 761 783 1580523 GAAGGGAGGAA 942 CCUCCCUUCCC GGGAAAACAG 1580521 1580527 CUCAGACAGACC 632 722 744 1580524 CGCCCAGACGG 943 GUCUGGGCGCC UCUGUCUGAG
represents a phosphodiester intemucleoside linkage, and each “s” represents a phosphorothioate intemucleoside linkage. The antisense RNAi oligonucleotide is complementary to the target nucleic acid (PMP22), and the sense RNAi oligonucleotide is complementary to the first of the 20 nucleosides of the antisense RNAi oligonucleotide (from 5′ to 3′), wherein the last two 3′-nucleosides of the antisense RNAi oligonucleotides are not paired with the sense RNAi oligonucleotide (are overhanging nucleosides).

TABLE-US-00039 TABLE 39 RNAi compounds targeting human PMP22 SEQ ID NO: 1 SEQ ID SEQ ID NO: 1 NO: 1 Antisense SEQ Antisense Antisense Sense SEQ Compound Antisense Sequence ID Start Stop Sense Sequence ID Number ID (5′ to 3′) NO. Site Site ID (5′ to 3′) NO. 1580519 1580525 UCAGACAGACCG 944 722 743 1580522 CGCCCAGACGG 945 UCUGGGCGCC UCUGUCUGA

Example 13: Effect of RNAi Compounds on Human PMP22 RNA In Vitro, Single Dose

[0569] Double-stranded RNAi compounds described above were tested in a series of experiments under the same culture conditions. The results for each experiment are presented in separate tables below.

[0570] Cultured A431 cells at a density of 20,000 cells per well were transfected using Lipofectamine 2000 with 20 nM of RNAi compound. After a treatment period of approximately 24 hours, RNA was isolated from the cells and PMP22 RNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS4579 (described herein above) was used to measure RNA levels. PMP22 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented as percent PMP22 RNA relative to the amount in untreated control cells (% UTC). The values marked with a “†” indicate that the antisense RNAi oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of RNAi compounds for which the antisense RNAi oligonucleotide is complementary to the amplicon region.

TABLE-US-00040 TABLE 40 Reduction of PMP22 RNA by RNAi compounds Compound PMP22 Number (% UTC) 1580285 64 1580286 54 1580290 46 1580303 34 1580304 17 1580305 40 1580306 19 1580307 24 1580308 34 1580321 19 1580322 35 1580323 18 1580324 21 1580325 24 1580326 19 1580339 24 1580340 26 1580341 22 1580342 63 1580343 34 1580344 33 1580357 24 1580358 30 1580359 25 1580360 24 1580361 21 1580362 37 1580375 47 1580376 28 1580377 28 1580378 24 1580379 34 1580380 30 1580393 19 1580394 42 1580395 18 1580396 18 1580397 40 1580398 35 1580411 19 1580412 45 1580413 20 1580414 38 1580415 20 1580416 37 1580429 59 1580430 54 1580431 20 1580432 39 1580433 28 1580434 47 1580447 30 1580448 21 1580449 29 1580450 25 1580451 33 1580452 32 1580465 48 1580466 14 1580467 19 1580468 16 1580469 27 1580470 17 1580483 14 1580484 69 1580485 69 1580486 94 1580487 31 1580488 28 1580501 34 1580502 115 1580503 58 1580504 82 1580505 76 1580506 61 1580519 119 1580520 73 1580521 116

