IMMORTALIZED KERATINOCYTES, LENTIVIRUS FOR KERATINOCYTE IMMORTALIZATION, AND METHODS OF USE
20230374451 · 2023-11-23
Inventors
Cpc classification
C07K14/025
CHEMISTRY; METALLURGY
C12Y207/07049
CHEMISTRY; METALLURGY
C12N2740/15022
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
C12N9/1276
CHEMISTRY; METALLURGY
International classification
C07K14/025
CHEMISTRY; METALLURGY
C12N9/12
CHEMISTRY; METALLURGY
Abstract
Provided herein are recombinant lentiviral vectors and methods of using the same to produce genetically modified keratinocytes that can be maintained in culture for over 100 population doubling without loss of morphological features or differentiation capacity. Immortalized keratinocytes and immortalized cell lines obtained by the methods of this disclosure are useful for studying the role of pathogenic mutations in skin disease phenotype, for screening for potential therapeutic agents, and for producing race-, sex, and age-specific epidermis for research and clinical applications.
Claims
1. A replication competent lentiviral vector comprising (i) a nucleic acid sequence encoding at least two proteins selected from (a) to (c): (a) a human TERT (hTERT) protein, (b) an HPV16 E7 oncoprotein, and (c) an HPV16 E6 oncoprotein, and a cleavable peptide or self-cleaving peptide, and (ii) a promoter suitable for expression in a mammalian cell, wherein the nucleic acid sequence of (i) is transcribed as a single transcript comprising the first protein-cleavable peptide or self-cleaving peptide-second protein.
2. The lentiviral vector of claim 1, further comprising cis-acting sequences necessary for transcription, packaging, and integration in a target cell.
3. The lentiviral vector of claim 1, wherein the self-cleaving peptide is a 2a self-cleavage peptide sequence selected from the group consisting of equine rhinitis A virus, foot-and-mouth disease virus, porcine teschovirus-1 and Thosea asigna virus.
4. The lentiviral vector of claim 1, wherein the 2A peptide is selected from T2A, F2A, E2A, and P2A.
5. The lentiviral vector of claim 1, wherein the virus encodes: a) HTERT and E7; b) HTERT and E6; or c) E6 and E7.
6. A eukaryotic host cell transfected with the recombinant lentivirus according to claim 1.
7. The eukaryotic host cell according to claim 6, which is a human keratinocyte.
8. The eukaryotic host cell according to claim 6, wherein the human keratinocyte is obtained from a human subject having a skin disease or disorder.
9. The eukaryotic host cell according to claim 8, wherein the skin disease or disorder is selected from epidermolysis bullosa (EB), xeroderma pigmentosum (XP), psoriasis, eczema, dermatitis, skin cancer, and premature aging.
10. A method for generating immortalized keratinocytes, the method comprising: a) transducing or transfecting kerotinocyte target cells with one or more vectors capable of expressing two or more of the following proteins: (i) a human TERT (hTERT) protein, (ii) a HPV16 E7 oncoprotein, and (iii) a HPV16 E6 oncoprotein, wherein the two or more proteins are expressed at a 1:1 ratio within the cell; and b) culturing the transduced or transfected cells in a cell culture, thereby generating immortalized keratinocytes.
11. The method of claim 10, wherein the one or more vectors comprise lentiviral vectors, and wherein the first and second protein are encoded within the same vector.
12. The method of either claim 10, wherein the one or more vectors comprise a nucleic acid sequence that when transcribed encodes the first and second protein as a single transcript, and wherein the nucleic acid sequence encodes a cleavable peptide or self-cleaving peptide between the first and second protein.
13. The method of claim 10, wherein the immortalized keratinocytes are maintained in culture for at least 50 or at least 100 population doublings.
14. (canceled)
15. The method of claim 10, wherein the immortalized keratinocytes are at least 90% or 95% pure.
16. (canceled)
17. The method of claim 10, wherein the keratinocyte target cells are obtained from a human subject having a skin disease or disorder.
18. The method of claim 10, wherein the skin disease or disorder is selected from epidermolysis bullosa (EB), xeroderma pigmentosum (XP), psoriasis, eczema, and dermatitis.
19. The method of claim 10, wherein the vector is a lentiviral vector of claim 1.
20. A cell line comprising a plurality of immortalized keratinocytes obtained according to the method of claim 10.
21. A method of preparing an in vitro three-dimensional (3D) artificial skin model, the method comprising: (a) providing immortalized keratinocytes obtained by the methods of claim 10; (b) culturing immortalized keratinocytes in a cell culture substrate in the presence of a culture medium comprising Human Keratinocyte Growth Supplement and CaCl.sub.2; (c) after about 1 day, removing the culture medium from the cultured immortalized keratinocytes of step (b); and (d) further culturing the cultured immortalized keratinocytes for about 19 to about 28 days in the presence of a culture medium comprising Human Keratinocyte Growth Supplement, CaCl.sub.2), Keratinocyte Growth Factor, and ascorbic acid, under conditions that promote differentiation and organization of the immortalized keratinocytes into a three-dimensional (3D) artificial skin model, whereby an in vitro 3D artificial skin model comprising basal, supra-basal, granular, and cornified epidermal layers is obtained.
22. An in vitro three-dimensional skin dermis model obtained according to the method of claim 21, wherein the 3D skin dermis model comprises basal, supra-basal, granular, and cornified epidermal layers derived from immortalized keratinocytes.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0020] The present invention will be better understood and features, aspects and advantages other than those set forth above will become apparent when consideration is given to the following detailed description thereof. Such detailed description makes reference to the following drawings, where:
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033] While the present invention is susceptible to various modifications and alternative forms, exemplary embodiments thereof are shown by way of example in the drawings and are herein described in detail. It should be understood, however, that the description of exemplary embodiments is not intended to limit the invention to the particular forms disclosed, but on the contrary, the intention is to cover all modifications, equivalents and alternatives falling within the spirit and scope of the invention as defined by the claims.
DETAILED DESCRIPTION OF THE PRESENT DISCLOSURE
[0034] The methods and compositions provided herein are based, at least in part, on the inventor's development of a set of tools and methodologies that allow for immortalization of keratinocytes. In particular, the methods and compositions are based on development of a novel lentivirus comprising nucleic acids encoding the combination of human TERT (hTERT), oncoprotein E7 from human papilloma virus 16 (HPV16), or the combination of two of TERT, E7 and E6 being expressed from one vector. Primary keratinocytes can maintain their proliferative and differentiation ability for about 2-3 weeks in culture and about 15 population doublings before a rapid decline in viability occurs with increasing senescence and cell death. By contrast, keratinocytes into which the lentivirus of this disclosure is introduced survive over 6 months in culture and undergo over 100 population doublings, and are thus considered to be immortal. Without being bound to any particular mechanism or mode of action, it is believed that the hTERT_E7/hTERT_E6/E7_E6 gene products work in combination to immortalize keratinocytes without disrupting functional and morphological characteristic of the immortalized cells relative to primary keratinocytes.
[0035] This was unexpectedly in view of the prior art, as discussed more below. The present inventors found that the co-expression of hTER and E7, hTERT and E6, or E7 and E6 within keratinocytes at 1:1 ratio within the same cell (by using a lentiviral vector that expresses both protein as a single transcript that is cleaved) allows for the immortalization of the keratinocytes and ability to culture the cells for at least 50 doublings. Advantageously, immortalized keratinocytes retain the ability to differentiate into 3D epidermis even after extended in vitro culture.
[0036] The immortalized engineered keratinocytes described herein allow advantages over the primary keratinocytes in the ability to be propagated in culture for extensive numbers of doublings, providing a source for a population of cells that can provide reproducible, reliable and consistent results and information and can be used to build 3-D cultures for drug evaluation and study. Further, these cells can be used to study cell senescence, relationship of keratinocytes with the fibroblast and the construction of 3-D epidermis to study drug translocation and delivery
[0037] To date, the only known immortalized functional keratinocyte cell lines are the N/TERTs (Smits et al., 2017). The N/TERTs were created by transduction of hTERT along with an unspecified spontaneous mutation that allowed knockdown of p16 and immortalization (Dickson et al., 2000). This undefined immortalization cannot be replicated easily or consistently. The viral oncogenes E6 and E7 of human papilloma virus type 16 (HPV16) play an important role in carcinogenesis and transforming basal keratinocytes (Hoppe-Seyler et al., 2018). Other researchers have examined the expression of hTERT and E7 together in keratinocytes and found that they could “immortalize” the cells based on long term survival in culture (Halbert et al., 1991; Kiyono et al., 1998; Liu et al., 2007; Miller et al., 2013). However, none of the previous studies combined these two genes into one virus (all were introduced on separate viruses into the cells) and none of them examined the functionality of these keratinocytes and their ability to differentiate into 3D epidermis. In fact, one study even found that E6 and E7 would transform keratinocytes making them immortal and differentiation resistant (Munger et al., 1989). Herein, the inventor discloses the discovery that using the novel lentiviruses of the present disclosure containing the two gene combinations of hTERT_E7, hTERT_E6, or E7_E6 can immortalize keratinocytes while maintaining the keratinocyte phenotype and differentiation ability.
