Methods of detecting analytes

Abstract

Localized detection of RNA in a tissue sample that includes cells is accomplished on an array. The array include a number of features on a substrate. Each feature includes a different capture probe immobilized such that the capture probe has a free 3′ end. Each feature occupies a distinct position on the array and has an area of less than about 1 mm.sup.2. Each capture probe is a nucleic acid molecule, which includes a positional domain including a nucleotide sequence unique to a particular feature, and a capture domain including a nucleotide sequence complementary to the RNA to be detected. The capture domain can be at a position 3′ of the positional domain.

Claims

1. A method for localized detection of RNA in a tissue section, the method comprising: (a) providing an array comprising a plurality of features on a substrate, wherein each feature occupies a distinct position on the array, wherein a feature of the plurality of features comprises a plurality of capture probes immobilized thereon, and wherein the plurality of capture probes comprise a nucleic acid molecule having the following domains oriented 5′ to 3′: (i) a first sequence comprising a positional domain comprising a nucleotide sequence unique to the feature; and (ii) a second sequence comprising a capture domain comprising a nucleotide sequence complementary to the RNA to be detected; (b) contacting the array with the tissue section and allowing at least one RNA of the tissue section to hybridize to the capture domain of the capture probe; (c) generating a cDNA molecule, by extending the capture probe using the hybridized RNA as an extension template, such that the generated cDNA molecule comprises the nucleotide sequence of the positional domain; (d) releasing the generated cDNA molecule, or a portion thereof, or a second strand complementary to the generated cDNA molecule, or a portion thereof, from the array, and (e) identifying the nucleotide sequence of the positional domain in the released cDNA molecule, or the complement thereof; and (f) correlating the nucleotide sequence of the positional domain with the distinct position on the array, thereby detecting the RNA in the tissue section.

2. The method of claim 1, further comprising, between steps (c) and (d), a step of generating the second strand complementary to the generated cDNA molecule or the portion thereof.

3. The method of claim 1, wherein step (d) comprises releasing the generated cDNA molecule, or a portion thereof, or the second strand complementary to the generated cDNA molecule, or a portion thereof, from the capture domain of the capture probe, by denaturation.

4. The method of claim 1 further comprising a step of amplifying the generated cDNA, or a portion thereof, the second strand complementary to the generated cDNA, or a portion thereof, released from the array.

5. The method of claim 1, wherein the capture probe further comprises a cleavage domain 5′ of the positional domain.

6. The method of claim 5, further comprising cleaving the cleavage domain of the capture probe, wherein cleaving comprises applying a cleavage enzyme that recognizes a nucleotide sequence in the cleavage domain and cleaves the generated cDNA molecule at a position that is 5′ to the positional domain, thereby releasing the generated cDNA molecule or the portion thereof, or the second strand or the portion thereof, from the feature on the array.

7. The method of claim 1, wherein the RNA is selected from the list consisting of mRNA, tRNA, rRNA, viral RNA, small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), microRNA (miRNA), small interfering RNA (siRNA), piwi-interacting RNA (piRNA), ribozymal RNA, antisense RNA and non-coding RNA.

8. The method of claim 7, wherein the RNA is mRNA.

9. The method of claim 8, wherein the capture domain of the capture probe hybridizes to a poly-A tail of mRNA.

10. The method of claim 9, wherein the capture domain comprises a poly-T sequence.

11. The method of claim 1, wherein the method further comprises a step of staining the tissue section prior to step (c).

12. The method of claim 1, further comprising correlating the nucleotide sequence obtained in step (f) with an image of the tissue section, wherein the method includes a step of imaging the tissue section prior to step (c).

13. The method of claim 1, wherein the capture probe of the plurality of capture probes has a free 3′ end.

14. The method of claim 1, wherein the capture probe is immobilized on the substrate by a linker.

15. The method of claim 1, wherein the array is a bead array and the capture probe is immobilized on beads of the bead array.

