NOVEL CORONAVIRUS RBD SPECIFIC MONOCLONAL ANTIBODY AND LINEAR EPITOPE AND APPLICATION THEREOF

Abstract

The present disclosure belongs to the field of immune technology, and particularly discloses a SARS-CoV-2 RBD-specific monoclonal antibody including a heavy chain having an amino acid sequence set forth in SEQ ID NO: 1 and a light chain having an amino acid sequence set forth in SEQ ID NO: 2. The present disclosure further discloses a linear epitope of the SARS-CoV-2 RBD-specific monoclonal antibody having an amino acid sequence set forth in SEQ ID NO: 3. The SARS-CoV-2 RBD-specific monoclonal antibody and the linear epitope thereof of the present disclosure are critical for research and development of vaccines and micromolecule drugs, diagnosis, prevention and treatment of COVID-19.

Claims

1. A SARS-CoV-2 RBD-specific monoclonal antibody, comprising a heavy chain having an amino acid sequence set forth in SEQ ID NO: 1 and a light chain having an amino acid sequence set forth in SEQ ID NO: 2.

2. The SARS-CoV-2 RBD-specific monoclonal antibody according to claim 1, wherein the SARS-CoV-2 RBD-specific monoclonal antibody is obtained by sorting RBD-specific memory B cells and then acquiring antibody variable region cDNA from mRNA of the RBD-specific memory B cells.

3. The SARS-CoV-2 RBD-specific monoclonal antibody according to claim 1, wherein the SARS-CoV-2 RBD-specific monoclonal antibody is for preparing a reagent or a medicament for detecting or diagnosing SARS-CoV-2.

4. (canceled)

5. (canceled)

6. The SARS-CoV-2 RBD-specific monoclonal antibody according to claim 1, wherein the SARS-CoV-2 RBD-specific monoclonal antibody is used for any of the following (b1)-(b4): (b1) binding to SARS-CoV-2; (b2) detecting SARS-CoV-2; (b3) binding to a SARS-CoV-2 S protein; and (b4) detecting the SARS-CoV-2 S protein.

7. The SARS-CoV-2 RBD-specific monoclonal antibody according to claim 1, wherein the SARS-CoV-2 RBD-specific monoclonal antibody comprises a linear epitope having an amino acid sequence set forth in SEQ ID NO: 3.

8. The SARS-CoV-2 RBD-specific monoclonal antibody according to claim 6, wherein the linear epitope is obtained by: denaturing SARS-CoV-2 S protein or SARS-CoV-2 RBD protein; binding the SARS-CoV-2 RBD-specific monoclonal antibody to the SARS-CoV-2 S protein or the SARS-CoV-2 RBD protein after denaturation; and performing antigenic linear epitope section synthesizing of the S protein or the RBD protein to obtain the linear epitope.

9. (canceled)

10. (canceled)

11. The SARS-CoV-2 RBD-specific monoclonal antibody according to claim 1, wherein the SARS-CoV-2 RBD-specific monoclonal antibody is for preparing a reagent or a medicament for detecting or diagnosing SARS-CoV-2.

12. The SARS-CoV-2 RBD-specific monoclonal antibody according to claim 11, wherein the medicament comprises the SARS-CoV-2 RBD-specific monoclonal antibody and a pharmaceutically acceptable excipient, diluent or carrier.

13. The SARS-CoV-2 RBD-specific monoclonal antibody according to claim 2, wherein the SARS-CoV-2 RBD-specific monoclonal antibody is for preparing a reagent or a medicament for detecting or diagnosing SARS-CoV-2.

14. The SARS-CoV-2 RBD-specific monoclonal antibody according to claim 13, wherein the medicament comprises the SARS-CoV-2 RBD-specific monoclonal antibody and a pharmaceutically acceptable excipient, diluent or carrier.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0019] FIG. 1 shows a cell sorting diagram of analyzing RBD-specific memory B cells by a flow cytometry;

[0020] FIG. 2 shows a cell sorting diagram of analyzing RBD-specific memory B cells by a flow cytometry;

[0021] FIG. 3 shows an electropherogram of single-cell antibody gene PCR products, where 1-24, 25-48 and 49-72 represent well numbers of electrophoresis;

[0022] FIG. 4 shows a agarose gel electropherogram of an antibody gene expression cassette containing CMV promoters, WPRE-gamma or WPRE-kappa elements after PCR amplification;

[0023] FIG. 5 shows RBD-specific assay results of CQTS126;

[0024] FIG. 6 shows ELISA results for binding of the SARS-CoV-2 RBD-specific monoclonal antibody to SEQ ID NO: 3;

[0025] FIG. 7 shows results of Experiment I in which SEQ ID NO: 3 is bound in the plasma of patients but not in that of healthy subjects;

[0026] FIG. 8 shows results of Experiment II in which SEQ ID NO: 3 is bound to a RBD receptor ACE2.

DETAILED DESCRIPTION

[0027] The present disclosure is further detailed by way of specific embodiments:

Example 1

[0028] This example provides a SARS-CoV-2 RBD-specific monoclonal antibody (mAb 1-CQTS126) comprising a heavy chain amino acid sequence set forth in SEQ ID NO: 1 and a light chain amino acid sequence set forth in SEQ ID NO: 2.

[0029] This example further provides use of the SARS-CoV-2 RBD-specific monoclonal antibody in preparing a reagent or a medicament for detecting or diagnosing SARS-CoV-2.

[0030] In practical manufacturing, the SARS-CoV-2 RBD-specific monoclonal antibody obtained in this example can be used to prepare a nucleic acid molecule, prepare an expression cassette, a recombinant vector, a recombinant bacterium or a transgenic cell line comprising the nucleic acid molecule, or prepare a pharmaceutical composition comprising the SARS-CoV-2 RBD-specific monoclonal antibody and a pharmaceutically acceptable excipient, diluent or carrier.

[0031] In application, the SARS-CoV-2 RBD-specific monoclonal antibody obtained in this example can be used to prepare a product that may possess use for any of the following (b1)-(b4): (b1) binding to SARS-CoV-2; (b2) detecting SARS-CoV-2; (b3) binding to a SARS-CoV-2 S protein; and (b4) detecting the SARS-CoV-2 S protein.