[0038] Accordingly, provided herein are recombinant vectors, including lentiviral vectors and methods of using the same to produce genetically modified keratinocytes that can be maintained in culture for over 100 population doublings without loss of morphological features or differentiation capacity. Immortalized keratinocytes and immortalized cell lines obtained by the methods of this disclosure are useful for studying the role of pathogenic mutations in skin disease phenotype, for screening for potential therapeutic agents, and for producing race-, sex, and age-specific epidermis for research and clinical applications.
[0039] In a first aspect, provided herein are recombinant vectors, including lentiviral vectors for producing genetically modified keratinocytes that are capable of undergoing over numerous cell doublings in an in vitro culture environment such that the modified keratinocytes are considered to be immortalized.
[0040] In some cases, the recombinant lentiviral vector is a replication competent lentiviral vector that comprises A: (i) a nucleic acid sequence encoding a human TERT protein, (ii) a nucleic acid sequence encoding an E7 protein of a human papilloma virus, B. a nucleic acid sequence encoding a human TERT protein, (ii) a nucleic acid sequence encoding an E6 protein of a human papilloma virus, C. (i) a nucleic acid sequence encoding an E7 protein of a human papilloma virus, (ii) a nucleic acid sequence encoding an E6 protein of a human papilloma virus, where one or more of the nucleic acid sequences are operably linked to a promoter. In some cases, the recombinant lentiviral vector comprises one or more nucleic acid sequences encoding a human TERT (hTERT) protein and a HPV16 E7 oncoprotein/hTERT protein and a HPV16 E6 oncoprotein/HPV16 E7 and a HPV16 E6 oncoprotein wherein any of the preceding combinations two of nucleic acid sequences encoding are separated by a cleavable or self-cleaving peptide sequence. The lentiviral vector can further comprise an internal ribosome entry site (IRES), and a promoter suitable for expression in a mammalian cell, where the sequences encoding hTERT, T2A, HPV16 E7/hTERT, T2A, HPV16 E6/HVP16 E7, T2A HVP16 E6 are preferably transcribed from the promoter as a multi-cistronic RNA. In some cases, the lentiviral vector further comprises cis-acting sequences necessary for transcription, packaging, and integration in a target cell. In one embodiment, the lentiviral vector used comprises SEQ ID NO: 24 (pLV_GS_hTERT_E6), SEQ ID NO: 25 (pLV_GS_hTERT_E7), SEQ ID NO: 26 (pLV_hTERT_E7), or SEQ ID NO: 27 (pLV_E7_E6) or a sequence having at least 90% sequence similarity to one of SEQ ID NO:24-27, alternatively at least 95% sequence similarity to one of SEQ ID NO:24-27.
[0041] In some cases, the recombinant lentiviral vector is a replication competent lentiviral vector that comprises (i) a nucleic acid sequence encoding a human TERT protein, (ii) a nucleic acid sequence encoding an E7 protein of a human papilloma virus, where one or more of the nucleic acid sequences are operably linked to a promoter. In some cases, the recombinant lentiviral vector comprises one or more nucleic acid sequences encoding a human TERT (hTERT) protein and a HPV16 E7 oncoprotein, where nucleic acid sequences encoding hTERT and HPV16 E7 are separated by a self-cleaving peptide, for example, a 2A self-cleaving peptide sequence. The lentiviral vector can further comprise an internal ribosome entry site (IRES), and a promoter suitable for expression in a mammalian cell, where the sequences encoding hTERT, HPV16 E7, and the 2A peptide are preferably transcribed from the promoter as a multi-cistronic RNA. In some cases, the lentiviral vector further comprises cis-acting sequences necessary for transcription, packaging, and integration in a target cell.
[0042] In some embodiments, the lentiviral vector includes a 2A element, which is a nucleic acid sequence encoding a 2A peptide. 2A peptides, first discovered in picornaviruses, are short (about 18-22 amino acids) and produce equimolar levels of multiple genes from the same mRNA. Any appropriate 2A self-cleavage peptide sequence can be used for recombinant lentiviral vectors of this disclosure. Sequences encoding commonly used 2A peptides such as T2A (thosea asigna virus 2A), P2A (porcine teschovirus-1 2A), E2A (equine rhinitis A virus), and F2A (foot and mouth disease virus 2A), are known and available to practitioners in the art. In some embodiments, equine rhinitis A virus self-cleaving peptide is used in the compositions of the current disclosure and has the following sequence: QCTNYALLKLAGDVESNPGP (SEQ ID NO: 1). In some embodiments, foot and mouth disease virus self cleaving peptide is used in the compositions of the current disclosure and has the following sequence: VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 2). In some embodiments, porcine teschovirus self-cleaving peptide is used in the compositions of the current disclosure and has the following sequence: ATNFSLLKQAGDVEENPGP (SEQ ID NO: 3). In some embodiments, Thosea asigna virus 2A self-cleaving peptide is used in the compositions of the current disclosure and has the following sequence: EGRGSLLTCGDVEENPGP (SEQ ID NO: 4). In some cases, one or more glycine-serine-glycine spacers (GSG) is added to the 5′ end of the 2A peptide to improve cleavage efficiency.
[0043] Various promoters can be operably linked to drive expression of the gene products (e.g., hTERT, HPV16 E7, HPV16 E6) of interest in accordance with embodiments herein. Examples of promoters, include, but are not limited to, viral promoters, plant promoters, and mammalian promoters. Examples of viral promoters include, but are not limited to human elongation factor 1α-subunit (EF-1α) promoter, cytomegalovirus (CMV) immediate early promoter, CAG promoter (which is a combination of the CMV early enhancer element and chicken beta-actin promoter, described in Alexopoulou et al. BMC Cell Biology 9:2, (2008)), simian virus 40 (SV40) promoter, and any variants thereof. Exemplary mammalian promoters include, but are not limited to, human EF-1α promoter, human ubiquitin C (UCB) promoter, murine phosphoglycerate kinase-1 (PGK) promoter, and any variants thereof. As used herein, the term “operably linked” is used to describe the connection between regulatory elements and a gene or its coding region. Typically, gene expression is placed under the control of one or more regulatory elements, for example, without limitation, constitutive or inducible promoters, tissue-specific regulatory elements, and enhancers. A gene or coding region is said to be “operably linked to” or “operatively linked to” or “operably associated with” the regulatory elements, meaning that the gene or coding region is controlled or influenced by the regulatory element. For instance, a promoter is operably linked to a coding sequence if the promoter is capable of affecting the expression of that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter). To increase expression from the promoter, in some cases the promoter comprises a transcriptional enhancer.
[0044] In some cases, the lentiviral vector further comprises a nucleic acid sequence encoding a selectable marker. In some cases, one or more of the nucleic acid sequences and the selectable marker are expressed by a single open reading frame. As used herein, the term “selectable marker” or “marker gene” refers to a gene which encodes an enzyme having an activity that confers resistance to an antibiotic or drug upon the cell in which the selectable marker is expressed. Examples of selectable markers include, without limitation, hygromycin phosphotransferase, blasticidin-S-deaminase (BSD), puromycin acetyltransferase (PAT), and neomycin phosphotransferase II (NPTII).
[0045] In some cases, the lentiviral vector comprises a screening marker. As used herein, the term “screening marker” or “reporter gene” refers to a gene encoding a protein that may be assayed (screened) directly or indirectly. In a particular embodiment, the reporter can be directly assayed. Examples of reporter genes include, but are not limited to, bioluminescence catalyzing enzymes (e.g. luciferase), fluorescent proteins (e.g., RFP (e.g., monomer red fluorescent protein), CFP, YFP, GFP and variants thereof (e.g., turboGFP (Evrogen; Russia))), chloramphenicol acetyltransferase, β-galactosidase, alkaline phosphatase, and horseradish peroxidase.