16. The method of claim 1, wherein the array comprises at least 1,000 features.

17. The method of claim 1, wherein the features of the array have an average diameter of about less than 100 micrometers, about less than 50 micrometers, about less than about 20 micrometers, or about less than 10 micrometers.

18. The method of claim 1, wherein the substrate comprises one or more arrays.

19. The method of claim 18, wherein the one or more arrays comprise different positional domains.

20. The method of claim 1, wherein the capture probes further comprise a primer binding site.

21. The method of claim 1, wherein the tissue section comprises a fixed or fresh-frozen tissue section.

22. The method of claim 21, wherein the fixed tissue section is a formalin-fixed paraffin embedded tissue section.

23. The method of claim 1, wherein the plurality of features comprises printed or photolithographically deposited features.

24. The method of claim 1, wherein identifying the nucleotide sequence of the positional domain comprises sequencing.

Description

(1) The invention will be further described with reference to the following non-limiting Examples with reference to the following drawings in which:

(2) FIG. 1 shows the overall concept using arrayed “barcoded” oligo-dT probes to capture mRNA from tissue sections for transcriptome analysis.

(3) FIG. 2 shows the a schematic for the visualization of transcript abundance for corresponding tissue sections.

(4) FIG. 3 shows 3′ to 5′ surface probe composition and synthesis of 5′ to 3′ oriented capture probes that are indirectly immobilized at the array surface.

(5) FIG. 4 shows a bar chart demonstrating the efficiency of enzymatic cleavage (USER or Rsal) from in-house manufactured arrays and by 99° C. water from Agilent manufactured arrays, as measured by hybridization of fluorescently labelled probes to the array surface after probe release.

(6) FIG. 5 shows a fluorescent image captured after 99° C. water mediated release of DNA surface probes from commercial arrays manufactured by Agilent. A fluorescent detection probe was hybridized after hot water treatment. Top array is an untreated control.

(7) FIG. 6 shows a fixated mouse brain tissue section on top of the transcriptome capture array post cDNA synthesis and treated with cytoplasmic (top) and nucleic stains (middle), respectively, and merged image showing both stains (bottom).

(8) FIG. 7 shows a table that lists the reads sorted for their origin across the low density in-house manufactured DNA-capture array as seen in the schematic representation.

(9) FIG. 8 shows a FFPE mouse brain tissue with nucleic and Map2 specific stains using a barcoded microarray.

(10) FIG. 9 shows FFPE mouse brain olfactory bulb with nucleic stain (white) and visible morphology.

(11) FIG. 10 shows FFPE mouse brain olfactory bulb (approx 2×2 mm) with nucleic stain (white), overlaid with theoretical spotting pattern for low resolution array.

(12) FIG. 11 shows FFPE mouse brain olfactory bulb (approx 2×2 mm) with nucleic stain (white), overlaid with theoretical spotting pattern for medium-high resolution array.

(13) FIG. 12 shows FFPE mouse brain olfactory bulb zoomed in on glomerular area (top right of FIG. 9).

(14) FIG. 13 shows the resulting product from a USER release using a random hexamer primer (R6) coupled to the B_handle (B_R6) during amplification; product as depicted on a bioanalyzer.

(15) FIG. 14 shows the resulting product from a USER release using a random octamer primer (R8) coupled to the B_handle (B_R8) during amplification; product as depicted on a bioanalyzer.

(16) FIG. 15 shows the results of an experiment performed on FFPE brain tissue covering the whole array. ID5 (left) and ID20 (right) amplified with ID specific and gene specific primers (B2M exon 4) after synthesis and release of cDNA from surface; ID5 and ID20 amplified.

(17) FIG. 16 shows a schematic illustration of the principle of the method described in Example 4, i.e. use of microarrays with immobilized DNA oligos (capture probes) carrying spatial labeling tag sequences (positional domains). Each feature of oligos of the microarray carries a 1) a unique labeling tag (positional domain) and 2) a capture sequence (capture domain).

