CATION CHELATOR HOT START

20230374576 · 2023-11-23

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention is in the field of regulation of enzymatic activity in nucleic acid modifying reactions. It describes a method of regulating enzymatic activity by adding chelating agents to the reaction composition and exploits the fact that both the binding of divalent cations to these chelating agents and the pH of commonly used buffers is temperature dependent. PCR experiments that are hampered by non-specific side products can be regulated such that the target sequence is amplified in a more specific manner.

    Claims

    1. A kit, comprising: (i) a DNA polymerase suitable for nucleic acid amplification, optionally a reverse transcriptase, and (ii) a buffer comprising: (a) Tris, (b) magnesium divalent cation, and (c) EGTA, wherein when in an amplification reaction mixture, the magnesium divalent cation is at a concentration between 0.01 and 20 mM, and EGTA is at a concentration between 0.1 and 20 mM, wherein the nucleic acid amplification is not an isothermal nucleic acid amplification.

    2. The kit of claim 1, wherein the DNA polymerase is a DNA polymerase from an organism of genus Thermus, Aquifex, Thermotoga, Thermocridis, Hydrogenobacter, Thermosynchecoccus, Thermoanaerobacter, Pyrococcales, Thermococcus, or Sulfolobus.

    3. The kit of claim 1, wherein the DNA polymerase is a DNA polymerase from an organism organism selected from Aquifex aeolicus, Aquifex pyogenes, Thermus thermophilus, Thermus aquaticus, Thermotoga neopolitana, Thermus pacificus, Thermus eggertssonii and Thermotoga maritima.

    4. The kit of claim 1, wherein the DNA polymerase is Thermus aquaticus (Taq) DNA polymerase.

    5. The kit of claim 1, wherein the kit comprises a reverse transcriptase.

    6. The kit of claim 5, wherein the reverse transcriptase is a viral reverse transcriptase.

    7. The kit of claim 6, wherein the viral reverse transcriptase (RT) is Moloney murine leukemia virus (MMLV) RT, avian myeloblastosis virus (AMV) RT, human immunodeficiency virus (HIV) RT, or equine infectious anemia virus (EIAV) RT.

    8. The kit of claim 1, wherein when in an amplification reaction mixture, the magnesium divalent cation is at a concentration between 0.1 and 10 mM.

    9. The kit of claim 1, wherein when in an amplification reaction mixture, EGTA is at a concentration between 0.5 and 10 mM.

    10. The kit of claim 1, wherein when in an amplification reaction mixture, EGTA is at a concentration between 1 and 8 mM.

    11. The kit of claim 1, further comprising dNTPs.

    Description

    EXAMPLES

    [0036] Selection of Chelating Agent

    [0037] Tris buffer is routinely used in PCR buffers. At room temperature the pH of a Tris based PCR buffer is 8.7. Tris shows a temperature-dependent shift in pH value of 0.03 pH units per ° C. This means that at 95° C. the pH value is 6.6. In order to select a chelating agent for PCR experiments, the pH-dependency of the binding constants of three different chelating agents, NTA; EDTA and EGTA, was investigated. Known pK values from literature for every chelating agent were used to determine the pH dependency of the complex formation (FIG. 1). The correlation curve for EGTA shows a strong correlation between pH value and binding constant. Therefore, EGTA was selected for subsequent experiments.

    [0038] Endpoint PCR

    [0039] An amplification experiment was performed using a test system that is known to be prone to produce non-specific side products. A genomic DNA sequence of 1.2 kb was the target sequence. Primers HugA and HugB were used.

    [0040] The primer sequences are as follows:

    TABLE-US-00001 TABLE 1 Primer sequences used for endpoint PCR experiment. SEQ ID Primer NO name Sequence 1 HugA CACACAGCGATGGCAGCTATGC 2 HugB CCCAGTGATGGGCCAGCT

    [0041] Reactions with and without EGTA were performed in parallel. In set A, the magnesium concentration was varied in 1 mM steps, start and end point were 5 and 10 mM respectively. In set B, the start point was 0.5 mM and the end point was 4 mM Mg. The setup is described in Table 2.

    TABLE-US-00002 TABLE 2 HugI PCR reactions mixture. MM A MM B Puffer (—Mg) 1 1 X Taq 0.625 0.625 Units Primer HugA 0.5 0.5 μM Primer HugB 0.5 0.5 μM dNTPs 0.2 0.2 mM gDNA 10 10 ng EGTA 5 0 mM

    [0042] The amplification program was as follows (Table 3):

    TABLE-US-00003 TABLE 3 Amplification program of HugI PCR. Time [min:sec] Temp [° C.] 03:00 95 00:30 94 01:00 59 01:00 72 10:00 72 4

    [0043] 35 cycles were performed.

