Method of fluorescent detection of isothermal loop-mediated amplification (LAMP) of a target nucleic acid, oligonucleotides and kits thereof
11827923 · 2023-11-28
Assignee
Inventors
Cpc classification
C12Q2525/161
CHEMISTRY; METALLURGY
International classification
Abstract
The invention concerns a method for detecting isothermal loop-mediated (LAMP) amplification of a target nucleic acid sequence which is based on the fluorescence resonance energy transfer (FRET) mechanism. The invention also concerns a set of oligonucleotides and a kit adapted for carrying out the LAMP-FRET method of the invention.
Claims
1. A set of oligonucleotides for detecting loop-mediated isothermal amplification (LAMP) of a target nucleic acid sequence, the set comprising: (a) a first outer primer F3 and a second outer primer B3; (b) a first inner primer FIP and a second inner primer BIP, wherein: (1) FIP consists of a 3′ nucleic acid sequence F2 and a 5′ nucleic acid sequence F1c and BIP consists of a 3′ nucleic acid sequence B2 and a 5′ nucleic acid sequence B1c; (2) F2 is complementary to a F2c region of the target nucleic acid sequence and B2 is complementary to a B2c region of the target nucleic acid sequence; and (3) F2c and B2c are non-overlapping regions located on opposite strands of the target nucleic acid sequence; (c) a loop primer LF and/or a loop primer LB, wherein: (1) said loop primer LF is capable of hybridizing to a region of the target nucleic acid sequence between F2 and F1; and (2) said loop primer LB is complementary to a region of the target nucleic acid sequence between B1 and B2; wherein said loop primer LF, or said loop primer LB, if present, is labeled with at least one acceptor fluorophore at its 5′-end; and (d) a nucleic acid probe, labeled at its 3′-end with at least one donor fluorophore capable of transferring excitation energy to said at least one acceptor fluorophore of a labeled loop primer, wherein: (1) if said loop primer LF is labeled with said at least one acceptor fluorophore at its 5′-end, the nucleotide sequence of said nucleic acid probe is selected so that said nucleic acid probe is capable of hybridizing to the target nucleic acid sequence at a position 5′ to the position at which such labeled loop primer LF hybridizes to said target nucleic acid sequence; and (2) if said loop primer LB is labeled with said at least one acceptor fluorophore at its 5′-end, the nucleotide sequence of said nucleic acid probe is selected so that said nucleic acid probe is capable of hybridizing to the target nucleic acid sequence at a position 5′ to the position at which such labeled loop primer LB hybridizes to said target nucleic acid sequence; wherein hybridization of said nucleic acid probe to the target nucleic acid sequence causes the 3′-end of the nucleic acid probe to be in close proximity to the 5′-end of hybridized labeled loop primer, and wherein: (i) the intensity of fluorescence emission of the acceptor fluorophore increases upon absorption of the donor fluorophore excitation energy; (ii) the ratio of donor and/or acceptor fluorescence intensities of fluorescence changes upon absorption of the donor fluorophore excitation energy; or (iii) the fluorescence life-time of the acceptor fluorophore changes upon absorption of the donor fluorophore excitation energy.
2. The set of oligonucleotides according to claim 1, wherein said set of oligonucleotides includes said labeled loop primer LF, and does not include said loop primer LB.
3. The set of oligonucleotides according to claim 1, wherein said set of oligonucleotides includes said labeled loop primer LB, and does not include said loop primer LF.
4. The set of oligonucleotides according to claim 1, wherein said set of oligonucleotides includes said labeled loop primer LB, and additionally includes loop primer LF.
5. The set of oligonucleotides according to claim 4, wherein both said loop primer LB and said loop primer LF are labeled.
6. The set of oligonucleotides according to claim 1, wherein said nucleic acid probe is labeled at its 3′-end with at least one donor fluorophore selected from the group consisting of Fluorescein, BODIPY FL, Alexa555, ATTO550, Cy3, FAM, TET, HEX, JOE, VIC, Cy3, NED, Quasar 570, Oyster 556, and TAMRA.