(18) FIG. 17 shows the results of the spatial genomics protocol described in Example 5 carried out with genomic DNA prefragmented to mean size of 200 bp. Internal products amplified on array labeled and synthesized DNA. The detected peak is of expected size.

(19) FIG. 18 shows the results of the spatial genomics protocol described in Example 5 carried out with genomic DNA prefragmented to mean size of 700 bp. Internal products amplified on array labeled and synthesized DNA. The detected peak is of expected size.

(20) FIG. 19 shows the results of the spatial genomics protocol described in Example 5 carried out with genomic DNA prefragmented to mean size of 200 bp. Products amplified with one internal primer and one universal sequence contained in the surface oligo. Amplification carried out on array labeled and synthesized DNA. The expected product is a smear given that the random fragmentation and terminal transferase labeling of genomic DNA will generate a very diverse sample pool.

(21) FIG. 20 shows the results of the spatial genomics protocol described in Example 5 carried out with genomic DNA prefragmented to mean size of 700 bp. Products amplified with one internal primer and one universal sequence contained in the surface oligo. Amplification carried out on array labeled and synthesized DNA. The expected product is a smear given that the random fragmentation and terminal transferase labeling of genomic DNA will generate a very diverse sample pool.

(22) FIG. 21 shows a schematic illustration of the ligation of a linker to a DNA fragment to introduce a binding domain for hybridisation to a poly-T capture domain, and subsequent ligation to the capture probe.

(23) FIG. 22 shows the composition of 5′ to 3′ oriented capture probes used on high-density capture arrays.

(24) FIG. 23 shows the frame of the high-density arrays, which is used to orientate the tissue sample, visualized by hybridization of fluorescent marker probes.

(25) FIG. 24 shows capture probes cleaved and non-cleaved from high-density array, wherein the frame probes are not cleaved since they do not contain uracil bases. Capture probes were labelled with fluorophores coupled to poly-A oligonucleotides.

(26) FIG. 25 shows a bioanalyzer image of a prepared sequencing library with transcripts captured from mouse olfactory bulb.

(27) FIG. 26 shows a Matlab visualization of captured transcripts from total RNA extracted from mouse olfactory bulb.

(28) FIG. 27 shows Olfr (olfactory receptor) transcripts as visualized across the capture array using Matlab visualization after capture from mouse olfactory bulb tissue.

(29) FIG. 28 shows a pattern of printing for in-house 41-ID-tag microarrays.

(30) FIG. 29 shows a spatial genomics library generated from a A431 specific translocation after capture of poly-A tailed genomic fragments on capture array.

(31) FIG. 30 shows the detection of A431 specific translocation after capture of spiked 10% and 50% poly-A tailed A431 genomic fragments into poly-A tailed U2OS genomic fragments on capture array.

(32) FIG. 31 shows a Matlab visualization of captured ID-tagged transcripts from mouse olfactory bulb tissue on 41-ID-tag in-house arrays overlaid with the tissue image. For clarity, the specific features on which particular genes were identified have been circled.

EXAMPLE 1

(33) Preparation of the Array

(34) The following experiments demonstrate how oligonucleotide probes may be attached to an array substrate by either the 5′ or 3′ end to yield an array with capture probes capable of hybridizing to mRNA.

(35) Preparation of In-House Printed Microarray with 5′ to 3′ Oriented Probes

(36) 20 RNA-capture oligonucleotides with individual tag sequences (Tag 1-20, Table 1 were spotted on glass slides to function as capture probes. The probes were synthesized with a 5′-terminus amino linker with a C6 spacer. All probes where synthesized by Sigma-Aldrich (St. Louis, Mo., USA). The RNA-capture probes were suspended at a concentration of 20 μM in 150 mM sodium phosphate, pH 8.5 and were spotted using a Nanoplotter NP2.1/E (Gesim, Grosserkmannsdorf, Germany) onto CodeLink™ Activated microarray slides (7.5 cm×2.5 cm; Surmodics, Eden Prairie, Minn., USA). After printing, surface blocking was performed according to the manufacturer's instructions. The probes were printed in 16 identical arrays on the slide, and each array contained a pre-defined printing pattern. The 16 sub-arrays were separated during hybridization by a 16-pad mask (ChipClip™ Schleicher & Schuell BioScience, Keene, N.H., USA).

