Tumor-navigating, self-eradicating, trail-armed salmonella for precision cancer therapy
11519007 · 2022-12-06
Assignee
Inventors
Cpc classification
A61K9/0019
HUMAN NECESSITIES
C07K14/70575
CHEMISTRY; METALLURGY
C12N15/87
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
C12N15/87
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
Abstract
The present disclosure relates to genetically modified strains of Salmonella, engineered to be tumor navigating, self-eradicating, and armed with TRAIL to trigger tumor cell apoptosis. Also provided herein are methods of producing and methods of using such genetically modified Salmonella strains to treat cancer.
Claims
1. A genetically modified Salmonella bacterium, wherein the bacterium comprises: (a) SEQ ID NO: 7, wherein SEQ ID NO: 7includes a recombinant gene encoding human TNF-related Apoptosis-inducing Ligand (TRAIL); (b) the following seven modifications: ΔP.sub.murA araC P.sub.BAD murA, ΔasdA::TT araC P.sub.BAD c2 Δ(araC P.sub.BAD)::P22 P.sub.R araBAD, Δ(wza-wcaM), ΔrelA::araC P.sub.BAD lacl TT, ΔpagP::P.sub.lpplpxE, and ΔendA; and (c) one or more of the following three modifications: ΔP.sub.tar::P.sub.trc ΔlacO tar, ΔP.sub.tsr ::P.sub.trc ΔlacO tsr, and Δtrg.
2. The genetically modified Salmonella bacterium of claim 1, wherein the bacterium is capable of self-eradication in non-tumor cells.
3. The genetically modified Salmonella bacterium of claim 1, wherein the bacterium comprises the following 3 modifications ΔP.sub.tar::P.sub.trc ΔlacO tar, ΔP.sub.tsr::P.sub.trc ΔlacO tsr, and Δtrg.
4. The genetically modified Salmonella bacterium of claim 1, wherein the bacterium is S. Typhimurium.
5. The genetically modified Salmonella bacterium of claim 1, wherein the bacterium comprises ΔP.sub.tar::P.sub.trc ΔlacO tar.
6. A method of treating cancer in a subject in need thereof comprising administering an effective amount of the genetically modified Salmonella bacterium of claim 1 to the subject, whereby the genetically modified Salmonella bacterium treats cancer in the subject.
7. The method of claim 6, wherein administering comprises oral administration or intra-tumoral injection of the genetically modified Salmonella bacterium.
8. A method for stimulating tumoricidal activity in a subject comprising administering an effective amount of the genetically modified Salmonella bacterium of claim 1 to the subject, whereby the genetically modified Salmonella bacterium induces tumoricidal activity in the subject.
9. The method of claim 8, wherein administering comprises oral administration or intra-tumoral injection of the genetically modified Salmonella bacterium.
10. The method of claim 8, wherein the subject has cancer.
11. A genetically modified Salmonella bacterium, wherein the bacterium comprises: (a) SEQ ID NO:7, wherein SEQ ID NO: 7 includes a recombinant gene encoding human TNF-related Apoptosis-inducing Ligand (TRAIL); (b) the following seven modifications ΔP.sub.murA araC P.sub.BAD murA, ΔasdA::TT araC P.sub.BAD c2 Δ(araC P.sub.BAD)::P22 P.sub.R araBAD, Δ(wza-wcaM), Δpmi, ΔrelA::araC P.sub.BAD lacl TT, ΔpagP::P.sub.lpp lpxE, and ΔendA; (c)one or more of the following three modifications: ΔP.sub.tar::P.sub.trc ΔlacO tar, ΔP.sub.tsr::P.sub.trc ΔlacO tsr, and Δtrg; and (d) one or more of the following mutations: ΔsseL, ΔspvD, and ΔssrAB.
12. The genetically modified Salmonella bacterium of claim 11, wherein the bacterium is capable of self-eradication in non-tumor cells.
13. The genetically modified Salmonella bacterium of claim 11, wherein the bacterium comprises mutations ΔsseL, ΔspvD, and ΔssrAB.
14. The genetically modified Salmonella bacterium of claim 11, wherein the bacterium is S. Typhimurium.
15. The genetically modified Salmonella bacterium of claim 11, wherein the bacterium comprises ΔP.sub.tar::P.sub.trcΔlacO tar.
16. A method of treating cancer in a subject in need thereof comprising administering an effective amount of the genetically modified Salmonella bacterium of claim 11 to the subject, whereby the genetically modified Salmonella bacterium treats cancer in the subject.
17. The method of claim 16, wherein administering comprises oral administration or intra-tumoral injection of the genetically modified Salmonella bacterium.
18. A method for stimulating tumoricidal activity in a subject comprising administering an effective amount of the genetically modified Salmonella bacterium of claim 11 to the subject, whereby the genetically modified Salmonella bacterium induces tumoricidal activity in the subject.
19. The method of claim 18, wherein administering comprises oral administration or intra-tumoral injection of the genetically modified Salmonella bacterium.
20. The method of claim 18, wherein the subject has cancer.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
DETAILED DESCRIPTION
(12) The present disclosure addresses the aforementioned drawbacks of conventional methods for treating cancer, including current uses of oncolytic bacteria in cancer treatments. In particular, the methods and compositions described herein are based at least in part on the inventor's development of genetically modified Salmonella (GMS) capable of precise navigation to tumors and self-eradication. The GMS described herein armed with TRAIL to trigger cancer cell apoptosis. As demonstrated in the Examples, genetically modified Salmonella of this disclosure navigate to cancer cells, self-lyse, release TRAIL, and induce cancer cell apoptosis in vitro. Moreover, intratumorally injected GMS effectively suppress subcutaneous tumor growth, and orally administrated GMS reduce the number of polyps and prolong lifespan in an in vivo model of colon cancer.
(13) Accordingly, in a first aspect, provided herein is a genetically modified Salmonella bacterium, where the bacterium comprises a recombinant gene encoding human TRAIL. Also provided herein is a genetically modified Salmonella bacterium, where the bacterium comprises a recombinant gene encoding for increased expression of a methyl-accepting chemotaxis protein (MCP). Also provided herein is a genetically modified Salmonella bacterium, where the bacterium comprises a recombinant gene encoding for reduced toxicity of the bacterium in a plurality of non-tumor cells.
(14) In some cases, the genetically modified Salmonella bacterium comprises a first recombinant gene encoding human TRAIL, a second recombinant gene encoding for increased expression of a methyl-accepting chemotaxis protein (MCP), and a third recombinant gene encoding for reduced toxicity of the bacterium in a plurality of non-tumor cells. Such genetically modified Salmonella bacteria are capable of self-eradication in vivo. Such GMS also exhibit increased chemotaxis to tumor cells and increased tumoricidal activity relative to a Salmonella bacterium not comprising the first recombinant gene. As demonstrated in the Examples, lysis of the genetically modified Salmonella of this disclosure releases TRAIL, thus inducing apoptosis of cancer cells targeted by the modified bacteria. In some cases, other members of the tumor necrosis factor family, such as Tumor Necrosis Factor α (TNFα) and Fas Ligand (FasL), may be used in place of TRAIL. In such cases, TNFα or FasL is released by lysis of the genetically modified Salmonella to induce apoptosis of cancer cells targeted by the modified bacteria.
(15) As used herein, the terms “genetically modified” and “genetically engineered” are used interchangeably and refer to a prokaryotic cell that includes an exogenous polynucleotide, regardless of the method used for insertion. In some cases, the cell has been modified to comprise a non-naturally occurring nucleic acid molecule that has been created or modified by the hand of man (e.g., using recombinant DNA technology) or is derived from such a molecule (e.g., by transcription, translation, etc.). A cell that contains an exogenous, recombinant, synthetic, and/or otherwise modified polynucleotide is considered to be an engineered cell. The term “altered,” as used herein, refers to any change in the nucleic acid sequence that results in the nucleic acid sequence not being expressed. In an exemplary embodiment, the alteration results in the nucleic acid sequence not being expressed in a host. In one embodiment, the alteration is a deletion. In another embodiment, the alteration places an exogenous nucleic acid under the control of a regulatable promoter, such that the nucleic acid is not expressed in a host.