7. The set of oligonucleotides according to claim 6, wherein said nucleic acid probe is labeled at its 3′-end with BODIPY FL.
8. The set of oligonucleotides according to claim 1, wherein said labeled loop primer is labeled at its 5′-end with at least one acceptor fluorophore selected from the group consisting of Cy5.5, Cy5, ATTO647N, Alexa 647, ROX, LC red 610, Texas red, LC red 640, LC red 670, Quasar 670, Oyster 645, and LC red 705.
9. The set of oligonucleotides according to claim 8, wherein said labeled loop primer is labeled at its 5′-end with ATTO647N.
10. The set of oligonucleotides according to claim 1, wherein said nucleic acid probe is labeled at its 3′-end with BODIPY FL, and said labeled loop primer is labeled at its 5′-end with ATTO647N.
11. A kit for detecting loop-mediated isothermal amplification (LAMP) of a target nucleic acid sequence, the kit comprising the set of oligonucleotides according to claim 1 and a DNA polymerase having strand displacement activity.
12. The kit according to claim 11, wherein said set of oligonucleotides includes said labeled loop primer LF, and does not include said loop primer LB.
13. The kit according to claim 11, wherein said set of oligonucleotides includes said labeled loop primer LB, and does not include said loop primer LF.
14. The kit according to claim 11, wherein said set of oligonucleotides includes said labeled loop primer LB, and additionally includes loop primer LF.
15. The kit according to claim 14, wherein both said loop primer LB and said loop primer LF are labeled.
16. The kit according to claim 11, wherein said nucleic acid probe is labeled at its 3′-end with at least one donor fluorophore selected from the group consisting of Fluorescein, BODIPY FL, Alexa555, ATTO550, Cy3, FAM, TET, HEX, JOE, VIC, Cy3, NED, Quasar 570, Oyster 556, and TAMRA.
17. The kit according to claim 11, wherein said labeled loop primer is labeled at its 5′-end with at least one acceptor fluorophore selected from the group consisting of Cy5.5, Cy5, ATTO647N, Alexa 647, ROX, LC red 610, Texas red, LC red 640, LC red 670, Quasar 670, Oyster 645, and LC red 705.
18. The kit according to claim 15, wherein: (a) said nucleic acid probe is labeled at its 3′-end with BODIPY FL; and/or (b) said labeled loop primer is labeled at its 5′-end with ATTO647N.
19. The kit according to claim 11, wherein said kit additionally comprises deoxynucleotide triphosphates sufficient to permit primer extension to occur.
20. The kit according to claim 11, wherein the DNA polymerase is selected from the group consisting of Bst large fragment polymerase, Bst 2.0, Bst 3.0, Bca (exo-), Vent, Vent (exo-), Deep Vent, Deep Vent (exo-), Φ29 phage, MS-2 phage, Z-Taq, KOD, Klenow fragment, GspSSD, GspF, OmniAmp Polimerase, SD Polimerase and any combination thereof.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
DETAILED DESCRIPTION OF THE INVENTION
(5) According to the present invention, the first inner primer FIP consists of a 3′ nucleic acid sequence designated as F2, which is complementary to a F2c region of the target nucleic acid sequence, and a 5′ nucleic acid sequence designated as F1c. The second inner primer BIP consists of a 3′ nucleic acid sequence designated as B2, which is complementary to a B2c region of the target nucleic acid sequence, and a 5′ nucleic acid sequence designated as B1c. The F2c and B2c regions are non overlapping regions located on opposite strands of the target nucleic acid sequence.
(6) The external primer F3 consists in the F3 region that is complementary to the F3c region; the external primer B3 consists in the B3 region that is complementary to the B3c region.
(7) As mentioned above, the method of the present invention employs one or two loop-primers, i.e. a Loop Primer B and/or Loop Primer F (which are designated in the following as “LF loop-primer” and “LB loop-primer”, respectively), which contain sequences complementary to the single stranded loop region located between the B1 and B2 regions or located between the F1 and F2 regions.