    [0044] The analysis of the PCR reactions on the agarose gel (FIG. 2) shows that the reactions containing EGTA as a chelating agent are more specific as of having less side products compared to those reactions without EGTA. Other buffers routinely used in enzymatic reactions are listed in Table 4.

    TABLE-US-00004 TABLE 4 List of buffers commonly used in enzymatic reactions. Buffer Product Useful CAS ID No. # Description pH Range Number pKa 1 A3594 ACES BioPerformance 6.1-7.5 7365-82-4 6.80 Certified, ≥99.0% 2 B4554 BES BioPerformance Certified, cell 6.4-7.8 10191-18-1 7.10 culture tested, ≥99.0% 3 B4429 BIS-TRIS BioPerformance Certified, 5.8-7.2 6976-37-0 6.50 cell culture tested, suitable for insect cell culture, ≥98% 4 B4679 BIS-TRIS propane BioPerformance 6.3-9.5 64431-96-5 6.80 Certified, cell culture tested, ≥99.0% 5 E0276 EPPS BioPerformance Certified, cell 7.3-8.7 16052-06-5 8.00 culture tested, ≥99.5% (titration) 6 G3915 Gly-Gly BioPerformance Certified, cell 7.5-8.9 556-50-3 8.20 culture tested, ≥99% 7 H4034 HEPES BioPerformance Certified, ≥99.5% 6.8-8.2 7365-45-9 7.50 (titration), cell culture tested 8 H3784 HEPES sodium salt BioPerformance 6.8-8.2 75277-39-3 7.50 Certified, suitable for cell culture, ≥99.5% 9 H3662 HEPES sodium salt solution 1M, 75277-39-3 BioReagent, suitable for cell culture 10 H3537 HEPES solution 1M, BioReagent, 6.8-8.2 7365-45-9 suitable for cell culture, suitable for molecular biology, 0.2 μm filtered 11 M2933 MES hydrate BioPerformance 5.5-6.7 4432-31-9 6.10 Certified, suitable for cell (anhydrous) culture, ≥99.5% 12 M3058 MES sodium salt BioPerformance 5.5-6.7 71119-23-8 6.10 Certified, suitable for cell culture 13 M1317 MES solution 1M, BioReagent, for 5.5-6.7 molecular biology, suitable for cell culture 14 M3183 MOPS BioPerformance Certified, cell 6.5-7.9 1132-61-2 7.20 culture tested, ≥99.5% (titration) 15 M9024 MOPS sodium salt BioPerformance 6.5-7.9 71119-22-7 7.20 Certified, suitable for cell culture, ≥99.5% 16 M1442 MOPS solution BioReagent, 1M, for 6.5-7.9 molecular biology, suitable for cell culture 17 P1851 PIPES BioPerformance Certified, 6.1-7.5 5625-37-6 6.80 suitable for cell culture, ≥99% 18 P5493 Phosphate buffered saline 10× concentrate, BioPerformance Certified, suitable for cell culture 19 P5368 Phosphate buffered saline BioPerformance Certified, pH 7.4 20 S6191 Sodium chloride BioPerformance 7647-14-5 Certified, ≥99.5% (titration), Cell Culture Tested 21 S6566 Sodium phosphate monobasic 7558-80-7 Biotechnology Performance Certified, Cell Culture Tested 22 T5316 TAPS BioPerformance Certified, cell 7.7-9.1 29915-38-6 8.40 culture tested, ≥99.5% (titration) 23 T5441 TAPS sodium salt BioPerformance 7.7-9.1 91000-53-2 8.40 Certified, suitable for cell culture, ≥99% 24 T5691 TES BioPerformance Certified, cell 6.8-8.2 7365-44-8 7.50 culture tested, ≥99% (titration) 25 T5816 Tricine BioPerformance Certified, cell 7.4-8.8 1389475.00 8.10 culture tested, ≥99% (titration) 26 T7193 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 7.0, average Mw 154.8 27 T9943 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 7.0, average Mw 154.8 28 T7443 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 7.2, average Mw 153.8 29 T7693 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 7.4, average Mw 151.6 30 T0319 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 