[0046] In another aspect, provided herein is a genetically modified keratinocyte. In some embodiments, the genetically modified keratinocyte comprises an exogenous vector capable of expressing two of the proteins selected from hTERT, HPV16 E6, and HPV16 E7 in the keratinocyte. Preferably, in some embodiments, the two proteins are expressed at equal level (e.g. at 1:1 ratio within the cell). Preferably, the genetically modified keratinocyte is obtained by introducing into a human keratinocyte a recombinant vector, for example, a lentiviral vector of this disclosure. Without being bound to any particular theory or mode of action, it believed that introduction of the lentiviral vector into a human keratinocyte results in expression of the encoded proteins, hTERT and HPV16 E7, HTERT or HPV16 E6, or HPV16 E7 and HPV16 E6, and immortalization of the introduced cell. Modified keratinocytes of this disclosure (a) are immortalized; (b) form cornified envelopes when induced to differentiate; (c) undergo normal squamous differentiation; and maintain cell type-specific growth requirements including, without limitation, exhibition of morphological characteristics of normal human keratinocytes and expression of cytokeratin 14 and p63, dependence on epidermal growth factor for growth, and inhibition of growth by transforming growth factor β1.
[0047] In one embodiment, the lentiviral vector used comprises SEQ ID NO: 24 (pLV_GS_hTERT_E6), SEQ ID NO: 25 (pLV_GS_hTERT_E7), SEQ ID NO: 26 (pLV_hTERT_E7), or SEQ ID NO: 27 (pLV_E7_E6) or a sequence having at least 90% sequence similarity to one of SEQ ID NO:24-27, alternatively at least 95% sequence similarity to one of SEQ ID NO:24-27.
[0048] As used herein, “cis-acting sequences necessary for transcription, packaging, and integration in a target cell” includes, but is not limited to: nucleic acids encoding GAG, POL, REV, TAT, and ENV.
[0049] The term “permanent” or “immortalized” as used herein in reference to cells can refer to cells that may undergo cell division and double in cell numbers while cultured in an in vitro environment a multiple number of times until the cells terminate. An immortalized cell line may double over 20 times before a significant number of cells terminate in culture. Preferably, an immortalized cell line may double over 60 times or over 70 times before a significant number of cells terminate in culture. More preferably, an immortalized cell line may double over 80 times or 90 times before a significant number of cells terminate in culture. Most preferably, an immortalized cell line may double over 100 times before a significant number of cells die in culture.
[0050] Because the genetically modified keratinocyte comprises one or more exogenous nucleic acids (e.g., sequence encoding human TERT, sequence encoding one or more viral proteins (E6 or E7)), the genetically modified keratinocyte is considered to be “transgenic.” As used herein, the term “transgenic” refers to a cell having a genome into which genetic material from a different organism has been artificially introduced. Genetic material that is artificially introduced or is about to be artificially introduced into the genome of a cell and/or animal is referred to herein as a “transgene” or “transgenic DNA sequence.” The transgenic DNA sequences are integrated in all or a portion of the animals cells, especially in the germ cells. The integration into the genome may be transient or stable. Preferably, the integration is stable.
[0051] The term “express” and grammatical variations thereof refer to the transcription and/or translation of a particular nucleotide sequence driven by its promoter. As used herein, the term “encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
[0052] Any appropriate method of introducing nucleic acid sequences or constructs can be used for the methods described herein. In some cases, nucleic acids are transfected into keratinocyte. The term “transfected” or “transformed” or “transduced” as used herein refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell (e.g., mouse cell). A “transfected” or “transformed” or “transduced” cell is one which has been transfected, transformed or transduced with exogenous nucleic acid, and the term includes the primary subject cell and its progeny.
[0053] As used herein, the term “construct”, “nucleic acid construct” or “DNA construct” refers to an artificially constructed (i.e., not naturally occurring) DNA molecule that is capable of expressing the polypeptide it encodes. The term “vector” refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes the vector as a self-replicating nucleic acid structure as well as the vector incorporated into the genome of a host cell into which it has been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as “expression vectors”. Vectors suitable for use with the present invention comprise the constructs described herein and heterogeneous sequence necessary for proper propagation of the vector and expression of the encoded polypeptide. Preferably, the constructs are packaged in a vector suitable for delivery into a mammalian cell including but not limited to, an adeno-associated viral (AAV) vector, a lentiviral vector, or a vector suitable for transfection. As used herein, the term “vector,” “virus vector,” “delivery vector” (and similar terms) generally refers to a virus particle that functions as a nucleic acid delivery vehicle, and which comprises the viral nucleic acid (i.e., the vector genome) packaged within the virion. Suitable vectors are known and commercially available in the art. A skilled artisan will be familiar with the elements and configurations necessary for vector construction to encode the constructs described herein. In a preferred embodiment, the vector is lentiviral vector.
[0054] Modified keratinocytes of this disclosure can be passaged using cell culture techniques well known to those skilled in the art. The term “cell passaging” can refer to a technique that involves the steps of (1) releasing cells from a solid support or substrate and disassociation of these cells, and (2) diluting the cells in media suitable for further cell proliferation. Cell passaging may also refer to removing a portion of liquid medium containing cultured cells and adding liquid medium to the original culture vessel to dilute the cells and allow further cell proliferation. In addition, cells may also be added to a new culture vessel that has been supplemented with medium suitable for further cell proliferation. The term “cultured,” as used herein, in reference to cells can refer to one or more cells that are undergoing cell division or not undergoing cell division in an in vitro environment. An in vitro environment can be any medium known in the art that is suitable for maintaining cells in vitro, such as suitable liquid media or agar, for example. Specific examples of suitable in vitro environments for cell cultures are described in Culture of Animal Cells: a manual of basic techniques (1994); Cells: a laboratory manual (1998); and Animal Cells: culture and media (1994).
[0055] In another aspect, provided herein are immortalized human keratinocyte cell lines, where the immortalized cells of the cell line are obtained by introducing a recombinant vector (e.g., lentiviral vector) of this disclosure into human keratinocytes of any source. In some embodiments, the recombinant vector is capable of expressing at least two proteins selected from hTERT, HPV16 E6 and HPV16E7. In some cases, human keratinocytes for production of an immortalized keratinocyte cell line according to the methods provided herein are obtained from a human subject not known to have a skin disease. In other cases, the human subject is known to have or is suspected of having a skin disease. As demonstrated in the Examples, immortalized keratinocyte cell lines have been produced according to methods of this disclosure using primary keratinocytes obtained from several recessive dystrophic epidermolysis bullosa (RDEB) patients and their HLA-matched bone marrow donors. Also, primary keratinocytes from a patient with xeroderma pigmentosum complement group A (XPA) cells were immortalized.
[0056] In one embodiment, the lentiviral vector used comprises SEQ ID NO: 24 (pLV_GS_hTERT_E6), SEQ ID NO: 25 (pLV_GS_hTERT_E7), SEQ ID NO: 26 (pLV_hTERT_E7), or SEQ ID NO: 27 (pLV_E7_E6) or a sequence having at least 90% sequence similarity to one of SEQ ID NO:24-27, alternatively at least 95% sequence similarity to one of SEQ ID NO:24-27.
[0057] In some cases, genetically modified, immortalized keratinocytes of this disclosure are useful in drug discovery and development including screening for potential therapeutic agents. Human keratinocytes (skin cells) are needed for laboratory skin toxicity testing of cosmetics and pharmaceuticals to reduce or eliminate animal testing. However, these cells are short lived in culture and difficult to obtain. The current source of keratinocytes for industry is leftover skin from surgeries. The preferred age, sex, and race of the donor skin for toxicity testing can be difficult to obtain and the source material is constantly changing.
[0058] In some cases, the methods comprise contacting or administering a candidate test agent to an immortalized keratinocyte of this disclosure. The methods further comprise, following contacting or administration of the test agent, analyzing the contacted genetically modified cell for a molecular, physiological, and/or behavioral change relative to a similarly modified cell which has not been contacted to the test agent. Exemplary test agents include, without limitation, small molecules, proteins, peptides, antibodies, oligonucleotides, small interfering RNAs (siRNAs), polynucleotides, peptidomimetics, cytotoxic agents, chemical compounds, pharmaceutical agents, and infectious agents.
[0059] In some cases, analyzing comprises detecting at least one positive or negative effect of the test agent on morphology or life span of an immortalized keratinocyte. In some cases, detecting comprises performing a method selected from the group consisting of RNA sequencing, gene expression profiling, transcriptome analysis, cell proliferation assays, metabolome analysis, detecting reporter or sensor, protein expression profiling, Förster resonance energy transfer (FRET), metabolic profiling, and microdialysis. In some cases, the agent can be screened for an effect on gene expression, and detecting can comprise assaying for differential gene expression in the contacted immortalized keratinocytes relative to a control immortalized keratinocyte.