(8) Typically, when used in a LAMP reaction, loop-primers hybridize to the intermediate LAMP products and provide an increased number of starting points for DNA synthesis. According to the invention, either the LF loop primer or the LB loop-primer, if present, is labeled at its 5′-end with at least one acceptor fluorophore.
(9) Compared with standard LAMP technology, the method of the invention involves the use of an additional oligonucleotide, more particularly a nucleic acid probe, which is labeled at its 3′-end with at least one donor fluorophore. Said nucleic acid probe is capable of hybridizing to the target nucleic acid sequence at a position which is 5′ to the labeled LF or LB primer so that, when hybridized to the target nucleic acid sequence, the 3′-end of the nucleic acid probe is brought into close proximity to the 5′-end of the labeled LF or LB loop primer.
(10) In the present description, a nucleic acid sequence (either a primer or a probe) that is capable of hybridizing to a given target nucleic acid sequence is for example complementary to said nucleic acid sequence.
(11) It is noted that a “close proximity” of said labeled loop-primer and said labeled nucleic acid probe occurs only during the amplification phase of a LAMP reaction when the loop-primer is incorporated and extended in the LAMP amplification product.
(12) As shown in
(13) The labeled loop-primer may be either LF or LB (when LB is present). According to the invention, upon hybridization of said oligonucleotides to the target nucleic acid sequence during the LAMP reaction, the donor fluorophore at the 3′-end of the nucleic acid probe is brought into close proximity to the acceptor fluorophore at the 5′-end of the LF or LB loop primer. Fluorescence energy transfer occurs between such fluorophores, e.g. the donor fluorophore located at the 3′-end of the nucleic acid probe transfers excitation energy to the acceptor fluorophore located at the 5′-end of the LF or LB loop primer. As a result, an increase in the intensity of the fluorescence emission of the acceptor fluorophore is generated and detected. Such an increase is an indication of DNA amplification since it is generated upon incorporation of the labeled loop-primer in the LAMP amplification product and subsequent primer extension.
(14) The performance of the method of the invention was evaluated by the present inventors in comparison with prior art fluorescence-based LAMP assays, more specifically the FRET-based LAMP assay described by Chou et al. and the LAMP system making use of intercalating dyes.
(15) In order to compare the performance of the LAMP method of the invention with the assay by Chou et al., a dilution design was used and titration series ranging from 2×10.sup.1 copies/μL, to 2×10.sup.6 copies/μL, of a denatured plasmid containing a WSSV genomic fragment were subjected to LAMP amplification on a Rotor-Gene Q instrument (Qiagen). In particular, comparative analysis was performed on the dilutions corresponding to 2×10.sup.3 copies/4, and 2×10.sup.6 copies/μL, respectively. The amplification of the target produced an increasing fluorescent signal with a sigmoidal shape that was detected by setting readings with 1 minute step.
(16) By using the Rotor-Gene Software the normalized signal was generated, and by setting a fluorescence threshold at 0.2 corresponding at around 50% of the fluorescence increment, the Threshold time (minutes) was identified to detect the target amplification.
(17) A comparative analysis of the threshold time generated for these diluted samples by each of the LAMP methods under examination showed that the method of the invention achieves a significant earlier detection of the target nucleic acid sequence compared to the method by Chou et al (shown in
(18) Moreover, the statistical significance of the difference in the detection time measured between the LAMP methods under examination was calculated by performing a Student's t-test, which provided a p-value lower than 0.05.
(19) To further assess the method of the invention for the ability to detect target nucleic acids in a natural matrix, the experimental procedure as above-described was applied to the same dilution of the WSSV plasmid (2×10.sup.3 copies/4, and 2×10.sup.6 copies/μL) in human genomic DNA (20 ng/μL). LAMP amplification reactions performed on such dilutions revealed that the presence of material, such a genomic DNA, which may cause interference, did generate delay in the detection of target nucleic acid sequence by both the methods. Moreover, target detection was accomplished by the method of the invention at 10 or more minutes earlier than the detection achieved by the LAMP system by Chou et al.