[0032] This example further provides a method for screening the SARS-CoV-2 RBD-specific monoclonal antibody, including: sorting a single RBD-specific memory B cell from peripheral blood of a patient who has recovered from COVID-19, acquiring mRNA of the RBD-specific memory B cell, constructing an antibody variable region gene expression cassette through RT-PCR and nested PCR, transferring the antibody variable region gene expression cassette into 293T cells to express an antibody, collecting supernatant, detecting RBD specificity of the supernatant by ELISA, and screening to obtain the RBD-specific monoclonal antibody. Specifically, the method includes following steps:

[0033] S1, peripheral blood samples of several patients who had recovered from COVID-19 were collected; PBMCs were separated and frozen in a freezer at −80° C. for later use.

[0034] S2, Dead cells of the PBMCs obtained in the S1 were removed by using a dead dye; live memory B cells with high specificity and binding capacity to RBD in the PBMCs were stained and labeled with CD19, mIg-G, mIg-D and RBD to screen out the RBD-specific memory B cells; the specific memory B cells were sorted by a flow cytometry onto 96-well plates at one specific memory B cell per well, and frozen in a freezer at −80° C. for later use.

[0035] Specifically, a concentration range of the dead dye of this example in staining is preferably 1-2 μg/mL, more preferably 1.5 μg/mL; CD19 is a B cell marker supplied by Biolegend, and a concentration range in staining is 1-2 μg/mL, preferably 1.5 μg/mL in this example. mIg-G is a B cell surface receptor supplied by Biolegend, and the concentration range in staining is 1-2 μg/mL, preferably 1.5 μg/mL in this example; mIg-D is a B cell surface receptor supplied by Biolegend, and a concentration range in staining is 1-2 μg/mL, preferably 1.5 μg/mL in this example; RBD is a SARS-CoV-2 receptor-binding domain supplied by Sino Biological, and a concentration range in staining is 1-2 μg/mL, preferably 1.5 μg/mL in this example.

[0036] The RBD-specific memory B cells were sorted by the flow cytometry. Cells in the PBMCs were sorted using CD19, mIg-G, mIg-D and S-RBD to obtain memory B cells specific for RBD, as shown in FIGS. 1 and 2. Batch IDs 0428, 0505, 0522 and 0528 in FIG. 2 were selected batches. The rationale of screening RBD-specific memory B cells using CD19, mIg-G, mIg-D and S-RBD in this example is as follows: the PBMCs were stained with the dead dye to remove dead cells, and live memory B cells expressing RBD-specific IgG in the PBMCs were stained and labled with a B cell marker CD19 and a memory B cell markers mIg-G (positive) and a mIg-D (negative). CD19 cell population was separated by the flow cytometry; mIg-G.sup.+mIg-D.sup.− cell population was separated from the CD19 positive cell population; RBD positive memory B cells were separated from the mIg-G.sup.+mIg-D.sup.− cell population, and sorted by a flow cytometric sorter.

[0037] S3, the mRNA of a single RBD-specific memory B cell was collected, and the antibody variable region cDNA was obtained by RT-PCR amplification. Specifically, when the antibody variable region cDNA was subjected to the RT-PCR amplification, primers designed in this example efficiently facilitate amplification of an antibody gene sequence. Results are shown in FIG. 3.

[0038] S4, the antibody variable region cDNA obtained in S1-S3 was amplified by nested PCR to construct an antibody variable region gene expression cassette.

[0039] S3 and S4 were performed by following eight procedures: (1) freezing/thawing and lysis of cells; (2) preparation of related primers; (3) single-cell mRNA reverse transcription (RT); (4) a 1st PCR; (5) a 2nd PCR; (6) BCR-ORF PCR amplification for constructing a gene expression cassette; (7) CMV and WPRE-γ/κ/1 fragment amplification and CMV, BCR-Vγ/κ/1 (a product of (6)) and WPRE-γ/κ/1 overlapping PCR pre-ligation; and (8) BCR-γ ORF, BCR-κ ORF and BCR-1 PCR amplification.

[0040] Operations, preparation of reaction solutions and reaction conditions are as follows: [0041] (1) After flow cytometric sorting, the cells were stored in a freezer at −80° C.; before RT-PCR, the cells were thawed to a room temperature, centrifuged at 300 g for 5 min, and kept in an ice bath for later use. [0042] (2) Preparation of related primers (for primer sequences, see Table 9. Primer sequence listing)

[0043] Preparation of BCR_RT_Primer_Mix (each 2 μM): G289_primer (10 μM), K244_primer (10 μM) and L81 primer (10 μM), each of 100 μL, were taken and mixed in a ratio of 1:1:1.

[0044] Preparation of AP_Leader_Mix (each 2 μM): AP_G_Leader_Mix: 380 μL of water was added into a 1.5-mL centrifuge tube, 31 GV_N primers (each of 20 μL) were taken, with a final volume of 1000 μL; AP_K_Leader_Mix: 620 μL of water was added into a 1.5-mL centrifuge tube, 19 KV_N primers (each of 20 μL) were taken, with a final volume of 1000 μL; AP_L_Leader_Mix: 580 μL of water was added into a 1.5-mL centrifuge tube, 21 LV_N primers (each of 20 μL) were taken, with a final volume of 1000 μL;

[0045] Preparation of IGHJ_region_Primer_Mix: 920 μL of water was added into a 1.5-mL centrifuge tube, 4 IGHJ_N primers (each of 20 μL) were taken, with a final volume of 1000 μL;

[0046] Preparation of K194_Primer_Mix: 2 primers (K194-primer-01 (10 μM) and K194-primer-02 (10 μM)) were taken, each of 100 μL, and mixed;

[0047] Preparation of L19_Primer_Mix: 3 primers (L19-primer-01 (10 μM), L19-primer-02 (10 μM) and L19-primer-03 (10 μM)) were taken, each of 100 μL, and mixed. [0048] (3) Reverse transcription (RT) (a 10-μL system): reagents required for the preparation are shown in Table 1 below.

TABLE-US-00001 TABLE 1 Experimental system of reverse transcription Seq. Component Amount (μl) 1 Water 4.85 2 2.5 mM dNTPs 2 3 BCR_RT_Primer_Mix 0.4 4 5 × PrimeScript II Buffer 2 5 200 U/μl PrimeScript II Reverse Transcriptase 0.5 6 40,000 U/ml RNase Inhibitor, Murine (NEB) 0.25

[0049] 10 μL of the reaction solution was added to a PCR tube containing cells, mixed well, and centrifuged at 300 g for 1 min.