(37) TABLE-US-00001 TABLE 1 Name Sequence 5′ mod 3′ mod Length Sequences for free 3′ capture probes TAP-ID1 UUAAGTACAAATCTCGACTGCCACTCTGAACCTTCT Amino-C6 72 CCTTCTCCTTCACCTTTTTTTTTTTTTTTTTTTTVN (SEQ ID NO: 1) Enzymatic  UUAAGTACAA 10 recog (SEQ ID NO: 2) Universal   ATCTCGACTGCCACTCTGAA 20 amp (SEQ ID NO: 3) handle P ID1 CCTTCTCCTTCTCCTTCACC 20 (SEQ ID NO: 4) Capture  TTTTTTTTTTTTTTTTTTTTVN 22 sequence (SEQ ID NO: 5) ID1 CCTTCTCCTTCTCCTTCACC 20 (SEQ ID NO: 6) ID2 CCTTGCTGCTTCTCCTCCTC 20 (SEQ ID NO: 7) ID3 ACCTCCTCCGCCTCCTCCTC 20 (SEQ ID NO: 8) ID4 GAGACATACCACCAAGAGAC 20 (SEQ ID NO: 9) ID5 GTCCTCTATTCCGTCACCAT 20 (SEQ ID NO: 10) ID6 GACTGAGCTCGAACATATGG 20 (SEQ ID NO: 11) ID7 TGGAGGATTGACACAGAACG 20 (SEQ ID NO: 12) ID8 CCAGCCTCTCCATTACATCG 20 (SEQ ID NO: 13) ID9 AAGATCTACCAGCCAGCCAG 20 (SEQ ID NO: 14) ID10 CGAACTTCCACTGTCTCCTC 20 (SEQ ID NO: 15) ID11 TTGCGCCTTCTCCAATACAC 20 (SEQ ID NO: 16) ID12 CTCTTCTTAGCATGCCACCT 20 (SEQ ID NO: 17) ID13 ACCACTTCTGCATTACCTCC 20 (SEQ ID NO: 18) ID14 ACAGCCTCCTCTTCTTCCTT 20 (SEQ ID NO: 19) ID15 AATCCTCTCCTTGCCAGTTC 20 (SEQ ID NO: 20) ID16 GATGCCTCCACCTGTAGAAC 20 (SEQ ID NO: 21) ID17 GAAGGAATGGAGGATATCGC 20 (SEQ ID NO: 22) ID18 GATCCAAGGACCATCGACTG 20 (SEQ ID NO: 23) ID19 CCACTGGAACCTGACAACCG 20 (SEQ ID NO: 24) ID20 CTGCTTCTTCCTGGAACTCA 20 (SEQ ID NO: 25) Sequences for free 5′ surface probes and on-chip  free 3′ capture probe synthesis Free 5′   GCGTTCAGAGTGGCAGTCGAGATCACGCGGCAATCA Amino  66 surface TATCGGACAGATCGGAAGAGCGTAGTGTAG C7 probe-A (SEQ ID NO: 26) Free 5′   GCGTTCAGAGTGGCAGTCGAGATCACGCGGCAATCA Amino  66 surface TATCGGACGGCTGCTGGTAAATAGAGATCA C7 probe-U (SEQ ID NO: 27) Nick GCG  3 LP′ TTCAGAGTGGCAGTCGAGATCAC 23 (SEQ ID NO: 28) ID′ GCGGCAATCATATCGGAC 18 (SEQ ID NO: 29) A′ 22bp   AGATCGGAAGAGCGTAGTGTAG 22 MutY (SEQ ID NO: 30) mismatch U′ 22bp   GGCTGCTGGTAAATAGAGATCA MutY (SEQ ID NO: 31) mismatch Hybridized sequences for capture probe synthesis Illumina   ACACTCTTTCCCTACACGACGCTCTTCCGATCT  33 amp (SEQ ID NO: 32) handle A Universa   AAGTGTGGAAAGTTGATCGCTATTTACCAGCAGCC 35 ampl (SEQ ID NO: 33) handle U Capture_LP_ GTGATCTCGACTGCCACTCTGAATTTTTTTTTTTTT Phosphorylated 45 Poly-dTVN TTTTTTTVN (SEQ ID NO: 34) Capture_LP_ GTGATCTCGACTGCCACTCTGAATTTTTTTTTTTTT Phosphorylated 47 Poly-d24T TTTTTTTTTTT (SEQ ID NO: 35) Additional secondary universal amplification handles Illumina   AGACGTGTGCTCTTCCGATCT 21 amp (SEQ ID NO: 36) handle B Universal   ACGTCTGTGAATAGCCGCAT 20 amp (SEQ ID NO: 37) handle X B_R6 handle  AGACGTGTGCTCTTCCGATCTNNNNNNNN 27 (26) (or X) (SEQ ID NO: 38) B_R8 handle  AGACGTGTGCTCTTCCGATCTNNNNNNNNNN 29 (28) (or X) (SEQ ID NO: 39) B_polyTVN  AGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTT 43 (42) (or X) TTTTTTVN (SEQ ID NO: 40) B_poly24T  AGACGIGTGCTCTTCCGATCTTTTTTTTTTTTTTT 45 (44) (or X) TTTTTTTTTT (SEQ ID NO: 41) Amplification handle to incorporate A handle into P handle products A_P handle ACACTCTTTCCCTACACGACGCTCTTCCGATCTATC 53 TCGACTGCCACTCTGAA (SEQ ID NO: 42)