[0060] In another aspect, provided herein is a method for generating immortalized keratinocytes. In some cases, the method comprises providing keratinocyte target cells; providing one or more recombinant lentiviral vectors as described herein; transducing or transfecting the keratinocyte target cells with the one or more recombinant lentiviral vectors; and culturing the transduced or transfected cells in a cell culture under conditions suitable for expression of at least two of hTERT, HPV16 E7, and HPV16 E6 encoded by the recombinant lentiviral vector, thereby generating immortalized keratinocytes. For example, hTERT and HPV16 E7, hTERT and HPV16 E6, or HPV16 E6 and E7 are expressed in the cell. In a preferably embodiment, the cell expresss hTERT and HPV16 E7. Preferably, the immortalized keratinocytes can be maintained in culture without differentiation for at least 50 population doublings. More preferably, the immortalized keratinocytes are maintained in culture without differentiation for at least 100 population doublings. Preferably, the immortalized keratinocytes are at least 70% (e.g., at 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more) pure. In one embodiment, the lentiviral vector used comprises SEQ ID NO: 24 (pLV_GS_hTERT_E6), SEQ ID NO: 25 (pLV_GS_hTERT_E7), SEQ ID NO: 26 (pLV_hTERT_E7), or SEQ ID NO: 27 (pLV_E7_E6) or a sequence having at least 90% sequence similarity to one of SEQ ID NO:24-27, alternatively at least 95% sequence similarity to one of SEQ ID NO:24-27. In some cases, keratinocyte target cells for the methods are obtained from a human subject having a skin disease or disorder. As used herein, the term “skin disease or disorder” refers to any of a number of skin ailments that afflict the skin surface or deeper skin tissue, including, without limitation, atopic dermatitis, seborrheic dermatitis, all types of psoriasis, acne, ichthyosis, contact dermatitis, eczema, photodermatoses, dry skin disorders, herpes simplex, zoster (shingles), pyoderma gangrenosum, rosacea, hives, inflamed burns, epidermal hyperkeratosis, acanthosis, epidermal inflammation, dermal inflammation, pruritus, skin pigmentation disorders, skin cancer, premature aging, and skin infections (e.g., impetigo, folliculitis, furunculosis, carbunculosis, ecthyma, erysipelas, cellulitis, necrotizing fasciitis, dermatophytosis, candidiasis, tinea, athlete's foot, nail fungal infection, diaper rash, herpes simplex, herpes zoster, cold sores, warts, molluscum contagiosum, etc). In some cases, the keratinocyte target cells can be obtained from a human subject that has epidermolysis bullosa (EB), a group of genetic skin blistering diseases caused by mutations in any of 15 different genes that function in maintaining the mechanical strength of the skin. Other examples include, keratinocytes obtained from subjects having xeroderma pigmentosum (XP), Fanconi anemia, Werner syndrome, Bloom syndrome, ataxia telangiectasia, Cockayne syndrome, dyskeratosis congenita, or progeria, which are all genetic disorders that result in abnormal skin pigmentation, premature aging and/or predisposition to skin cancer. In other cases, keratinocyte target cells are derived from human subjects having more common skin disorders such as psoriasis, eczema, and dermatitis (e.g., atopic dermatitis). Accordingly, the present disclosure provides methods for producing disease-specific lines of immortalized keratinocytes which are particularly well suited for studying the role of pathogenic mutations in skin disease phenotype, for screening for potential therapeutic agents, and for producing race-, sex, and age-specific epidermis for research and clinical applications. As demonstrated in the Examples, immortalized keratinocyte cell lines have been produced according to methods of this disclosure using primary keratinocytes obtained from several recessive dystrophic epidermolysis bullosa (RDEB) patients and their HLA-matched bone marrow donors and from a patient with xeroderma pigmentosum complementation group A (XPA).
[0061] In some cases, keratinocyte target cells for the methods are obtained from a human subject having a skin disease or disorder. As used herein, the term “skin disease or disorder” refers to any of a number of skin ailments that afflict the skin surface or deeper skin tissue, including, without limitation, atopic dermatitis, seborrheic dermatitis, all types of psoriasis, acne, ichthyosis, contact dermatitis, eczema, photodermatoses, dry skin disorders, herpes simplex, zoster (shingles), pyoderma gangrenosum, rosacea, hives, inflamed burns, epidermal hyperkeratosis, acanthosis, epidermal inflammation, dermal inflammation, pruritus, skin pigmentation disorders, and skin infections (e.g., impetigo, folliculitis, furunculosis, carbunculosis, eethyma, erysipelas, cellulitis, necrotizing fasciitis, dermatophytosis, candidiasis, tinea, athlete's foot, nail fungal infection, diaper rash, herpes simplex, herpes zoster, cold sores, warts, molluscum contagiosum, etc). In some cases, the keratinocyte target cells can be obtained from a human subject that has epidermolysis bullosa (EB), a group of genetic skin blistering diseases caused by mutations in any of 15 different genes that function in maintaining the mechanical strength of the skin. As another example, keratinocytes may be obtained from a subject having xeroderma pigmentosum (XP), which is a genetic skin disorder that causes ultraviolet light sensitivity due to a DNA repair deficiency, resulting in abnormal skin pigmentation and predisposition to skin cancer. In other cases, keratinocyte target cells are derived from human subjects having more common skin disorders such as psoriasis, eczema, and dermatitis (e.g., atopic dermatitis). Accordingly, the present disclosure provides methods for producing disease-specific lines of immortalized keratinocytes which are particularly well suited for studying the role of pathogenic mutations in skin disease phenotype, for screening for potential therapeutic agents, and for producing race-, sex, and age-specific epidermis for research and clinical applications. As demonstrated in the Examples, immortalized keratinocyte cell lines have been produced according to methods of this disclosure using primary keratinocytes obtained from several recessive dystrophic epidermolysis bullosa (RDEB) patients and their HLA-matched bone marrow donors.
[0062] In another aspect, provided herein is a method of preparing an in vitro three-dimensional (3D) artificial skin model. In some cases, the method comprises (a) providing immortalized keratinocytes obtained by i) introducing into a keratinocyte target cell one or more of the lentiviral vectors of the current disclosure, thereby producing a genetically modified keratinocyte; and ii) culturing the genetically modified keratinocyte under conditions that maintain the genetically modified keratinocytes in vitro, thereby generating immortalized keratinocytes; (b) culturing immortalized keratinocytes in a cell culture substrate in the presence of a culture medium comprising Human Keratinocyte Growth Supplement and CaCl.sub.2; (c) after about 1 day, removing the culture medium from the cultured immortalized keratinocytes of step (b); and (d) further culturing the cultured immortalized keratinocytes for about 19 to about 28 days in the presence of a culture medium comprising Human Keratinocyte Growth Supplement, CaCl.sub.2, Keratinocyte Growth Factor, and ascorbic acid, under conditions that promote differentiation and organization of the immortalized keratinocytes into a three-dimensional (3D) artificial skin model, whereby an in vitro 3D artificial skin model comprising basal, supra-basal, granular, and cornified epidermal layers is obtained. In one embodiment, the lentiviral vector used comprises SEQ ID NO: 24 (pLV_GS_hTERT_E6), SEQ ID NO: 25 (pLV_GS_hTERT_E7), SEQ ID NO: 26 (pLV_hTERT_E7), or SEQ ID NO: 27 (pLV_E7_E6) or a sequence having at least 90% sequence similarity to one of SEQ ID NO:24-27, alternatively at least 95% sequence similarity to one of SEQ ID NO:24-27.
[0063] As used herein, “human keratinocyte growth supplement” or “HKGS” refers to an ionically-balanced supplement containing bovine pituitary extract (BPE), recombinant human insulin-like growth factor-I, hydrocortisone, bovine transferrin, and human epidermal growth factor. Each 5-mL bottle of HKGS contains all of the growth factors, hormones, and tissue extracts necessary for the culture of human epidermal keratinocytes. When a 500-mL bottle of medium is supplemented with HKGS, the final concentrations of the components in the supplemented medium are: bovine pituitary extract (BPE): 0.2% v/v, recombinant human insulin-like growth factor-I: 0.01 μg/mL, hydrocortisone: 0.18 μg/mL, bovine transferrin: 5 μg/mL, human epidermal growth factor: 0.2 ng/mL.