TABLE-US-00041 TABLE 41 Reduction of PMP22 RNA by RNAi compounds Compound PMP22 Number (% UTC) 1580051 51 1580053 54 1580056 36 1580069 93 1580070 54 1580071 71 1580072 81 1580073 74 1580074 55 1580087 92 1580088 50 1580089 53 1580090 68 1580091 100 1580092 95 1580105 72 1580106 108 1580107 51 1580108 101 1580109 36 1580110 54 1580123 111 1580124 105 1580125 82 1580126 104 1580127 98 1580133 103 1580141 97 1580142 98 1580143 91 1580144 79 1580145 57 1580146 64 1580159 103 1580160 98 1580161 98 1580162 92 1580163 102 1580164 106 1580177 40 1580178 83 1580179 58 1580180 42 1580181 74 1580182 77 1580195 44 1580196 28 1580197 50 1580198 59 1580199 44 1580200 27 1580213 65 1580214 40 1580215 89 1580216 98 1580217 86 1580218 97 1580231 26 1580232 108 1580233 89 1580234 40 1580235 96 1580236 40 1580249 79 1580250 46 1580251 25 1580252 27 1580253 39 1580254 100 1580267 32 1580268 110 1580269 62 1580270 75 1580271 48 1580272 58 1580287 45 1580288 89 1580289 101

TABLE-US-00042 TABLE 42 Reduction of PMP22 RNA by RNAi compounds Compound PMP22 Number (% UTC) 1579820 131 1579821 104 1579822 123 1579835 136 1579836 113 1579837 124 1579838 70 1579839 72 1579840 127 1579853 96 1579854 39 1579855 78 1579856 65 1579857 119 1579858 117 1579871 57 1579872 40 1579873 63 1579874 36 1579875 96 1579876 47 1579889 43 1579890 31 1579891 43 1579892 43 1579893 31 1579894 34 1579907 100 1579908 44 1579909 86 1579910 78 1579911 130 1579912 57 1579925 36 1579926 34 1579927 71 1579928 37 1579929 42 1579930 37 1579943 42 1579944 39 1579945 43 1579946 71 1579947 35 1579948 44 1579961 34 1579962 47 1579963 40 1579964 42 1579965 38 1579966 33 1579979 50 1579980 34 1579981 45 1579982 83 1579987 33 1579988 54 1579997 58 1579998 58 1579999 30 1580000 43 1580001 26 1580002 40 1580015 36 1580016 28 1580017 45 1580018 53 1580019 60 1580020 29 1580033 70 1580034 60 1580035 47 1580036 36 1580037 40 1580038 40 1580052 89 1580054 94 1580055 93

TABLE-US-00043 TABLE 43 Reduction of PMP22 RNA by RNAi compounds Compound PMP22 Number (% UTC) 1579592 42 1579593 102  1579594 118  1579595 107  1579596 111† 1579597 100  1579610  90† 1579611  49† 1579612  51† 1579613  96† 1579614  78† 1579615  70† 1579628 97 1579629 160  1579630 55 1579631 42 1579632 113  1579633 107  1579646 113  1579647 73 1579648 75 1579649 94 1579650 18 1579651 44 1579664 38 1579665 90 1579666 95 1579667 106  1579668 119  1579669 50 1579682 67 1579683 25 1579684 30 1579685 34 1579686 36 1579687 27 1579700 63 1579701 31 1579702 56 1579703 37 1579705 38 1579706 36 1579718 25 1579719 47 1579720 26 1579721 39 1579722 24 1579723 35 1579736 29 1579737 33 1579738 33 1579739 44 1579740 51 1579741 49 1579754 72 1579755 85 1579756 72 1579757 42 1579758 55 1579759 72 1579772 66 1579773 86 1579774 64 1579781 58 1579782 34 1579783 39 1579788 45 1579789 47 1579790 46 1579799 78 1579800 105  1579801 93 1579802 105  1579803 74 1579804 89 1579817 115  1579818 69 1579819 77

Example 14: Dose-Dependent Inhibition of Human PMP22 in A431 Cells by RNAi Compounds

[0571] RNAi compounds selected from the examples above were tested at various doses in A431 cells. Cultured A431 cells at a density of 20,000 cells per well were treated using Lipofectamine 2000 with various concentrations of RNAi compounds as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and PMP22 RNA levels were measured by quantitative real-time RTPCR. Human PMP22 primer-probe set RTS4579 (described herein above) was used to measure RNA levels as described above. PMP22 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of PMP22 RNA is presented in the tables below as percent PMP22 RNA, relative to untreated control cells (% UTC).