(16) Some embodiments of the instant disclosure comprise a species or subspecies of the Salmonella genera. For instance, the recombinant bacterium may be a Salmonella Enterica serovar. In an exemplary embodiment, a bacterium of the disclosure may be derived from (i.e., an isolate of) S. Enterica serovar Typhimurium, referred to herein as Salmonella Typhimurium, and also from S. Typhi, S. Paratyphi, S. Enteritidis, S. Choleraesius, S. Arizona, or S. Dublin. In an exemplary embodiment, the recombinant bacterium is derived from S. Typhimurium. As used herein, “Salmonella Typhimurium” refers to an isolate of Salmonella Typhimurium. Likewise, the terms “S. Typhi,” “S. Paratyphi,” “S. Enteritidis,” “S. Choleraesius,” “S. Arizona,” and “S. Dublin” as used herein refer to isolates of Salmonella Typhi, S. Paratyphi, S. Enteritidis, S. Choleraesius, S. Arizona, and S. Dublin, respectively. As used herein the terms “strain” and “isolate” are used interchangeably.
(17) As described and demonstrated herein, Salmonella are genetically modified to increase navigation of the bacteria to cancer cells (tumor cells) by modulating the expression of MCP, which are transmembrane chemoreceptors important for taxis (bacterial movement) toward or away from particular substrates. Salmonella MCPs include Tar (taxis towards aspartate and maltose, away from nickel and cobalt; aka cheM), Tsr (taxis towards serine, away from leucine, indole and weak acids), Trg (taxis towards sugars, galactose and ribose), Tap (taxis towards dipeptides), McpC (repellent response towards L-cystine), Tip, McpA, and McpB. The coding sequence of Tsr (Methyl-accepting chemotaxis protein) of Salmonella Typhimurium is accession number A0A0H3NL96. The coding sequence of Tar (Methyl-accepting chemotaxis protein II) of S. Typhimurium is accession number P02941.
(18) In some cases, a recombinant bacterium of this disclosure is engineered for increased chemotaxis toward tumor cells by increasing expression of Tar and/or increasing expression or Tsr. In some cases, the genetic modification further comprise reducing expression of Trg. For example, a bacterium can be genetically altered to produce modified Salmonella having constitutive over-expression of one or more chemoreceptors such as Tar and Tsr. In some cases, a genetically modified Salmonella bacterium comprises mutation ΔP.sub.tar::P.sub.trc ΔlacO tar. In other cases, the genetically modified Salmonella bacterium comprises mutations ΔP.sub.tar::P.sub.trc ΔlacO tar, tsr: ΔP.sub.tsr::P.sub.trc ΔlacOtsr, and Δtrg. In some cases, the genetically modified Salmonella bacterium is from strain GMS410(pK5079) or GMS515(pK5079). A plasmid map for pK5079 is provided in
(19) In certain embodiments, a recombinant bacterium of the disclosure may also be attenuated. As used herein, the term “attenuated” refers to the state of the bacterium wherein the bacterium has been weakened from its wild-type fitness by some form of recombinant or physical manipulation such that the bacterium's virulence is reduced relative to a control (a non-recombinant/non-manipulated bacterium). This includes altering the genotype of the bacterium to reduce its ability to cause disease. However, the bacterium's ability to colonize the tumor is, preferably, not substantially compromised. For instance, in one embodiment, regulated attenuation allows the recombinant bacterium to express one or more nucleic acids encoding products important for the bacterium to withstand stresses encountered in the host after immunization. This allows efficient invasion and colonization of tumor tissues before the recombinant bacterium is regulated to display the attenuated phenotype. As used herein in this context, the term “reduce/reduced” means a reduction of at least 10%, preferably 25%, even more preferably 50%, still more preferably 60%, even more preferably 70%, still more preferably 80%, even more preferably 90% and most preferably of 100% as compared to the appropriate control.
(20) For genetically modified Salmonella, non-limiting examples of nucleic acid sequences which may be used for attenuation include: a pab nucleic acid sequence, a pur nucleic acid sequence, an aro nucleic acid sequence, an asdA nucleic acid sequence, murA, nadA, pncB, galE, pmi, fur, rpsL, ompR, htrA, hemA, cdt, cya, crp, dam, phoP, phoQ, rfc, poxA, galU, mviA, sodC, recA, ssrA, sirA, inv, hilA, rpoE, figM, tonB, slyA, and any combination thereof. Generally, the nucleic acids provided above as non-limiting examples encode “attenuation proteins,” meaning any protein the absence of which attenuates a bacterium. The “Δ” as used herein, refers to gene deletion. The “::” as used herein, refers to gene insertion. The “asd” refers to a gene encoding aspartate-semialdehyde dehydrogenase. The asd mutants (“Δasd”) of Gram-negative bacteria have an obligate requirement for diaminopimelic acid (DAP), which is an essential constituent of the peptidoglycan layer of the cell wall of these organisms. The “murA” refers to a gene required for the synthesis of the peptidoglycan layer of the bacterial cell wall. Like asdA mutants, murA mutants (“ΔmurA”) are deficient in bacterial cell wall synthesis.
(21) In some cases, the genetically modified bacterium is further modified such that the recombinant bacterium is capable of regulated attenuation. Generally speaking, the bacterium comprises a chromosomally integrated regulatable promoter. The promoter replaces the native promoter of, and is operably linked to, at least one nucleic acid sequence encoding an attenuation protein, such that the absence of the function of the protein renders the bacterium attenuated. In some embodiments, the promoter is modified to optimize the regulated attenuation.
(22) In some cases, the genetically modified bacterium is further modified such that the recombinant bacterium exhibits a reduced expression of immunosuppressive membrane proteins, which are typically overexpressed during Salmonella infection. Generally speaking, the bacterium comprises chromosomal gene mutations, largely originates from the Salmonella pathogenicity island 2 (SPI2), which encodes proteins associated with induction of programmed death ligand 1 (PD-L1) expression. PD-L1 is an immunosuppressive membrane protein that binds to T cells via the PD-1 receptor and thereby halts their activation. PD-L1 expression plays an essential role in the immunological tolerance of self-antigens but is also exploited for immune evasion by pathogen-infected cells and cancer cells. It has been demonstrated that Salmonella infection of intestinal epithelial cells combined with gamma interferon (IFNγ) causes the synergistic induction of PD-L1. The increased expression of PD-L1 through Salmonella infection was seen in both human and rat intestinal epithelial cell lines. It was determined that cellular invasion by the bacteria is necessary for PD-L1 induction, potentially indicating that Salmonella strains are delivering mediators from inside the host cell that triggers the increased PD-L1 expression. In addition, Salmonella plus IFNγ induction of PD-L1 decreased the cytokine production of activated T cells. Knockout mutants, including but not limited ΔsseL, ΔspvD or ΔssrAB, cause the absence of the function of specific proteins to prevent the induction of PD-L1 expression. In some embodiments, the mutations are combined to maximize the effect of selected mutations. In some cases, a genetically modified Salmonella bacterium comprises one or more mutations selected from ΔsseL, ΔspvD, and/or ΔssrAB. The term “sseL” refers to a gene encoding sulfatase/phosphatase/protease, which acts as a deubiquitinase in infected host cells. The term “spvD” refers to a gene encoding cysteine hydrolase, which negatively regulates the NF-κB signaling pathway and promotes virulence of S. Typhimurium in mice. The term “ssrAB” refers to chromosomal loci located within SPI-2, which encodes two-component regulatory system SsrAB, which regulates the expression of several operons in SPI-2 and, in addition, a large number of genes for non-SPI2-encoded effector proteins.