Preparation of In-House Printed Microarray with 3′ to 5′ Oriented Probes and Synthesis of 5′ to 3′ Oriented Capture Probes

(38) Printing of surface probe oligonucleotides was performed as in the case with 5′ to 3′ oriented probes above, with an amino-C7 linker at the 3′ end, as shown in Table 1.

(39) To hybridize primers for capture probe synthesis, hybridization solution containing 4×SSC and 0.1% SDS, 2 μM extension primer (the universal domain oligonucleotide) and 2 μM thread joining primer (the capture domain oligonucleotide) was incubated for 4 min at 50° C. Meanwhile the in-house array was attached to a ChipClip (Whatman). The array was subsequently incubated at 50° C. for 30 min at 300 rpm shake with 50 μL of hybridization solution per well.

(40) After incubation, the array was removed from the ChipClip and washed with the 3 following steps: 1) 50° C. 2×SSC solution with 0.1% SDS for 6 min at 300 rpm shake; 2) 0.2×SSC for 1 min at 300 rpm shake; and 3) 0.1×SSC for 1 min at 300 rpm shake. The array was then spun dry and placed back in the ChipClip.

(41) For extension and ligation reaction (to generate the positional domain of the capture probe) 50 μL of enzyme mix containing 10× Ampligase buffer, 2.5 U AmpliTaq DNA Polymerase Stoffel Fragment (Applied Biosystems), 10 U Ampligase (Epicentre Biotechnologies), dNTPs 2 mM each (Fermentas) and water, was pipetted to each well. The array was subsequently incubated at 55° C. for 30 min. After incubation the array was washed according to the previously described array washing method but the first step has the duration of 10 min instead of 6 min.

(42) The method is depicted in FIG. 3.

(43) Tissue Preparation

(44) The following experiments demonstrate how tissue sample sections may be prepared for use in the methods of the invention.

(45) Preparation of Fresh Frozen Tissue and Sectioning onto Capture Probe Arrays

(46) Fresh non-fixed mouse brain tissue was trimmed if necessary and frozen down in −40° C. cold isopentane and subsequently mounted for sectioning with a cryostat at 10 μm. A slice of tissue was applied onto each capture probe array to be used.