7.4, average Mw 151.6 31 T7818 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 7.5, average Mw 150.6 32 T7943 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 7.6, average Mw 149.0 33 T8068 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 7.7, average Mw 147.6 34 T8193 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 7.8, average Mw 145.8 35 T8443 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 8.0, average Mw 141.8 36 T0819 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 8.0, average Mw 141.8 37 T8568 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 8.1, average Mw 139.8 38 T8943 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 8.3, average Mw 135.4 39 T8818 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 8.5, average Mw 131.4 40 T1194 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 8.5, average Mw 131.4 41 T9443 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 8.8, average Mw 127.2 42 T9568 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 8.9, average Mw 125.6 43 T9693 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 9.0, average Mw 124.6 44 T1444 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 9.0, average Mw 124.6 45 T9818 Trizma ® Pre-set crystals 7.0-9.0 BioPerformance Certified, pH 9.1, average Mw 123.0 46 T0194 Trizma ® Pre-set crystals pH 7.2, 7.0-9.0 average Mw 153.8 47 T0444 Trizma ® Pre-set crystals pH 7.5, 7.0-9.0 average Mw 150.6 48 T0569 Trizma ® Pre-set crystals pH 7.6, 7.0-9.0 average Mw 149.0 49 T0694 Trizma ® Pre-set crystals pH 7.7, 7.0-9.0 average Mw 147.6 50 T0944 Trizma ® Pre-set crystals pH 8.1, 7.0-9.0 average Mw 139.8 51 T1069 Trizma ® Pre-set crystals pH 8.3, 7.0-9.0 average Mw 135.4 52 T1319 Trizma ® Pre-set crystals pH 8.8, 7.0-9.0 average Mw 127.2 53 T6066 Trizma ® base BioPerformance 41524.00 77-86-1 8.10 Certified, meets EP, USP testing specifications, cell culture tested, ≥99.9% (titration) 54 T5941 Trizma ® hydrochloride 7.0-9.0 1185-53-1 8.10 BioPerformance Certified, cell culture tested, ≥99.0% (titration) 55 T1819 Trizma ® hydrochloride solution pH 7.0-9.0 7.0, 1M, BioReagent, for molecular biology, suitable for cell culture 56 T2069 Trizma ® hydrochloride solution pH 7.0-9.0 7.2, 1M, BioReagent, for molecular biology, suitable for cell culture 57 T1944 Trizma ® hydrochloride solution pH 7.0-9.0 7.4, 0.1M 58 T2194 Trizma ® hydrochloride solution pH 7.0-9.0 7.4, 1M, BioReagent, for molecular biology, suitable for cell culture 59 T2319 Trizma ® hydrochloride solution pH 7.0-9.0 7.5, 1M, BioReagent, for molecular biology, suitable for cell culture 60 T2944 Trizma ® hydrochloride solution pH 7.0-9.0 7.5, 2M, BioReagent, for molecular biology, suitable for cell culture 61 T2444 Trizma ® hydrochloride solution pH 7.0-9.0 7.6, 1M, BioReagent, for molecular biology, suitable for cell culture 62 T2569 Trizma ® hydrochloride solution pH 7.0-9.0 7.8, 1M, BioReagent, for molecular biology, suitable for cell culture 63 T2694 Trizma ® hydrochloride solution pH 7.0-9.0 8.0, 1M, BioReagent, for molecular biology, suitable for cell culture 64 T3069 Trizma ® hydrochloride solution pH 7.0-9.0 8.0, 2M, BioReagent, for molecular biology, suitable for cell culture 65 T2819 Trizma ® hydrochloride solution pH 7.0-9.0 9.0, 1M, BioReagent, for molecular biology, suitable for cell culture