[0064] Also provided herein is an in vitro three-dimensional skin dermis model obtained according to this method, where the 3D skin dermis model comprises basal, supra-basal, granular, and cornified epidermal layers derived from immortalized keratinocytes.
[0065] In another aspect, provided herein are articles of manufacture such as kits for producing immortalized keratinocytes or immortalized keratinocyte cell lines according to methods of this disclosure. In some cases, the kit comprises a recombinant lentiviral vector that comprises nucleic acid sequence encoding at least two proteins selected from (a) to (c): (a) a human TERT (hTERT) protein, (b) an HPV16 E7 oncoprotein, and (c) an HPV16 E6 oncoprotein, and a cleavable peptide or self-cleaving peptide, and (ii) a promoter suitable for expression in a mammalian cell, wherein the nucleic acid sequence of (i) is transcribed as a single transcript comprising the first protein-cleavable peptide or self cleaving peptide-second protein In some cases, the recombinant lentiviral vector comprises one or more nucleic acid sequences encoding a human TERT (hTERT) protein, an HPV16 E7 oncoprotein, and/or an HPV16 E6 oncoprotein, where nucleic acid sequences encoding any of the preceding proteins are separated by a 2A self-cleaving peptide sequence. Preferably, the recombinant lentiviral vector further comprises an internal ribosome entry site (IRES), and a promoter suitable for expression in a mammalian cell, where the sequences encoding hTERT_HPV16 E7/hTERT_E6/E7_E6, the 2A peptide, and the IRES are preferably transcribed from the promoter as a multi-cistronic RNA. In some cases, the recombinant lentiviral vector further comprises cis-acting sequences necessary for transcription, packaging, and integration in a target cell. In some cases, the kit may further comprise instructions and/or reagents for introducing the recombinant lentiviral vector into target cells and, in some cases, instructions and reagents for maintaining immortalized keratinocytes in culture for numerous population doublings. In some cases, the kit comprises materials for obtaining primary keratinocyte samples from a human subject such as a subject having a particular skin disease or disorder.
[0066] In another aspect, provided herein are articles of manufacture such as kits for producing immortalized keratinocytes or immortalized keratinocyte cell lines according to methods of this disclosure. In some cases, the kit comprises a recombinant lentiviral vector that comprises (i) a nucleic acid sequence encoding a human TERT protein, (ii) a nucleic acid sequence encoding an E7 protein of a human papilloma virus, where one or more of the nucleic acid sequences are operably linked to a promoter. In some cases, the recombinant lentiviral vector comprises one or more nucleic acid sequences encoding a human TERT (hTERT) protein and a HPV16 E7 oncoprotein, where nucleic acid sequences encoding hTERT and HPV16 E7 are separated by a 2A self-cleaving peptide sequence. Preferably, the recombinant lentiviral vector further comprises an internal ribosome entry site (IRES), and a promoter suitable for expression in a mammalian cell, where the sequences encoding hTERT, HPV16 E7, the 2A peptide, and the IRES are preferably transcribed from the promoter as a multi-cistronic RNA. In some cases, the recombinant lentiviral vector further comprises cis-acting sequences necessary for transcription, packaging, and integration in a target cell. In some cases, the kit may further comprise instructions and/or reagents for introducing the recombinant lentiviral vector into target cells and, in some cases, instructions and reagents for maintaining immortalized keratinocytes in culture for numerous population doublings. In some cases, the kit comprises materials for obtaining primary keratinocyte samples from a human subject such as a subject having a particular skin disease or disorder.
[0067] With respect to the use of substantially any plural and/or singular terms herein, those having skill in the art can translate from the plural to the singular and/or from the singular to the plural as is appropriate to the context and/or application. The various singular/plural permutations may be expressly set forth herein for sake of clarity.
[0068] It will be understood by those within the art that, in general, terms used herein, and especially in the appended claims (e.g., bodies of the appended claims) are generally intended as “open” terms (e.g., the term “including” should be interpreted as “including but not limited to,” the term “having” should be interpreted as “having at least,” the term “includes” should be interpreted as “includes but is not limited to,” etc.). It will be further understood by those within the art that if a specific number of an introduced claim recitation is intended, such an intent will be explicitly recited in the claim, and in the absence of such recitation no such intent is present. For example, as an aid to understanding, the following appended claims may contain usage of the introductory phrases “at least one” and “one or more” to introduce claim recitations. However, the use of such phrases should not be construed to imply that the introduction of a claim recitation by the indefinite articles “a” or “an” limits any particular claim containing such introduced claim recitation to embodiments containing only one such recitation, even when the same claim includes the introductory phrases “one or more” or “at least one” and indefinite articles such as “a” or “an” (e.g., “a” and/or “an” should be interpreted to mean “at least one” or “one or more”); the same holds true for the use of definite articles used to introduce claim recitations. In addition, even if a specific number of an introduced claim recitation is explicitly recited, those skilled in the art will recognize that such recitation should be interpreted to mean at least the recited number (e.g., the bare recitation of “two recitations,” without other modifiers, means at least two recitations, or two or more recitations). Furthermore, in those instances where a convention analogous to “at least one of A, B, and C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., “a system having at least one of A, B, and C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and/or A, B, and C together, etc.). In those instances where a convention analogous to “at least one of A, B, or C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., “a system having at least one of A, B, or C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and/or A, B, and C together, etc.). It will be further understood by those within the art that virtually any disjunctive word and/or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase “A or B” will be understood to include the possibilities of “A” or “B” or “A and B.”
[0069] While various aspects and embodiments have been disclosed herein, other aspects and embodiments will be apparent to those skilled in the art. The various aspects and embodiments disclosed herein are for purposes of illustration and are not intended to be limiting, with the true scope and spirit being indicated by the following claims.
[0070] While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention.
[0071] The term “comprising” as used herein is synonymous with “including,” “containing,” or “characterized by,” and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.
[0072] All numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification are to be understood as being modified in all instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth herein are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of any claims in any application claiming priority to the present application, each numerical parameter should be construed in light of the number of significant digits and ordinary rounding approaches.
[0073] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. This applies regardless of the breadth of the range.
[0074] In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. “A” refers to adenosine, “C” refers to cytosine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine.
[0075] The above description discloses several methods and materials of the present invention. This invention is susceptible to modifications in the methods and materials, as well as alterations in the fabrication methods and equipment. Such modifications will become apparent to those skilled in the art from a consideration of this disclosure or practice of the invention disclosed herein. Consequently, it is not intended that this invention be limited to the specific embodiments disclosed herein, but that it cover all modifications and alternatives coming within the true scope and spirit of the invention.
[0076] The foregoing description and Examples detail certain embodiments. It will be appreciated, however, that no matter how detailed the foregoing may appear in text, the invention may be practiced in many ways and the invention should be construed in accordance with the appended claims and any equivalents thereof.
EXAMPLES
Example 1—Producing Immortalized Keratinocytes Using a Lentivirus Comprising hTERT and HPV16 E7
[0077] This example demonstrates novel, streamlined production of immortalized keratinocytes by introducing the combination of the two genes (hTERT and E7) into a single lentivirus. As demonstrated in this section, immortalized keratinocytes produced using this lentivirus exhibit the normal structural and functional properties of primary keratinocytes, but can be maintained in culture for over 100 population doublings. Such extended culture is not possible with primary keratinocytes. Unlike other immortalized keratinocytes described in the art which arose from spontaneous unknown mutations, the genetic properties of the immortalized keratinocytes of this disclosure are known and reproducible, and the cell populations can be produced on an industrial scale. The immortalized keratinocytes of this disclosure are also preferable to the standard source of keratinocytes for 3D skin models, namely leftover human skin from surgeries. Using surgical skin remnants is cumbersome, time consuming, and expensive, and the resulting 3D skin product is inconsistent and unpredictable. By contrast, the hTERT_E7 lentivirus demonstrated herein can be used to make cell lines out of potentially any human keratinocyte and provide an unlimited, consistent supply for toxicity testing and other research and clinical applications.
[0078] Materials and Methods
[0079] Keratinocytes: HEKa cells were obtain from ATCC (PCS-200-011), WT1, T20, XPA, and RDEB8 keratinocytes were obtained from patients following informed consent, IRB approval, and in accordance with the Declaration of Helsinki Principles.
[0080] Keratinocyte cell culture: Both immortalized and primary keratinocytes were grown on type IV collagen (Sigma, C5533-5MG) coated cell culture plates in EpiLife (Invitrogen, MEPI500CA)/1×EpiLife Defined Growth Supplement (EDGS) (Invitrogen, S0125) in 37° C./5% CO.sub.2 humidified incubator.