(23) In another aspect, provided herein are methods for producing genetically modified Salmonella bacteria having increased tumoricidal activity. In exemplary embodiments, the method comprises: transforming a first recombinant gene into a regulated attenuation strain of Salmonella forming a strain B, the first recombinant gene encoding for chemotaxis of the strain B toward a plurality of tumor cells; transforming a second recombinant gene into the strain B forming a strain C, the second recombinant gene encoding for (i) reduced toxicity of strain C in a plurality of non-tumor cells; and (ii) toxicity of strain C in the plurality of tumor cells; and transforming a third recombinant gene into the strain C forming a strain D, the third recombinant gene encoding for activation of tumoricidal activity. In some cases, the first recombinant gene encodes for synthesis of Tar or synthesis of Tsr. Preferably, the third recombinant gene can encode human TRAIL. In some cases, strain D comprises mutation ΔP.sub.tar::P.sub.trc ΔlacO tar, or comprises mutations ΔP.sub.tar::P.sub.trc ΔlacO tar, ΔP.sub.tsr::P.sub.trc ΔlacOtsr, and Δtrg. In some cases, strain D is GMS410(pK5079). In other cases, strain D is GMS515(pK5079).
(24) The genetically modified Salmonella described herein can be used in any of a variety of applications. For example, the genetically modified Salmonella can be used in therapeutic methods to treat cancer or a cancer-associated condition. In some cases, a method of treating cancer in a subject in need thereof will comprise administering an effective amount of a modified Salmonella bacterium having the genetic modifications described herein and, thus, being tumor navigating, self-eradicating, and armed with TRAIL to trigger tumor cell apoptosis, to the subject, whereby the genetically modified Salmonella bacterium treats cancer in the subject. As used herein, the term “effective amount” means, in the context of a composition, an amount of an immunogenic composition capable of inducing an immune response that reduces the incidence of or lessens the severity of infection or incident of disease in an animal. Alternatively, in the context of a therapy, the term “effective amount” refers to the amount of a therapy which is sufficient to reduce or ameliorate the severity or duration of a disease or disorder (e.g., cancer), or one or more symptoms thereof, prevent the advancement of a disease or disorder, cause the regression of a disease or disorder, prevent the recurrence, development, onset, or progression of one or more symptoms associated with a disease or disorder, or enhance or improve the prophylaxis or treatment of another therapy or therapeutic agent. The effective amount to be administered will depend upon the host receiving the modified bacteria as well as factors such as the size, weight, and age of the host.
(25) As used herein, “subject” refers to an animal or a patient for whom the described treatment is intended. In exemplary embodiments, subjects treated according to the methods provided herein are human. In other cases, subjects treated according to the methods provided herein are non-human mammals, including by way of example and not limitation, members of rodentia (e.g., mouse, rat, guinea pig), lagomorpha (e.g., rabbits, hares), perissodactyla (e.g., horses, donkeys, etc.), artodactyla (e.g., pigs, cows, sheep), carnivora (e.g., cats, canines), and primates (e.g., apes, monkeys, baboons, and humans).
(26) As used herein, the terms “treat” and “treating” refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to treat, rescue, ameliorate, or otherwise lessen an undesired symptom or condition associated with cancer or any condition associated with aberrant cell proliferation. In some cases, the term “treated” refers to any beneficial effect on progression of a disease or condition. Beneficial effects can include reversing, alleviating, inhibiting the progress of, preventing, or reducing the likelihood of the disease or condition to which the term applies or one or more symptoms or manifestations of such a disease or condition. Where the disease or condition is a cancer or cancer-associated condition, treating can refer to the management and care of a patient for the purpose of combating cancer, and can include reversing, alleviating, inhibiting the progress of, preventing, or reducing the likelihood of, or lessening the severity of any aspect of the cancer or cancer-associated condition (e.g., metastasis, tumor growth). As used herein, the terms “preventing” and “prevent” refer not only to a complete prevention of a certain disease or condition, but also to partially or substantially attenuating, reducing the risk of, or delaying the development or recurrence of the disease or condition to which the term applies.
(27) In some cases, the methods provided herein are directed to treating or preventing a cancer in a subject by administering a composition provided herein. In other cases, the present disclosure provides a method of inhibiting, retarding, or preventing growth of a tumor or tumor cells in a subject. In exemplary embodiments, colon cancer (colorectal cancer) is treated using the methods provided herein. Examples of other cancers appropriate for methods of treating or preventing as provided herein include, without limitation, lung cancer, pancreatic cancer, prostate cancer, skin cancer, bladder cancer, kidney cancer, ovarian cancer, colorectal cancer, breast cancer, cervical cancer, brain cancer, esophageal cancer, and stomach cancer. Other diseases or conditions appropriate for methods of treating or preventing as provided herein include, without limitation, lymphoma and chronic and acute leukemia.
(28) Any appropriate route or mode of administration to the subject can be employed according to a method provided herein. In some cases, administering comprises oral administration of the genetically modified Salmonella bacterium. In other cases, administering comprises intra-tumoral injection of the genetically modified Salmonella bacterium. The mode of administration can be determined based on the physical location, type, or number of tumors in the subject's body.
(29) Clinicians, physicians, and other health care professionals can administer genetically modified Salmonella bacteria to a subject in need thereof according to a method provided herein. In some cases, a single administration of the composition may be sufficient. In other cases, more than one administration of the composition is performed at various intervals (e.g., once per week, twice per week, daily, monthly) or according to any other appropriate treatment regimen. The duration of treatment can be a single dose or periodic multiple doses for as long as administration of a composition provided herein is tolerated by the subject.
(30) Any appropriate method can be practiced to determine, detect, or monitor a subject's response to treatment according to a method provided herein. As used herein, “determining a subject's response to treatment” refers to the assessment of the results of a therapy in a subject in response to administration of a composition provided herein or to treatment according to a method provided herein. For example, a subject's condition can be monitored continuously or evaluated at appropriate time intervals (e.g., at regular or irregular time points) to detect and/or monitor any changes in disease progression (e.g., change in tumor size) as an indicator of the subject's response to a composition comprising genetically modified Salmonella bacteria as described herein. In some cases, tumors can be measured to detect or monitor any change in, for example, tumor size or tumor growth rate (e.g., tumor expansion or shrinkage, inhibited or accelerated tumor growth rate). For example, detection methods such as computed tomography (CT), magnetic resonance imaging (MRI) scanning, and x-ray (e.g., chest x-ray) can be used. In some cases, ultrasound examinations can be used to detect and measure tumor regression or to detect progression of lesions. In other cases, evaluation of a tumor can involve cytology or histology of, for example, biopsy samples. For solid tumors, evaluation of a subject's response to treatment as provided herein can include assessing RECIST (“Response Evaluation Criteria in Solid Tumors”). RECIST criteria can be used to evaluate a subject's response to the therapy used to treat their disease or condition. See, for review, Therasse et al., J. Natl. Cancer Inst. 92:205-16, 2000.
(31) The term “promoter”, as used herein, may mean a synthetic or naturally-derived molecule which is capable of conferring, activating or enhancing expression of a nucleic acid in a cell. A promoter may comprise one or more specific transcriptional regulatory sequences to further enhance expression and/or to alter the spatial expression and/or temporal expression of same.