(47) Preparation of Formalin-Fixed Paraffin-Embedded (FFPE) Tissue

(48) Mouse brain tissue was fixed in 4% formalin at 4° C. for 24 h. After that it was incubated as follows: 3× incubation in 70% ethanol for 1 hour; 1× incubation in 80% ethanol for 1 hour; 1× incubation in 96% ethanol for 1 hour; 3× incubation in 100% ethanol for 1 hour; and 2× incubation in xylene at room temperature for 1 h.

(49) The dehydrated samples were then incubated in liquid low melting paraffin 52-54° C. for up to 3 hours, during which the paraffin was changed once to wash out residual xylene. Finished tissue blocks were then stored at RT. Sections were then cut at 4 μm in paraffin with a microtome onto each capture probe array to be used.

(50) The sections were dried at 37° C. on the array slides for 24 hours and stored at RT.

(51) Deparaffinization of FFPE Tissue

(52) Formalin fixed paraffinized mouse brain 10 μm sections attached to CodeLink slides were deparaffinised in xylene twice for: 10 min, 99.5% ethanol for 2 min; 96% ethanol for 2 min; 70% ethanol for 2 min; and were then air dried.

cDNA Synthesis

(53) The following experiments demonstrate that mRNA captured on the array from the tissue sample sections may be used as template for cDNA synthesis.

cDNA Synthesis on Chip

(54) A 16 well mask and Chip Clip slide holder from Whatman was attached to a CodeLink slide. The SuperScript™ III One-step RT-PCR System with Platinum® Taq DNA Polymerase from Invitrogen was used when performing the cDNA synthesis. For each reaction 25 μl 2× reaction mix (SuperScript™ III One-step RT-PCR System with Platinum® Taq DNA Polymerase, Invitrogen), 22.5 μl H.sub.2O and 0.5 μl 100×BSA were mixed and heated to 50° C. SuperScript III/Platinum Taq enzyme mix was added to the reaction mix, 2 μl per reaction, and 50 μl of the reaction mix was added to each well on the chip. The chip was incubated at 50° C. for 30 min (Thermomixer Comfort, Eppendorf).

(55) The reaction mix was removed from the wells and the slide was washed with: 2×SSC, 0.1% SDS at 50° C. for 10 min; 0.2×SSC at room temperature for 1 min; and 0.1×SSC at room temperature for 1 min. The chip was then spin dried.

(56) In the case of FFPE tissue sections, the sections could now be stained and visualized before removal of the tissue, see below section on visualization.

(57) Visualization

(58) Hybridization of Fluorescent Marker Probes Prior to Staining

(59) Prior to tissue application fluorescent marker probes were hybridized to features comprising marker oligonucleotides printed on the capture probe array. The fluorescent marker probes aid in the orientation of the resulting image after tissue visualization, making it possible to combine the image with the resulting expression profiles for individual capture probe “tag” (positional domain) sequences obtained after sequencing. To hybridize fluorescent probes a hybridization solution containing 4×SSC and 0.1% SDS, 2 μM detection probe (P) was incubated for 4 min at 50° C. Meanwhile the in-house array was attached to a ChipClip (Whatman). The array was subsequently incubated at 50° C. for 30 min at 300 rpm shake with 50 μL of hybridization solution per well.

(60) After incubation, the array was removed from the ChipClip and washed with the 3 following steps: 1) 50° C. 2×SSC solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2×SSC for 1 min at 300 rpm shake and 3) 0.1×SSC for 1 min at 300 rpm shake. The array was then spun dry.

(61) General Histological Staining of FFPE Tissue Sections Prior to or Post cDNA Synthesis

(62) FFPE tissue sections immobilized on capture probe arrays were washed and rehydrated after deparaffinization prior to cDNA synthesis as described previously, or washed after cDNA synthesis as described previously. They are then treated as follows: incubate for 3 minutes in Hematoxylin; rinse with deionized water; incubate 5 minutes in tap water; rapidly dip 8 to 12 times in acid ethanol; rinse 2×1 minute in tap water; rinse 2 minutes in deionized water; incubate 30 seconds in Eosin; wash 3×5 minutes in 95% ethanol; wash 3×5 minutes in 100% ethanol; wash 3×10 minutes in xylene (can be done overnight); place coverslip on slides using DPX; dry slides in the hood overnight.