[0081] Construction of pLV-hTERT_E7: Plasmid pLV-hTERT-IRES-hygro (#85140, Addgene) was the starting material for the immortalization vector. This lentiviral plasmid was chosen for its expression of hTERT and hygromycin. The hTERT gene was needed for part of the immortalization and the hygromycin was the preferred antibiotic selection. The pLV-hTERT-IRES-hygro plasmid had two restriction enzyme (RE) sites (EcoRI and NotI) immediately after the stop codon for hTERT gene that were utilized for incorporation of the HPV16 E7 gene. A gBlock, double stranded DNA fragment, was designed and order (IDT) with the HVP16 E7 gene flanked by EcoRI and NotI restriction sites. Standard cloning techniques were used to incorporate the gBlock including digestion of pLV-hTERT-IRES-hygro and HVP16 E7 gBlock with EcoRI and NotI, ligation with T4 DNA ligase, and bacterial transformation. Bacteria colonies were screened for correct incorporation of the HPV E7 gblock into the plasmid with phTert_F1/R1 primers. Site directed mutagenesis (Q5 Site Directed Mutagenesis Kit, NEB) was then used to remove the stop codon from the hTERT gene and incorporate the T2A (self-cleaving sequence) between the hTERT and HVP E7 genes. Sanger sequencing was used to confirm correct integration of T2A and HVP E7 sequences. Primer and gBlock sequences can be found in Table 1.
Construction of pLV_GS_hTERT_E7: This plasmid was designed and by the inventors and the sequence sent to GenScript for custom manufacturing/engineering into their lentivirus plasmid backbone. According to their service agreement, this constitutes a “works made for hire” (www.genscript.com/standard_t_c.html?src=pullmenu).
Construction of pLV_GS_hTERT_E6: Plasmid pLV_GS_hTERT_E7 was the starting material for the immortalization vector. This lentiviral plasmid was chosen for its expression of hTERT and hygromycin. The hTERT gene was needed for part of the immortalization and the hygromycin was the preferred antibiotic selection. The pLV_GS_hTERT_E7 plasmid had two restriction enzyme (RE) sites, BamHI in hTERT gene and KpnI in the IRES that were utilized for incorporation of the HPV16 E6 gene. A gBlock, double stranded DNA fragment, was designed and ordered (IDT) with the HVP16 E6 gene flanked by a portion of the hTERT gene and IRES including the restriction sites. Standard cloning techniques were used to incorporate the gBlock including digestion of pLV_GS_hTERT_E7 and HVP16 E6 gBlock with BamHI and KpnI, ligation with T4 DNA ligase, and bacterial transformation. Bacteria colonies were screened for correct incorporation of the HPV E6 gblock into the plasmid with HPV_E6_F1/R1 primers. Sanger sequencing was used to confirm correct integration of T2A and HVP E6 sequences. Primer and gBlock sequences can be found in Table 1.
[0082] Construction of pLV_E7_E6: Plasmid pLV-hTERT-IRES-hygro (#85140, Addgene) was the starting material for the immortalization vector. This lentiviral plasmid was chosen for its promoter, IRES and hygromycin and consistency with other lentiviral plasmid. The hygromycin was the preferred antibiotic selection. The pLV-hTERT-IRES-hygro plasmid had two restriction enzyme (RE) sites, BamHI immediately before the start codon for hTERT gene and NotI immediately after the stop codon for hTERT gene that were utilized for removal of hTERT and incorporation of the HPV16 E7 and HPV16 E6 genes. A gBlock, double stranded DNA fragment, was designed and ordered (IDT) with the HVP16 E7 gene, T2A and HPV16 E6 gene flanked by BamHI and NotI restriction sites. Standard cloning techniques were used to incorporate the gBlock including digestion of pLV-hTERT-IRES-hygro and HVP16 E7_E6 gBlock with BamHI and NotI, ligation with T4 DNA ligase, and bacterial transformation. Bacteria colonies were screened for correct incorporation of the HPV_E7_E6 gblock into the plasmid with HPV_E7_93F2/HPV_E7_256_R2 primers. Sanger sequencing was used to confirm correct integration of T2A and HVP E7 and HPV E6 sequences. Primer and gBlock sequences can be found in Table 1.
[0083] Lentivirus production: The lentivirus was produced in 293T cells using the 3rd generation lentiviral packaging system. Briefly, 293T cells were plated on 0.1% gelatin coated plates. Transfection the next day with pLV-hTERT_E7/pLV_GS_hTERT_E7/pLV_GS_hTERT_E6/pLV_E7_E6_ plus lentiviral packaging plasmids and transfection reagent (Lipofectamine 2000, Invitrogen). The following day, the media was replaced. After 72 hours, the lentivirus containing media was collected and cellular debris pelleted by centrifugation. The lentivirus was concentrated with Lenti-X Concentrator (Takara Bio) according to manufacturer's instructions. Lentivirus resuspended in keratinocyte media (EpiLife with EDGS supplement, Invitrogen), aliquoted and stored at −80° C.
[0084] Lentiviral transduction of keratinocytes: Lentiviral transduction of keratinocytes was optimized using LentiBlast (Oz Biosciences). Transduction solution composed of keratinocyte media, 10 μM Rock inhibitor, 5 μL LentiBlast A+1 μL LentiBlast B/mL, and 1×10{circumflex over ( )}6 Keratinocytes/mL. Transduction solution aliquoted 1 mL per well of 6 well plate coated with type IV collagen. After 24 hours, media was replaced with keratinocyte media containing 0.5 μg/mL hygromycin B.
[0085] Senescence assay: Senescence was detected using the Senescence β-Galactosidase Staining kit (Cell Signaling, 9860) according to manufacturer's instructions.
[0086] Establishing immortality: The population doubling time (PDT) of the cells was determined by plating at low density in a 6-well plate and allowing the cells to establish for 2-3 days. Then cell images were collected with a BioTeK Cytation imager at the start and at the end of a 48 hour time frame from the same 4 locations in the well. The average cell number from the 4 images from the start (n.sub.o) and after 48 hours (n) were used in the following formula:
PDT=(elapsed time)/[(log(n)−log(n.sub.o))/log(2)]
[0087] Once the PDT was determined, the amount of time needed to attain 100 population doublings was calculated.
[0088] Human epidermis equivalents (HEE): HEE protocol was adapted from previously described protocols. Briefly, 0.5-1×10{circumflex over ( )}6 keratinocytes in 0.5 mL EpiLife/1× Human Keratinocyte Growth Supplement (HKGS)/1.5 mM CaCl.sub.2 seeded in culture inserts (Millicell, PIHP01250) in 6 well plate with 1.5 mL EpiLife/1×HKGS/1.5 mM CaCl.sub.2. The next day, carefully remove media in insert, and add 1.5 mL EpiLife/1×HKGS/1.5 mM CaCl.sub.2/Keratinocyte Growth Factor (KGF) 10 ng/mL/L-Ascorbic Acid 73 μg/mL to 6-well plate. The cells continued to grow in the liquid-air interface and media changed every other day. Cultured in 37° C./5% CO.sub.2 humidified incubator for 19-28 days.
[0089] Histology: HEE were fixed in formalin and embedded in paraffin and cut at 6 μm for Haemotoxylin and Eosin (H&E) staining. HEE with XPA and T20 immortalized cells were embedded in optimal cutting temperature compound (OCT) and rapidly frozen on an aluminum plate in liquid nitrogen. Sectioned at 6 μm for H&E and immunofluorescence. Sections were fixed in acetone at room temperature for 5 minutes. Blocking in 10% normal donkey serum for 1 hour. Primary antibodies were mouse anti-involucrin, 1:500 and rabbit anti-keratin 5 antibody, 1:500 for 1 hour at room temperature. Secondary antibodies were donkey anti-mouse Alexa Fluor 488 and donkey anti-Rabbit Cy3 for 1 hour at room temperature.