(32) The terms “nucleic acid” and “nucleic acid molecule,” as used herein, refer to a compound comprising a nucleobase and an acidic moiety, e.g., a nucleoside, a nucleotide, or a polymer of nucleotides. Nucleic acids generally refer to polymers comprising nucleotides or nucleotide analogs joined together through backbone linkages such as but not limited to phosphodiester bonds. Nucleic acids include deoxyribonucleic acids (DNA) and ribonucleic acids (RNA) such as messenger RNA (mRNA), transfer RNA (tRNA), etc. Typically, polymeric nucleic acids, e.g., nucleic acid molecules comprising three or more nucleotides are linear molecules, in which adjacent nucleotides are linked to each other via a phosphodiester linkage. In some embodiments, “nucleic acid” refers to individual nucleic acid residues (e.g. nucleotides and/or nucleosides). In some embodiments, “nucleic acid” refers to an oligonucleotide chain comprising three or more individual nucleotide residues. As used herein, the terms “oligonucleotide” and “polynucleotide” can be used interchangeably to refer to a polymer of nucleotides (e.g., a string of at least three nucleotides). In some embodiments, “nucleic acid” encompasses RNA as well as single and/or double-stranded DNA. Nucleic acids may be naturally occurring, for example, in the context of a genome, a transcript, an mRNA, tRNA, rRNA, small interfering RNA (siRNA), small nuclear RNA (snRNA), a plasmid, cosmid, chromosome, chromatid, or other naturally occurring nucleic acid molecule. On the other hand, a nucleic acid molecule may be a non-naturally occurring molecule, e.g., a recombinant DNA or RNA, an artificial chromosome, an engineered genome, or fragment thereof, or a synthetic DNA, RNA, DNA/RNA hybrid, or include non-naturally occurring nucleotides or nucleosides. Furthermore, the terms “nucleic acid,” “DNA,” “RNA,” and/or similar terms include nucleic acid analogs, i.e. analogs having other than a phosphodiester backbone. Nucleic acids can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, and backbone modifications. A nucleic acid sequence is presented in the 5′ to 3′ direction unless otherwise indicated. In some embodiments, a nucleic acid is or comprises natural nucleosides (e.g. adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadeno sine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2′-fluororibose, ribose, 2′-deoxyribose, arabinose, and hexose); and/or modified phosphate groups (e.g., phosphorothioates and 5′-N-phosphoramidite linkages).
(33) Nucleic acids and/or other constructs of the disclosure may be isolated. As used herein, “isolated” means to separate from at least some of the components with which it is usually associated whether it is derived from a naturally occurring source or made synthetically, in whole or in part.
(34) The terms “protein,” “peptide,” and “polypeptide” are used interchangeably herein and refer to a polymer of amino acid residues linked together by peptide (amide) bonds. The terms refer to a protein, peptide, or polypeptide of any size, structure, or function. Typically, a protein, peptide, or polypeptide will be at least three amino acids long. A protein, peptide, or polypeptide may refer to an individual protein or a collection of proteins. One or more of the amino acids in a protein, peptide, or polypeptide may be modified, for example, by the addition of a chemical entity such as a carbohydrate group, a hydroxyl group, a phosphate group, a farnesyl group, an isofarnesyl group, a fatty acid group, a linker for conjugation, functionalization, or other modification, etc. A protein, peptide, or polypeptide may also be a single molecule or may be a multi-molecular complex. A protein, peptide, or polypeptide may be just a fragment of a naturally occurring protein or peptide. A protein, peptide, or polypeptide may be naturally occurring, recombinant, or synthetic, or any combination thereof. A protein may comprise different domains, for example, a nucleic acid binding domain and a nucleic acid cleavage domain. In some embodiments, a protein comprises a proteinaceous part, e.g., an amino acid sequence constituting a nucleic acid binding domain.
(35) Nucleic acids, proteins, and/or other moieties of the disclosure may be purified. As used herein, purified means separate from the majority of other compounds or entities. A compound or moiety may be partially purified or substantially purified. Purity may be denoted by weight measure and may be determined using a variety of analytical techniques such as but not limited to mass spectrometry, HPLC, etc.
(36) In interpreting this disclosure, all terms should be interpreted in the broadest possible manner consistent with the context. It is understood that certain adaptations of the disclosure described in this disclosure are a matter of routine optimization for those skilled in the art, and can be implemented without departing from the spirit of the disclosure, or the scope of the appended claims.
(37) So that the compositions and methods provided herein may more readily be understood, certain terms are defined:
(38) As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. Any reference to “or” herein is intended to encompass “and/or” unless otherwise stated.
(39) The terms “comprising”, “comprises” and “comprised of” as used herein are synonymous with “including”, “includes” or “containing”, “contains”, and are inclusive or open-ended and do not exclude additional, non-recited members, elements, or method steps. The phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting. The use of “including,” “comprising,” “having,” “containing,” “involving,” and variations thereof, is meant to encompass the items listed thereafter and additional items. Embodiments referenced as “comprising” certain elements are also contemplated as “consisting essentially of” and “consisting of” those elements. Use of ordinal terms such as “first,” “second,” “third,” etc., in the claims to modify a claim element does not by itself connote any priority, precedence, or order of one claim element over another or the temporal order in which acts of a method are performed. Ordinal terms are used merely as labels to distinguish one claim element having a certain name from another element having a same name (but for use of the ordinal term), to distinguish the claim elements.
(40) The terms “about” and “approximately” shall generally mean an acceptable degree of error for the quantity measured given the nature or precision of the measurements. Typical, exemplary degrees of error are within 10%, and preferably within 5% of a given value or range of values. Alternatively, and particularly in biological systems, the terms “about” and “approximately” may mean values that are within an order of magnitude, preferably within 5-fold and more preferably within 2-fold of a given value. Numerical quantities given herein are approximate unless stated otherwise, meaning that the term “about” or “approximately” can be inferred when not expressly stated.
(41) Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. As used herein and in the claims, the singular forms “a,” “an,” and “the” include the singular and the plural reference unless the context clearly indicates otherwise. Thus, for example, a reference to “an agent” includes a single agent and a plurality of such agents. Any reference to “or” herein is intended to encompass “and/or” unless otherwise stated.
(42) Various exemplary embodiments of compositions and methods according to this disclosure in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and the following examples and fall within the scope of the appended claims. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the disclosure described herein. Such equivalents are intended to be encompassed by the following claims.
EXAMPLES
(43) The following examples will enable one of skill in the art to more readily understand the principles thereof. The following examples are presented by way of illustration and are not meant to be limiting in any way.
(44) The inventor previously developed a self-destructing Salmonella lysis system in which the bacteria are attenuated, yet capable of synthesizing a selected protein or harboring a DNA vaccine, to serve as vaccine delivery platforms against various infectious diseases. The Salmonella lysis system contained two components: a lysis Salmonella strain and a lysis vector. The Salmonella lysis strains harbor a deletion of asdA and the arabinose-regulated expression of murA, two genes required for the synthesis of the peptidoglycan layer of the bacterial cell wall. They also contain additional mutations intended to enhance bacterial cell lysis and antigen or DNA vaccine delivery. The lysis vector cooperatively works with its host Salmonella lysis strain to facilitate the arabinose-dependent bacterial cell wall synthesis needed for bacterial reproduction. Upon invasion of host tissues, which is an arabinose-free environment, synthesis of the bacterial cell wall eventually ceases. This leads to bacterial cell lysis to release cell contents after bacteria accumulate in host tissues and accomplish Salmonella self-eradicating. Experiments were undertaken to genetically engineer the lysis strains into a versatile set of tumor navigating anti-cancer material delivering vehicles.
(45) Five to six percent of individuals will develop colorectal cancer (CRC) over their lifetime in the United States. The heavy burden that CRC imposes on our society emphasizes the need to develop effective strategies to prevent and treat this disease. It has been reported that mutations of the adenomatous polyposis coli (APC) gene predispose individuals to familial adenomatous polyposis (FAP), characterized by multiple tumors in the large intestine. Mice carrying a CDX2P-NLS-Cre recombinase transgene and a loxP-targeted Apc allele develop mainly colorectal tumors after tamoxifen induction. A transgenic Apc.sup.flox/flox/CDX2-CRE colon tumor mouse models greatly mimic human FAP-associated colorectal cancer and sporadic colorectal cancer. Moreover, direct orthotopic cell microinjection, between the mucosa and the muscularis externa layers of the cecal wall of immunocompromised NOD. Cg-Prkdcscid II2rgtm1Wjl/SzJ (NSG™) mice, induces tumor foci in the most relevant metastatic sites observed in humans. The application of this procedure to the human colorectal cancer cell lines HCT-116 yielded high tumor takes and dissemination rates, replicating the metastatic spread to lymph nodes, liver, lung, and peritoneum observed in advanced human colorectal cancer. To faithfully recapitulate human CRC, in addition to allograft and xenograft subcutaneous tumor models, the transgenic and orthotopic colon tumor mouse models were used to evaluate our re-engineered GMS therapeutic strains on inhibition of tumor growth and cancer metastasis.