(20) In assay validation, linearity represents one of the most relevant indicators of assay accuracy, in that it measures the ability of the procedure to return values that are directly proportional to the concentration of the target analyte in the test samples. In the present study, LAMP amplification data obtained by applying either the method of the invention or the method by Chou et al. on the above-indicated sample titration series were subjected to linear regression analysis.
(21) In
(22) The present inventors performed a further evaluation by comparing the performance of the method of the invention with a LAMP assay that involves the use of intercalating dyes for fluorescence detection. Linear regression analysis was applied on the LAMP amplification data obtained by carrying out either the method of the present invention or the intercalating dye-based assay on ten-fold serially diluted plasmid DNA samples containing the MYH11 gene. The results of linear regression analysis are shown in
(23) Along with the better assay linearity, a higher analytical sensitivity and wider linearity range were observed for the method of the present invention. Finally, compared to the intercalating dye-based LAMP, the method of the present invention which employs a labeled loop-primer/probe FRET pair results in enhanced assay specificity, since intercalating dyes such as YO-PRO emit a fluorescence signal upon binding to any double-stranded DNA, irrespective of the specific nucleotide sequence.
(24) In the method of the present invention, the amplification of the target nucleic acid sequence leads to a detectable change in a fluorescence parameter, namely an increase in acceptor fluorescence intensity when energy transfer occurs between the donor fluorophore at the 3′-end of the nucleic acid probe and the acceptor fluorophore at the 5′-end of the LF or LB loop primer.
(25) It is to be understood that other fluorescence parameters which are affected by the proximity of the donor and acceptor fluorophores and consequently by the acceptor fluorescence emission may also be evaluated, including, for example, the ratio of donor and/or acceptor fluorescence intensities or fluorescence life-time.
(26) As outlined above, acceptance of donor excitation energy by a FRET acceptor fluorophore requires close proximity between said molecules and the efficiency of FRET is very sensitive to the distance and relative orientation between donor and acceptor. According to the method of the present invention, upon hybridization to the target nucleic acid sequence, the distance between the labeled 3′-end of the nucleic acid probe and the labeled 5′-end of the loop primer should preferably be comprised between zero and 6 nucleotides, for example zero, 1, 2, 3, 4, 5 or 6 nucleotides.
(27) According to the present invention, the nucleic acid probe comprises at least one donor fluorophore linked to its 3′-end. Such a donor fluorophore acts as a blocker of DNA synthesis in that it makes the 3′-terminal of the nucleic acid probe no longer available as origin for DNA polymerization.
(28) Conversely, in the present invention the acceptor fluorophore carried by the labeled loop-primer is linked to the 5′-end of said oligonucleotide in order to avoid any interference with DNA synthesis during LAMP reaction. Specifically, the labeled loop-primer according to the invention has a 3′-free hydroxyl group which serves as origin for the synthesis of the complementary DNA strand.
(29) Since target detection is achieved directly via signal components linked on specific oligonucleotides, the method of the present invention provides a sequence-specific detection technology. According to the invention, the labeled nucleic acid probe and/or labeled loop-primer may be designed to tolerate sequence variations for detection of diverse DNA or RNA sequences or to differentiate between sequence polymorphism. In addition, it is understood that hybridization of the nucleic acid probe or the loop-primer with their respective complementary sequences on the target nucleic acid may be enhanced by incorporating in such oligonucleotides certain types of modified nucleotides, for example, 2′-O-methylribonucleotides or nitropyrole-based nucleotides, or certain types of nucleic acid analogs with non-natural backbone, for example PNA (peptide nucleic acid) or LNA (locked nucleic acid). The use of nucleic acid analogs in nucleic acid amplification methods is well established and known to the person skilled in the art.