[0050] Reaction conditions: at 45° C. for 45 min (mixing every 20 min); at 70° C. for 15 min.

[0051] After the reaction was complete, the 96-well plate was subjected to transient centrifugation at 600×g, and 1 μL of RT product was taken as a template for the 1st PCR. [0052] (4) 1st PCR (a 10-μL system) (see a primer sequence listing for primer sequences): as shown in Table 2 below, 3 PCR systems were prepared for separate amplification of three antibody chains, respectively. The reagents and amounts added were the same except for the primers added.

TABLE-US-00002 TABLE 2 Experimental system of the 1st PCR Seq. Component Amount (μl) 1 2 × PrimeSTAR GC Buffer (Takara) 5 2 nuclease-free water 2.75 3 2.5 mM dNTP 0.8 4 10 μM Forward Primer 0.2 5 10 μM Reverse Primer 0.2 6 2.5 U/μl PrimeSTAR HS DNA polymerase 0.05 7 Template (RT product solution) 1

[0053] Primers to be added are shown in Table 3:

TABLE-US-00003 TABLE 3 Primers of the 1st PCR Antibody Antibody Antibody gamma chain kappa chain lambda chain amplification amplification amplification Forward AP_G_leader AP_K_leader AP_L_leader Primer Mix Mix Mix Reverse G289_primer(10 K244_Primer(10 L81_Primer(10 Primer μM) μM) μM)

[0054] Based on principle of PCR, experimental reaction conditions of the 1st PCR were: (1) pre-denaturation at 95° C. for 3 min; (2) denaturation at 95° C. for 10 s, annealing at 55° C. for 5 s, and extension at 72° C. for 1 min and for 30 cycles; and (3) extension for 5 min at 72° C. after the cycles, and storage at 4° C. [0055] (5) 2nd PCR (a 10-μL system) (see a primer sequence listing, Tables 8 and 9, for primer sequences): as shown in Table 4 below, 3 PCR systems were prepared for separate amplification of three antibody chains, respectively. The reagents and amounts added were the same except for the primers added.

TABLE-US-00004 TABLE 4 Experimental system of the 2nd PCR Seq. Component Amount (μl) 1 2 × PrimeSTAR GC Buffer (Takara) 5 2 nuclease-free water 2.75 3 2.5 mM dNTP 0.8 4 10 μM Forward Primer 0.2 5 10 μM Reverse Primer 0.2 6 2.5 U/μl PrimeSTAR HS DNA polymerase 0.05 7 Template (10-fold diluted product of the 1st PCR) 1

[0056] Primers to be added are shown in Table 5:

TABLE-US-00005 TABLE 5 Primers of the 2nd PCR Antibody Antibody Antibody gamma chain kappa chain lambda chain amplification amplification amplification Forward 10 μM AP_Primer 10 μM 10 μM Primer AP_Primer AP_Primer Reverse IGHJ_region_Primer 10 μM 10 μM Primer Mix K194_Primer L19_Primer Mix Mix

[0057] Based on principle of PCR, experimental reaction conditions of the 2nd PCR were: (1) pre-denaturation at 95° C. for 3 min; (2) denaturation at 95° C. for 10 s, annealing at 55° C. for 5 s, and extension at 72° C. for 45 s and for 35 cycles; and (3) extension for 5 min at 72° C. after the cycles, and storage at 4° C.

[0058] After the PCR was finished, 4 μL of each well was loaded for 1.5% agarose gel electrophoresis. Wells of the paired Gamma, Kappa or Lambda chains were sequenced. [0059] (6) Amplification and construction of an antibody expression cassette (BCR-ORF): for PCR amplification of a promoter region (CMV promoter), WPRE-γ (antibody gamma chain) and WPRE-κ (antibody kappa chain), PCR amplification systems are shown in Table 6 below.

TABLE-US-00006 TABLE 6 Amplification system CMV promoter PCR WPRE-γ PCR WPRE-κ/l PCR System system system 2xMix 25 μl 2xMix 25 μl 2xMix 25 μl H.sub.2O 22 μl H.sub.2O 22 μl H.sub.2O 22 μl CMV-FP01 1 μl CMV-FP01 1 μl CMV-FP01 1 μl CMV-RP 1 μl CMV-RP 1 μl CMV-RP 1 μl pcDNA3.4- 1 μl pcDNA3.4- 1 μl pcDNA3.4- 1 μl ScaB-IgG1 (25 ng) ScaB-IgG1 (25 ng) ScaB-Hk/HL (25 ng) Total 50 μl Total 50 μl Total 50 μl

[0060] PCR amplification conditions were: (1) pre-denaturation at 95° C. for 3 min; (2) denaturation at 95° C. for 15 s, annealing at 56° C. for 15 s, and extension at 72° C. for 1 min and for 30 cycles; and (3) extension for 5 min at 72° C. after the cycles, and storage at 12° C. [0061] (7) CMV and WPRE-γ/κ/1 fragment amplification and CMV, BCR-Vγ/κ/1 and WPRE-γ/κ/1 overlap PCR pre-ligation: experimental systems are shown in Table 7 below.

TABLE-US-00007 TABLE 7 Experimental system of amplification BCR-γ PCR system BCR-κ/l PCR system 2xMix 12.5 μl 2xMix 12.5 μl H.sub.2O 9 μl H.sub.2O 9 μl CMV 1 μl CMV 1 μl WPRE-γ 1 μl WPRE-κ/l 1 μl BCR-Vγ 1.5 μl BCR-Vκ/l 1.5 μl Total 25 μl Total 25 μl

[0062] PCR amplification conditions were: pre-denaturation at 95° C. for 3 min; denaturation at 95° C. for 15 s, annealing at 50° C. for 15 s, and extension at 72° C. for 1.5 min and for 10 cycles; and extension for 5 min at 72° C. after the cycles, and storage at 12° C.

[0063] (8) BCR-γ ORF, BCR-κ ORF and BCR-1 PCR amplification: experimental systems are shown in Table 8 below.

