IMPROVED ADENO-ASSOCIATED VIRUS GENE THERAPY VECTORS

Abstract

“MAAP” is a naturally-occurring, newly-discovered about 13 KDa adeno-associated vims protein. It is not homologous to known proteins. When AAV producer cells are cultured for more than 24 hours, we found that inactivating translation of the full-length MAAP improves the productivity of the transfected producer cells. The resulting AAV viruses are also of better quality and more stable. Our findings thus provide a way to improve the industrial manufacture of recombinant adeno-associated virus gene therapy vectors.

Claims

1.-82. (canceled)

83. An adeno-associated virus genome that has a mutation that reduces expression of full-length wild-type membrane associated accessory protein (MAAP) yet maintains expression of VP1, wherein said mutation introduces at least one stop codon to stop translation of full-length wild-type MAAP.

84. The adeno-associated virus genome of claim 83, wherein the genome further has a mutation that inactivates the MAAP mRNA translation-initiation codon.

85. The adeno-associated virus genome of claim 83, wherein the mutation that reduces expression of full-length wild-type membrane associated accessory protein (MAAP) introduces at least one stop codon to stop translation of MAAP polypeptide at a polypeptide residue aligning with MAAP polypeptide consensus sequence SEQ ID NO. 11 from residue numbers 9 to 110, preferably from residues numbers 39 to 103.

86. The adeno-associated virus genome of claim 83, wherein the mutation that reduces expression of full-length wild-type membrane associated accessory protein (MAAP) introduces at least one stop codon to stop translation of MAAP polypeptide at a polypeptide residue aligning with MAAP polypeptide consensus sequence SEQ ID NO. 11 a) residue number 9, 33, 39, 47, 65, 90, 100, 103, 105, 106 or 110; b) residue numbers 33, 39 and 47; or c) residue number 100.

87. The adeno-associated virus genome of claim 83, where the genome is a naturally-occurring serotype, preferably, where the genome is selected from a serotype 1 genome, serotype 2 genome, serotype 5 genome, serotype 6 genome, serotype 8 genome and a serotype 9 genome.

88. The adeno-associated virus genome of claim 83, wherein the VP1 peptide sequence (a) is unaltered from wild type, or (b) contains a mutation.

89. The adeno-associated virus genome of claim 83, wherein the MAAP and VP1 peptide sequences each have at least 80% homology to wild type.

90. A producer cell that produces adeno-associated virus, the producer cell comprising the adeno-associated virus genome of claim 83.

91. The producer cell of claim 90, wherein the producer cell is eukaryotic, preferably selected from: a) mammalian, preferably human cells; b) yeast cells; or c) insect cells.

92. A method for producing adeno-associated virus, the method comprising: obtaining an adeno-associated virus genome, and then introducing said genome into a cell to create the producer cell of claim 90, and then culturing said producer cell whereby said producer cell produces adeno-associated virus, preferably further comprising harvesting said adeno-associated virus, where said harvested adeno-associated virus comprises a transgene.

93. The method of claim 92, where the producer cell produces a) virus preparation wherein the ratio of the number of capsids containing the gene or genome of interest to the number of total physical capsids is at least as high as the ratio of the number of capsids containing the gene or genome of interest to the number of total physical capsids produced by a similar cell containing a wild-type adeno-associated virus genome: b) virus having a ratio of full: empty virus capsids least as high as does a similar cell infected with a wild-type adeno-associated virus genome; c) virus having a ratio of full: empty virus capsids 30% higher than does a similar cell infected with wild-type adeno-associated virus; d) virus having at least as many viral genomes/mL as does a similar cell infected with wild-type adeno-associated virus; or e) having at least four times as many viral genomes/mL as does a similar cell infected with wild-type adeno-associated virus.

94. The method of claim 92, wherein the producer cell is cultured for at least 30 hours, at least 36 hours, at least 48 hours, at least 72 hours, at least 96 hours.

95. Adeno-associated virus produced by the method of claim 92.

96. A method of increasing stability, increasing capsid integrity, or reducing capsid degradation of an adeno-associated virus (AAV), comprising including in the AAV the adeno-associated virus genome of claim 83.

97. A method of increasing the proportion of AAV capsids containing a gene or genome of interest, comprising including in the AAV the adeno-associated virus genome of claim 83 and the gene or genome of interest.

98. A method of the increasing the viral titre (viral genomes/mL) of a producer cell producing an AAV, comprising including in the AAV the adeno-associated virus genome of claim 83 and introducing the AAV in the producer cell.

99. A method for increasing the retention of viral genomes or viral particles in a producer cell producing an AAV, comprising including in the AAV the adeno-associated virus genome of claim 83 and introducing the AAV in the producer cell, preferably, further comprising harvesting and/or purifying the viral genomes or viral particles from the producer cells, preferably substantially free of media.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0175] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of any necessary fee.

[0176] FIG. 1 shows the fluorescence intensity of cells transfected with various plasmids and as control with PEI alone.

[0177] FIG. 2 follows the expression over time of the Rep78/52, VPs, AAP and MAAP proteins during WT AAV production in 293T cells.

[0178] FIG. 3 shows AAV viral titers (expressed as viral genomes per mL when measured using ddPCR) 24 hours after infection of producer cells. Column 1: wild-type (wt) AAV serotype 2. Column 2 is MAAP with the first theoretical non-canonical start codon (CTG, coding for residue L1 on the full-length serotype 2 MAAP polypeptide, SEQ ID NO. 2) mutated to CGG. Column 3 is MAAP with residue Q9 on SEQ ID NO. 2 mutated to a stop codon. Column 4 is MAAP with residue S39 on SEQ ID NO. 2 mutated to a stop codon. Column 5 is MAAP with residues S33, S39 and S47 on SEQ ID NO. 2 each mutated to a stop codon. Columns 6-12 are MAAP with each of residues S65, E90, L100, W103, W105, L106 and L110 (respectively) on SEQ ID NO.2 mutated to a stop codon.

[0179] FIG. 4 shows AAV viral titers (expressed as viral genomes per mL when measured using ddPCR) 72 hours after infection of producer cells. Columns are as with preceding FIG. 3.

[0180] FIG. 5 shows MAAP over-expression effect on AAV viral genomes per mL at 24 h, Column 1 wild type MAAP gene; Column 2: MAAP with residues S33, S39 and S47 on the full-length MAAP polypeptide each mutated to a stop codon. Column 3: As column 1, but cells treated also with MAAP overexpressing plasmid; Column 4: As column 2, but cells treated also with MAAP overexpressing plasmid; Column 5: wt-AAV2 and GFP overexpressing plasmid treated cells; Column 6: as column 2, but with GFP plasmid.

[0181] FIG. 6 shows MAAP over-expression effect on AAV viral genomes per mL at 72 h post-transfection, Column 1 wild type MAAP gene; Column 2: MAAP with residues S33, S39 and S47 on the full-length MAAP polypeptide each mutated to a stop codon. Column 3: As column 1, but cells treated also with MAAP overexpressing plasmid; Column 4: As column 2, but cells treated also with MAAP overexpressing plasmid; Column 5: wt-AAV2 and GFP overexpressing plasmid treated cells; Column 6: as column 2, but with GFP plasmid.

[0182] FIG. 7 measures the amount of contaminant kanamycin-resistance gene (kan) DNA (from the plasmids used to make virus) relative to AAV viral genome packaged in viral capsids when measured 24 hours after infection of producer cells. Columns are as with preceding FIG. 3.

[0183] FIG. 8 measures the amount of contaminant kan DNA relative to AAV viral genome packaged in viral capsids when measured 72 hours after infection of producer cells. Columns are as with preceding FIG. 3.

[0184] FIG. 9 measures the amount of packaged contaminant kan DNA after or in the presence of MAAP over-expression relative to AAV viral genome packaged in viral capsids when measured 24 hours after infection of producer cells. Columns are as with preceding FIG. 5.

[0185] FIG. 10 measures the amount of packaged contaminant kan DNA after or in the presence of MAAP over-expression relative to AAV viral genome packaged in viral capsids when measured 72 hours after infection of producer cells. Columns are as with preceding FIG. 6.

[0186] FIG. 11 measures the amount of contaminant adenovirus serotype 5 E4 gene DNA (from the helper adenovirus plasmid that was used to make adeno-associated virus) relative to AAV viral genome packaged in AAV viral capsids when measured 24 hours after infection of producer cells. Columns are as with preceding FIG. 3.

[0187] FIG. 12 measures the amount of contaminant adenovirus serotype 5 E4 gene DNA (from the helper adenovirus that was used to make adeno-associated virus) relative to AAV viral genome packaged in AAV viral capsids when measured 72 hours after infection of producer cells. Columns are as with preceding FIG. 3.

[0188] FIG. 13 is a photograph of a Western blot measuring polypeptide expression at 24h in cells transfected with plasmid coding for wt-AAV (v1 and v7 denote different versions of an adenovirus-genome helper plasmid; v7 is smaller than v1), and for MAAP with stop codons newly-introduced at amino acid residue Nos. E90, L100, W103, W105, L106 or L110 (as shown on the full-length MAAP sequence of SEQ ID NO. 2), and a negative control. Top panel: Expression of alpha-tubulin. Middle panel: Expression of MAAP. Bottom panel: expression of full-length VP-1, -2 and -3 (upper bands) and their degradation products (lower bands).

[0189] FIG. 14 is a photograph of a Western blot measuring expression of VP-1, -2 and -3 (top panel), MAAP (middle panel) and alpha-tubulin (bottom panel). Column 1: molecular weight marker. Column 2: wild-type (wt) AAV2. Column 3 is MAAP with the first theoretical non-canonical start codon (CTG, coding for residue L1 on the full-length MAAP polypeptide, SEQ ID NO. 2) mutated to CGG. Column 4 is MAAP with residue Q9 on the full-length MAAP polypeptide mutated to a stop codon. Column 5 is MAAP with residue S39 on the full-length MAAP polypeptide mutated to a stop codon. Column 6 is MAAP with residues S33, S39 and S47 on the full-length MAAP polypeptide each mutated to a stop codon. Column 7 is negative control.

[0190] FIG. 15 compares the percentage of capsids that are empty (lacking the desired DNA payload) or full (having the desired DNA payload). Columns are as with FIG. 3 above.

[0191] FIG. 16 shows the impact of MAAP variants on rAAV vg titers. rAAV of serotypes 1, 2, 5, 6, 8 and 9 encoding mSeAP were produced using 2-plasmid system from Plasmid Factory or 3-plasmid systems. The viral genome titers were quantified. Within the 3-plasmid systems, cap genes encoding same capsid serotype but either wt-MAAP, MAAP-triple stop, and MAAP-S/L-100 were used for rAAV production. (A) rAAV yields expressed as vg.Math.mL.sup.−1 alongside mean and SD. Statistical significance between rAAVs produced with wt-MAAP and mutated MAAP were calculated using two-tailed, unpaired Student's T-tests.

[0192] FIG. 17 shows the effect of MAAP variants on rAAV genome packaging. rAAV of serotypes 2, 5, 6 and 8 encoding mSeAP were produced using a 2-plasmid system containing a cap gene coding for wt-MAAP, and 3-plasmid systems with the cap gene encoding wt-MAAP or MAAP variants. rAAV vg titers were quantified. In parallel, we quantified the total number of AAV capsids from the same samples by ELISA. We present the ratio of capsid containing rAAV genome versus total capsids, expressed as percentage. Percentages of rAAV capsids encoding the mSeAP transgene are shown accompanied by mean and SD. Statistical significance between rAAV produced with cap gene encoding wt-MAAP or mutated MAAP was calculated using two-tailed, unpaired Student's T-tests.