[0572] The half maximal inhibitory concentration (IC.sub.50) of each RNAi compound was calculated using GraphPad Prism 6 software (GraphPad Software, San Diego, CA) and is also presented in the table below. IC.sub.50 values were calculated from dose and PMP22 RNA levels by least squares fit to equation: log(inhibitor) vs. normalized response—Variable slope, Y=100/(1+10{circumflex over ( )}((LogIC50−X)*HillSlope)).

TABLE-US-00044 TABLE 44 Dose-dependent reduction of human PMP22 RNA in A431 cells by RNAi compounds Compound PMP22 RNA (% UTC) IC.sub.50 No. 0.025 nM 0.25 nM 2.5 nM 25 nM (nM) 1580304 40 23 8 12 <0.025 1580306 38 14 11 9 <0.025 1580321 35 17 11 11 <0.025 1580323 73 41 13 12 0.13 1580324 78 19 19 13 0.08 1580326 38 17 13 11 <0.025 1580393 130 60 25 14 0.63 1580395 52 19 10 14 <0.025 1580396 40 15 10 11 <0.025 1580411 59 16 12 9 0.04 1580413 33 16 9 10 <0.025 1580415 56 22 12 16 0.03 1580431 90 58 24 15 0.48 1580448 75 34 13 9 0.11 1580466 64 24 13 15 0.05 1580467 71 55 24 13 0.26 1580468 53 24 10 8 0.03 1580470 69 24 17 8 0.07 1580483 52 20 14 14 <0.025

TABLE-US-00045 TABLE 45 Dose-dependent reduction of human PMP22 RNA in A431 cells by RNAi compounds Compound PMP22 RNA (% UTC) IC.sub.50 No. 0.025 nM 0.25 nM 2.5 nM 25 nM (nM) 1580307 85 26 16 16 0.11 1580325 40 28 14 14 <0.025 1580339 51 20 15 20 <0.025 1580340 62 46 21 14 0.11 1580341 74 38 22 15 0.15 1580357 58 41 19 20 0.06 1580359 78 48 26 18 0.29 1580360 51 27 14 18 <0.025 1580361 47 24 22 19 <0.025 1580376 30 20 15 16 <0.025 1580377 37 23 17 15 <0.025 1580378 29 15 13 13 <0.025 1580380 56 24 18 13 0.03 1580433 99 114 46 22 2.88 1580449 108 50 22 16 0.40 1580450 80 43 16 15 0.19 1580466 53 18 13 8 0.03 1580469 62 25 13 13 0.05 1580488 74 55 28 17 0.35

TABLE-US-00046 TABLE 46 Dose-dependent reduction of human PMP22 RNA in A431 cells by RNAi compounds Compound PMP22 RNA (% UTC) IC.sub.50 No. 0.025 nM 0.25 nM 2.5 nM 25 nM (nM) 1579650 54 37 13 15 0.04 1579683 32 23 18 24 <0.025 1579687 51 28 24 30 <0.025 1579718 68 26 15 18 0.07 1579720 75 62 22 17 0.39 1579722 47 36 16 27 <0.025 1579736 83 40 21 33 0.28 1579999 41 13 10 13 <0.025 1580001 54 24 15 17 <0.025 1580016 109 76 42 36 3.15 1580020 51 24 16 20 <0.025 1580196 84 62 35 31 1.06 1580200 110 88 40 42 4.63 1580231 67 29 22 30 0.07 1580251 54 37 22 30 0.03 1580252 63 28 25 28 0.05 1580358 134 46 32 36 1.08 1580452 71 49 30 26 0.29 1580466 49 22 11 12 <0.025