TABLE-US-00008 TABLE 8 Experimental system of amplification BCR-γ PCR system BCR-κ/l PCR system 2xMix 25 μl 2xMix 25 μl H.sub.2O 22.5 μl H.sub.2O 22.5 μl CMV-FP01 1 μl CMV-FP01 1 μl WPRE-RP 1 μl WPRE-RP 1 μl BCR-γ pre-ligation 0.5 μl BCR-κ/l pre-ligation 0.5 μl product product Total 50 μl Total 50 μl

[0064] PCR amplification procedures: pre-denaturation at 95° C. for 3 min; denaturation at 95° C. for 15 s, annealing at 58° C. for 15 s, and extension at 72° C. for 1.5 min, and for 30 cycles; and extension for 5 min at 72° C. after the cycles, and storage at 12° C.

[0065] After amplification, by agarose gel electrophoresis, whether the size of the obtained antibody variable region gene was correct or not was analyzed by gel imaging. The results are shown in FIG. 4, where a Marker is in a middle and a strip is at 5000 bp.

[0066] BCR-γ ORF and BCR-κ/ORF ethanol precipitation: PCR products of BCR-γ ORF and BCR-κ ORF (each of 30 μL) were added into an 8-tube strip before 120 μL of absolute ethanol and 6 μL of sodium acetate solution were added, which was uniformly stirred, standing for 30 min at −80° C. and centrifuged at 10000 rpm for 20 min. Supernatant was discarded, and the residue was sequentially washed with 200 μL of 70% ethanol and absolute ethanol once. Ethanol was evaporated at 56° C. 40 μL of sterile water was added and the mixture was shaken completely to dissolve the precipitate before the concentration of the antibody variable region gene was determined.

[0067] See Table 9 for the primer sequences.