[0193] FIG. 18 shows MAAP variants modify the secretion profiles of rAAV. rAAV of serotypes 1, 2, 5, 6, 8 and 9 encoding mSeAP were produced using 2-plasmid system from Plasmid Factory or 3-plasmid systems and viral genome titers were quantified from the cell culture or from cell culture media. Within the 3-plasmid systems, cap genes encoding wt-MAAP; MAAP-triple stop, MAAP-S/L-100 were used for rAAV production. The mean percentages of vg titers in cell media in respect to vg titers in cell lysate are displayed as ‘secreted viral particles’ with SD. Statistical significance between rAAV of same capsid serotype but produced with wt-MAAP or MAAP variants was calculated using two-tailed, unpaired Student's T-tests.

[0194] FIG. 19 shows the MAAP phylogenetic tree. Phylogenetic tree of the MAAP protein sequence of primate AAVs. Nodes with bootstrap values above 75 are indicated with 4 different size of circles. The nomenclature is either the serotype name or a reference to the species in which the AAV was identified (hu, human; rh, rhesus macaque; pi, pigtailed macaque) followed by a serotype number.

[0195] FIG. 20 shows the sequences of SEQ ID NO's 1 to 29.

[0196] FIG. 21 A-J provides the nucleic acid sequences of cap genes encoding inter alia MAAP for AAV serotypes 1-10, respectively.

EXAMPLES

Example 1

[0197] Materials & Methods

[0198] Full-Length and Truncated MAAP

[0199] Doing an analysis of AAV, we identified a possible novel viral protein and several non-canonical start codons for its translation. We then discovered that one of these three non-canonical start codons in fact operates in wild-type AAV to initiate translation of a novel wild-type protein. SEQ ID NO's 1-10 provide the primary amino acid sequence for the wild type protein for AAV serotypes 1-10 respectively. The amino acid sequence for each of these serotypes is highly conserved at the C-terminal end. At the N-terminal end, AAV serotype 4 (SEQ ID NO. 4) and serotype 5 (SEQ ID NO. 5) wild-type proteins have a leading 15-25 amino acid residue sequence not seen in the other serotypes. SEQ ID NO. 11 provides the primary amino acid sequence for the theoretical consensus of all ten of these serotypes. We refer to these proteins collectively, and each one individually, as “MAAP”..sup.1 .sup.1 The same newly-discovered protein has recently and independently been described by Ogden P. J. et al., Comprehensive AAV Capsid Fitness Landscape Reveals A Viral Gene And Enables Machine-Guided Design, 366 Science 1139 (2019). Ogden et al. refers to this newly-discovered protein as “membrane-associated accessory protein” or “MAAP.”

[0200] The wild-type DNA sequence includes two further non-canonical start codons. One of these is AGG, (coding for amino acid residue 13 on the full-length polypeptide sequence of SEQ ID NO. 2). The other is ACG (coding for amino acid residue 14 on the full-length polypeptide sequence of SEQ ID NO. 2.

[0201] Virus Preparations

[0202] AAV Virus production was carried out as follows. 293T cells (European Collection of Cell Cultures 293T Number: 12022001) were grown in Dulbecco's modified Eagle medium (DMEM, Gibco 11965084) supplemented with 10% fetal bovine serum (FBS, Thermo Fisher 10091-148), supplemented with 2 mM 1-glutamine (Gibco, 25030-024), and penicillin-streptomycin (Gibco 15070-063).

[0203] Polyethyleneimine (PEI) transfections of AAV plasmid and adenovirus helper plasmid were performed on 293T cells in T25 flasks (60,000 cells/cm.sup.2). The PEI Pro™ (Polyplus Transfection, ref #115-100)/DNA weight ratio was maintained at 1:1 in serum-free DMEM medium. For AAV2, we used AAV2 plasmid and adenovirus helper plasmid in a 1:1 ratio at a total of 350 ng/cm.sup.2. Other AAV serotypes may be similarly used with the appropriate ratio of AAV plasmid to helper plasmid.

[0204] To analyze the relative usage of the non-canonical start codons, we point-mutated the first non-canonical start codon from CTG to CGG, inactivating the codon as a potential start codon.

[0205] To evaluate the function of this novel protein, we created artificially-truncated mutant forms of it. Designing these mutations was non-trivial because the same DNA sequence is used to express VP1, a viral protein that is critical for virus entry into a host cell and intracellular delivery of the viral genome to the infected cell nucleus. Thus, we needed to make point mutations that create codons that stop MAAP translation, yet do not perturb transcription of, nor the amino acid sequence of, VP1. We identified eleven suitable mutation sites. These new stop codons theoretically truncate MAAP (here, serotype 2, SEQ ID. NO. 2) translation at amino acid residue Nos. Q9, S33, S39, S47, S65, E90, L100, W103, W105, L106 and L110. The Table below provides a more complete list the different plasmids used in the study, the point-mutations we performed on the MAAP gene, and their impacts on the resulting MAAP and VP1 amino acid sequences.

TABLE-US-00001 TABLE 1 Plasmids used Plasmids Used MAAP MAAP VP1 # Name wt mutated VP1 wt mutated Use p0059 p0059- Stuffer plasmid pDEST- eGFP p0088 p0088- — — — — Helper plasmid pHelper- used for WT AAV2 Ad5-Lio and rAAV2 production. Encodes VAI, VAII, E2, E4 regions of Adenovirus 5. p0108 p0108- WT — WT — Reference for WT pGRG25- sequence sequence AAV2 production AAV2WT (Savy et al., 2018) p0188 p0188- Gln 9 stop 9 Ala 35 Val 35 Study of MAAP AAV2WT- (CAG) (TAG) (GCA) (GTA) start codon MAAP Q16 -> stop p0189 p0189- Ser 33 Stop 33 Leu 59 Leu 59 Study of MAAP AAV2WT- (TCG)- (TAG)- (CTC)- (CTA)- inactivation MAAP Ser 39 Stop 39 Val 65 Val 65 S40-S46- (TCA)- (TGA)- (GTC)- (GTA)- S54 -> Ser 47 Stop 47 Leu 72 Leu 72 stops (TCG) (TAG) (CTC) (CTA) p0190 p0190- Ser 33 Stop 33 Leu 59 Leu 59 Study of MAAP AAV2WT- (TCG) (TAG) (CTC) (CTA) inactivation MAAP S40 -> stop p0191 p0191- Ser 39 Stop 39 Val 65 Val 65 Study of MAAP AAV2WT- (TCA) (TGA) (GTC) (GTA) inactivation MAAP S46 -> stop p0192 p0192- Ser 47 Stop 47 Leu 72 Leu 72 Study of MAAP AAV2WT- (TCG) (TAG) (CTC) (CTA) inactivation MAAP S54 -> stop p0193 p0193- Ser 65 Stop 65 Leu 91 Leu 91 Study of MAAP AAV2WT- (TCA) (TGA) (CTC) (CTC) inactivation MAAP S72 -> stop p0194 p0194- Glu 90 Stop 90 Arg 116 Leu 116 Study of MAAP AAV2WT- (GAG) (TAG) (CGA) (CTA) † nuclear MAAP localization signal E97 -> stop p0195 p0195- Leu 100 Stop 100 Leu 126 Leu 126 Study of MAAP AAV2WT- (TTG) (TAG) (CTT) (CTA) nuclear MAAP localization signal L107 -> stop p0196 p0196- Trp 103 Stop 103 Leu 129 Leu 129 Study of MAAP AAV2WT- (TGG) (TAG) (CTG) (CTA) nuclear MAAP localization signal W110 -> stop p0197 p0197- Trp 105 Stop 105 Leu 131 Leu 131 Study of MAAP AAV2WT- (TGG) (TAG) (CTG) (CTA) nuclear MAAP localization signal W112 -> stop p0198 p0198- Leu 106 Stop 106 Val 132 Val 132 Study of MAAP AAV2WT- (TTG) (TAG) (GTT) (GTA) nuclear MAAP localization signal L113 -> stop p0199 p0199- Leu 110 Stop 110 Val 136 Val 136 Study of MAAP AAV2WT- (TTA) (TGA) (GTT) (GTG) nuclear MAAP localization signal L117 -> stop p0200 p0200- WT WT insertion Study of MAAP AAV2WT- sequence sequence of GFP start codon- MAAP- fused to MAAP-GFP fusion GFP MAAP in WT-AAV takes plasmid context place after VP1- P145 p0201 p0201- Gln 9 Stop 9 Ala 35 Val 35 Study of MAAP AAV2WT- (CAG) (TAG) (GCA) (GTA) start codon- MAAP- MAAP-GFP fusion GFP Q16 in WT-AAV -> stop plasmid context p0202 p0202- Ser 33 Stop 33 Leu 59 Leu 59 Study of MAAP AAV2WT- (TCG) (TAG) (CTC) (CTA) inactivation- MAAP- MAAP-GFP GFP S40 fusion -> stop p0203 p0203- Ser 39 Stop 39 Val 65 Val 65 Study of MAAP AAV2WT- (TCA) (TGA) (GTC) (GTA) inactivation- MAAP- MAAP-GFP GFP S46 fusion -> stop p0204 p0204- Ser 47 Stop 47 Leu 72 Leu 72 Study of MAAP AAV2WT- (TCG) (TAG) (CTC) (CTA) inactivation- MAAP- MAAP-GFP GFP S54 fusion -> stop p0205 p0205- Ser 33 Stop 33 Leu 59 Leu 59 Study of MAAP AAV2WT- (TCG)- (TAG)- (CTC)- (CTA)-Val inactivation- MAAP- Ser 39 Stop 39 Val 65 65 (GTA)- MAAP-GFP GFP S40- (TCA)- (TGA)- (GTC)- Leu 72 fusion 46-54 -> Ser 47 Stop 47 Leu 72 (CTA) stops (TCG) (TAG) (CTC) p0206 p0206- Leu 1 Arg 1 Pro 27 Pro 27 Study of MAAP AAV2WT- (CTG) (CGG) (CCT) (CCG) start codon- MAAP- MAAP-GFP fusion GFP in WT-AAV start1 plasmid context Leu8 -> Arg p0223 p0223- Leu 1 Arg 1 Pro 27 Pro 27 Study of MAAP AAV2WT- (CTG) (CGG) (CCT) (CCG) start codon MAAP- start 1 Leu8 -> Arg p0226 p0226- WT — WT — Study of MAAP AAV2WT- sequence sequence interaction with AAP- AAP S13-W46 -> stops p0230 p0230- WT — WT — Reference for WT pUC-K- sequence sequence AAV2 production AAV2WT- Reverse p0273 p0273- Helper plasmid Ad5-Lio- used for WT AAV2 v7 and rAAV2 production. Encodes VAI, VAII, E2, E4 regions of Adenovirus 5. p0280 p0280- Expression of MAAP MAAP driven by ATG codon, under CMV enhancer- CMV promoter- SV40 intron promoter sequence p0283 p0283- Expression of MAAP- MAAP-GFP driven GFP by ATG codon, under CMV enhancer-CMV promoter-SV40 intron promoter sequence p0326 p0326- Expression of MAAP MAAP initiated at start 2 Start 2 (R13) modified to ATG codon, under CMV enhancer-CMV promoter-SV40 intron promoter sequence p0331 p0331- AAP # = Plasmid code number. wt = wild-type. † = This mutation modifies the VP1 amino acid sequence at the same time as it introduces a stop codon in MAAP.