(30) In the context of the present invention, the term “target nucleic acid sequence” refers to nucleic acid sequences to be amplified and detected. This also includes the complementary second strand of the nucleic acid sequences to be amplified and either strand of a copy of the nucleic acid sequence which is produced by amplification. The target nucleic acid can originate from a variety of sources. For example, target nucleic acids can be naturally occurring DNA or RNA isolated from any source, recombinant molecules, cDNA, or synthetic analogs, as known in the art. In some embodiments, the target nucleic acid sequence may comprise one or more single-nucleotide polymorphisms (SNPs), allelic variants, and other mutations such as deletion mutations, insertion mutations, point mutations. In other embodiments, the target nucleic acid sequence may comprise a junction sequence of a fusion gene, possibly associated with cancer. In yet another embodiment, the target nucleic acid sequence may originate from a microorganism, including specific clones or strains of microorganisms, possibly involved in inducing diseases in human beings and animals.
(31) The method of the present invention is also suitable for quantitatively determine the amount of target nucleic acid sequences in a sample. In a preferred embodiment of the invention, the quantification of a target nucleic acid sequence is accomplished via the generation of a standard curve by plotting a graph of known copy number (or concentration) of such target nucleic acid sequence against LAMP assay time to positivity. Quantification of unknown target copy number (or concentration) in the test samples may be extrapolated from the standard curve on the basis of the time to positivity measured in the unknown sample.
(32) Another aspect of the present invention is a set of oligonucleotides for detecting loop-mediated isothermal amplification (LAMP) of a target nucleic acid sequence, the set consisting of a first outer primer F3, a second outer primer B3, a first inner primer FIP, a second inner primer BIP, a first loop-primer LF, a second loop-primer LB and one nucleic acid probe, all as defined above with reference to the method of the invention.
(33) Either the LF loop primer or the LB loop primer (when LB is present) is labeled at its 5′-end with at least one acceptor fluorophore and the nucleic acid probe is labeled at its 3′-end with at least one donor fluorophore.
(34) A requirement for Förster resonance energy transfer to occur is that the emission spectrum of the donor fluorophore overlaps with the absorption spectrum of the acceptor fluorophore, so that excitation by lower-wavelength light of the donor fluorophore is followed by transfer of the excitation energy to the acceptor fluorophore.
(35) There are many molecules which may serve either as the donor or the acceptor fluorophore in the present invention.
(36) According to a preferred embodiment, the donor fluorophore is selected from the group consisting of Fluorescein, BODIPY FL, Alexa555, ATTO550, Cy3, FAM, TET, HEX, JOE, VIC, Cy3, NED, Quasar 570, Oyster 556, TAMRA and/or the acceptor fluorophore is selected from the group consisting of Cy5.5, Cy5, ATTO647N, Alexa 647, ROX, LC red 610, Texas red, LC red 640, LC red 670, Quasar 670, Oyster 645, LC red 705.
(37) Especially preferred is the donor/acceptor pair BODIPY FL/ATTO647N.
(38) In yet another embodiment, the nucleic acid probe and/or the loop primer are labeled with more than one fluorophore, preferably two fluorophores.
(39) In the most preferred embodiment, the FRET donor/acceptor pair consists of two BODIPY FL fluorophore and one ATTO647N fluorophore, respectively. The selection of suitable donor/acceptor fluorophore pair suitable for the present invention is well within the knowledge of the person skilled in the art.
(40) As mentioned above, a further aspect of the present invention is a kit for detecting loop-mediated isothermal amplification (LAMP) of a target nucleic sequence, the kit comprising the set of oligonucleotides as defined above, as well as one or more DNA polymerases having strand displacement activity. The DNA polymerase is preferably selected from the group consisting of Bst large fragment polymerase, Bst 2.0, Bst 3.0, Bca (exo-), Vent, Vent (exo-), Deep Vent, Deep Vent (exo-), Φ29 phage, MS-2 phage, Z-Taq, KOD, Klenow fragment, GspSSD, GspF, OmniAmp Polimerase, SD Polimerase and any combination thereof. The most preferred DNA polymerase is the Bst large fragment polymerase.
(41) The following experimental section is provided purely by way of illustration and is not intended to limit the scope of the invention as defined in the appended claims.