(46) The Salmonella chemotaxis system was engineered to develop tumor navigating, self-eradicating, and TRAIL-armed genetically engineered Salmonella. These GMS hold tumor-navigating features and are able to release TRAIL into tumor bed via Salmonella cell lysis leading to the induction of tumor cell apoptosis. These GMS were comprehensively evaluated to assure the safety and demonstrate their efficacy on the suppression of cancer growth and metastasis in subcutaneous, orthotopic, and transgenic colon cancer mouse models. These GMS dramatically induced a variety of types of cancer cell death in vitro. Intra-tumor (IT) injected GMS significantly reduced tumor growth in both allograft and xenograft subcutaneous colon cancer mouse models. Moreover, oral administrated (OR), a convenient and less toxic route than parenteral administration, GMS reduced significant tumor growth in the transgenic CRC mouse model and inhibited metastasis in the xenograft orthotopic colon cancer mouse model.
(47) Materials and Methods
(48) Attachment and invasion assay of GMS strain in cancer cells
(49) This assay was performed following the protocol previously described by S. Stender et al., with minor modifications. Briefly, 0.1×10.sup.6 HCT-116 or CT-26 cells were seeded into a 4-well Nunc® Lab-Tek® Chamber Slide (154526, Thermo Fisher Scientific) for 24 hours in a tissue culture medium containing 10% FBS. GMS strains were grown overnight in LA broth and then diluted 1:20 into a fresh LA medium, grown until OD.sub.600 nm reached 0.9. To start the assay, bacteria were spun down and re-suspended with 500 μl of tissue culture medium without FBS. HCT-116 or CT-26 cells were incubated with the bacteria suspension at a multiplicity of infection (MOI; the number of bacteria per cell) of 200:1 at 37° C., 5% CO.sub.2 for 90 minutes. Then the cells were washed three times with phosphate-buffered saline (PBS) and fixed in PBS containing 3.7% paraformaldehyde. Extracellular bacteria were stained with a mouse monoclonal anti-Salmonella antibody (NB110-16952, Novus Biological, 1:200) and a secondary anti-mouse-Alexa Fluor 488 conjugate (A11001, Thermo Fisher Scientific, 1:200). After permeabilization of the cell membrane (3 minutes in PBS, 0.1% Triton X-100), intracellular bacteria were stained with the anti-Salmonella antibody (NB110-16952, Novus Biological, 1:200) and a secondary anti-mouse-Alexa Fluor 555 conjugate (A21422, Thermo Fisher Scientific, 1:200). The nuclei of cancer cells were stained with 4,6-diamidino-2-phenylindole (DAPI). Samples were mounted and analyzed using an EVOS™ FL Auto Imaging System (Thermo Fisher Scientific).
(50) Apoptosis Cell Detection by Flow Cytometry Analysis
(51) Cancer cells were harvested after being treated with the control vehicle or desired GMS stains at a MOI of 20:1 for 16 hours. Cell death was detected using the Annexin V-FITC kit (4830-01-K, Trevigen) or FITC Annexin V Apoptosis Detection Kit (640914, Biolegend) following the manufactory protocols. Samples were then analyzed by flow cytometry (Beckman counter). The percentage of dead cells from each sample was analyzed using Kaluza Analysis Software (Beckman counter).
(52) Transwell Chemotaxis Assays
(53) 0.5×10.sup.6/well of HCT-116 or CT-26 cells were cultured in a 6-well plate with a medium containing 10% FBS for 24 hours before the assay, and then the cells were cultured in the 1.5 mL tissue medium without FBS during the assay. GMS strains were grown overnight in LA broth, and then diluted 1:20 into fresh LA medium grown until OD600 nm reached 0.9. Next, 200 μl bacteria solutions from each GMS strain were span down and re-suspended into 200 μl tissue culture media, then added to the top of the insert wells (3 μm pore) (353092, BD Falcon) and covered with an 800 μl soft swimming agar layer (0.25% agar, 1% tryptone). The insert wells with GMS strains were put into the 6-well plates with HCT-116 or CT-26 cells to incubate at 37° C. for 6 hours. 100 μl culture media from the bottom section were 182 sub-cultured on a LA agar plate at 37° C. for 16 hours. Colonies from each plate were counted.
(54) Animal Models
(55) All animal experiments conform to our animal protocols approved by the Institutional Animal Care and Use Committee. We aimed for at least three animals per group (range 3-12 mice) to allow basic statistical inference while using a justifiable number of mutant mice. Mice of similar ages were randomly allocated into different groups.
(56) Subcutaneous CT-26 tumors in BALB/c mice: BALB/c mice were purchased from Charles River Laboratories (Worcester, MA). 1×10.sup.5 CT-26 cells were injected into the flanks of the BALB/c mice at 6-8 weeks old. For the colonization assay, 1×10.sup.8 CFU of each GMS strain in 20 μl of PBS was intra-tumor injected when the tumor size reached 0.3 mm.sup.3 (3 mice/group). Mice were euthanized at day 9 post-inoculation, and their spleens and tumors were collected aseptically. Tissues were homogenized and plated on LB agar with 0.2% arabinose to evaluate colonization and persistence, and onto LB agar plates without arabinose to confirm arabinose dependency. For the safety and anti-cancer efficacy assays, mice were treated with 1×10.sup.8 CFU GMS strain in 20 μl of PBS by intra-tumor injection when the tumor size reached 0.3 mm.sup.3.
(57) Subcutaneous HCT-116 tumors in NSG™ mice: NSG™ mice were obtained from Jackson Laboratory. About 1×10.sup.6 HCT-116 cells were injected into the flanks of NSG™ mice at 6-8 weeks old. These mice were treated with GMS strains (20 μl, 1×10.sup.9 CFU in PBS) by intra-tumor injection when the tumor size reached 0.3 mm.sup.3.
(58) Transgenic APC.sup.flox/flox and CDX2-CRE tumor models: APC.sup.flox/flox and CDX2-CRE mice (Jackson Laboratory) were crossed to generate C57BL/6J (Apc.sup.flox/flox/CDX2-CRE) mice. At 8 weeks old, Apc.sup.flox/flox/CDX2-CRE mice were injected with Tamoxifen (T5648-19, Sigma-Aldrich) (IP, 25 mg/kg body weight) in sunflower seed oil (S1929, Spectrum) to induce polypus formation in the large intestine. These mice were orally treated with GMS strains (30 μl, 1×10.sup.9 CFU) 10 days post Tamoxifen induction. Mice were euthanized 10 days after inoculation, and the colorectal polypi were analyzed. For survival assay, mice were treated orally with GMS every 10 days for three treatments, beginning 10 days post-Tamoxifen injection.
(59) Liver metastasis in NSG™ orthotopic mouse models: about 5×10.sup.4 HCT-116 cells were injected into the cecal wall of NSG™ mice at 8 weeks old. Mice were orally treated with GMS strains (30 μl, 1×10.sup.9 CFU) 7 days after surgery. Mice were euthanized 35 days after inoculation, and the tumor numbers in livers were recorded.
(60) Immunohistochemical Staining
(61) Paraffin-embedded tissue sections (5 μm thick) were stained with an anti-Ki67 rabbit antibody (12202, 1:400, cell signaling technology) or an anti-Salmonella rabbit antibody (NB600-1087, 1:200, Novus Biologicals) overnight at 4° C. The immunohistochemical staining was completed by using a VECTASTAIN Elite ABC HRP Kit (PK-6100, Vector laboratory) and a DAB Peroxidase (HRP) Substrate Kit (SK-4100, Vector laboratory) following the manufacturer's protocols. Samples were mounted and analyzed using an EVOS™ 227 FL Auto Imaging System (Thermo Fisher Scientific).