TABLE-US-00002 TABLE 2 Plasmids used for AAV production Plasmids Used for AAV Production MAAP # Name MAAP wt mutated n t 3 24 h; 72 h p0223-AAV2WT-MAAP- start1 Leu8 −> Arg p0188 p0188-AAV2WT-MAAP Q16 −> stop Gln 9 stop 9 3 24 h; 72 h (CAG) (TAG) p0189 p0189-AAV2WT-MAAP S40-S46-S54 −> stops Ser 33 Stop 33 3 24 h; 72 h (TCG) - (TAG) - Ser 39 Stop 39 (TCA) - (TGA) - Ser 47 Stop 47 (TCG) (TAG) p0190 p0190-AAV2WT-MAAP S40 −> stop Ser 33 Stop 33 — — (TCG) (TAG) p0191 p0191-AAV2WT-MAAP S46 −> stop Ser 39 Stop 39 3 24 h; 72 h (TCA) (TGA) p0192 p0192-AAV2WT-MAAP S54 −> stop Ser 47 Stop 47 — — (TCG) (TAG) no sample; p0193-AAV2WT-MAAP S72 −> stop 3 72 h no WB p0194 p0194 - AAV2WT-MAAP E97 −> stop Glu 90 Stop 90 3 24 h; 72h (GAG) (TAG) p0195 p0195 - AAV2WT-MAAP L107 −> stop Leu 100 Stop 100 3 24 h; 72 h (TTG) (TAG) p0196 p0196 - AAV2WT-MAAP W110 −> stop Trp 103 Stop 103 2 24 h (TGG) (TAG) p0197 p0197 - AAV2WT-MAAP W112 −> stop Trp 105 Stop 105 2 24 h (TGG) (TAG) p0198 p0198 - AAV2WT-MAAP L113 −> stop Leu 106 Stop 106 3 24 h; 72 h (TTG) (TAG) p0199 p0199 - AAV2WT-MAAP L117 −> stop Leu 110 Stop 110 3 24 h; 72 h (TTA) (TGA) WB 24 h samples p0230-pUC-K-AAV2WT-Reverse p0189-AAV2WT-MAAP S40-S46-S54 −> stops p0194 - AAV2WT-MAAP E97 −> stop p0195 - AAV2WT-MAAP L107 −> stop p0196 - AAV2WT-MAAP W110 −> stop p0197 - AAV2WT-MAAP W112 −> stop p0198 - AAV2WT-MAAP L113 −> stop p0199 - AAV2WT-MAAP L117 −> stop neg p0230-pUC-K-AAV2WT-Reverse 3 24 h; 72 h p0223-AAV2WT-MAAP- start1 Leu8 −> Arg p0188-AAV2WT-MAAP Q16 −> stop p0191-AAV2WT-MAAP S46 −> stop p0189-AAV2WT-MAAP S40-S46-S54 −> stops # = Plasmid code number. n = number of experimental runs. t = time (hours) after producer cell infection for virus harvest

[0206] For fluorescence-activated cell sorting, we used the following plasmids:

TABLE-US-00003 TABLE 3 Plasmids Used in Fluorescence-Activated Cell Sorting Plasmids Used in Fluorescence-Activated Cell Sorting # name MAAP wt MAAP mutated p0200 p0200-AAV2WT-MAAP-GFP WT sequence WT sequence p0201 p0201-AAV2WT-MAAP-GFP Q16 −> stop Gln 9 (CAG) Stop 9 (TAG) p0202 p0202-AAV2WT-MAAP-GFP S40 −> stop Ser 33 (TCG) Stop 33 (TAG) p0203 p0203-AAV2WT-MAAP-GFP S46 −> stop Ser 39 (TCA) Stop 39 (TGA) p0204 p0204-AAV2WT-MAAP-GFP S54 −> stop Ser 47 (TCG) Stop 47 (TAG) p0205 p0205-AAV2WT-MAAP-GFP S40-46-54 −> stops Ser 33 (TCG) - Ser 39 Stop 33 (TAG) - Stop (TCA) -Ser 47 (TCG) 39 (TGA) - Stop 47 (TAG) p0206 p0206-AAV2WT-MAAP-GFP Leu 1 (CTG) Arg 1 (CGG) start1 Leu8 −> Arg # = Plasmid number MAAP original = MAAP original codon and amino acid MAAP final = MAAP final mutation

[0207] Virus was harvested 24 h and 72 h after transfection.

[0208] For viral genome titer determination and AAV capsid ELISA samples, virus was harvested using Triton-X-100 buffer (0.5% Triton-X-100 (Sigma-Aldrich, refmX100-1L) and 2 mM MgCl2 (Merck, ref #E13980)) in 1×phosphate-buffered saline (PBS, Gibco, ref #18912-014) and Denarase (50 U/ml, c-Lecta, ref #20804-5M). Lysis buffer was added to the media and cells were incubated for 2 h at 37° C. before cell lysate was collected.

[0209] For samples processed for Western blot, virus was harvested as follows. Cells were detached using Tryple Select™ (Gibco, ref #12563-011) and suspended in 1×PBS (Gibco, rem #14190-094). Cells were pelleted by centrifugation (500 g, 5 min). Cell pellet was washed with 1×PBS and centrifugation was repeated. Cells were re-suspended in radio-immunoprecipitation assay (RIPA, Thermo Scientific, refm89901) buffer containing Proteinase Inhibitor Cocktail (cOmplete™, Roche, ref #1169749800). Samples were incubated on ice for 20 min and centrifuged at 20,000 g for 15 min. Supernatant was collected.

TABLE-US-00004 TABLE 4 Primers And Probes Used In The Study ID Sequence Rep2-PRB /56-FAM/CCCGTGTCA/ZEN/GAATCTCAACCCGTT/ 3IABKFQ/ Rep2-FWD CTTCACTCACGGACAGAAAGA Rep2-REV CTGGCACCTTTCCCATGATA Ad5-E4-PRB /56-FAM/ACCCAGCCA/ZEN/ACCTACACATTCGTT/3IABKFQ/ Ad5-E4-FWD CATCCACCACCGCAGAATAA Ad5-E4-REV ACATGGTTCTTCCAGCTCTTC Kan-PRB /56-FAM/TCGCACCTG/ZEN/ATTGCCCGACATTAT/3IABKFQ/ Kan-FWD ATCGGGCTTCCCATACAATC Kan-REV GCTCTAGGCCGCGATTAAA Notes: 56-FAM, ZEN and 3IABKFQ are imaging agents.

[0210] Quantification of AAV and Contaminating Sequences by Droplet Digital PCR

[0211] To obtain droplet digital PCR (ddPCR) AAV viral genome (vg) titers, crude preparations of virus were first treated with DNaseI (0.01 U/μl, Invitrogen, ref #18047-019) and then Proteinase K (0.1 μg/μl, Roche, ref #03115879001), and viral titers were obtained by ddPCR amplification (QX200, Bio-Rad) with appropriate primers. For example, for AAV2, we used primers for Rep2-FWD and Rep2-REV, and probe Rep2-PRB to detect the AAV replicase region.

[0212] To assess levels of unwanted, contaminating DNA originating from the AAV plasmid backbone and Adenovirus helper plasmid backbone and packaged into AAV capsid, ddPCR was performed using appropriate primers. For example, to detect contamination by the kanamycin-resistance gene present on the plasmid backbone, we used primers for Kan-FWD and Kan-REV, and probe Kan-PRB for the kanamycin resistance gene. The adenovirus E4 (Ad5-E4) region set of primers (Ad5-E4-FWD; Ad5-E4-REV) and probe (Ad5-E4-PRB) was used to quantify the Adenovirus helper plasmid. All primers and probes were ordered from Integrated DNA Technologies.

[0213] For mastermix generation, primers (900 nM) and probe (250 nM) were diluted in 2×ddPCR supermix for Probes (no dUTP, Bio-Rad, ref #1863025) and nuclease free water (Thermo Scientific, ref #R0582). The Table above provides a list of primers and probes used in the study. Other primers and probes may be similarly used for different AAV serotypes or to probe for different contaminant DNA.

[0214] ELISA

[0215] To determine the ratios of capsids containing AAV genomes versus total AAV capsids, A20 capsid ELISAs were performed on serial dilutions of the virus preparation with the AAV titration ELISA kit (Progen, ref #PRATV) according to the manufacturer's instructions.

[0216] MAAP and AAP Antisera

[0217] Polyclonal anti-MAAP antiserum was obtained from the immunization of rabbit with the peptide KKIRLLGATSDEQSSRRKRG (SEQ ID NO 28), conjugated to a carrier before immunization (Davids Biotechnologie GmbH, Germany).

[0218] Polyclonal anti-AAP antiserum was obtained from the immunization of Guinea pig with peptide RSTSSRTSSARRIKDASRR (SEQ ID NO 29), conjugated to a carrier before immunization. Antisera were affinity purified (Davids Biotechnologie GmbH, Germany).

[0219] Western Blotting

[0220] Sample was denatured using 2-mercaptoethanol (10%, Sigma-Aldrich) in Laemmi sample buffer (Bio-Rad, re 1610747). A constant volume of each sample was run on Mini-Protean TGX gels (4-10%, Bio-Rad). Proteins were transferred to 0.2 μm PVDF membrane (Trans-Blot Turbo Transfer Pack, Bio-Rad) and stained with selected primary antibody (table) overnight. Proteins were detected with horseradish peroxydase (HRP) conjugated secondary antibody, and visualized using ChemiDoc (Bio-Rad).

TABLE-US-00005 TABLE 5 Western blot analysis: antibodies and dilutions used Western blot analysis: antibodies and dilutions used Detected protein Primary antibody 1° dil Secondary antibody 2° dil AAV 303.9 (Progen) 1:250 Goat anti-mouse IgG 1:3000 replicase (H + L)-HRP conjugate (Bio- Rad) AAV B1 (Progen) 1:250 Goat anti-mouse IgG 1:3000 capsid (H + L)-HRP conjugate (Bio- proteins Rad) MAAP GAL-KKI 1 μg/mL Goat anti-rabbit IgG 1:3000 (Davids Biotechnologie) (H + L)-HRP conjugate (Bio- Rad) AAP GAL-RST 3 μg/mL Anti-guinea pig IgG (H + L)- 1:1000 (Davids Biotechnologie) HRP conjugate (Sigma) α-tubulin α-tubulin HRP  1:1000 NA NA conjugated mouse monoclonal IgG 1° dil = primary dilution; 2° dil = secondary dilution α-tubulin HRP conjugated mouse monoclonal IgG from Santa Cruz Biotechnology.

Statistical Analysis

[0221] Statistical comparison were performed using one-way analysis of variance (ANOVA), followed by a comparison of the wt-AAV2 reference against the other AAV2 assayed, performed using Dunnett's Multiple Comparison Test. The statistical tests were performed using GraphPad™ software (Prism).

Results

MAAP Translation Initiates at A CTG Codon

[0222] After detecting a possible novel viral protein, we analyzed the genome of wt AAV to identify potential non-ATG (non-canonical) initiation codons. Our review revealed at least three different non-canonical triplets that could theoretically initiate translation. Each of these three differs by only one base compared to the canonical ATG start codon. Thus, each can theoretically initiate translation.

[0223] We found that the first CTG encountered on the MAAP reading frame is the principal translation initiation codon for MAAP. The CTG translates to a leucine in MAAP (L1 on the full-length protein). On VP1 frame (−1 to MAAP), at this site is CCT that translates to P27.

[0224] To analyze non-canonical start codon usage in the context of the wild-type genome, we mutated the first potential non-canonical start codon of MAAP (CTG, L1 on the full-length protein) to CGG (translating to R1). This abolished its potential start codon function. In response, we found that MAAP production fell to levels undetectable using Western blot.

[0225] We thus confirmed our results several different ways. First, we introduced a stop codon in place of MAAP-Q9, between the first (CTG) and the second (AGG) potential non-canonical start codons. In response, we found that MAAP protein production fell to levels undetectable using Western blot.

[0226] Similarly, we introduced a stop codon in place of MAAP-S39. In response, we found that MAAP protein production fell to levels undetectable using Western blot.

[0227] Similarly, we placed three consecutive stop codons at MAAP amino acid residues S33, S39 and S47. In response, we found that MAAP production fell to levels undetectable using Western blot.

[0228] Our results differ from what Ogden (2019) observed. In their study, Ogden (2019) observed protein expression (perhaps in truncated form) when the first CTG start codon was mutated and when a stop codon was introduced in place of MAAP-Q6, while using a MAAP-flag tag fusion protein.