TABLE-US-00009 TABLE 9 Primer sequence listing Primer_ V/D/J gene Name segments Primer_Sequence(5'>3') Usage description GV_01 IGHV1-18*01 CGGTACCGCGGGCCCGGGAatggactggacctggagcat AP_G_Leader_Mix (SEQ ID NO: 4) As forward primer of heavy chain 1st PCR GV_02 IGHV1-2*01 CGGTACCGCGGGCCCGGGAatggactggacctggaggat (SEQ ID NO: 5) GV_03 IGHV1-24*01 CGGTACCGCGGGCCCGGGAatggactgcacctggaggat (SEQ ID NO: 6) GV_04 IGHV1-38-4*01 CGGTACCGCGGGCCCGGGAatggactggaactggaggat (SEQ ID NO: 7) GV_05 IGHV1-45*01 CGGTACCGCGGGCCCGGGAatggactggacctggagaat (SEQ ID NO: 8) GV_06 IGHV1-46*01 CGGTACCGCGGGCCCGGGAatggactggacctggagggt (SEQ ID NO: 9) GV_07 IGHV1-58*01 CGGTACCGCGGGCCCGGGAatggactggatttggaggat (SEQ ID NO: 10) GV_08 IGHV1-69*01 CGGTACCGCGGGCCCGGGAatggactggacctggaggtt (SEQ ID NO: 11) GV_09 IGHV2-26*01 CGGTACCGCGGGCCCGGGAatggacacactttgctacac (SEQ ID NO: 12) GV_10 IGHV2-5*01 CGGTACCGCGGGCCCGGGAatggacacactttgctccac (SEQ ID NO: 13) GV_11 IGHV2-70*01 CGGTACCGCGGGCCCGGGAatggacatactttgttccac (SEQ ID NO: 14) GV_12 IGHV2/OR16- CGGTACCGCGGGCCCGGGAatggacacgttttgctccac 5*01 (SEQ ID NO: 15) GV_13 IGHV3-11*01 CGGTACCGCGGGCCCGGGAatggagtttgggctgagctg (SEQ ID NO: 16) GV_14 IGHV3-13*01 CGGTACCGCGGGCCCGGGAatggagttggggctgagctg (SEQ ID NO: 17) GV_15 IGHV3-16*01 CGGTACCGCGGGCCCGGGAatggaatttgggctgagctg (SEQ ID NO: 18) GV_16 IGHV3-21*01 CGGTACCGCGGGCCCGGGAatggaactggggctccgctg (SEQ ID NO: 19) GV_17 IGHV3-43*01 CGGTACCGCGGGCCCGGGAatggagtttggactgagctg (SEQ ID NO: 20) GV_18 IGHV3-48*01 CGGTACCGCGGGCCCGGGAatggagttggggctgtgctg (SEQ ID NO: 21) GV_19 IGHV3-49*01 CGGTACCGCGGGCCCGGGAatggagtttgggcttagctg (SEQ ID NO: 22) GV_20 IGHV3-53*01 CGGTACCGCGGGCCCGGGAatggagttttggctgagctg (SEQ ID NO: 23) GV_21 IGHV3-64*01 CGGTACCGCGGGCCCGGGAatgacggagtttgggctgag (SEQ ID NO: 24) GV_22 IGHV3-64D*06 CGGTACCGCGGGCCCGGGAatggagttctggctgagctg (SEQ ID NO: 25) GV_23 IGHV3-7*01 CGGTACCGCGGGCCCGGGAatggaattggggctgagctg (SEQ ID NO: 26) GV_24 IGHV3-9*01 CGGTACCGCGGGCCCGGGAatggagttgggactgagctg (SEQ ID NO: 27) GV_25 IGHV4-28*01 CGGTACCGCGGGCCCGGGAatgaaacacctgtggttctt (SEQ ID NO: 28) GV_26 IGHV4-38-2*02 CGGTACCGCGGGCCCGGGAatgaagcacctgtggttttt (SEQ ID NO: 29) GV_27 IGHV4-39*01 CGGTACCGCGGGCCCGGGAatgaagcacctgtggttctt (SEQ ID NO: 30) GV_28 IGHV4-59*01 CGGTACCGCGGGCCCGGGAatgaaacatctgtggttctt (SEQ ID NO: 31) GV_29 IGHV5-10-1*02 CGGTACCGCGGGCCCGGGAatgcaagtgggggcctctcc (SEQ ID NO: 32) GV_30 IGHV5-51*01 CGGTACCGCGGGCCCGGGAatggggtcaaccgccatcct (SEQ ID NO: 33) GV_31 IGHV6-1*01 CGGTACCGCGGGCCCGGGAatgtctgtctccttcctcat (SEQ ID NO: 34) KV_01 IGKV1/OR2- CGGTACCGCGGGCCCGGGAatgagggcccccactcagct AP_K_Leader_Mix 0*01 (SEQ ID NO: 35) As forward primer of kappa light chain 1st PCR KV_02 IGKV1/OR2- CGGTACCGCGGGCCCGGGAatggaaatgagggtccccgc 108*01 (SEQ ID NO: 36) KV_03 IGKV1-16*01 CGGTACCGCGGGCCCGGGAatggacatgagagtcctcgc (SEQ ID NO: 37) KV_04 IGKV1-27*01 CGGTACCGCGGGCCCGGGAatggacatgagggtccctgc (SEQ ID NO: 38) KV_05 IGKV1-5*01 CGGTACCGCGGGCCCGGGAatggacatgagggtccccgc (SEQ ID NO: 39) KV_06 IGKV1-8*01 CGGTACCGCGGGCCCGGGAatgagggtccccgctcagct (SEQ ID NO: 40) KV_07 IGKV1D-16*01 CGGTACCGCGGGCCCGGGAatggacatgagggtcctcgc (SEQ ID NO: 41) KV_08 IGKV1D-43*01 CGGTACCGCGGGCCCGGGAatggacatgagggtgcccgc (SEQ ID NO: 42) KV_09 IGKV2-24*01 CGGTACCGCGGGCCCGGGAatgaggctccttgctcagct (SEQ ID NO: 43) KV_10 IGKV2-28*01 CGGTACCGCGGGCCCGGGAatgaggctccctgctcagct (SEQ ID NO: 44) KV_11 IGKV3/OR2- CGGTACCGCGGGCCCGGGAatggaagccccagcacagct 268*01 (SEQ ID NO: 45) KV_12 IGKV3-15*01 CGGTACCGCGGGCCCGGGAatggaagccccagcgcagct (SEQ ID NO: 46) KV_13 IGKV3-20*01 CGGTACCGCGGGCCCGGGAatggaaaccccagcgcagct (SEQ ID NO: 47) KV_14 IGKV3-7*01 CGGTACCGCGGGCCCGGGAatggaagccccagctcagct (SEQ ID NO: 48) KV_15 IGKV3D-7*01 CGGTACCGCGGGCCCGGGAatggaaccatggaagcccca (SEQ ID NO: 49) KV_16 IGKV4-1*01 CGGTACCGCGGGCCCGGGAatggtgttgcagacccaggt (SEQ ID NO: 50) KV_17 IGKV5-2*01 CGGTACCGCGGGCCCGGGAatggggtcccaggttcacct (SEQ ID NO: 51) KV_18 IGKV6-21*01 CGGTACCGCGGGCCCGGGAatgttgccatcacaactcat (SEQ ID NO: 52) KV_19 IGKV6D-41*01 CGGTACCGCGGGCCCGGGAatggtgtccccgttgcaatt (SEQ ID NO: 53) LV_01 IGLV1-40*01 CGGTACCGCGGGCCCGGGAatggcctggtctcctctcct AP_L_Leader_Mix (SEQ ID NO: 54) As forward primer of lambda light chain 1st PCR LV_02 IGLV1-41*01 CGGTACCGCGGGCCCGGGAatgacctgctcccctetcct (SEQ ID NO: 55) LV_03 IGLV1-47*02 CGGTACCGCGGGCCCGGGAatggccggcttccctctcct (SEQ ID NO: 56) LV_04 IGLV10-54*02 CGGTACCGCGGGCCCGGGAatgccctgggctctgctcct (SEQ ID NO: 57) LV_05 IGLV11-55*01 CGGTACCGCGGGCCCGGGAatggccctgactcctctcct (SEQ ID NO: 58) LV_06 IGLV2-8*02 CGGTACCGCGGGCCCGGGAatggcctgggctctgctgct (SEQ ID NO: 59) LV_07 IGLV3-1*01 CGGTACCGCGGGCCCGGGAatggcatggatccctctctt (SEQ ID NO: 60) LV_08 IGLV3-10*02 CGGTACCGCGGGCCCGGGAatggcctggacccctctcct (SEQ ID NO: 61) LV_09 IGLV3-19*01 CGGTACCGCGGGCCCGGGAatggcctggacccctctctg (SEQ ID NO: 62) LV_10 IGLV3-21*01 CGGTACCGCGGGCCCGGGAatggcctggaccgttctcct (SEQ ID NO: 63) LV_11 IGLV3-25*02 CGGTACCGCGGGCCCGGGAatggcctggatccctctact (SEQ ID NO: 64) LV_12 IGLV3-27*01 CGGTACCGCGGGCCCGGGAatggcctggatccctctcct (SEQ ID NO: 65) LV_13 IGLV3-9*02 CGGTACCGCGGGCCCGGGAatggcctggaccgctctcct (SEQ ID NO: 66) LV_14 IGLV4-3*01 CGGTACCGCGGGCCCGGGAatggcctgggtctccttcta (SEQ ID NO: 67) LV_15 IGLV4-60*02 CGGTACCGCGGGCCCGGGAatggcctggaccccactcct (SEQ ID NO: 68) LV_16 IGLV5-39*02 CGGTACCGCGGGCCCGGGAatggcctggactcctctcct (SEQ ID NO: 69) LV_17 IGLV6-57*02 CGGTACCGCGGGCCCGGGAatggcctgggctccactact (SEQ ID NO: 70) LV_18 IGLV7-43*01 CGGTACCGCGGGCCCGGGAatggcctggactcctctctt (SEQ ID NO: 71) LV_19 IGLV8-61*02 CGGTACCGCGGGCCCGGGAatggcctggatgatgcttct (SEQ ID NO: 72) LV_20 IGLV8/OR8- CGGTACCGCGGGCCCGGGAatggcctgcatgatgcttct 1*02 (SEQ ID NO: 73) LV_21 IGLV9-49*02 CGGTACCGCGGGCCCGGGAatggcctgggctcctctgct (SEQ ID NO: 74) IGHJ_01 IGHJ1*01 GATGGGCCCTTGGTGGAGGGTGAGGAGACGGTGA IGHJ_region_ CCAGGG(SEQ ID NO: 75) Primer_Mix IGHJ_02 IGHJ2*01 GATGGGCCCTTGGTGGAGGGTGAGGAGACAGTGA CCAGGG(SEQ ID NO: 76) IGHJ_03 IGHJ3*01 GATGGGCCCTTGGTGGAGGGTGAAGAGACGGTGA CCATTG(SEQ ID NO: 77) IGHJ_04 IGHJ6*01 GATGGGCCCTTGGTGGAGGGTGAGGAGACGGTGA CCGTGG(SEQ ID NO: 78) IGKJ_01 IGKJ1*01 GATGGTGCAGCCACAGTTCGTTTGATTTCCACCTTG IGKJ_region_ GTCC(SEQ ID NO: 79) Primer_Mix IGKJ_02 IGKJ2*01 GATGGTGCAGCCACAGTTCGTTTGATCTCCAGCTTG GTCC(SEQ ID NO: 80) IGKJ_03 IGKJ3*01 GATGGTGCAGCCACAGTTCGTTTGATATCCACTTTG GTCC(SEQ ID NO: 81) IGKJ_04 IGKJ4*01 GATGGTGCAGCCACAGTTCGTTTGATCTCCACCTTG GTCC(SEQ ID NO: 82) IGKJ_05 IGKJ5*01 GATGGTGCAGCCACAGTTCGTTTAATCTCCAGTCGT GTCC(SEQ ID NO: 83) IGLJ_01 IGLJ1*01 GGGGCAGCCTTGGGCTGACCTAGGACGGTGACCTT IGLJ_region_ GGTCC(SEQ ID NO: 84) Primer_Mix IGLJ_02 IGLJ2*01 GGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTT GGTCC(SEQ ID NO: 85) IGLJ_03 IGLJ4*01 GGGGCAGCCTTGGGCTGACCTAAAATGATCAGCTG GGTTC(SEQ ID NO: 86) IGLJ_04 IGLJ5*01 GGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTC GGTCC(SEQ ID NO: 87) IGLJ_05 IGLJ5*02 GGGGCAGCCTTGGGCTGACCTAGGACGGTCAGCTC CGTCC(SEQ ID NO: 88) IGLJ_06 IGLJ6*01 GGGGCAGCCTTGGGCTGACCGAGGACGGTCACCTT GGTGC(SEQ ID NO: 89) IGLJ_07 IGLJ7*01 GGGGCAGCCTTGGGCTGACCGAGGACGGTCAGCT GGGTGC(SEQ ID NO: 90) IGLJ_08 IGLJ7*02 GGGGCAGCCTTGGGCTGACCGAGGGCGGTCAGCT GGGTGC(SEQ ID NO: 91) G289-primer N.D. TCTTGTCCACCTTGGTGTTGCT As reverse primer (SEQ ID NO: 92) of heavy chain RT & 1st PCR G97-primer N.D. AGTAGTCCTTGACCAGGCAGCCCAG As reverse primer (SEQ ID NO: 93) of heavy chain 2nd PCR K244-primer N.D. GTTTCTCGTAGTCTGCTTTGCTCA As reverse primer (SEQ ID NO: 94) of kappa light chain RT & 1st PCR K194-primer- N.D. GTGCTGTCCTTGCTGTCCTGCT As reverse primer 01 (SEQ ID NO: 95) of kappa light chain 2nd PCR K194-primer- N.D. GTGCTGTCCTTGCTCTCCTGCT 02 (SEQ ID NO: 96) L81-primer N.D. CACCAGTGTGGCCTTGTTGGCTTG As reverse primer (SEQ ID NO: 97) of lambda light chain RT & 1st PCR L19-primer- N.D. GGGCGGGAACAGAGTGACC As reverse primer 01 (SEQ ID NO: 98) of lambda light chain 2nd PCR L19-primer- N.D. GGGCGGGAACAGAGTGACA 02 (SEQ ID NO: 99) L19-primer- N.D. GGGTGGGAACAGAGTGACC 03 (SEQ ID NO: 100) AP3 N.D. CGGTACCGCGGGCCCGGGA As forward primer (SEQ ID NO: 101) of 2nd PCR G20FP N.D. CCCTCCACCAAGGGCCCATC Construction of the (SEQ ID NO: 102) linear antibody expression cassettes