[0090] Immunofluorescence: 2D:Keratinocytes were plated on type IV collagen coated chamber slides and allowed to grow until approximately 50% confluent. Cells fixed with 4% Paraformaldehyde for 10 min at room temperature. 3D: Keratinocytes were plated with 3D collagen droplets. Briefly, 2.5×10{circumflex over ( )}5 keratinocytes in 0.25 mL EpiLife/lx Human Keratinocyte Growth Supplement (HKGS)/1.5 mM CaCl.sub.2 plated with collagen droplets in 24 well plate with 0.25 mL EpiLife/1×HKGS/1.5 mM CaCl.sub.2. The next day, carefully remove media and add 0.25 mL EpiLife/1×HKGS/1.5 mM CaCl.sub.2/Keratinocyte Growth Factor (KGF) 10 ng/mL/L-Ascorbic Acid 73 μg/mL to 24-well plate. The cells continued to grow with media changed every other day. Cultured in 37° C./5% CO.sub.2 humidified incubator for 10 days. Fixed in 4% paraformaldehyde for 1 hour at room temperature. Permeabilized for 15 minutes in PBS/0.2% triton X-100. Blocked with 2% BSA for 2 hours at room temperature. Primary antibodies were anti-Cytokeratin 14 (1:200, Abcam ab7800) and rabbit anti-cytokeratin 5 (1:500, BioLegend 905501) and rabbit anti-filaggrin (1:500, BioLegend). 2D secondary antibodies were donkey anti-mouse Alexa Fluor 488 (1:800) donkey anti-rabbit Alexa Fluor 488 (1:800), 3D secondary antibodies were donkey anti-rabbit Rhodamine Red-X, and donkey anti-mouse Alexa Fluor 647. Nuclei were stained with DAPI.
[0091] RT-qPCR: RNA was isolated from cells before and after transduction with either the LV_GS_hTERT_E6 or LV_E7_E6 lentivirus. cDNA synthesis and subsequent qPCR with primers specific to either E6 or E7 as indicated. ACTB gene used as reference gene and Ct method was used to calculate the relative gene expression compared to wild type untransduced cells (T20). qPCR primers can be found in Table 1,
[0092] Results
[0093] To streamline the immortalization of keratinocytes and make it more consistent and reproducible, the inventors engineered a single lentivirus with the two genes that had demonstrated the most consistent immortalization of keratinocytes. The new lentivirus construct, pLV-hTERT_E7 (
[0094] The pLV-hTERT_E7 vector was then used to make replication deficient lentivirus that was used to infect the HEKa, WT1, and RDEB8 keratinocyte cells. The HEKa and WT1 cells are from normal volunteers, but the RDEB8 cells were from a patient with Recessive Dystrophic Epidermolysis Bullosa (RDEB). Hygromycin selection was used to isolate the population that had taken up the lentivirus and PCR amplification using a forward primer within hTERT and a reverse primer in the E7 gene was used to confirm stable integration of the virus.
[0095] Mostly senescent cells were observed in the HEKa primary cells by passage 5, but reduced senescence and increased proliferation was observed after transduction with pLV-hTERT_E7 (
[0096] Next, assays were conducted to determine whether the immortalized keratinoctyes retained normal keratinocyte phenotypic markers. Therefore, the cells were stained with keratinocyte phenotypic markers, cytokeratin 5 (CK5) and cytokeratin 14 (CK14) (
[0097] The ability of the immortalized keratinocytes to differentiate was evaluated by HEE formation. HEKa+hTERT_E7 and WT1+hTERT_E7 were differentiated into HEE and stained with H&E to observe the histology and with immunofluorescence (IF) using markers for keratinocyte differentiation (
[0098] Once the inventors established the LV_hTERT_E7 could immortalized keratinocytes and maintain the ability to differentiate, the inventors wanted to compare this lentivirus to three other potential immortalization viruses. First, was a lentivirus plasmid with the same hTERT and E7 genes that in a new lentivirus backbone with similar features, LV_GS_hTERT_E7. Second, was a lentivirus plasmid with hTERT and E6 genes that was cloned into the pLV_GS_hTERT_E6. Third, was a lentivirus with E7 and E6 genes that was cloned in to the LV-hTERT-IRES-hygro plasmid, pLV_E7_E6. The expectation was that the LV_hTERT_E7 and LV_GS_hTERT_E7 with the same genes and a different lentivirus backbone would perform equally well, and that both of these lentiviruses would perform better than the LV_GS_hTERT_E6 and LV_E7_E6. This was based on the previous research comparing the immortalization of keratinocytes with these genes in separate lentiviruses and based on extended viability (Kiyono et al., 1998; Miller et al., 2013). The four different lentivirus plasmids were constructed and made into lentivirus. Two cell lines (XPA and T20) were transduced with all four lentiviruses at passage 2 and placed in hygromycin selection. All four of the lentiviruses extended the life of both cell lines, but surprisingly both XPA and T20 cell lines transduced with LV_hTERT_E7 and LV_GS_hTERT_E7 underwent cellular senescence after 3 months of growth. However, the XPA and T20 cell lines transduced with the LV_GS_hTERT_E6 and LV_E7_E6 continued to grow for over 6 months and over 100 population doublings. While the LV_hTERT_E7 can immortalize keratinocytes as demonstrated previously, they were less effective at immortalizing both the XPA and T20 keratinocytes than the LV_GS_hTERT_E6 and pLV_E7_E6.
[0099] XPA and T20 cells transduced with LV_GS_hTERT_E6 and LV_E7_E6 were further characterized. The expression of E6 and E7 was evaluated in the cell lines to confirm stable expression the transgenes (
[0100] These data demonstrated that the all 4 of the lentivirus designed and engineered can reproducibly extend the proliferative capacity and establish immortalized keratinocyte cell lines. In addition, the resulting immortalized keratinocytes maintain the ability to differentiate into HEE. This creates new opportunities in studying skin disease mechanisms. In addition, these lentiviruses and these cell lines could provide consistent HEE products for toxicity testing or the option to create and obtain cells of varied sources from any designated sex, age, race or disease as needed. This would help eliminate animal toxicity testing and the limitations of obtaining human keratinocytes from surgical waste for HEE toxicity testing.