[0229] We further characterized the MAAP start codon by comparing the size of the wild-type MAAP with recombinant MAAP in which we changed the MAAP-L1 CTG start codon to an ATG, or when N-terminally truncated MAAP was expressed from the second potential start codon (MAAP-R13, AGG) changed to ATG. We detected the MAAP of the same molecular weight as the protein expressed from MAAP-L1 modified to ATG, while recombinant N-terminal truncated MAAP expressed from MAAP-R13 modified to ATG is detected at lower molecular weight in Western blot.

[0230] We also produced MAAP with enhanced green fluorescent protein (eGFP) fused in its C-terminal part (MAAP-GFP), and cloned it into the wt-AAV2 genome. It results in functional disruption of VP1/2 proteins. This is due to the insertion of the eGFP in the cap ORF frame. However, the capacity to encode the AAP, and VP3 proteins should be conserved. Likewise, the Rep protein expression and regulation of the p40 promoter should not be impaired. Thus, detected fluorescence originating from eGFP should reflect the production level of the MAAP protein in the viral context.

[0231] The MAAP-GFP fusion protein expressed from the wt-AAV2 genome had a median fluorescence intensity of 30872 when co-transfected with the plasmid encoding Adenovirus 5 helper genes (FIG. 1). The mutation of the MAAP-L1 CTG start to a CGG codon led to a fluorescent intensity of 17524. See FIG. 1. That is similar to the intensity level detected when we introduced a stop codon in place of MAAP-Q39 or MAAP-S47 or simultaneously to all three positions MAAP-S33,-39 and -47. When we introduced a stop codon in place of MAAP-Q9 or MAAP-S33, the levels of fluorescence intensity fell to 15896 and 15021, respectively. This level of expression remains above the background level and could hint at potential initiation of translation at different positions in the MAAP protein when stop codons are introduced in the reading frame. Alternatively, this level of expression could hint at potential read through of the inserted stop codons. We note, however, that with these new stop codons inserted, we were not able to detect any MAAP production at all using Western blot.

[0232] In the absence of adenovirus helper plasmid, the production level of MAAP-GFP was detected above the background level. This may be because the HEK293T cell line includes a copy of the adenoviral E1 gene. That E1 gene may act as trans-activator for AAV promoters.

[0233] Our experiments confirm the MAAP-L1 (CTG) as the start codon of the wild-type MAAP. Downstream of MAAP-L1, potential start codons located at position MAAP-R13 (AGG), MAAP-T14 (ACG) or further downstream of the MAAP protein may be used to translate an N-terminally truncated version of the MAAP, when translation of MAAP from L1 is impaired, as reflected by the MAAP-GFP production results.

Kinetic of MAAP Production

[0234] MAAP is expressed from the cap gene, possibly from the spliced form of the p40 transcript leading to VP2/3 expression. According to ribosome scanning mechanism, we find that translation initiates at the CTG start codon of the MAAP protein (frame-shifted +1 to VP1 orf), followed by VP2 translation initiated at the ACG start codon, continued with AAP expression at a CTG codon (frame-shifted +1 to VP1 orf), and achieved by the VP3 protein, initiated at an ATG codon.

[0235] In a kinetic experiment, we followed the expression over time of the Rep78/52, VPs, AAP and MAAP proteins during WT AAV2 production in 293T cells. At 6.5 hours after transfection, we detected the very faint expression of VP3 and Rep52. At 12 hours post-transfection, we detected all AAV proteins except AAP. At 13 hours post-transfection, we detected AAP. See FIG. 2. Additionally, Protein expression intensified progressively and reached a plateau 21 h post-transfection. During AAV production, we could only detect the Rep78 and 52 isoform but not Rep 68 and 40.

[0236] During the production process, we also observed capsid degradation starting 21 h post-transfection. This is seen as lower than VP3 protein bands on Western blot using Progen B1 antibody targeting the C-terminal part of VPs.—See FIG. 2.

[0237] The AAP C-terminal region displays nuclear and nucleolar localization signal composed of five basic amino acid rich (“BR”) clusters. Any combination of 4 of these BR clusters will target the protein to the nucleus and nucleolus.

[0238] Similarly, we found that the MAAP C-terminal end displays three BR clusters: KKIR (BR1), RRKR (BR2), and RNLLRRLREKRGR (BR3). These are shown on SEQ ID NO. 2 at residues 78-82, 94-97 and 107-119 respectively. We thus concluded that the C-terminal part of the MAAP protein may contain nuclear localization signal(s).

Effect of MAAP on Wild Type AAV

[0239] MAAP Inactivation and Impact on AAV Production

[0240] The modification of MAAP, either by the mutation of the start codon or introduction of stop codons at various positions in the MAAP coding sequence led to a reduction of AAV productivity at 24 h post transfection. See FIG. 3. This reduction in AAV productivity was statistically significant when MAAP-L1 (CTG) was modified to MAAP-R1 (CGG), with a productivity decreasing to only 21% of that observed with wt-AAV2. When a stop codon was introduced in place of MAAP-Q9, productivity decreased to only 39% of that observed with wt-AAV2. We also observed a reduction to 15% and 20% of wild-type productivity (respectively) for AAV mutants for which MAAP-W103 or MAAP-W105 were mutated to stop codon. Introduction of stop codons in place of MAAP-S33-39-S47, MAAP-S65, led to a trend in the reduction of AAV titers to 76% and 61% of levels seen with compared to wt-AAV2. Introduction of a stop codon in place of amino acid residue number 90, 100, 106 or 110 produced no clear trend in difference viz results observed with the wild-type gene. See FIG. 3. Thus, 24 h post transfection the expression of MAAP protein provides a replicative advantage compared to AAV mutants in which the MAAP gene is inactivated. Our results differ from Ogden (2019), who observed that the MAAP mutants did not have reduced titers. However, they observed that MAAP mutants were out-competed unless complemented in trans with functional MAAP polypeptide. This conclusion fits with our observed results of MAAP providing a replicative advantage to wt-AAV2 at 24 h post transfection.

TABLE-US-00006 TABLE 6 Amount of Viral Genomes Amount of Viral Genomes (υg)/mL Rep 24 h A B C D E F G H I J K L I 6.49 1.38 2.55 3.53 4.93 3.99 6.18 5.98 0.99 1.28 5.87 6.62 II — 0.21 0.39 0.54 0.76 0.61  0.95 0.92 0.15 0.20 0.90 1.02 n 7 4 4 4 7 3  4 7 3 3 4 1 KEY: Column A = wt-AAV2. B = MAAP-L1 (CTG) .fwdarw. MAAP R1 (CGG). C = MAAP-Q9 .fwdarw. stop. D = MAAP-S39 .fwdarw. stop. E = MAAP-S33-S39-S47 .fwdarw. stop. F = MAAP-S65 .fwdarw. stops. G = MAAP-E90 .fwdarw. stop. H = MAAP-L100 .fwdarw. stop. I = MAAP-W103 .fwdarw. stop. J = MAAP-W105 .fwdarw. stop. K = MAAP-L106 .fwdarw. stop. L = MAAP-L110 .fwdarw. stop. Row I = mean (vg.mL.sup.−1) × 10.sup.10. Row II = fold difference vs wt-AAV. n = number of samples.

[0241] At 72 h time point, only MAAP mutants in which MAAP-W103 and MAAP-W105 were replaced by stop codons showed reduced titers, respectively 0.75 and 0.76-fold, compared to wt-AAV2. See FIG. 4. Surprisingly, however, we found that for all other studied MAAP mutants, AAV titers were improved, rather than decreased. This surprising increase in AAV titer was significant for mutants in which MAAP-S33-S39-S47, MAAP-E90, MAAP-L100, MAAP-L106, are replaced by stop codons, with titers respectively increased by 3.50, 4.62, 3.67, 4.08-fold compared to wt-AAV2. Thus, when production time (i.e., the time transfected cells are cultured to produce virus) is extended beyond 24 hours, inactivation of MAAP protein results in higher AAV titers than does wild-type AAV.

TABLE-US-00007 TABLE 7 Amount of Viral Genomes Amount of Viral Genomes (υg)/mL Rep 72 h A B C D E F G H I J K L I 6.19 7.35 10.3 15.5 21.7 17.4 28.6 22.7 4.62 4.74 25.3 20.3 II — 1.19  1.67  2.51  3.50  2.82  4.62  3.67 0.75 0.76  4.08  3.28 n 7 4  4  4  7  3  4  7 3 3  4  4 KEY: Column A = wt-AAV2. Column B = MAAP-L1 (CTG) .fwdarw. MAAP R1 (CGG). Column C = MAAP-Q9 .fwdarw. stop. Column D = MAAP-S39 .fwdarw. stop. Column E = MAAP- S33-S39-S47 .fwdarw. stop. Column F = MAAP-S65 .fwdarw. stops. Column G = MAAP-E90 .fwdarw. stop. Column H = MAAP-L100 .fwdarw. stop. Column I = MAAP-W103 .fwdarw. stop. Column J = MAAP-W105 .fwdarw. stop. Column K = MAAP-L106 .fwdarw. stop. Column L =MAAP-L110 .fwdarw. stop. Row I = mean (vg.mL.sup.−1) × 10.sup.10. Row II = fold difference vs wt-AAV2. n = number of samples.

[0242] Next, we studied the effect of MAAP over-production to wt-AAV production, or to AAV mutant where MAAP-S33-S39-S47 were mutated to stop codons. At 24 h after transfection, when additional MAAP was expressed with wt-AAV2, we observed a 0.67-fold reduction in AAV titer compared to wt-AAV2. See FIG. 5, left. At 72 h time point, a 0.36-fold reduction compared to wt-AAV2 was observed. See FIG. 6, right. When we added to the wt-AAV reference cell a plasmid of similar size to the MAAP expression plasmid (to mimic the additional DNA mass provided by the addition of the MAAP expression plasmid), a 0.91-fold reduction compared to wt-AAV2 reference was observed at 24 h time point and 0.96-fold reduction at 72 h time point.

TABLE-US-00008 TABLE 8 Amount of Viral Genomes Amount of Viral Genomes (υg)/mL Rep 24 h A A B C D E F I 2.33 3.86 1.57 2.28 2.12 2.33 II — 1.66 0.67 0.98 0.91 1.00 KEY: Column A = wt-AAV2. Column B = MAAP S33-S39-S47 .fwdarw. stops. Column C = wt-AAV1 + MAAP. Column D = MAAP S33-S39-S47 .fwdarw. stops + MAAP. Column E = wt-AAV2 + eGFP. Column F = MAAP S33-S39-S47 .fwdarw. stops + eGFP. Row I = mean (vg.mL.sup.−1) × 10.sup.10. Row II = fold difference vs wt-AAV2.

TABLE-US-00009 TABLE 9 Amount of Viral Genomes Amount of Viral Genomes (υg)/mL Rep 72 h A B C D E F I 3.77 22.2 1.36 4.61 3.63 14.3 II —  5.89 0.36 1.22 0.96  3.80 KEY: Column A = wt-AAV2. Column B = MAAP S33-S39-S47 .fwdarw. stops. Column C = wt-AAV1 + MAAP. Column D = MAAP S33-S39-S47 .fwdarw. stops + MAAP. Column E = wt-AAV2 + eGFP. Column F = MAAP S33-S39-S47 .fwdarw. stops + eGFP. Row I = mean (vg.mL.sup.−1) × 10.sup.10. Row II = fold difference vs wt-AAV2.

[0243] When we produced AAV for which MAAP-S33-S39-S47 are mutated to stop codons we observed a 1.66 fold increase in vg titers compared to wt-AAV2 at 24 h time point and 5.89-fold increase at 72 h time point.