[0068] S5, the antibody variable region gene expression cassette obtained in S4 was transfected into 293T cells for antibody expression in 48 h; supernatant was collected, and the RBD specificity was determined by ELISA to select full human monoclonal antibodies of RBD specificity.

[0069] (A) The antigen was diluted with PBS to a final concentration of 2 μg/mL, and a 384-well ELISA plate was coated at 10 μL/well overnight at 4° C. or for 2 h at 37° C. (overnight at 4° C. is preferred in this example). NOTE: After the addition, the plate was subjected to transient centrifugation to ensure that the liquid was at bottom.

[0070] An experimental system is shown in Table 10 below:

TABLE-US-00010 TABLE 10 Experimental system of coating Original Final Dilution Reagent Catalog No. concentration concentration factor SARS-COV-2 Cat: 40592- 200 μg/mL 2 μg/mL 1:100 RBD V08H Goat pab to Cat: ab97221 1 mg/mL 2 μg/mL 1:500 Hu IgG-ALP

[0071] (B) Preparation of PBST (0.05% of Tween 20, Cat. No. TB220): 0.5 mL of Tween 20 was added for 1 L of PBS;

[0072] The plate was washed with PBST in a Thermo Scientific Wellwash Versa microplate washer or manually (the machine-washed plate was also manually clapped/centrifuged for 1 min on a microplate centrifuge (MPC-P25) until no water or bubbles were found on the plate).

[0073] Blocking: 80 μL of 5% BSA (BioFroxx, Cat. No. 4240GR100) in PBST were added to the washed plate and incubated for 1 h at 37° C. in an incubator. The plate was washed with PBST by machine or manually.

[0074] (C) Adding samples and standards. Standard: 10 μL/well, serially diluted from an original concentration of 1 μg/mL to 250 ng/mL, 125 ng/mL, 62.5 ng/mL, 31.25 ng/mL, 15.63 ng/mL, 7.81 ng/mL, 3.9 ng/mL and 1.95 ng/mL. Blocking solution; Sample: supernatant of cells transfected with antibody gene. Negative control/blank control: blocking solution, at 10 μL/well.