(62) Isolation of Immunocytes from Tumor and Flow Cytometry Analysis
(63) CT-26 cells (approximately 1×10.sup.5) were implanted in the hind flanks of BALB/c mice. When tumors reached 150 mm.sup.3 in volume (day 0), mice were treated with PBS or GMS515(pK5097). Tumor tissues were carefully separated on day seven post-treatment. For transgenic Apc.sup.flox/floxCDX2-CRE mice, polyps were isolated under the dicing microscope were weighted and minced. Then tumor tissues were minced and digested using digestion buffer (RPMI medium containing 5% FBS, 200 units/ml of collagenase, and 25 U/ml DNase I) (Gibco) for 1 hour at 37° C. under slow rotation. Discontinuous (44% and 67%) percoll (GE) separation method was used to enrich immunocytes. Immunocyte cells isolated from tumor were incubated for 30 min on ice with the appropriate combination of the following antibodies (Biolegend) in staining buffer (PBS with 0.1% BSA) at the following dilution: CD45-PB (1:200), or CD45-FITC (1:200), CD3-PB (1:100), CD8a-PE-Cy7 (1:100), CD107a-FITC (1:50), IFN-γ-FITC (1:50), CD335-PE (1:100). For analysis of IFNγ positive T cells and NK cells, isolated colonic immune cells (approximately 5×10.sup.6 cells/well) were incubated with CT-26 tumor cells (approximately 1×10.sup.6 cells/well) in a 6-well plate with brefeldin A, 5 μg/m1 (Biolegend) in RPMI supplemented medium with 10% FBS. Cells were incubated at 37° C. for 4 hours, then were washed and stained with cell surface markers. Cells were fixed and permeabilized using a Cytofix/Cytoperm kit (BD biosciences) followed by intracellular cytokine detection with anti-IFNγ-FITC (1:50) in a permeabilization buffer at 4° C. for 30 minutes. After the cells were washed twice with 1 ml of the labeling buffer, they were analyzed on a Gallios flow cytometer (Beckman Coulter).
(64) Bacterial Strains and Plasmids
(65) Bacterial strains, plasmids, and primers used in this study are provided herein. S. Typhimurium strains with asdA gene deletions were grown at 37° C. in LB broth or on LB agar supplemented with 50 μg/ml DAP. Transformants containing araC PBAD asdA murA plasmids were selected on LB agar plates containing 0.2% arabinose (LA). LB agar, containing 5% sucrose and no sodium chloride, was used for sacB gene-based counter-selection in allelic exchange experiments. When required, 25 μg/ml chloramphenicol was added to the culture media. For mouse inoculation, Salmonella strains were grown with aeration in LA broth to an optical density at 600 nm (OD600) of 0.9 from a non-aerated static overnight culture. Salmonella cells were resuspended in PBS at appropriate CFU. The exact CFU of each inoculum were determined by titer tests after inoculation.
(66) General DNA Procedures
(67) DNA manipulations were carried out as described by Sambrook et al. Oligonucleotides were synthesized by Integrated DNA Technologies (IDT). Escherichia coli and Salmonella were transformed by electroporation. Suicide vector technology was used to generate precise deletion/deletion-insertion mutations. Conjugational transfer of suicide vectors was performed using the suicide vector donor strain χ7213. PCR amplification was used to obtain DNA fragments for cloning and verification of chromosomal deletion mutations. All plasmid constructs and chromosomal deletion mutations were further verified by nucleotide sequencing.
(68) Construction of tumor-navigating strains GMS410 and GMS515
(69) Suicide vectors pK4946 (ΔP.sub.tar::P.sub.trc ΔlacO tar) and pK4947 (ΔP.sub.tsr::P.sub.trc ΔlacO tsr) were constructed using primers listed in Table 1. Briefly, DNA cassettes (the upstream DNA flanking sequence promoter P.sub.trc ΔlacO—downstream flanking sequence) were inserted into the suicide vector pRE112 (Table 1). Suicide vector pK4948 (for mutation Δtrg) was constructed by inserting the flanking sequence of gene trg into suicide vector pRE112. To test the tumor-navigating feature of mutations ΔP.sub.tar::P.sub.trc ΔlacO tar, ΔP.sub.tsr::P.sub.trc ΔlacO tsr, and Δtrg, each single mutation was created in Salmonella by conjugating wild-type strain χ3761 with E. coli strain χ7213 carrying suicide vector pK4946, pK4947, or pK4948. The resulting strains were named GMS371, GMS372, and GMS525 (Table 1). Then, single mutation ΔP.sub.tar::P.sub.trc ΔlacO tar or triple mutations ΔP.sub.tar::P.sub.trc ΔlacO tar, ΔP.sub.tsr::P.sub.trc ΔlacOtsr, and Δtrg, were introduced into strain GMS409 by conjugation to achieve the tumor-navigating strains GMS410 and GMS515, respectively.
(70) The promoter sequence for P.sub.trc ΔlacO DNA cassette is set forth in the accompanying sequence listing as SEQ ID NO:1:
(71) TABLE-US-00001 (SEQ ID NO: 1) 5′-ATTCTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAAT −35 −10 GTGTAGATGCGTAGGCACCTGTTACGACGAACCACACAGGAAACAGA random sequence SD CC-3′
(72) Nucleic acid sequences for plasmids pK4946, pK4947, and pK4948 are provided as SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:6, respectively.
(73) Construction of TRAIL Expressing Lysis Vector pK5079
(74) The cDNA fragment of human TRAIL gene (GenBank: ABM84955.1) was derived from plasmid pDNR-Dual_with_human_insert (Clone ID: HsCD00001122, DNASU). The amplified TRAIL sequence was inserted into lysis vector pYA3681 to achieve TRAIL expressing lysis vector pK5079 (see
(75) Construction of Suicide Vectors to Create GMS Strains Preventing Salmonella-Induced PD-L1 Overexpression.
(76) Suicide vectors pK4951 (ΔsseL), pK4952 (ΔspvD), and pK4953 (ΔssrAB) were constructed using primers listed in Table 1. Briefly, DNA cassettes (the upstream DNA flanking sequence- downstream flanking sequence) were inserted into the suicide vector pRE112 (Table 1). Suicide vectors pK4951 (for mutation SseL), pK4952 (for mutation SpvD), and pK4953 (for mutation SsrAB) were constructed by inserting the flanking sequence of genes sseL, spvD, and ssrAB into suicide vector pRE112, respectively. To test the effect of these mutations on Salmonella-induced PD-L1 overexpression, ΔsseL, ΔspvD, and ΔssrAB, each single mutation will be created in Salmonella by conjugating wild-type strain χ3761 with E. coli strain χ7213 carrying suicide vector pK4951, pK4952, or pK4953. Then, single mutation ΔsseL, ΔspvD, and ΔssrAB will be introduced into strain GMS515 by conjugation, respectively.
(77) Nucleic acid sequences for plasmids pK4951, pK4952, and pK4953 are provided as SEQ ID NO:41, SEQ ID NO:42, and SEQ ID NO:43, respectively.
(78) Strain Characterization
(79) The GMS strains were compared with vector controls for the stability of plasmid maintenance over 50 generations, arabinose-dependent growth, and protein synthesis. Molecular genetic attributes were confirmed by PCR and sequencing with appropriate primers. Lipopolysaccharide profiles of GMS strains were examined. For detection of constitutive over-expression of chemoreceptors Tar and Tsr in GMS strains, 12 μl and 2 μl of bacterial cultures at an OD.sub.600 of 0.9 were subjected to an SDS/PAGE and immunoblot analysis, respectively.
(80) Growth Curve of GMS Strains
(81) Cells were grown in LB-broth at 37° C. until reaching the early stationary phase. A 1:100 dilution of a saturated culture in LB was incubated at 185 rpm. The OD.sub.600 was measured at different time points over 8 hours. The data are presented as the means and SD from three independent experiments.