[0244] MAAP added to AAV for which MAAP-S33-S39-S47 are mutated to stop codons resulted in vg titers similar to wt-AAV2 at 24 h time point and with 1.22-fold increase at 72 h time point. When the MAAP-S33-S39-S47 are mutated to stop codons and is complemented with plasmid of similar size to the MAAP expression plasmid, the titers were equal to the wt-AAV2 reference at 24 h time point and 3.80-fold higher at 72 h time point.

[0245] In summary, for culture periods longer than 24 hours, we surprisingly found that the over-expression of the MAAP protein resulted in reduced viral genome (vg) titers. This suggests that MAAP is required in a stoichiometric amount relative to another AAV protein(s), potentially the AAP or the VPs.

[0246] Packaging of Contaminating DNA

[0247] Next, we studied the effect of MAAP on the packaging of contaminating DNA, into the AAV capsid, originating from the AAV producer plasmids. We first studied the level of kanamycin-resistance gene packaged in the AAV capsid by ddPCR. The kanamycin-resistance gene is present both in the adenovirus serotype 5 helper plasmid and the plasmid encoding the AAV genome. During wt-AAV production, at 24 h after transfection, we measured 3.77% of Kanamycin resistance gene contamination packaged, compared to wt-AAV2 genome packaging, while at 72 h time point this percentage was equal to 3.50%. See FIGS. 7 and 8.

TABLE-US-00010 TABLE 10 Kanamycin resistance gene vs AAV genome packaging % of Kanamycin resistance gene vs AAV genome packaging at 24 hours A B C D E F G H I J K L I 3.77 38.88 6.47 18.55 3.47 7.20 6.45 4.59 33.10 40.34 15.19 7.29 II — 10.31 1.72  4.92 0.92 1.91 1.71 1.22  8.78 10.70  4.03 1.93 n 6  3 3  3 6 3 3 6  3  3  3 3 KEY: Column A = wt-AAV2. Column B = MAAP-L1 (CTG) .fwdarw. MAAP R1 (CGG). Column C = MAAP-Q9 .fwdarw. stop. Column D = MAAP-S39 .fwdarw. stop. Column E = MAAP-S33-S39-S47 .fwdarw. stop. Column F = MAAP-S65 .fwdarw. stops. Column G = MAAP-E90 .fwdarw. stop. Column H = MAAP-L100 .fwdarw. stop. Column I = MAAP-W103 .fwdarw. stop. Column J = MAAP-W105 .fwdarw. stop. Column K = MAAP-L106 .fwdarw. stop. Column L = MAAP-L110 .fwdarw. stop. Row I = % of Kanamycin resistance gene vs AAV genome packaging. Row II = fold difference vs wt-AAV2. n = number of samples.

TABLE-US-00011 TABLE 11 Kanamycin resistance gene vs AAV genome packaging % of Kanamycin resistance gene vs AAV genome packaging at 72 hours A B C D E F G H I J K L I 3.50 37.21 9.25 20.40 4.93 5.82 5.82 5.27 36.93 47.12 16.27 8.55 II — 10.63 2.64  5.83 1.41 1.66 1.66 1.51 10.55 13.46  4.65 2.44 n 6  3 3  3 6 3 3  6  3  3  3 3 KEY: Column A = wt-AAV2. Column B = MAAP-L1 (CTG) .fwdarw. MAAP R1 (CGG). Column C = MAAP-Q9 .fwdarw. stop. Column D = MAAP-S39 .fwdarw. stop. Column E = MAAP-S33-S39-S47 .fwdarw. stop. Column F = MAAP-S65 .fwdarw. stops. Column G = MAAP-E90 .fwdarw. stop. Column H = MAAP-L100 .fwdarw. stop. Column I = MAAP-W103 .fwdarw. stop. Column J = MAAP-W105 .fwdarw. stop. Column K = MAAP-L106 .fwdarw. stop. Column L = MAAP-L110 .fwdarw. stop. Row I = % of Kanamycin resistance gene vs AAV genome packaging. Row II = fold difference vs wt-AAV2. n = number of samples.

TABLE-US-00012 TABLE 12 Kanamycin resistance gene vs AAV genome packaging. % of Kanamycin resistance gene us AAV genome packaging at 24 hours A B C D E F I 4.05 3.11 7.08 7.34 5.43 5.09 II — 0.77 1.75 1.81 1.34 1.26 KEY: Column A = wt-AAV2. Column B = MAAP S33-S39-S47 .fwdarw. stops. Column C = wt-AAV2 + MAAP. Column D = MAAP S33-S39-S47 .fwdarw. stops + MAAP. Column E = wt-AAVS + eGFP. Column F = MAAP S33-39-S47 .fwdarw. stops + eGFP. Row I = % of Kanamycin resistance gene vs AAV genome packaging. Row II = fold difference vs wt-AAV2.

TABLE-US-00013 TABLE 13 Kanamycin resistance gene vs AAV genome packaging. of Kanamycin resistance gene vs AAV genome packaging at 72 hours A B C D E F I 5.78 6.10 10.15 8.43 5.22 5.86 II — 1.06 1.76 1.46 0.90 1.01 KEY: Column A = wt-AAV2. Column B = MAAP S33-S39-S47 .fwdarw. stops. Column C = wt-AAV2 + MAAP. Column D = MAAP S33-S39-S47 .fwdarw. stops + MAAP. Column E = wt-AAVS + eGFP. Column F = MAAP S33-39-S47 .fwdarw. stops + eGFP. Row I = % of Kanamycin resistance gene vs AAV genome packaging. Row II = fold difference vs wt-AAV2.

[0248] The level of kanamycin gene packaging was increased significantly when MAAP-L1 CTG start codon was modified to CGG, or when MAAP-S39, MAAP-W103 or MAAP-W105 and MAAP-L106 were modified to stop codon, with increases respectively of 10.31, 4.92, 8.78, 10.70 and 4.03-fold compared to wt-AAV at 24 h time point. See FIG. 7. This increased 10.63, 5.83, 10.55, 13.46 and 4.65-fold compared to wt-AAV at 72 h time point. See FIG. 8. The highest contamination level was observed for the MAAP-W105 mutated to stop codon with an increase of 13.46-fold over wt-AAV, with Kanamycin resistance gene packaging representing 47.12% compared to the AAV genome. See FIG. 8.

[0249] AAV for which MAAP-S33-S39-S47 are mutated to stop codons, MAAP-S65, MAAP-E90, MAAP-L100 and MAAP-L110 showed a trend of higher Kanamycin packaging compared to wt-AAV2 both at 24 h and at 72 h time points.

[0250] When MAAP was added in complement to wt-AAV production or to AAV in which MAAP-S33-S39-S47 are mutated to stop codons, we observed an increase in Kanamycin resistance gene packaging compared to the wt-AAV without addition MAAP protein expression. See FIGS. 9 and 10.

[0251] To study whether the antibiotic resistance gene contamination is originating preferentially from the Adenovirus helper plasmid or from the wt-AAV2 encoding plasmid, we measured the level of contamination originating from the Adenovirus 5 E4 gene present on the plasmid encoding the Adenovirus 5 helper functions necessary for AAV production. When MAAP-L1 CTG start codon was modified to CGG, we observed statistically significant increase only in Adenovirus 5 E4 gene packaging of 6.37-fold at 24 h time point. See FIG. 11. At 72 h time point, no statistically significant differences compared to wt-AAV2 were detected. However, at 72 h time point, a trend in reduction of Adenovirus 5 E4 gene packaging was observed particularly for mutants in which stop codons are introduced in place of MAAP-S33-S39-S47, MAAP-S65, MAAP-E90, MAAP-L100 or MAAP-L110 with 0.43, 0.32, 0.53, 0.31, 0.44-fold respectively. See FIG. 12.

TABLE-US-00014 TABLE 14 Ad5 E4 gene vs AAV genome packaging. % of Ad5 E4 gene vs AAV genome packaging at 24 hours A B C D E F G H I J K L 1 1.23 5.09 1.14 1.12 1.90 3.21 2.00 1.47 5.23 7.83 1.22 1.45 II 4.13 0.92 0.91 1.55 2.61 1.63 1.19 4.25 6.37 0.99 1.18 n 6 3 3 3 6 3 3 6 3 3 3 3 KEY: Column A = wt-AAV2. Column B = MAAP-L1 (CTG) .fwdarw. MAAP R1 (CGG). Column C = MAAP-Q9 .fwdarw. stop. Column D = MAAP-S39 .fwdarw. stop. Column E = MAAP-S33-S39-S47 .fwdarw. stop. Column F = MAAP-S65 .fwdarw. stops. Column G = MAAP-E90 .fwdarw. stop. Column H = MAAP-L100 .fwdarw. stop. Column I = MAAP-W103 .fwdarw. stop. Column J = MAAP-W105 .fwdarw. stop. Column K = MAAP-L106 .fwdarw. stop. Column L = MAAP-L110 .fwdarw. stop. Row I = % of Ad5 E4 gene vs AAV genome packaging. Row II = fold difference vs wt-AAV2. n = number of samples.

TABLE-US-00015 TABLE 15 Ad5 E4 gene vs AAV genome packaging. % of Ad5 E4 gene vs AAV genome packaging at 72 hours A B C D E F G H I J K L I 0.21 0.47 0.14 0.15 0.09 0.07 0.11 0.06 0.22 0.47 0.39 0.09 II — 2.22 0.68 0.73 0.43 0.32 0.53 0.31 1.03 2.23 1.88 0.44 n 6 3 3 3 6 3 3 6 3 3 3 3 KEY: Column A = wt-AAV2. Column B = MAAP-L1 (CTG) .fwdarw. MAAP R1 (CGG). Column C = MAAP-Q9 .fwdarw. stop. Column D = MAAP-S39 .fwdarw. stop. Column E = MAAP-S33-S39-S47 .fwdarw. stop. Column F = MAAP-S65 .fwdarw. stops. Column G = MAAP-E90 .fwdarw. stop. Column H = MAAP-L100 .fwdarw. stop. Column I = MAAP-W103 .fwdarw. stop. Column J = MAAP-W105 .fwdarw. stop. Column K = MAAP-L106 .fwdarw. stop. Column L = MAAP-L110 .fwdarw. stop. Row I = % of Ad5 E4 gene vs AAV genome packaging. Row II = fold difference vs wt-AAV2. n = number of samples.

[0252] The results suggest that a higher level of contaminating DNA is packaged in the AAV capsid when MAAP expression is impaired, or when it originates from the same plasmid backbone that encodes the AAV genome. However, DNA packaged from the adenovirus helper plasmid is reduced compared to the wt-AAV, particularly where MAAP-S33-S39-S47, MAAP-S65, MAAP-E90, MAAP-L100 or MAAP-L110 have been mutated to a stop codon. Overall, our results indicate that MAAP may be involved in ITR-mediated DNA packaging independently of the ITR D sequence, present on the AAV genome side but absent on the backbone side of the ITRs.

[0253] MAAP Impact on AAV Capsid

[0254] The wild-type AAV capsid is composed of the VP1, VP2 and VP3 proteins in a relative ratio of about 1:1:10. However, specific degradation products of these VPs are detected starting 21 h post-transfection in 293 and 293T cells. See FIG. 2 For example, in AAV serotype 2, VP-1, -2 and -3 are about 87, 73, and 61 kDa respectively. We detected degradation of the VPs by using a monoclonal antibody against each of the C-terminal ends of the three VPs. (The antibodies are described in Wobus C E et al., Monoclonal Antibodies against the Adeno-Associated Virus Type 2(AAV-2) Capsid: Epitope Mapping and Identification of Capsid Domains Involved in AAV-2-Cell Interaction and Neutralization of AAV-2Infection, 74 J. Virol. 9281 (2000).) Using this, we observed VP1, VP2 and VP3 degrading within 21 hours after transfection. These are observed in FIG. 2 at at 32 kDa (FIG. 2 dash; FIG. 13; FIG. 14), 18 kDa (FIG. 2 asterisk; FIG. 13; FIG. 14), and 14 kDa (FIG. 2 hash; FIG. 13; FIG. 14).