EXAMPLES
Example 1—Comparison of the LAMP Method of the Invention with the LAMP Assay by Chou et al
(42) Sample Preparation
(43) To compare the LAMP method of the invention with the LAMP assay described in Chou et al., a suitable target nucleic acid sequence was prepared. Briefly, a 350-bp DNA fragment derived from the White spot syndrome virus (WSSV) genome (nt226681-227934, GenBank AF332093.1) was cloned into the pMA-T vector (GENEART) by using the Sfi I/Sfi I restriction site combination to provide the positive control. Ten-fold dilution series in the range of approximately 2×10.sup.6 copies/μL to 2×10.sup.1 copies/μL were prepared for the recombinant WSSV plasmid.
(44) Two different plasmid dilution series were prepared using as diluent either Tris-HCl 10 mM, pH 8.5 alone, or this buffer additionally containing human genomic DNA (20 ng/μl).
(45) In the present study, the analyzed plasmid dilutions were denatured at 100° C. for 10 minutes. After denaturation, the plasmid samples were immediately placed on ice for 10 minutes.
(46) LAMP Reaction
(47) The LAMP oligonucleotide primers and probes employed for the comparative analysis were designed as described in Chou et al., and are listed in Table 1 below.
(48) TABLE-US-00001 TABLE 1 Oligo SEQ ID name Sequence (5′ -> 3′) NO: F3 TGATTCAGATGGCATGGATACTT 1 (Forward outer primer) B3 CCGATACTGCCATTGAAAGC 2 (Reverse outer primer) FIP TGTTATGGTAGTGAACCCCTTTGCA 3 CGACTTATCATTCAAGACATCAAT (Forward inner primer) BIP GGAAGAAAGATACAAGCCCATTGG 4 CGCTCCCTTACCACCTTCCTTAATC (Reverse inner primer) LoopB GCCATTGAAGCAGTGTTGGGAT 5 (Reverse loop) LoopF GATCGTTAACAACAACAATACTGGA 6 (Forward loop) LCF CACCCACAGCGGCTCTTGC-Fluorescein 7 (3′fluorescein labeled FRET probe) LCQ LC640-CGTTCGCCATTGAAGCAGTGTTGG- 8 Phosphate (5′LC640 labeled FRET probe)
(49) Table 1 contains the full set of oligonucleotides used in the assay by Chou et al. The set of oligonucleotides employed in the LAMP method according to the invention differs from the oligonucleotide set by Chou et al. for the following features: 1) it contains one single nucleic acid probe, namely LCF, which is labeled at its 3′-end with fluorescein; 2) it does not include any loop primer LoopB, and the latter is replaced with the LCQ primer, which is labeled at its 5′-end with the fluorescent moiety LC640. In the light of the above, the method by Chou et al. provides for the generation of a fluorescent amplification signal by means of the FRET mechanism between a labeled donor probe and a labeled acceptor probe. Conversely, in the method according to the present invention the function of acceptor oligonucleotide is carried out by one of the loop primers, previously labeled, thereby reducing the number of oligonucleotides employed in the LAMP reaction. Moreover, the method of the invention overcomes the disadvantage associated with the assay by Chou et al. of a possible competition of the FRET probes employed in said assay with the loop primers for the binding to the same target nucleotide sequence.
(50) In the present study, the following primer concentrations were used in the LAMP reactions: 0.375 μM outer primers (F3 and B3), 2 μM inner primers (FIP and BIP), 1.1 μM loop primer LoopF, 0.3 μM loop primer LoopB (present only in the reaction according to Chou et al), 0.25 μM LCF and LCQ.
(51) The LAMP reactions were performed in a 20 μl mixture containing: 0.375 mM dNTPs, 2.4 U of Bst DNA polymerase Large Fragment (New England BioLabs, Beverly, MA, USA), 1× Reaction Buffer (20 mM HEPES buffer, pH 7.9, 20 mM KCl, 3 mM MgCl2, and 0.1% Triton X100).
(52) The reaction mixtures were incubated at 60° C. for 120 minutes on a Rotor-Gene Q instrument (Qiagen). The amplification products were then kept at 4° C.