(82) TABLE-US-00002 TABLE 1 Bacterial strains, plasmids, and primers used in this study Strain or Plasmid Description Source Escherichia coli χ6212 Δasd-DH5α derivative Kang HY, Srinivasan J, Curtiss R, 3rd. Immune responses to recombinant pneumococcal PspA antigen delivered by live attenuated Salmonella enterica serovar typhimurium vaccine. Infect Immun 2002; 70:1739-49. χ7213 F-supE42 λt3rthi-1 thr-1 Roland K, Curtiss R, 3rd, leuB6 supE44 Sizemore D. Construction tonA21 fhuA21 lacY1 and evaluation of a delta cya recA1 RP4 2-Tc::Mu delta crp Salmonella (λpir) ΔasdA4 Δ(zhf-2::Tn10) typhimurium strain expressing avian pathogenic Escherichia coli O78 LPS as a vaccine to prevent airsacculitis in chickens. Avian Dis 1999; 43:429-41. Salmonella enterica serovar Typhimurium χ3761 Wild-type Kong W, Wanda SY, Zhang X, et al. Regulated programmed lysis of recombinant Salmonella in host tissues to release protective antigens and confer biological containment. Proc Natl Acad Sci USA 2008; 105:9361-6. GMS371 ΔP.sub.tar:P.sub.trc .sub.ΔlacO tar This study (previously referred to as χ11371) GMS372 ΔP.sub.tsr::P.sub.trc .sub.ΔlacO tsr This study (previously referred to as χ11372) GMS525 Δtrg This study (previously referred to as χ11525) GMS526 tar-Flag-tag in χ3761 This study (previously referred to as χ3761 tar-tag) GMS527 tsr-c-Myc-tag in χ3761 This study (previously referred to as χ3761 tsr-tag) GMS528 ΔP.sub.tar::P.sub.trc .sub.ΔlacO tar- This study (previously Flag-tag in GMS371 referred to as χ11371 tar-tag) GMS529 ΔPtsr: :P.sub.trc .sub.ΔlacO tsr This study (previously c-Myc-tag in GMS372 referred to as χ11372 tsr-tag) χ11021 ΔP.sub.murA::TT araC P.sub.BAD murA Juarez-Rodriguez MD, Yang ΔasdA::TT J, Kader R, et al. Live araC P.sub.BAD c2 attenuated Salmonella ΔaraBAD Δ(gmd-fcl) Δpmi vaccines displaying regulated χrelA::TT araC delayed lysis and delayed P.sub.BAD lacI antigen synthesis to confer protection against Mycobacterium tuberculosis. Infect Immun 2012; 80:815- 31. GMS409 ΔP.sub.murA::TT araC P.sub.BAD murA This study (previously Δasd::TT araC P.sub.BAD c2 referred to as χ11409) Δ(araC P.sub.BAD)::P22 P.sub.R araBAD Δ(wza-wcaM) Δpmi ΔrelA::araC P.sub.BAD lacI TT ΔpagP::P.sub.lpp lpxE ΔendA GMS410 ΔP.sub.murA::TT araC P.sub.BAD murA This study (previously Δasd::TT araC P.sub.BAD c2 referred to as χ11410) Δ(araC P.sub.BAD)::P22 P.sub.R araBAD Δ(wza-wcaM) Δpmi ΔrelA::araC P.sub.BAD lacI TT ΔpagP::P.sub.lpp lpxE ΔendA ΔP.sub.tar::P.sub.trc .sub.ΔlacO tar GMS515 ΔP.sub.murA::TT araC P.sub.BAD murA This study (previously Δasd::TT araC P.sub.BAD c2 referred to as χ11515) Δ(araC P.sub.BAD)::P22 P.sub.R araBAD Δ(wza-wcaM) Δpmi ΔrelA::araC P.sub.BAD lacI TT ΔpagP::P.sub.lpp lpxE ΔendA ΔP.sub.tar::P.sub.trc .sub.ΔlacO tar ΔPtsr::P.sub.trc .sub.ΔlacO tsr Δtrg S. Typhimurium GMS strains GMS409 GMS409 carrying TRAIL- This study (pK5079) expressing plasmid pK5079 GMS410 GMS410 carrying TRAIL- This study (pK5079) expressing plasmid pK5079 GMS515 GMS515 carrying TRAIL- This study (pK5079) expressing plasmid pK5079 Plasmids Asd.sup.+/MurA.sup.+ expression lysis vectors pYA3681 Asd.sup.+/MurA.sup.+ expression lysis Kong W, Wanda SY, Zhang vector containing X, et al. Regulated pBR ori araC P.sub.BAD programmed lysis of SD-GTG asdA SD-GTG recombinant Salmonella in murA P22P.sub.R anti-sense host tissues to release mRNA prokaryotic protective antigens and confer expression biological containment. Proc cassette Natl Acad Sci USA 2008; 105:9361-6. pK5079 Asd.sup.+/MurA.sup.+ expression lysis This study (previously vector containing pBR referred to as pYA5079) ori araC P.sub.BAD SD-GTG asdA SD-GTG murA P22P.sub.R anti-sense mRNA prokaryotic expression cassette of human TRAIL Suicide vectors pK4946 To create genome mutation This study (previously ΔP.sub.tar::P.sub.trc .sub.ΔlacO tar referred to as pYA4946) pK4947 To create genome mutation This study (previously ΔPtsr::P.sub.trc .sub.ΔlacO tsr referred to as pYA4947) pK4948 To create genome mutation Δtrg This study (previously referred to as pYADtrg or PYA5077) pK4949 To create genome Tar-Flag-tag This study PK4950 To create genome Tsr-c-Myc-tag This study pK4951 To create genome mutation ΔsseL This study pK4952 To create genome mutation ΔspvD This study pK4953 To create genome mutation This study ΔssrAB Primers Name Sequence A. Construction of plasmid pK5079 C-Nco I TRAIL 5′GACGTCCCATGGCTATGATGGAGGTCCAGGGG 3681 5′ (SEQ ID NO: 8) C-Xma I TRAIL 5′CTGCAGCCCGGGCTAGCCAACTAAAAAGGCCCC 3681 3′ (SEQ ID NO: 9) B. Construction of suicide vectors pK4946 tar/cheM 5′CATCGCCAATACACCGGCCTTTATAAA Primer 1 (SEQ ID NO: 10) tar/cheM 5′CTACACATTATACGAGCCGGATGATTAATTGTCAACAG Primer 2 CTCATTTCAGAATCGCGGGCGATGAAGAGGCACTCTC (SEQ ID NO: 11) tar/cheM 5′GGCTCGTATAATGTGTAGATGCGTAGGCACCTGTTACG Primer 3 ACGAACCACACAGGAAACAGACCATGTTTAACCGTATCC GCGTTGTCAC (SEQ ID NO: 12) tar/cheM 5′GAAGTAGGCATCCATATTGCCATTGTC Primer 4 (SEQ ID NO: 13) PK4947 tsr Primer 1 5′GTCGTTATTGATAACCGCCGGCGTCGC (SEQ ID NO: 14) tsr Primer 2 5′CTACACATTATACGAGCCGGATGATTAATTGTCAACAG CTCATTTCAGAATATCACATAAAATAGCCCACGCCCTCC (SEQ ID NO: 15) tsr Primer 3 5′GGCTCGTATAATGTGTAGATGCGTAGGCACCTGTTACG ACGAACCACACAGGAAACAGACCATGTTAAAGCGAATTAA AATTGTTACC (SEQ ID NO: 16) pK4952 spvD Primer 1 5′-CCCAAGCTTCTCAGGGCAAATTTGCCGGTGACA (SEQ ID NO: 33) spvD Primer 2 5′- TAAAATGAATATTTAAAAAAGTTAAGTTACACTACCTCA ATAAAATGC (SEQ ID NO: 34) spvD Primer 3 5′- GCATTTTATTGAGGTAGTGTAACTTAACTTTTTTAAATAT TCATTTTA (SEQ ID NO: 35) spvD Primer 4 5′-CCCAAGCTTGCTGTACACAAAACGGACTGCACC (SEQ ID NO: 36) pK4953 ssrAB Primer 1 5′-CGGGAATTCGCTACTACTTGTGGTATAATAACC (SEQ ID NO: 37) ssrAB Primer 2 5′-CTTAATACCATCGGACGCCCCTGGAATGCTTCCC TCCAGTTGCCTGTT SEQ ID NO: 38) ssrAB Primer 3 5′-AACAGGCAACTGGAGGGAAGCATTCCAGGGGCGTC CGATGGTATTAAG (SEQ ID NO:39) ssrAB Primer 4 5′-CGGGAATTCTGATCCGAGAGATTCCATCCGCTA (SEQ ID NO: 40)
(83) Results
(84) Reprogramming Salmonella Chemotaxis System for Tumor-Navigating
(85) We have improved our self-eradicating Salmonella strains to better serve the delivery purpose. Lysis strain GMS409 was engineered to not only harbor the genetic attributes for self-eradicating feature, but also to display genetic characteristics for regulated delayed attenuation, delayed antigen synthesis, and reduced endotoxic activity. However, such GMS strain could not target either cancer cells or tumors. To transform a vaccine delivery strain GMS409 into a universal tumor-navigating delivery vehicle for cancer therapy, our approach was to reprogram the Salmonella chemotaxis system to enhance its chemotaxis toward particular tumor secreting amino acids. Such strategy will allow maximized GMS tumor-eradicating and release of an anti-cancer agent inside of the tumor during the self-eradicating process to trigger bacteria-based oncolysis.