[0255] Interestingly, for all constructs in which MAAP expression was inactivated, except the MAAP-L110 to stop mutant, we observed the disappearance of the three 32 kDa, 18 kDa and 14 kDa polypeptides (FIG. 13; FIG. 14). We also observed an increase in the quantity of VP1 and VP2 proteins. This suggests that the degradation products originated from the degradation of VP1 and VP2 specifically (FIG. 13; FIG. 14). However, the variant in which MAAP-L110 was mutated to stop codon still displayed the specific 18 kDa AAV capsid degradation product, but with lower intensity compared to wt-AAV2. This suggests that the specific proteolytic activity observed, when MAAP is expressed, is associated with its C-terminal part, more specifically with the basic amino acid-rich “BR3” domain (amino acid residues 107-119 on SEQ ID NO. 2), as only the MAAP-L110 to stop mutant, still encoding the BR3 domain, displayed the VP proteolytic fragment. When the MAAP was expressed in complement to the AAV mutant in which MAAP-S33-S39-S47 are replaced by stop codons, the proteolytic activity on the AAV capsid was restored. These data show that the virus preparation made from a genome that is MAAP-deleted or MAAP-truncated to eliminate the proteolytic domain, is physically different from virus made from a wild-type genome. Our finding here thus provides a way to increase both the yield of AAV, and the stability of the resulting AAV.

[0256] We analyzed the ratio of capsids containing the AAV genome in comparison to total AAV capsids at 72 h, to derive the ratio of empty capsids (lacking the desired DNA) to full capsids (carrying the desired DNA). Wild-type AAV2 showed 6.91% of capsid containing the AAV genome.

TABLE-US-00016 TABLE 16 Total Capsids Containing AAV Genome. Percent of Total Capsids Containing AAV Genome I II III IV V VI VII VIII IX X XI XII % 6.91 3.39 4.60 5.99 11.80 13.07 8.24 8.76 4.52 3.71 7.04 7.04 vs = 0.49 0.67 0.87  1.71  1.89 1.19 1.27 0.65 0.54 1.02 1.02 wt Column Number Key: I = wt-AAV2 II = MAAP gene with start codon (CTG) (L1 on the full-length polypeptide) mutated to CGG (R1) III= MAAP gene with Q9 on the full-length polypeptide point-mutated to stop codon. IV = MAAP gene with S39 point-mutated to stop codon. V = MAAP gene with all of S33, S39 and S47 point-mutated to stop codon. VI to XII = MAAP gene with S65, E90, L100, L103, L105, L106 or L110 (respectively) point-mutated to stop codon.
A reduction of capsids containing genome was observed when MAAP-L1 CTG start codon was modified to CGG, or when AAV MAAP-Q9, MAAP-39, MAAPW103 or MAAP-W105 were replaced by a stop codon. AAV MAAP-L106 or MAAP-L11=mutated to stop, encoding almost full-length MAAP, had similar level of AAV capsids containing AAV genomes compared to wt-AAV2. When AAV MAAP-S33-S39-S47 were replaced to stops, or when MAAP-S65, MAAP-E90 and MAAP-L100 were mutated to stop codon, we observed an increase of capsids containing AAV genomes compared to wt-AAV2. We plot more detailed data in FIG. 15.

TABLE-US-00017 TABLE 17 Capsids containing AAV genome % of capsids containing AAV genome A B C D E F G H I J K L I 6.91 3.39 4.60 5.99 11.80 13.07 8.24 8.76 4.52 3.71 7.04 7.04 II — 0.49 0.67 0.87 1.71 1.89 1.19 1.27 0.65 0.54 1.02 1.02 MAAP Truncation Effect on Virus Yield and Purity MAAP variant I II III IV V VI VII VIII IX X XI XII Rep 24 h mean 6.49 1.38 2.55 3.53 4.93 3.99 6.18 5.98 0.99 1.28 5.87 6.62 (vg/mL) * 10.sup.10 fold — 0.21 0.39 0.54 0.76 0.61 0.95 0.92 0.15 0.20 0.90 1.02 difference vs wt-AAV2 N 14 8 8 8 14 6 8 14 6 6 8 8 108 Rep 72 h mean 6.19 7.35 10.3 15.5 21.7 17.4 28.6 22.7 4.62 4.74 25.3 20.3 (vg/mL) * 1010 fold — 1.19 1.67 2.51 3.50 2.82 4.62 3.67 0.75 0.76 4.08 3.28 difference vs wt-AAV2 N 14 8 8 8 14 6 7 14 6 6 8 8 107 % Kan 24 h % of kan vs 3.77 38.9 6.47 18.6 3.47 7.20 6.45 4.59 33.1 40.3 15.2 7.29 AAV genome packaging fold — 10.3 1.72 4.92 0.92 1.91 1.71 1.22 8.78 10.7 4.03 1.93 difference vs wt-AAV2 N 12 6 6 6 12 6 6 12 6 6 6 6 90 % Kan 72 h % kan VS 3.50 37.2 9.25 20.4 4.93 5.82 5.82 5.27 36.9 47.1 16.3 8.55 AAV genome packaging fold — 10.6 2.64 5.83 1.41 1.66 1.66 1.51 10.6 13.5 4.65 2.44 difference vs wt-AAV2 N 12 6 6 6 12 6 5 12 6 6 6 6 89 % Ad5 E4 24 h % of Ad5 E4 1.23 5.09 1.14 1.12 1.90 3.21 2.00 1.47 5.23 7.83 1.22 1.45 gene vs AAV genome packaging fold — 4.13 0.92 0.91 1.55 2.61 1.63 1.19 4.25 6.37 0.99 1.18 difference vs wt-AAV2 N 12 6 6 6 12 6 6 12 6 6 6 6 90 % Ad5 E4 72 h % of Ad5 E4 0.21 0.47 0.14 0.15 0.09 0.07 0.11 0.06 0.22 0.47 0.39 0.09 gene vs AAV genome packaging fold — 2.22 0.68 0.73 0.43 0.32 0.53 0.31 1.03 2.23 1.88 0.44 difference vs wt-AAV2 N 12 6 6 6 12 6 5 12 6 6 6 6 89 % of capsids containing AAV genomes % 7.20 3.13 3.77 4.56 9.45 8.00 6.83 5.80 5.99 fold — 0.43 0.52 0.63 1.31 1.11 0.95 0.81 0.83 difference vs wt-AAV2 573.00 1719 KEY: Column A = wt-AAV2. Column B = MAAP-L1 (CTG) .fwdarw. MAAP R1 (CGG). Column C = MAAP-Q9 .fwdarw. stop. Column D = MAAP-S39 .fwdarw. stop. Column E =MAAP-S33-S39-S47 .fwdarw. stop. Column F = MAAP-S65 .fwdarw. stops. Column G = MAAP-E90 .fwdarw. stop. Column H = MAAP-L100 .fwdarw. stop. Column I = MAAP-W103 .fwdarw. stop. Column J = MAAP-W105 .fwdarw. stop. Column K = MAAP-L106 .fwdarw. stop. Column L = MAAP-L110 .fwdarw. stop. Row I = %. Row II = fold difference vs wt-AAV2. n = number of samples. Column Number Key: I = wt-AAV2 II = MAAP gene with start codon (CTG) (L1 on the full-length polypeptide) mutated to CGG (R1) III = MAAP gene with Q9 on the full-length polypeptide point-mutated to stop codon. IV = MAAP gene with S39 point-mutated to stop codon. V = MAAP gene with all of S33, S39 and S47 point-mutated to stop codon. VI to XII = MAAP gene with S65, E90, L100, L103, L105, L106 or L110 (respectively) point-mutated to stop codon. N-values here are presented as all measured samples not taking account of actual independent experiments vs. above

Conclusions

[0257] MAAP expression improves virus replication 24 hours after infection. Over longer infection times, however, we surprisingly found that MAAP expression deteriorates virus replication. We demonstrated that for infection periods greater than 24 hours, inactivating wild-type MAAP expression produces a higher yield of virus than produced using a wild-type genome.

[0258] We also surprisingly found that MAAP appears to affect degradation of viral capsid proteins. MAAP may have direct proteolytic activity. Alternatively, MAAP may interact with another protein, or with the viral or host cell cellular genome, to inhibit viral capsid protein degradation. Alternatively, MAAP may affect cellular proteolysis or proteolytic activity against AAV capsid proteins.

[0259] We demonstrated that eliminating MAAP, or truncating its C-terminal end produces a virus preparation that is both higher in yield and more resistant to degradation than virus made from a wild-type genome.

[0260] We also found that impairing the expression of MAAP increases the percentage of full virions. We thus provide a way to improve the quality of manufactured virus. This is critically important in manufacturing human gene therapy vectors.

[0261] We predict that inactivating wild-type MAAP expression produces a virus that is better able to transduce target cells.

[0262] Given our disclosure here, the artisan can readily make certain modifications. For example, we truncate translation of full-length MAAP by inserting point-mutations in the underlying DNA. The artisan could achieve the same ends by, for example, co-transfecting the producer cell with a plasmid coding for interfering RNA that interferes with MAAP expression. Alternatively, the artisan could treat the producer cell with a monoclonal antibody directed to MAAP. Such approaches achieve the same end as point-mutating the viral genome, albeit perhaps at greater expense. We thus intend the legal scope of our patent to be defined not by our various examples, but by our appended legal claims.

Example 2

[0263] Adeno-associated virus (AAV) was originally discovered as a contaminant of Adenovirus production.sup.1. AAV serotype 2 is considered as the reference model and encodes a ssDNA genome of 4679 bases packaged in an icosahedral capsid. The AAV2 genome is flanked by GC-rich DNA regions structured in hairpin, Inverted Terminal Repeats (ITRs). ITRs are recognized by the AAV large Rep proteins, allowing AAV genome replication, but also its integration in the host chromosomal DNA in a site specific manner. The smaller Rep proteins are necessary for the genome packaging. Capsids are composed of VP1, VP2 and VP3 proteins with a ratio of approximately 1:1:10 at the population level and with a total of 60 VP per capsid. The capsid assembly and the transport of the VPs to the nucleus is mediated by the Assembly Activating Protein (AAP), also encoded on the capsid gene but on a different reading frame than the VPs. The Membrane Associated Accessory Protein (MAAP) is encoded on the cap gene in the region coding also for the VP1/2 unique domain, and is associated with the cell.sup.2 and nuclear membranes (Example 1). MAAP accelerates wt-AAV2 replication. However, truncated C-terminal MAAP variants enhanced AAV2 production in plasmid based transfection production using an Adeno helper plasmid. Based on the results of Example 1, we have retained two AAV2 MAAP variants displaying potential interest for recombinant (r)AAV production, the MAAP-S33-S39-S47 mutated to stop codons (also referred to as a triple stop mutant) and the MAAP-L100 mutated to stop codon. Both mutant do not affect the VP1/2 protein sequences. Similar MAAP mutants were made in the cap gene encoding recombinant AAV serotypes 1, 2, 5, 6, 8 and 9, again without altering the VP1/2 amino acid sequence. In 293T cell line, viral genome (vg) yields were improved for all rAAV serotypes apart from rAAV5, particularly for cap genes encoding the MAAP-IUS100 variant. In these experiments the most drastic production increase was observed for rAAV6. The alteration of MAAP protein resulted also in the modification of the secretion profile of some rAAVs, resulting in rAAV6 and 8 present in the cell culture medium to be essentially retained inside the cells. DNA and protein sequences of MAAP of several AAV serotypes.sup.3 showed that almost all AAV cap genes could be implemented with MAAP-S33-S39-S47 and MAAP-L/S-100 mutations, without affecting their VP1 protein sequences. Constructing a phylogenetic tree of the MAAP shows two main clades of AAV that could be associated with specific properties of AAV serotypes.