TABLE-US-00001 TABLE 1 gBlock and primer sequences E7_Gblock_EcoRI_NotI: gBlock for cloning E7 into pLV_hTERT_IRES_hygro: E7 TAAGCAGAATTCATGCATGGAGATACACCTACATTGCATGAATATATGTTAGATTTGCAACCAGAGACAACTGATCTCTACTGTTAT GAGCAATTAAATGACAGCTCAGAGGAGGAGGATGAAATAGATGGTCCAGCTGGACAAGCAGAACCGGACAGAGCCCATTACAATATT GTAACCTTTTGTTGCAAGTGTGACTCTACGCTTCGGTTGTGCGTACAAAGCACACACGTAGACATTCGTACTTTGGAAGACCTGTTA ATGGGCACACTAGGAATTGTGTGCCCCATCTGTTCTCAGAAACCATAAGCGGCCGCTAAGCA (SEQ ID NO: 5) partialhTERT_T2A_E6: gBlock for cloning E6 gene into pLV_GS_hTERT_E7 (SEQ ID NO: 6): hTERT T2A E6 IRES BamHI in hTERT KpnI site in IRES GTCCTACGTCCAGTGCCAGG CGCAGGGCTCCATCCTCTCCACGCTGCTCTGCAGCCTGTGCTACGGCGACATGGAGAACAA GCTGTTTGCGGGGATTCGGCGGGACGGGCTGCTCCTGCGTTTGGTGGATGATTTCTTGTTGGTGACACCTCACCTCACCCACGCGAA AACCTTCCTCAGGACCCTGGTCCGAGGTGTCCCTGAGTATGGCTGCGTGGTGAACTTGCGGAAGACAGTGGTGAACTTCCCTGTAGA AGACGAGGCCCTGGGTGGCACGGCTTTTGTTCAGATGCCGGCCCACGGCCTATTCCCCTGGTGCGGCCTGCTGCTGGATACCCGGAC CCTGGAGGTGCAGAGCGACTACTCCAGCTATGCCCGGACCTCCATCAGAGCCAGTCTCACCTTCAACCGCGGCTTCAAGGCTGGGAG GAACATGCGTCGCAAACTCTTTGGGGTCTTGCGGCTGAAGTGTCACAGCCTGTTTCTGGATTTGCAGGTGAACAGCCTCCAGACGGT GTGCACCAACATCTACAAGATCCTCCTGCTGCAGGCGTACAGGTTTCACGCATGTGTGCTGCAGCTCCCATTTCATCAGCAAGTTTG GAAGAACCCCACATTTTTCCTGCGCGTCATCTCTGACACGGCCTCCCTCTGCTACTCCATCCTGAAAGCCAAGAACGCAGGGATGTC GCTGGGGGCCAAGGGCGCCGCCGGCCCTCTGCCCTCCGAGGCCGTGCAGTGGCTGTGCCACCAAGCATTCCTGCTCAAGCTGACTCG ACACCGTGTCACCTACGTGCCACTCCTGGGGTCACTCAGGACAGCCCAGACGCAGCTGAGTCGGAAGCTCCCGGGGACGACGCTGAC TGCCCTGGAGGCCGCAGCCAACCCGGCACTGCCCTCAGACTTCAAGACCATCCTGGACGGCTCCGGCGAGGGCAGGGGAAGTCTACT AACATGCGGGGACGTGGAGGAAAATCCCGGCCCACACCAAAAGAGAACTGCAATGTTTCAGGACCCACAGGAGCGACCCAGAAAGTT ACCACAGTTATGCACAGAGCTGCAAACAACTATACATGATATAATATTAGAATGTGTGTACTGCAAGCAACAGTTACTGCGACGTGA GGTATATGACTTTGCTTTTCGGGATTTATGCATAGTATATAGAGATGGGAATCCATATGCTGTATGTGATAAATGTTTAAAGTTTTA TTCTAAAATTAGTGAGTATAGACATTATTGTTATAGTTTGTATGGAACAACATTAGAACAGCAATACAACAAACCGTTGTGTGATTT GTTAATTAGGTGTATTAACTGTCAAAAGCCACTGTGTCCTGAAGAAAAGCAAAGACATCTGGACAAAAAGCAAAGATTCCATAATAT AAGGGGTCGGTGGACCGGTCGATGTATGTCTTGTTGCAGATCATCAAGAACACGTAGAGAAACCCAGCTGTAAGGCCGCAAATTCCG CCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCAC CATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGC CAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCT TTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACA ACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGC CCAGAA
CCATTGTATGGGATCTGATCTG E7 E6 insert: gBlock for cloning E7_E6 into pLV_hTERT_IRES_hygro (SEQ ID NO: 7): E7 T2A E6 GGATCC BamHI GCGGCCGC NotI TTCAGGTGTCGTGAGGATCCATGCATGGAGATACACCTACATTGCATGAATATATGTTAGATTTGCAACCAGAGACAACTGATCTCT ACTGTTATGAGCAATTAAATGACAGCTCAGAGGAGGAGGATGAAATAGATGGTCCAGCTGGACAAGCAGAACCGGACAGAGCCCATT ACAATATTGTAACCTTTTGTTGCAAGTGTGACTCTACGCTTCGGTTGTGCGTACAAAGCACACACGTAGACATTCGTACTTTGGAAG ACCTGTTAATGGGCACACTAGGAATTGTGTGCCCCATCTGTTCTCAGAAACCAGGCTCCGGCGAGGGCAGGGGAAGTCTACTAACAT GCGGGGACGTGGAGGAAAATCCCGGCCCACACCAAAAGAGAACTGCAATGTTTCAGGACCCACAGGAGCGACCCAGAAAGTTACCAC AGTTATGCACAGAGCTGCAAACAACTATACATGATATAATATTAGAATGTGTGTACTGCAAGCAACAGTTACTGCGACGTGAGGTAT ATGACTTTGCTTTTCGGGATTTATGCATAGTATATAGAGATGGGAATCCATATGCTGTATGTGATAAATGTTTAAAGTTTTATTCTA AAATTAGTGAGTATAGACATTATTGTTATAGTTTGTATGGAACAACATTAGAACAGCAATACAACAAACCGTTGTGTGATTTGTTAA TTAGGTGTATTAACTGTCAAAAGCCACTGTGTCCTGAAGAAAAGCAAAGACATCTGGACAAAAAGCAAAGATTCCATAATATAAGGG GTCGGTGGACCGGTCGATGTATGTCTTGTTGCAGATCATCAAGAACACGTAGAGAAACCCAGCTGTAAGCGGCCGCTCTAGAGTCGA C hTERT_F1 TCTGCTACTCCATCCTGAA (SEQ ID NO: 8) hTERT_R1 AGAGGGAAACCGTTGCTA (SEQ ID NO: 9) Q5_hTERT_T2A_E7_F cggagatgtagaagaaaatccagggcctATGCATGGAGATACACCTA (SEQ ID NO: 10) Q5_hTERT_T2A_E7_R catgtaaggagggaacccctgccctccctGTCCAGGATGGTCTTGAAG (SEQ ID NO: 11) hTERT_F2 CAAGAACGCAGGGATGTC (SEQ ID NO: 12) hTERT_R2 GACGGCAATATGGTGGAA (SEQ ID NO: 13) HPV_E7_93_F2 CTCAGAGGAGGAGGATGAA (SEQ ID NO: 14) HPV_E7_256_R2 TGCCCATTAACAGGTCTTC (SEQ ID NO: 15) HPV_E6_F1 TGCGACGTGAGGTATATG (SEQ ID NO: 16) HPV_E6_R1 GCTGTTCTAATGTTGTTCCA (SEQ ID NO: 17) qPCR_E6_Forward CAGGAGCGACCCAGAAAG (SEQ ID NO: 18) qPCR_E6_Probe ACCACAGTTATGCACAGAGCTGCA (SEQ ID NO: 19) qPCR_E6_Reverse CATATACCTCACGTCGCAGTAA (SEQ ID NO: 20) qPCR_E7_Forward AATGACAGCTCAGAGGAGGA (SEQ ID NO: 21) qPCR_E7_Probe AGAACCGGACAGAGCCCATTACAA (SEQ ID NO: 22) qPCR_E7_Reverse CGTAGAGTCACACTTGCAACA (SEQ ID NO: 23)
DISCUSSION
[0101] It is to be understood that the above description is intended to be illustrative, and not restrictive. The present disclosure has described one or more preferred embodiments, and it should be appreciated that many equivalents, alternatives, variations, and modifications, aside from those expressly stated, are possible and within the scope of the invention. Other embodiments will be apparent to those of skill in the art upon reading and understanding the above description. It should be noted that embodiments discussed in different portions of the description or referred to in different drawings can be combined to form additional embodiments of the present application. The scope should, therefore, be determined with reference to the appended claims, along with the full scope of equivalents to which such claims are entitled.
REFERENCES
[0102] DICKSON, M. A. et al. Human keratinocytes that express hTERT and also bypass a p16(INK4a)-enforced mechanism that limits life span become immortal yet retain normal growth and differentiation characteristics. Mol Cell Biol, v. 20, n. 4, p. 1436-47, February 2000. ISSN 0270-7306. Available at: <www.ncbi.nlm.nih.gov/pubmed/10648628>. [0103] HALBERT, C.; DEMERS, G.; GALLOWAY, D. The E7 gene of human papillomavirus type 16 is sufficient for immortalization of human epithelial cells. Journal of virology, v. 65, n. 1, 1991 January 1991. ISSN 0022-538X. Available at: <www.ncbi.nlm.nih.gov/pubmed/1845902>. [0104] HOPPE-SEYLER, K. et al. The HPV E6/E7 Oncogenes: Key Factors for Viral Carcinogenesis and Therapeutic Targets. Trends Microbiol, v. 26, n. 2, p. 158-168, 02 2018. ISSN 1878-4380. Available at: <www.ncbi.nlm.nih.gov/pubmed/28823569>. [0105] KIYONO, T. et al. Both Rb/p16INK4a inactivation and telomerase activity are required to immortalize human epithelial cells. Nature, v. 396, n. 6706, Nov. 5, 1998 1998. ISSN 0028-0836. Available at: <www.ncbi.nlm.nih.gov/pubmed/9817205>. [0106] LIU, X. et al. Myc and human papillomavirus type 16 E7 genes cooperate to immortalize human keratinocytes. Journal of virology, v. 81, n. 22, 27 Nov. 2007. ISSN 0022-538X. Available at: <www.ncbi.nlm.nih.gov/pubmed/17804506>. [0107] MILLER, J. et al. HPV16 E7 protein and hTERT proteins defective for telomere maintenance cooperate to immortalize human keratinocytes. PLoS pathogens, v. 9, n. 4, 2013 2013. ISSN 1553-7374. Available at: <www.ncbi.nlm.nih.gov/pubmed/23592995>. [0108] MÜNGER, K. et al. The E6 and E7 genes of the human papillomavirus type 16 together are necessary and sufficient for transformation of primary human keratinocytes. Journal of virology, v. 63, n. 10, 1989 October 1989. ISSN 0022-538X. Available at: <www.ncbi.nlm.nih.gov/pubmed/2476573>. [0109] SMITS, J. et al. Immortalized N/TERT keratinocytes as an alternative cell source in 3D human epidermal models. Scientific reports, v. 7, n. 1, Sep. 19, 2017 2017. ISSN 2045-2322. Available at: <www.ncbi.nlm.nih.gov/pubmed/28928444>.