[0075] The plate was incubated at 37° C. for 30 min, and washed with PBST by machine or manually.

[0076] (D) Adding secondary antibody: at a concentration of 10 μL/well, followed by incubation at 37° C. for 30 min. An experimental system is shown in Table 11 below:

TABLE-US-00011 TABLE 11 Experimental system of secondary antibody Name of Secondary Catalog Original Final Dilution antibody No. concentration concentration factor goat-anti-human A18808 1.5 mg/ml  0.3 μg/ml 1:5000 IgG-ALP Goat pab to Hu Ab98532 0.5 mg/ml 0.25 μg/ml 1:2000 IgG-ALP

[0077] The plate was washed with PBST by machine or manually. PNPP (disodium p-nitrophenyl phosphate) was added at 10 μL/well and the OD (450 nm) values were measured using a Thermo Scientific Muttiskan GO system at 5 min, 10 min, 15 min, 20 min, 25 min, 30 min, 35 min, 40 min, 45 min, 50 min, 55 min and 60 min. 50 mg of PNPP powder (Thermo, Prod. No. 34045) and 40 mL of ddH2O and 10 mL of diethanol amine substrate buffer (5x). PNPP was stored away from light at 4° C.

[0078] As shown in FIG. 5, CQTS126 is a desired monoclonal antibody. Samples with an OD value of 0.1 or higher are positive.

Example 2

[0079] This example provides a linear epitope of the SARS-CoV-2 RBD-specific monoclonal antibody having an amino acid sequence set forth in SEQ ID NO: 3.

[0080] This example further provides use of the linear epitope of the SARS-CoV-2 RBD-specific monoclonal antibody in preparing a nucleic acid, a recombinant vector, a host cell, a composition, a vaccine, test paper, a test reagent or a monoclonal antibody.

[0081] This example further provides a method for screening the linear epitope of the SARS-CoV-2 RBD-specific monoclonal antibody. At present, many documents have reported that the key amino acids or amino acid sites for the spatial structure of the SARS-CoV-2 S protein, RBD protein, and antibodies and receptor ACE2 of the proteins can be analyzed through the structure, but only a few are about the linear epitope of SARS-CoV-2. For example, “Mining of epitopes on spike protein of SARS-CoV-2 from COVID-19 patients” (Cell Research (2020) 0:1-3; https://doi org/10.1038/s41422-020-0366-x) reports the prediction of epitopes in S protein through softwares and the analysis using the blood of COVID-19 patients in convalescence, but not monoclonal antibody verification. In this example, a different method for designing epitopes was used, and a different linear epitope from known ones was found. In this experiment, SARS-CoV-2 S protein or SARS-CoV-2 RBD protein was denatured; the SARS-CoV-2 RBD-specific monoclonal antibody was bound to the S protein or the RBD protein after denaturation; an antigenic linear epitope section of the S protein or the RBD protein was then synthesized to give the linear epitope. The experiment specifically comprises the following steps: [0082] 1. Linear epitopes were designed and synthesized; [0083] 2. Antibody binding capacity of the linear epitopes was detected by an ELISA method to screen the linear epitopes. Specific principle is as follows: if the epitope of the antibody is a steric epitope, stereo conformation may be destroyed by treatment with SDS, mercaptoethanol, DTT, etc., and cannot be identified by the antibody. If the epitope is a linear epitope, the antibody can still bind to the epitope. [0084] (1) Consumables and reagents: streptavidin-coated plates (Thermo Fisher, P #15504); a Wash Buffer (prepared with Pierce® Protein-Free Blocking Buffers, P #37573), with 0.1% of BSA (BioFroxx, P #) added; goat F(ab′)2 anti-human IgG (Fab′)2 (alkaline phosphatase, Abcam, P #ab98532); and PNPP substrate (Thermo Fisher, P #34045). [0085] (2) A first day: the chemically synthesized RBD antigen peptide was diluted with PBS (with a final concentration of 20 μg/mL), and a 384-well ELISA plate was coated at 10 μL/well overnight at 4° C. or for 2 h at 37° C. (overnight at 4° C. is preferred in this example). NOTE: After addition, the plate was subjected to transient centrifugation.

[0086] The coated plate was High Binding, CORNING, Lot No. 20519008. [0087] (3) A second day: [0088] (a1) Preparation of PBST (0.05% of Tween 20, Cat. No. TB220): 0.5 mL of Tween 20 was added for 1 L of PBS;

[0089] The plate was washed with PBST in a Thermo Scientific Wellwash Versa microplate washer or manually (the machine-washed plate was also manually clapped/centrifuged for 1 min on a microplate centrifuge (MPC-P 25) until no water or bubbles were found on the plate); [0090] (a2) Blocking: the plate was blocked with 80 μL of 5% BSA (BioFroxx, Cat. No. 4240GR100) (PBST preparation) for 1 h at 37° C.; [0091] (a3) SARS-CoV-2 RBD-specific monoclonal antibodies were added at 10 μL/well (20 μg/mL), and the plate was washed 5 times after 1 h at the room temperature; [0092] (a4) 50 μL of goat F(ab′)2 anti-human IgG (Fab′)2 (alkaline phosphatase; Abcam, P #ab98532) was added, and the plate was incubated for 30 min at the room temperature; [0093] (a5) The plate was washed with 100 μL of wash buffer 5 times, and 50 μL of reaction substrate PNPP was added; [0094] (a6) An absorbance value (OD 405 nm) was measured.

[0095] Conclusion: as shown in FIG. 6, linear epitopes of SEQ ID NO: 3 were screened by experimental results of whether the SARS-CoV-2 RBD-specific monoclonal antibodies CQTS047, CQTS050 and CQTS126 bound to the epitope or not.

[0096] Experiment I: Linear epitope detection using serum antibody from COVID-19 patients in convalescence [0097] (1) Consumables and reagents: streptavidin-coated plates (Thermo Fisher, P #15504); a Wash Buffer (prepared with Pierce® Protein-Free Blocking Buffers, P #37573), with 0.1% of BSA (BioFroxx, P #) added; goat F(ab′)2 anti-human IgG (Fab′)2 (alkaline phosphatase, Abcam, P #ab98532); and PNPP substrate (Thermo Fisher, P #34045); [0098] (2) A first day: the chemically synthesized RBD antigen peptide was diluted with PBS (with a final concentration of 20 μg/mL), and a 384-well ELISA plate was coated at 10 μL/well overnight at 4° C. or for 2 h at 37° C. (overnight at 4° C. is preferred in this example). NOTE: After the addition, the plate was subjected to transient centrifugation.