[0264] Material and Methods

[0265] Virus Preparations

[0266] rAAV were constructed as described in Example 1. rAAV vectors were prepared as follows. 293T cells (European Collection of Cell Cultures 293T Number: 12022001) were grown in Dulbecco's modified Eagle medium (DMEM, Gibco 11965084) supplemented with 10% fetal bovine serum (FBS, Thermo Fisher 10091-148), supplemented with 2 mM L-glutamine (Gibco, 25030-024), and penicillin-streptomycin (Gibco 15070-063). Polyethylenimine (PEI) transfections of rep-cap plasmid, mSeAP-ITR plasmid and adenovirus helper plasmid (1:1:1 ratio, total 261 ng/cm.sup.2) were performed on 293T cells in 6-well plates (341000 cells/well). Alternatively pDG2, pDP6, pDP5rs, and pDP8 plasmids from Plasmid Factory were used in combination with the mSeAP-ITR plasmid (1:1 ratio, total 261 ng/cm.sup.2). The PEI Pro (Polyplus Transfection, ref #115-100)/DNA weight ratio was maintained at 1:1 in serum-free DMEM medium. Serum free media exchange was carried 24 h post transfection. rAAV were harvested 72 h after transfection. For viral genome titer determination and rAAV capsid ELISA samples, rAAV were harvested using Triton-X-100 buffer (0.5% Triton-X-100 (Sigma-Aldrich, ref #X100-1L) and 2 mM MgCl2 (Merck, ref #E13980) in 1×PBS (Gibco, rem 18912-014)) and Denarase (50 U/ml, c-Lecta, rem 20804-5M). Lysis buffer was added to the media and cells were incubated for 2 h at 37° C. before cell lysate was collected.

[0267] Quantification of rAAV Genomes by Droplet Digital PCR

[0268] To obtain droplet digital PCR (ddPCR) AAV vg titers, crude preparations of virus were DNaseI (0.01 U/μl, Invitrogen, rem 18047-019) and Proteinase K (0.1 μg/μl, Roche, rem 03115879001) treated, and viral titers were obtained by ddPCR amplification (QX200, Bio-Rad) with primers (CMV-FWD [5′-CATGACCTTATGGGACTTTCCT]; CMV-REV [5′-CTATCCACGCCCATTGATGTA]) and probe (CMV-PRB [5′-6-FAM/TCGCACCTG/ZEN/ATTGCCCGACATTAT/IABkFQ) detecting the CMV promoter driving the mSeAP expression cassette. All primers and probes were ordered from Integrated DNA Technologies. For mastermix generation, primers (900 nM) and probe (250 nM) were diluted in 2×ddPCR Supermix for Probes (no dUTP, Bio-Rad, ref #1863025) and nuclease free water (Thermo Scientific, remR0582).

[0269] ELISA

[0270] To determine the ratios of capsids containing rAAV genomes from AAV capsids, capsid ELISA was first performed on 500-10,000 serial dilutions of the virus preparation using AAV titration ELISA kits according to the manufacturer's instructions. For rAAV2, Progen, PRAT; for rAAV5, Progen PRAAV5; for rAAV6, Progen PRAAV6; for rAAV8, Progen PRAAV8. Ratios of capsids containing the genome of interest versus the total capsids, expressed as percentages, were then calculated by dividing rAAV vg titers by capsid titers.

[0271] Statistical Analysis

[0272] The statistical analyses were performed using GraphPad software (Prism). The significance values shown above the bars on the figures are denoted as **** (p<0.0001), *** (p<0.001), ** (p<0.01), * (p<0.05) or ns (not significant).

[0273] Phylogenetic Analysis

[0274] Cap gene sequences originally used by Gao and collaborators.sup.3 with accession number AY530553 to AY530629 were annotated for the MAAP ORF. The CTG codon found in the MAAP ORF was used to as start codon used for the translation of MAAP protein as found in 2 and for wt-AAV2 (Example 1 of this patent application). Alignment and phylogenetic reconstructions were performed using the function “build” of ETE3 v3.1.1.sup.6 as implemented on the GenomeNet (https://www.genome.jp/tools/ete/). Alignment was performed with MAFFI v6.861b with the default options.sup.7 or Multalin.sup.4. The tree was constructed using FastTree v2.1.8 with default parameters.sup.8. Graphical representation was performed using iTOL.sup.9.

[0275] Results

[0276] MAAP Variants Increase rAAV Productivity.

[0277] We generated rAAV of serotypes 1, 2, 5, 6, 8 and 9 encoding the mSeAP gene. The cap gene either encoded wild-type (wt)-MAAP of the respective serotypes, or the MAAP-S33-S39-S47 mutated to stop for rAAV1, 2, 6, 8 and 9 (corresponding to MAAP-S59-65-71 for AAV5) in the cap gene. Those MAAP mutants are referred to as MAAP triple stop herein. Lastly, we produced rAAV2 and 9 using MAAP-L100 to stop variant and rAAV1, 6 and 8 using MAAP-S100 to stop variant. Those variants are often referred to MAAP-US-100 in the text. Mutations introduced in the cap gene to obtain the MAAP triple stop and MAAP-U/S-100 variants did not affect the amino acid sequence of VP1/2 proteins. So, for all the AAV serotypes studied in this work can be introduced the MAAP-triple stop mutation, i.e a stop codon in the MAAP sequence in place of codons coding for S33-S39-S47 (for AAV5 those mutants correspond to S59-65-71), without modifying the amino acid sequence of the VPs. Likewise, all AAV serotypes can have their MAAP-L/S-100 mutated to stop codons without modifying the VP amino acid sequence. For AAV5 the equivalent mutation is found in MAAP-S123. For AAV hu.28, it corresponds to MAAP-W100.

[0278] The triple stop rAAV1 encoding mSeAP increased viral genome titers (vg) 6.02-fold over wt-MAAP, while MAAP-S100 variants resulted in a 7.47-fold increase (FIG. 16 and table 18). For rAAV2-mSEAP, the MAAP triple stop increased viral genome titers (vg) 2.30-fold, while MAAP-L100 variant resulted in a 3.41 increase over the wt-MAAP (FIG. 16 and table 18) For rAAV6-mSeAP, the figures were 6.51 and 8.20-fold, respectively, and for AAV8-mSeAP, 3.60-fold and 2.49-fold increase was obtained. For AAV9, variants MAAP-S33-S39-847 and MAAP-L100 resulted in 1.21-fold and 1.87-fold increase in vg titers, respectively, over the wt-MAAP sequence. In the case of rAAV5-mSeAP, the same modifications did not affect the vg titers. In conclusion, we observed a global increase in the rAAV productivity for rAAV1, 2, 6, 8 and 9, but not 5, when MAAP triple stops and MAAP-L/S-100 variants were used over the wt-MAAP.

[0279] Impact of MAAP Variants on rAAV Genome Packaging

[0280] We studied also the role of the above described MAAP mutations on the percentage of capsids containing the transgene of interest versus the total capsids (full viruses) and found not a significant difference between the mutants and wt-MAAP encoding serotype 2, 5, 8 viruses (FIG. 17 and table 19). However, rAAV6 showed an increase in the level of full viruses when MAAP variants were used (FIG. 17 and table 19). When a cap6 gene encoding the wt-MAAP was used, we measured on average 67.3% of capsids containing the rAAV genome, and 95.9% and 118.4%, respectively, when the cap6 gene was encoding MAAP-S33-S39-S47 and MAAP-S100 variants.

[0281] MAAP Variants Affects Eggress of rAAV

[0282] Next we studied how different rAAV serotypes egress into cell culture medium and observed that both MAAP-triple stops and MAAP-L/S100 variants led to a marked reduction of rAAV quantities in the cell media when compared to intracellular rAAV (FIG. 18 and table 20). For rAAV1 and 6, the proportion of vector found in the cell culture media prior to harvest was of 84.51% and 49.14% respectively. This proportion of vector found in the cell culture media felt to 10.45% for MAAP-triple stop and 8.31% for MAAP-S100 variants, respectively, for serotype 1, and 7.15% and 5.49% in the case of AAV6, respectively. Similar results were obtained for rAAV8, wt-MAAP resulting in 60.38% of rAAV8 in the cell culture media while the triple stop variant led to 11.33% and MAAP-S100 7.55% of the recombinant AAV present in the cell culture. A significant reduction in the proportion of modified rAAV2 and 5 in culture medium was also observed.

[0283] Phylogenetic Analysis of MAAP Across AAV Serotypes

[0284] A MAAP phylogenetic tree was constructed of 87 AAV serotypes of human and non-human primate origins (FIG. 19). The MAAP sequences were obtained from the cap genes of the different clades of AAV previously defined based on the VP1 protein sequences 3.

[0285] A major fork divides AAVs in two different large groups plus a branch represented by AAV5. Clade A is represented by AAV1, 3, 4, 6, 8, 9, 10 and all non-human primates AAVs. Clade B is represented by AAV2 and AAV serotypes isolated from humans. AAV5 forms a separated branch by itself. Interestingly, AAV1, 6, 8 and 9, members of MAAP clade A, were characterised by at least 40% of the produced AAV found in the cell culture medium. In comparison, AAV2, a member of clade B, had less than 20% of the capsids containing the recombinant AAV genome found in the cell culture medium as was the case with AAV5, present on a major separated branch of the AAV phylogenetic MAAP tree. Thus, clade A AAVs seem to be more secreted compared to the member(s) of clade B and AAV5. However, further studies are needed to confirm this initial result by studing more members of clade B.

[0286] All studied members of MAAP clades A and B yielded higher vg titers when MAAP variants were used in rAAV production, AAV5 being the only exeption. We did not observed higher vg titer when MAAP-S59-S65-S71 variant was used. As AAV5 MAAP forms an isolated, own clade without other members compared to the many AAV members of clades A and B, it could be that MAAP-S59-S65-S71 mutant has different biological activities. However, because of having the most divergent MAAP, more extensive characterization of the right site of modification could still lead to productivity increase.

[0287] Interestingly, beside the AAV5 MAAP, all the other MAAP proteins align, without any gaps in the alignment, except AAV hu.57. It lacks one histidine at the beginning of the MAAP sequence (supporting file MAAP protein alignment). The results show a high level of MAAP conservation throughout the AAV family. The alignment highlight the main MAAP clades A and B, with members possessing highly related protein sequences. We also analysed whether the MAAP mutants could be transposed to other AAV serotypes, without modifying the original VP1 amino acid sequence. For all the studied serotypes presented in FIG. 19, we were able to perform the MAAP Triple-stop mutation without interfering with VP1 amino acid sequence, excluding the cap gene of AAV serotypes hu.15 and hu.16, belonging to MAAP clade B.

[0288] Table 18 shows the mean vg.Math.mL.sup.−1 titer of rAAV produced at 72 hpt, the fold difference in respect to rAAV made with wt-MAAP and MAAP variants within the same capsid serotype, and the repeats of each experiment (N) assessed in the study. Samples from left to right are. Samples from left to right are. rAAV1-mSeAP, produced 3-plasmid system, using Rep2-Cap1 plasmid encoding wt-MAAP; MAAP-S33-S39-S47; and MAAP-S100. rAAV2-mSeAP, produced using pDG2 (Plasmid Factory), 3-plasmid system, using Rep2-Cap2 plasmid encoding wt-MAAP; MAAP-S33-S39-S47; and MAAP-L100. rAAV6-mSeAP, produced using pDP6 (Plasmid Factory), 3-plasmid system, using Rep2-Cap6 plasmid encoding wt-MAAP; MAAP-S33-S39-S47; and MAAP-S100. rAAV5-mSeAP, produced using pDP5rs (Plasmid Factory), 3-plasmid system, using Rep2-Cap5 plasmid encoding wt-MAAP; and MAAP-S59-S65-S71. rAAV8-mSeAP, produced using pDP8.ape (Plasmid Factory), 3-plasmid system, using Rep2-Cap8 plasmid encoding wt-MAAP; MAAP-S33-S39-S47 and MAAP-S100. rAAV9-mSeAP produced with 3-plasmid system, using Rep2-Cap9 plasmid encoding wt-MAAP; MAAP-S33-S39-S47 and MAAP-L100.