    [0045] Modulation of Residual Activity of Chemically Inactivated Taq DNA Polymerase Using EGTA/EDTA

    [0046] The following experiments employed a system to detect the formation of primer dimers in a PCR reaction mixture using residual active Taq polymerase molecules. Herein, bisulphite-treated DNA is used as a template. As a consequence of the bisulphite treatment, which entails the chemical modification of non-methylated cytosines to uracil), said template only consists of three bases. Since bisulphite treatment only works when using single stranded DNA, the majority of DNA after completion of said bisulphite treatment is single stranded. Primers that are used for amplification of such DNA sequences are characterized by reduced complexity since they only consist of three bases. Hence these prnmers are prone to dimer formation and are very likely to be able to bind>100.000 times to said bisulphite-treated DNA.

    [0047] Genomic DNA was propagated using the Qiagen REPLI g Midi Kit according to the manufacturer's protocol. Subsequently, 1 μg of said genomic DNA was used in 10 independent reactions wherein the DNA was subjected to bisulphite treatment using the EpiTect Bisulfite Kit followed by purification. The resulting DNA of each reaction was pooled and used in the subsequent amplification reactions. Primer sequences are shown in Table 5.

    TABLE-US-00005 TABLE 5 Primers used in amplification of bisulphite- treated DNA. SEQ ID Primer NO NO Sequence 3 1 ACCCCCACTAAACATACCCTTATTCT 4 2 GGGAGGGTAATGAAGTTGAGTTTAGG

    TABLE-US-00006 TABLE 6 Amplification reaction mixture. Reagent Concentration Volume (μl) EpiTect HRM PCR Kit 2x 12.5 Primer 1 10 μM 1.875 Primer 2 10 μM 1.875 Bisulphite-treated DNA 10 ng/μl 1 Water or EGTA 1-x mM 5 Water 2.75

    [0048] The final EGTA concentration was between 0.25 and 10 mM.

    [0049] One set of samples consisting of two reactions was incubated on ice for 120 min, whereas the other set of samples also consisting of two reactions was incubated at room temperature for 120 min. Subsequently both sets of samples were analyzed using the Rotor-Gene Q 5plex HRM System. The cycling program is shown in Table 7.

    TABLE-US-00007 TABLE 7 Cycling program used in the amplification of bisulphite-treated DNA. 95° C. - 5′ 95° C. - 10″ 55° C. - 30″ {close oversize parenthesis} ×40 72° C. - 10″ HRM 68° C.-82° C.

    [0050] Ct values are summarized in Table 8 and FIG. 3 shows the respective melting curves.

    TABLE-US-00008 TABLE 8 Summary of results obtained from the amplification experiment of bisulphite-treated DNA in the presence of different EGTA concentrations. Room temperature On ice EGTA Standard Standard [mM] Ct Average deviaton Ct Average deviation — 25.01 24.92 0.1 25.29 25.28 0.01 24.82 25.26 0.25 25.2 25.31 0.11 25.34 25.43 0.09 25.42 25.51 0.5 25.55 25.51 0.04 25.53 25.58 0.04 25.47 25.62 0.75 25.91 25.86 0.05 25.78 25.83 0.05 25.8 25.88 1 26.47 26.49 0.02 26.59 26.55 0.04 26.5 26.61 1.5 27.76 27.82 0.06 28.17 28.19 0.02 27.88 28.21 2 29.9 29.81 0.09 30.16 29.35 0.82 29.71 28.53 4 37.32 37.13 0.1 38.37 38.26 0.11 37.02 38.14 8 10 35.18 34.59 0.59 34

    [0051] Samples that had been incubated on ice without the addition of EGTA showed a Ct value of 25.28 and a specific melting curve (FIG. 3A) whereas the Ct value in the case of the samples that had been incubated at room temperate is shifted to the right (24.92). In this case no specific product was observed. Addition of EGTA up to a final concentration of 0.75 mM resulted in an increase of specificity without affecting the Ct values. The amount of specific product increased rapidly. In the case of EGTA concentrations exceeded 2 mM, successful amplification was prevented (FIG. 3H).

    [0052] In the follow-up experiment said primers and said bisulphite-treated DNA were used in amplification reactions wherein the magnesium dependency was analyzed. The composition of the reaction mixtures is shown in Table 9.

    TABLE-US-00009 TABLE 9 Amplification reaction mixture. Reagent Concentration Volume (μl) EpiTect HRM 2x 12.5 PCR Kit Primer 1 10 μM 1.875 Primer 2 10 μM 1.875 Bisulphite- 10 ng/μl 1 treated DNA Water or EGTA 5 mM 2.5 Magnesium 0.1 mM-0.6 mM 2.5 Water 2.75

    [0053] The final concentration of EGTA was 5 mM. The HRM master mix was supplemented with 0.1 0.6 mM magnesium.

    [0054] Two sets of reactions consisting of duplicates were used in the amplification experiment. One set of samples was incubated on ice for 120 min, whereas the other set of samples was incubated at room temperature for 120 min. Subsequently the samples were analyzed using the Rotor-Gene Q 5plex HRM System. The cycling program was the same as shown in Table 6. The results are shown in Table 9 and FIG. 4. Ct values corresponding to the samples incubated at room temperature and on ice respectively are shown in Table 10. FIG. 4 shows the respective melting curves.