[0099] The coated plate was High Binding, CORNING, Lot No. 20519008. [0100] (3) A second day: [0101] (a1) Preparation of PBST (0.05% Tween 20, Cat. No. TB220): 0.5 mL of Tween 20 was added for 1 L of PBS;

[0102] The plate was washed with PBST in a Thermo Scientific Wellwash Versa microplate washer or manually (the machine-washed plate was also manually clapped/centrifuged for 1 min on a microplate centrifuge (MPC-P 25) until no water or bubbles were found on the plate); [0103] (a2) Blocking: the plate was blocked with 80 μL of 5% BSA (BioFroxx, Cat. No. 4240GR100) (PBST preparation) for 1 h at 37° C.; [0104] (a3) Serum of COVID-19 patients in convalescence and healthy subjects (negative control) were added at 10 μL/well (original concentration), and the plate was washed 5 times after 1 h of incubation at the room temperature; [0105] (a4) 50 μL of goat F(ab′)2 anti-human IgG (Fab′)2 (alkaline phosphatase; Abcam, P #ab98532) was added, and the plate was incubated for 30 min at the room temperature; [0106] (a5) The plate was washed with 100 μL of wash buffer 5 times, and 50 μL of reaction substrate PNPP was added; [0107] (a6) An absorbance value (OD405 nm) was measured.

[0108] Conclusion: as shown in FIG. 7, the SARS-CoV-2 linear epitope of SEQ ID NO: 3 bound to serum of patients, but not to those of healthy subjects.

[0109] Experiment II: Binding of linear epitope to ACE2 [0110] (1) A first day: ACE2 protein (purchased from Sino Biological) was diluted with PBS (with a final concentration of 2 μg/mL), and a 384-well ELISA plate was coated at 10 μL/well overnight at 4° C. or for 2 h at 37° C. (overnight at 4° C. is preferred in this example). NOTE: After the addition, the plate was subjected to transient centrifugation. [0111] (2) A second day: [0112] (a1) Preparation of PBST (0.05% Tween 20, Cat. No. TB220): 0.5 mL of Tween 20 was added for 1 L of PBS; [0113] The plate was washed with PBST in a Thermo Scientific Wellwash Versa microplate washer or manually (the machine-washed plate was also manually clapped/centrifuged for 1 min on a microplate centrifuge (MPC-P 25) until no water or bubbles were found on the plate); [0114] (a2) Blocking: the plate was blocked with 80 μL of 5% BSA (BioFroxx, Cat. No. 4240GR100) (PBST preparation) for 1 h at 37° C.; [0115] (a3) The RBD antigen peptide was added at 10 μL/well (20 μg/mL). The plate was washed 5 times after 1 h of incubation at the room temperature; [0116] (a4) 50 μL of streptavidin-ALP antibody (3310-10) (1:1000) was added and the plate was incubated at the room temperature for 30 min; [0117] (a5) The plate was washed with 100 μL of wash buffer 5 times, and 50 μL of reaction substrate PNPP was added; [0118] (a6) An absorbance value (OD405 nm) was measured.

[0119] Conclusion: as shown in FIG. 8, the RBD antigen peptide of SEQ ID NO: 3 bound to ACRE2 of the RBD receptor.

[0120] Detailed above are preferred embodiments of the present disclosure. It should be appreciated that numerous modifications and variations can be devised by those skilled in the art according to the teachings of the present disclosure without creative efforts. Therefore, the technical schemes that can be obtained by those skilled in the art through logical analysis, inference or limited experiments based on the prior art according to the concepts of the present disclosure shall fall within the protection scope defined by the claims.

TABLE-US-00012 CQMU01-seql.txt <110>CHONGQING MEDICAL UNIVERSITY, Yulin Feng <120>NOVEL CORONAVIRUS RBD SPECIFIC MONOCLONAL ANTIBODY AND LINEAR EPITOPE AND APPLICATION THEREOF <160>3 <210>1 <211>123 <212>PRT <213>Artificial Sequence <400>1 Gln Met Gln Leu Val Gln Ser Gly Pro Glu Val Lys Lys Pro Gly 1                5                  10                  15 Thr Ser Val Lys Val Ser Cys Lys Ala Ser Gly Phe Thr Phe Ser                 20                  25                  30 Ser Ser Ala Val Gln Trp Val Arg Gln Ala Arg Gly Gln His Leu                 35                  40                  45 Glu Trp Ile Gly Trp Ile Val Val Gly Ser Gly Asn Thr Asn Tyr                 50                  55                  60 Ala Gln Lys Phe Gln Glu Arg Val Thr Leu Thr Arg Asp Met                 65                  70 Ser Thr Arg Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu 75                  80                  85 Asp Thr Ala Val Tyr Tyr Cys Ala Ala Pro Asn Cys Asn Ser Thr 90                  95                  100 Thr Cys His Asp Gly Phe Asp Ile Trp Gly Gln Gly Thr Val Val 105                 110                 115 Thr Val Ser Ser 120 <210>2 <211>108 <212>PRT <213>Artificial Sequence <400>2 Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro 1                5                  10                  15 Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Arg                 20                  25                  30 Ser Ser Tyr Leu Gly Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro                 35                  40                  45 Arg Leu Leu Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro                 50                  55                  60 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr                 65                  70                  75 Ile Ser Arg Leu Glu Ser Glu Asp Phe Ala Val Tyr Tyr Cys Gln                 80                  85                  90 Gln Tyr Asp Asn Ser Pro Trp Thr Phe Gly Gln Gly Thr Lys Val                 95                  100                 105 Glu Ile Lys <210>3 <211>25 <212>PRT <213>Artificial Sequence <400>3 Ile Ala Trp Asn Ser Lys Val Gly Gly Asn Tyr Asn Tyr Leu Tyr  1               5                  10                  15 Arg Leu Phe Arg Lys Ser Asn Leu Lys Pro                 20                  25