(53) LAMP amplification of the recombinant WSSV plasmid was detected by the analysis of the normalized fluorescent signal generated during the reaction. The Threshold time was identified by setting a fluorescence threshold at 0.2, corresponding at around 50% of the fluorescence increment.
(54) Data Analysis and Normalization
(55) Data analysis was performed using the statistical package within the Microsoft Excel. The same package was used for linear regression analysis.
(56) Data normalization was obtained by means of the Rotor-Gene Pure Detection v2.1 Software.
Example 2—Comparison of the LAMP Method of the Invention with an Intercalating Dye-Based LAMP Assay
(57) Sample Preparation
(58) In order to compare the performance of the method of the invention with a LAMP assay that involves the use of intercalating dyes, a suitable target nucleic acid sequence was prepared. Briefly, a 350-bp DNA fragment derived from the MYH11 gene (GenBank D10667.1) was cloned into the pMA-T vector (GENEART) by using the Sfi I/Sfi I restriction site combination to provide the positive control.
(59) The recombinant MYH11 plasmid was serially diluted 10-fold in buffer Tris-HCl 10 mM, pH 8.5, from approximately 2×10.sup.6 copies/μL to 2×10.sup.1 copies/μL.
(60) In the present study, the analyzed plasmid dilutions were denatured at 100° C. for 10 minutes. After denaturation, the plasmid samples were immediately placed on ice for 10 minutes.
(61) LAMP Reaction
(62) In Table 2 below are listed the LAMP oligonucleotide primers and probes employed for the comparative analysis.
(63) TABLE-US-00002 TABLE 2 SEQ ID Oligo name Sequence (5′ -> 3′) NO: F3 TCAAGAAACTGGAGGATGAG 9 (Forward outer primer) B3 TTCCGTTTCAGCTTCTCC 10 (Reverse outer primer) FIP TGTCGTTAAGTCACTAATCCTC 11 TGGTCATGGATGATCAGA (Forward inner primer) BIP GCCAAGAATCTTACCAAGCTG 12 AAGGCTCTTCTCTTCC (Reverse inner primer) Donor GAATCTATGATTTCAG-Bodipy FL 13 Probe (3′ Bodipy FL-labeled FRET probe) Acceptor ATTO 647N-ACTGGAAGTGCGGCTAAAG 14 LB loop (Reverse 5′ ATTO647N labeled loop)
(64) In the LAMP reaction according to the method of the invention, the following oligonucleotide concentrations were used: 0.05 μM outer primers (F3 and B3), 0.4 μM inner primers (FIP and BIP), 0.2 μM Acceptor LB loop primer and 0.2 μM Donor FRET probe. Conversely, besides the above-indicated outer and inner primers, the oligonucleotides set employed in the intercalating dye-based LAMP assay included only the LB loop primer in non-labeled form.
(65) The LAMP reactions were performed in a 25 μl mixture containing: 1.4 mM dNTPs, 8 U of Bst DNA polymerase Large Fragment (New England BioLabs, Beverly, MA, USA), 8 mM MgCl2, 1× Reaction Buffer (30 mM Tris-HCl, pH 8.0, 30 mM KCl, and 0.1% Triton X100).
(66) The reaction mixtures set up for the intercalating dye-based LAMP assay further included the YO-PRO intercalating dye (Life Technologies) at the concentration of 1 μM.
(67) The LAMP amplification reaction was conducted at 65° C. for 40 minutes on a Rotor-Gene Q instrument (Qiagen). The amplification products were then kept at 4° C.
(68) LAMP amplification of the recombinant MYH11 plasmid was detected by the analysis of the normalized fluorescent signal generated during the reaction. The Threshold time was identified by setting a fluorescence threshold at 0.2, corresponding at around 50% of the fluorescence increment.
(69) Data Analysis and Normalization
(70) Data analysis was performed using the statistical package within the Microsoft Excel. The same package was used for linear regression analysis.
(71) Data normalization was obtained by means of the Rotor-Gene Pure Detection v2.1 Software.