    TABLE-US-00010 TABLE 10 Summary of results obtained from the amplification experiment of bisulphite- treated DNA in the presence of EGTA and different magnesium concentrations. Room temperature On ice MgCl.sub.2 Standard Standard DNA EGTA [mM] Ct Average deviation Ct Average deviation 10 ng — — 22.41 22.62 0.21 25.32 25.46 0.14 22.82 25.59 5 mM 0 mM 28.86 28.77 0.09 28.74 28.82 0.08 28.67 28.89 0.1 27.53 27.62 0.09 27.82 27.81 0.02 27.71 27.79 0.2 26.69 26.98 0.29 26.85 27.12 0.27 27.27 27.39 0.3 26.14 26.39 0.25 26.25 26.38 0.13 26.64 26.51 0.4 26.06 26.15 0.09 26.01 26.08 0.06 26.24 26.14 0.5 25.82 25.84 0.02 25.81 25.85 0.04 25.86 25.89 0.6 25.55 25.52 0.03 25.61 25.59 0.03 25.49 25.56

    [0055] The experiment showed that in the case of the samples incubated on ice without the addition of EGTA a Ct value of 25.46 and a specific melting curve was obtained, whereas incubation at room temperature resulted in a shift of the Ct value (22.62) and no specific amplification product was observed. Addition of EGTA up to a final concentration of 5 mM led to increased specificity. The Ct value when using 5 mM EGTA was 28.77 and 28.82 respectively. Increasing the magnesium concentration resulted in lower Ct values whilst maintaining specificity.

    [0056] Modulation of DNase Activity

    [0057] In this set of experiments means of modulating activity of DNase, a nuclease isolated from bovine pancreas, were investigated.

    [0058] Human genomic DNA was propagated using the REPLI g Midi Kit (Qiagen) according to the manufacturer's instructions. DNase activity was analyzed in 10 μl reactions. Each reaction contained 50 mM Tris pH 8.2 as the reaction buffer, ˜1 μg genomic DNA, 1 mM MgCl.sub.2, and 50 μM CaCl.sub.2). Three different amounts of DNase (0.01, 0.1 and 1 U) were used. The samples were incubated at two different temperatures, 42° C. and on ice, for 5 and 15 min respectively. DNA degradation was terminated by adding EDTA to a final concentration of 8.33 mM and samples were incubated on ice prior to analysis of the reaction products using a 0.5% agarose gel.

    [0059] The results are shown in FIG. 5. The gel shows that DNase is active on ice. Reaction time and the amount of DNase strongly influence completeness of enzymatic digestion. Incubation of said genomic DNA on ice for 15 min using 1 U DNase led to complete degradation of the sample (lane 3). Incubation at 42° C. led to complete degradation when using any of the amounts of enzyme already after 5 min (lanes 8-13, ‘42° C.’).

    [0060] Addition of EGTA to a final concentration of 100 μM led to almost complete inhibition of degradation for any of the amounts of DNase that were used (lanes 2-7, ‘on ice’ ‘100 μM EGTA’). Exempt from this is the reaction using 1 U DNase for 15 min (lane 3 ‘on ice’ ‘100 μM EGTA’). However, in this case degradation is significantly reduced compared to the sample without EGTA. Increasing the temperature to 42° C. largely restored DNase activity (lanes 8-13 ‘42° C.‘ ’100 μM EGTA’).

    [0061] In the follow-up experiment EDTA was used as a chelating agent. The procedure of genomic DNA propagation as well the buffer and reaction conditions were equivalent to the experiment as described above.

    [0062] The reaction products were analyzed using a 0.5% agarose gel (FIG. 6). Lanes 1-6 correspond to samples where the reaction was performed on ice. A comparison of lanes 1-3 and lanes 4-6 shows that addition of EDTA largely reduced enzymatic activity. An increase in reaction temperature to 42° C. results in bound Ca.sup.2+ ions being released from complexes with EDTA and thereby restoring enzymatic activity. Complete DNA degradation can be observed in lanes 7-12.

    [0063] In summary, both examples show that chelating agents can be used to inhibit DNase activity and that shifting the reaction temperature restores enzymatic activity, thereby validating said system of activity regulation.