(86) In order to achieve this goal, we first replaced the promoters of the genes encoding chemoreceptors Tar (tar) and Tsr (tsr), respectively, with the Ptrc promoter for constitutive chemoreceptor synthesis. Salmonella strains GMS371 carrying single deletion-insertion mutation ΔP.sub.tar::P.sub.trc ΔlacO tar and GMS372 harboring single deletion-insertion mutation ΔP.sub.tsr::P.sub.trc ΔlacO tsr were created using Salmonella wild-type strain χ3761 (Table 1). The constitutive overexpression of chemoreceptors Tar and Tsr in GMS371 and GMS372, respectively, was confirmed by SDS electrophoresis and western blot assay. In addition, strains GMS371 and GMS372 showed similar growth and swimming speed comparing to their wild-type Salmonella parent strain χ3761. Chemotaxis assay was performed to demonstrate the ideal enhancement of chemotaxis caused by each deletion-insertion mutation. We found that GMS371 and GMS372 are significantly more attracted to aspartate and serine, respectively, than the wild-type strain χ3761. To further enhance the Salmonella accumulation in the layer of tumor quiescent cells, other than the necrotic core, the ribose/galactose receptor trg gene was deleted (
(87) Building Up Tumor-Targeting Self-Eradicating TRAIL Delivery Vehicles
(88) A human TRAIL-expressing lysis vector pK5079 was constructed by inserting the TRAIL coding sequence into lysis vector pYA3681 to assemble a self-eradicating Salmonella lysis system for cancer therapy. The repressor Lad, expressed from the built-in chromosomal lac/gene under arabinose-regulated araC P.sub.BAD promoter, will turn off TRAIL synthesis in vitro to avoid the reduced growth rates and a compromised ability to colonization caused by high-level production of foreign protein. The diagram of the model illustrating the regulatory of TRAIL synthesis in the GMS strain is shown in
(89) Reprogrammed Chemotaxis System Endues GMS Strains Superior Ability of Cancer Cell Seeking, Attaching and Invading
(90) To validate whether the GMS with chemoreceptor modifications could obtain cancer cell-navigating feature, a transwell culture system was used. A swimming agar layer was used as a barrier between GMS strains and colon cancer cells GMS strains were cultured in the upper compartment of the transwell culture system, while mouse colon cancer CT-26 or human colon cancer HCT-116 cells were grown in the lower compartment. The swimming agar layer and micropores in the insert membrane allow GMS strains to cross freely (
(91) Reprogrammed GMS Strains Efficiently Induced Colon Cancer Cell Death In Vitro
(92) To examine whether the reprogrammed GMS strains have the potential for cancer treatment, the multiple cytotoxic features against cancer cells built into the reprogrammed GMS strains were evaluated in vitro. We first validated the level of activated caspase-3, which is the key “executioner” caspase in the apoptotic cascade, after incubating CT-26 and HCT-116 cells with GMS strains, respectively. It was observed that both cancer cells co-incubated with GMS410(pK5079) or GMS515(pK5079) had higher levels of active caspase-3 protein and lower levels of pro-caspase-3, comparing to the cells co-incubated with GMS409(pK5079). Our results indicate that the self-eradicating TRAIL delivering GMS strains, with reprogrammed chemotaxis system, are able to promote the apoptotic cascade through caspase-3 activation (
(93) Reprogrammed GMS Suppress Tumor Growth In Vivo
(94) The engineered TRAIL-delivering GMS strains with reprogrammed chemotaxis system, displaying multiple cancer-killing features, have the potential to function as cancer therapeutics (
(95) We further evaluated the efficacy of strains GMS410(pK5079) and GMS515(pK5079) on cancer therapy in vivo using a human colon cancer HCT-116 cell xenograft mouse model (
(96) Evaluation of Reprogrammed GMS Strains Using a Transgenic Colon Tumor Mouse Model
(97) In addition to allograft and xenograft subcutaneous tumor models, GMS strains were evaluated in a transgenic Apc.sup.flox/flox/CDX2-CRE colon tumor mouse model, which mimic human FAP associated colorectal cancer and sporadic colorectal cancer (
(98) Reprogrammed GMS Strains-Based Therapy for Metastatic Cancer in an Orthotopic Xenograft Mouse Model
(99) Colorectal cancer is one of the leading causes of cancer mortality because of its metastasis. Liver is the most common organ for colon cancer metastasis. To investigate whether GMS410(pK5079) and GMS515(pK5079) are able to inhibit liver metastasis from orthotopically implanted colon cancer, the HCT-116 cells expressing luciferase were injected into the cecum wall of NSG™ mice. At day 7 post-surgery, mice were orally inoculated with PBS, GMS409(pK5079), GMS410(pK5079), or GMS515(pK5079) once per week for 5 weeks (
(100) Discussion
(101) Despite many advances in conventional methods such as chemo- and radiation-therapy, cancer treatment is still far from optimal. Current cancer therapies frequently encounter challenges including nonspecific systemic distribution of antitumor agents, inadequate drug concentrations reaching the tumor site, intolerable cytotoxicity and development of multiple drug resistance. As with any cancer therapy, the key issue is to achieve the desired concentration of the therapeutic agent specifically in tumor sites, thereby destroying cancerous cells while minimizing damage to normal cells. Bacterial cancer therapies offer unique features that can overcome these obstacles. However, intrinsic bacterial toxicity and tumor-targeting efficiency are two major concerns for the bacterial approach in cancer therapy. We report here that we have now addressed the concerns by constructing GMS strains with enhanced chemotaxis systems that are attracted by tumor released small molecules to confer tumor-navigating feature. Moreover, the regulated delayed attenuation and programmed self-eradicating features designed into these S. Typhimurium strains to enable them to efficiently colonize in tumors and allow the release of the tumoricidal contents, TRAIL, after cell lysis. We have demonstrated that the genetically engineered tumor navigating and self-eradicating GMS410(pK5079) and GMS515(pK5079) strains not only improve the safety of cancer treatment, but also efficiently target tumor tissue, release TRAIL into the tumor tissues, induce significant tumor regression and extend the survival rate in both allograft and xenograft colon cancer mouse models. We also validate the efficacy of anti-cancer metastasis using Salmonella based-cancer therapies in the orthotopic human colon cancer xenograft mouse model created through cecum wall surgical microinjection, which drives tumor foci to the most relevant metastatic sites observed in humans. Most importantly, orally administrated GMS410(pK5079) and GMS515(pK5079) successfully achieved metastasis blockage in such mouse models. In addition, we are the first to evaluate Salmonella-based cancer therapeutics in an inducible APC gene mutation mouse model, which can better mimic human familial adenomatous polyposis disease. The results proved that GMS410(pK5079) and GMS515(pK5079) strains effectively suppressed tumor progression. In addition, GMS515(pK5079) successfully recruited and activated significant anti-cancer immune cells to the tumor microenvironment. As such, these GMS strains show tremendous potential, either alone or in combination with other treatments, to make an important contribution in cancer therapy.
(102) The present disclosure has described one or more preferred embodiments, and it should be appreciated that many equivalents, alternatives, variations, and modifications, aside from those expressly stated, are possible and within the scope of the disclosure.