TABLE-US-00018 TABLE 18 rAAV vg titers R2C1-MAAP- R2C1-MAAP- R2C2-MAAP- R2C2- at 72 hpt R2C1 S33-S39-S47 S100 stop pDG2 R2C2 S33-S39-S47 MAAP-L100 mean (vg.mL.sup.−1) 8.85 × 10.sup.10 5.33 × 10.sup.11 6.61 × 10.sup.11 1.86 × 10.sup.11 2.38 × 10.sup.11 5.48 × 10.sup.11 8.12 × 10.sup.11 Fold difference vs R2CX — 6.02 7.47 0.78 — 2.30 3.41 N 2 2 2 6 6 6 6 rAAV vg titers R2C5-MAAP R2C6-MAAP- R2C6- at 72 hpt pDP5rs R2C5 S59-S65-S71 pDP6 R2C6 S33-S39-S47 MAAP- S100 mean (vg.mL.sup.−1) 1.95 × 10.sup.11 8.43 × 10.sup.11 7.37 × 10.sup.11 2.49 × 10.sup.11 1.01 × 10.sup.11 6.58 × 10.sup.11 8.29 × 10.sup.11 Fold difference vs R2CX 0.23 — 0.87 2.46 — 6.51 8.20 N 6 6 6 6 8 8 8 rAAV vg titers R2C8-MAAP- R2C8-MAAP- R2C9-MAAP- R2C9-MAAP at 72 hpt pDP8.ape R2C8 S33-S39-S47 S100 stop R2C9 S33-S39-S47 L100 stop mean (vg.mL.sup.−1) 2.59 × 10.sup.11 3.28 × 10.sup.11 1.18 × 10.sup.12 8.18 × 10.sup.11 3.59 × 10.sup.11 4.33 × 10.sup.11 6.73 × 10.sup.11 Fold difference vs R2CX 0.79 — 3.60 2.49 — 1.21 1.87 N 5 7 7 2 2 2 2

[0289] Table 19 shows the mean of capsids containing rAAV genome measured for each virus produced at 72 hpt, the fold difference in respect to rAAV of same capsid serotype but encoding wt-MAAP or MAAP variants, and the amount of technical replicates (N) assessed in the study. Samples from left to right are. rAAV2-mSeAP, produced using pDG2 (Plasmid Factory), 3-plasmid system, using Rep2-Cap2 plasmid encoding wt-MAAP; MAAP-S33-S39-S47; and MAAP-L100. rAAV6-mSeAP, produced using pDP6 (Plasmid Factory), 3-plasmid system, using Rep2-Cap6 plasmid encoding wt-MAAP; MAAP-S33-S39-S47; and MAAP-S100. rAAV5-mSeAP, produced using pDP5rs (Plasmid Factory), 3-plasmid system, using Rep2-Cap5 plasmid encoding wt-MAAP; and MAAP-S59-S65-S71. rAAV8-mSeAP, produced using pDP8.ape (Plasmid Factory), 3-plasmid system, using Rep2-Cap8 plasmid encoding wt-MAAP; MAAP-S33-S39-S47.

TABLE-US-00019 TABLE 19 Capsids containing rAAV R2C2-MAAP- R2C2-MAAP- R2C5-MAAP genomes at 72 hpt (%) pDG2 R2C2 S33-S39-S47 L100 pDP5rs R2C5 S59-S65-S71 Mean % 36.60 44.48 47.62  42.46 105.38 68.79 65.68 Fold difference vs R2CX  0.82 —  1.07  0.95  1.53 —  0.95 N  2  2  2  2  3  3  3 Capsids containing rAAV R2C6-MAAP- R2C6- R2C8-MAAP- genomes at 72 hpt (%) pDP6 R2C6 S33-S39-S47 MAAP-S100 pDP8.ape R2C8 S33-S39-S47 Mean % 72.11 67.30 95.92 118.37  50.04 71.54 69.00 Fold difference vs R2CX  1.07 —  1.43  1.76  0.70 —  0.96 N  2  2  2  2  2  2  2

[0290] Table 20 shows the mean percentage of secreted rAAV particles measured for each virus produced at 72 hpt, the fold difference in respect to rAAV of same serotype but produced with wt-MAAP or the MAAP variants, and the amount of technical replicates (N) assessed in the study. Samples from left to right are: rAAV1-mSeAP, produced with 3-plasmid system, using Rep2-Cap1 plasmid encoding wt-MAAP; MAAP-S33-S39-S47; and MAAP-S100. rAAV2-mSeAP, produced using pDG2 (Plasmid Factory), 3-plasmid system, using Rep2-Cap2 plasmid encoding wt-MAAP; MAAP-S33-S39-S47; and MAAP-L100. rAAV5-mSeAP, produced using pDP5rs (Plasmid Factory), 3-plasmid system, using Rep2-Cap5 plasmid encoding wt-MAAP; and MAAP-S59-S65-S71. rAAV6-mSeAP, produced using pDP6 (Plasmid Factory), 3-plasmid system, using Rep2-Cap6 plasmid encoding wt-MAAP; MAAP-S33-S39-S47; and MAAP-S100. rAAV8-mSeAP, produced using pDP8.ape (Plasmid Factory), 3-plasmid system, using Rep2-Cap8 plasmid encoding wt-MAAP; MAAP-S33-S39-S47 and MAAP-S100. rAAV9-mSeAP produced with 3-plasmid system, using Rep2-Cap9 plasmid encoding wt-MAAP; MAAP-S33-S39-S47 and MAAP-L100.

TABLE-US-00020 TABLE 20 Viral particles secreted R2C1-MAAP- R2C1-MAAP- R2C2-MAAP- R2C2-MAAP to media at 72 hpt (%) R2C1 S33-S39-S47 S100 stop PDG2 R2C2 S33-S39-S47 L100 Mean % 84.51 10.45  8.39 14.56 19.08  9.00 4.51 Fold difference vs R2CX —  0.12  0.10  0.76 —  0.47 0.24 N  2  2  2  3  3  3 3 Viral particles secreted R2C5-MAAP- R2C6-MAAP- R2C6-MAAP to media at 72 hpt (%) pDP5rs R2C5 S59-S65-S71 pDP6 R2C6 S33-S39-S47 S100 Mean %  8.88 17.13 12.33 38.97 49.14  7.15 5.49 Fold difference vs R2CX  0.52 —  0.72  0.79 —  0.15 0.11 N  3  3  3  3  5  5 5 Viral particles secreted to R2C8-MAAP- R2C8-MAAP- R2C9-MAAP- R2C9-MAAP- media at 72 hpt (%) pDP8.ape R2C8 S33-S39-S47 S100 stop R2C9 S33-S39-S47 L100 stop Mean % 39.81 60.38 11.33  7.55 37.79 18.42 8.93 Fold difference vs R2CX  0.66 —  0.19  0.13 —  0.49 0.24 N  3  5  5  2  2  2 2

[0291] Conclusions

[0292] Gene therapy requires typically large vector doses. We present in this work the use of two MAAP variants that improve the rAAV productivity of AAV. The quality, based on the higher level of capsids containing the rAAV genome, was improved for at least rAAV6, which could improve the manufacturing capabilities of rAAV vectors. One major interest in the use of MAAP variants to improve rAAV productivity and quality is that those mutations can be implemented in the cap gene without modifying the VP amino acid sequence and the rAAV capsid properties.

[0293] Based on Example 1, we observed that two MAAP variants presented particularly desirable properties for the production of the virus. Introducing early stop codons in the MAAP ORF, at position MAAP-L100 or MAAP-S33-S39-S47, without changing the VPs amino acid sequence led to reduced capsid degradation, improved AAV2 productivity, and improved ratio of capsids containing the wt-AAV2 genome in comparison to total capsids. Although our focus was on those two particular mutants, several others led to similar improvement of productivity and quality of AAV2 and could be implemented for rAAV vectors production for almost all AAV serotypes, again without modifying the VP1 amino acid sequence, if desired.

[0294] This example focused on rAAV1, 2, 5, 6, 8 and 9, and for all of them, beside the serotype 5, the MAAP mutants improved the productivity of the serotypes. When AAV serotypes are classified based on MAAP phylogeny, AAV5 is isolated as the unique representative of his own branch. AAV 1, 6, 8 and 9 are grouped in clade A with the non-human primate AAVs and clade B groups includes AAV2 and other serotypes identified from human samples. Thus, AAV serotypes for which the MAAP is classified as a member of clade A and B would demonstrate higher titer productivity levels when MAAP variants are introduced in the cap gene. Besides allowing the maximum level of productivity to reach a range of 10.sup.12 vg.Math.mL.sup.−1 when MAAP variants are used to produce rAAVs, another interesting property with the use of MAAP variants is the modification of the distribution profile of the rAAVs in the cell culture media or within the cells. For all the MAAP variants used to produce the different rAAV serotypes, we observed that the rAAV remained almost exclusively within the cells. This property of MAAP variants can be applied to AAV manufacturing and purification. Indeed AAV can be harvested only from the cells, if desired, and not from a combination of cells plus cell culture media. Processing only the cells for the purification of rAAV is associated with reduced manufacturing (purification) costs as lower volumes are processed. This saves costs in the use of regents such as DNase, allows cell lysis for vector harvest in defined buffers compared to cell culture media and uses lower liquid solution volumes. Lastly, the use of MAAP variants improves the levels of rAAV capsids containing the genome of interest, as seen particularly for rAAV6. This could lead to improve rAAV safety profiles by reducing the levels of empty capsids and capsids not containing the recombinant genome of interest. This could also reduce some purification steps in downstream processes as additional separation steps of the capsids containing the genome of interest with other capsids could become unnecessary.

[0295] Based on the DNA sequence of the cap gene in the region encoding the MAAP ORF, out of the 87 AAV serotypes we studied, all could produce the MAAP-triple stops and MAAP-L/S-100 mutations, without modifying the VP protein sequence. Thus, it is believed that the examples herein are applicable to all AAV serotypes.

REFERENCES EXAMPLE 2

[0296] 1. Atchison, R. W., Casto, B. C. & Hammon, W. M. D. Adenovirus-Associated Virus.

[0297] Science (80-.). 149, 754-755 (1965). [0298] 2. Ogden, P. J., Kelsic, E. D., Sinai, S. & Church, G. M. Comprehensive AAV capsid fitness landscape reveals a viral gene and enables machine-guided design. Science (80). 366, 1139-1143 (2019). [0299] 3. Gao, G. et al. Clades of Adeno-Associated Viruses Are Widely Disseminated in Human Tissues. J. Virol. 78, 6381-6388 (2004). [0300] 4. Corpet, F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 16, 10881-90 (1988). [0301] 5. Girod, A. et al. The VP1 capsid protein of adeno-associated virus type 2 is carrying a phospholipase A2 domain required for virus infectivity. J. Gen. Virol. 83, 973-978(2002). [0302] 6. Huerta-Cepas, J., Serra, F. & Bork, P. ETE 3: Reconstruction, Analysis, and Visualization of Phylogenomic Data. Mol. Biol. Evol. (2016). doi:10.1093/molbev/msw046 [0303] 7. Katoh, K. & Standley, D. M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. (2013). doi:10.1093/molbev/mst010 [0304] 8. Price, M. N., Dehal, P. S. & Arkin, A. P. Fasttree: Computing large minimum evolution trees with profiles instead of a distance matrix. Mol. Biol. Evol. (2009). doi:10.1093/molbev/msp077 [0305] 9. Letunic, I. & Bork, P. Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Res. (2021). doi:10.1093/nar/gkab301