    FIGURE CAPTIONS

    [0064] FIG. 1: Selection of chelating agents. pH-dependency of pK values of EDTA, EGTA and NTA. Logarithmic values of the pK value was plotted versus the pH value.

    [0065] FIG. 2: Agarose gel of HugI PCR amplification experiment. The lanes are annotated as follows: 1: DNA ladder, 2: MMA+5 mM Mg, 3: MMA+6 mM Mg, 4: MMA+7 mM Mg, 5: MMA+8 mM Mg, 6: MMA+9 mM Mg, 7: MMA+10 mM Mg, 8: DNA ladder, 9: DNA ladder, 10: MMB+0.5 mM Mg, 11: MMB+1 mM Mg, 12: MMB+2 mM Mg, 13: MMB+3 mM Mg, 14: MMB+4 mM Mg, 15: DNA ladder.

    [0066] An increase in Mg concentration leads to successful amplification of the target product ‘specific PCR product’, although much unspecific product is visible (lane 10-lane 12). A further increase of Mg concentration leads to generation of unspecific PCR products (lane 14, 4 mM Mg Cl.sub.2). In contrast, addition of 5 mM EGTA in presence of 5-10 mM MgCl.sub.2 results in specific PCR product (lane 2-lane 7), although the amount of unspecific by product increase while Mg concentration is increased.

    [0067] FIGS. 3A-3H

    [0068] Melting curves (EGTA titration experiment).

    [0069] The curves are annotated as follows: A: no additive, B: 0.25 mM EGTA, C: 0.5 mM EGTA, D: 0.75 mM EGTA, E: 1 mM EGTA, F: 1.5 mM, G: 2 mM EGTA, H: 4-10 mM.

    [0070] FIGS. 4A-4H

    [0071] Melting curves (Mg titration experiment).

    [0072] The curves are annotated as follows: A: no additives, B: 5 mM EGTA, C: 5 mM EGTA+0, 1 mM Mg, D: 5 mM EGTA+0.2 mM Mg, E: 5 mM EGTA+0.3 mM Mg, F: 5 mM EGTA+0.4 mM Mg, G: 5 mM EGTA+0.5 mM Mg, H: 5 mM EGTA+0.6 mM Mg.

    [0073] FIG. 5

    [0074] Agarose gel analysis of DNase assay at different temperatures and influence of EGTA.

    [0075] Lanes are annotated as follows: Note that reactions corresponding to samples in lane 2-7 were performed on ice and are hence labelled ‘on ice’. Similarly, reactions corresponding to samples in lanes 8-13 were performed at 42° C. and are labelled ‘42° C.’ accordingly.

    [0076] Reactions at both temperatures were performed in the absence and presence of 100 μM EGTA (‘0 μM EGTA and ‘100 μM EGTA respectively).

    [0077] Lane M: GelPilot High Range Ladder (6 μl), lane 1: 1 μg WGA gDNA (no DNase added), lanes 2 and 3: 1 μl DNase (IU) 5 and 15 min, lanes 4 and 5: 0.1 μl DNase (0.1U) 5 and 15 min, lanes 6 and 7: 0.01 μl DNase (0.01U), 5 and 15 min, lanes 8 and 9: 1 μl DNase (IU) 5 and 15 min, lanes 10 and 11: 0.1 μl DNase (0.1U) 5 and 15 min, lanes 12 and 13: 0.01 μl DNase (0.01U) 5 and 15 min.

    [0078] FIG. 6

    [0079] Agarose gel analysis of DNase assay at different temperatures and influence of EDTA.

    [0080] Reactions corresponding to samples in lanes 1-6 were performed on ice and are hence labeled ‘on ice’ Reactions corresponding to samples in lane 7-12 were performed at 42° C. and are labeled ‘42° C.’ accordingly. Lanes are annotated as follows: Lane K: 1 μg WGA gDNA.

    [0081] Lane 1: 1 U DNase, lane 2: 0.5 U DNase, lane 3: 0.1 U DNase, Lane 4: 1 U DNase+100 μM EDTA, lane 5: 0.5 U DNase+100 μM EDTA, lane 6: 0.1 U DNase+100 μM EDTA. Lane 7: 1 U DNase, lane 8: 0.5 U DNase, lane 9: 0.1 U DNase, lane 10: 1 U DNase+100 μM EDTA, lane 11: 0.5 U DNase+100 μM EDTA, lane 12: 0.1 U DNase+100 μM EDTA, lane M: GelPilot 1 kb Ladder (3 μl).