(63) General Immunohistochemistry Staining of a Target Protein in FFPE Tissue Sections Prior to or Post cDNA Synthesis

(64) FFPE tissue sections immobilized on capture probe arrays were washed and rehydrated after deparaffinization prior to cDNA synthesis as described previously, or washed after cDNA synthesis as described previously. They were then treated as follows without being allowed to dry during the whole staining process: sections were incubated with primary antibody (dilute primary antibody in blocking solution comprising 1× Tris Buffered Saline (50 mM Tris, 150 mM NaCl, pH 7.6), 4% donkey serum and 0.1% triton-x) in a wet chamber overnight at RT; rinse three times with 1×TBS; incubate section with matching secondary antibody conjugated to a fluorochrome (FITC, Cy3 or Cy5) in a wet chamber at RT for 1 hour. Rinse 3× with 1×TBS, remove as much as possible of TBS and mount section with ProLong Gold+DAPI (Invitrogen) and analyze with fluorescence microscope and matching filter sets.

(65) Removal of Residual Tissue

(66) Frozen Tissue

(67) For fresh frozen mouse brain tissue the washing step directly following cDNA synthesis was enough to remove the tissue completely.

(68) FFPE Tissue

(69) The slides with attached formalin fixed paraffinized mouse brain tissue sections were attached to ChipClip slide holders and 16 well masks (Whatman). For each 150 μl Proteinase K Digest Buffer from the RNeasy FFPE kit (Qiagen), 10 μl Proteinase K Solution (Qiagen) was added. 50 μl of the final mixture was added to each well and the slide was incubated at 56° C. for 30 min.

(70) Capture Probe (cDNA) Release

(71) Capture Probe Release with Uracil Cleaving USER Enzyme Mixture in PCR Buffer (Covalently Attached Probes)

(72) A 16 well mask and CodeLink slide was attached to the ChipClip holder (Whatman). 50 μl of a mixture containing 1× FastStart High Fidelity Reaction Buffer with 1.8 mM MgCl2 (Roche), 200 μM dNTPs (New England Biolabs) and 0.1 U/1 μl USER Enzyme (New England Biolabs) was heated to 37° C. and was added to each well and incubated at 37° C. for 30 min with mixing (3 seconds at 300 rpm, 6 seconds at rest) (Thermomixer comfort; Eppendorf). The reaction mixture containing the released cDNA and probes was then recovered from the wells with a pipette.

(73) Capture Probe Release with Uracil Cleaving USER Enzyme Mixture in TdT (Terminal Transferase) Buffer (Covalently Attached Probes)

(74) 50 μl of a mixture containing: 1× TdT buffer (20 mM Tris-acetate (pH 7.9), 50 mM Potassium Acetate and 10 mM Magnesium Acetate) (New England Biolabs, www.neb.com); 0.1 μg/μl BSA (New England Biolabs); and 0.1 U/1 μl USER Enzyme (New England Biolabs) was heated to 37° C. and was added to each well and incubated at 37° C. for 30 min with mixing (3 seconds at 300 rpm, 6 seconds at rest) (Thermomixer comfort; Eppendorf). The reaction mixture containing the released cDNA and probes was then recovered from the wells with a pipette.

(75) Capture Probe Release with Boiling Hot Water (Covalently Attached Probes)

(76) A 16 well mask and CodeLink slide was attached to the ChipClip holder (Whatman). 50 μl of 99° C. water was pipetted into each well. The 99° C. water was allowed to react for 30 minutes. The reaction mixture containing the released cDNA and probes was then recovered from the wells with a pipette.

(77) Capture Probe Release with Heated PCR Buffer (Hybridized In Situ Synthesized Capture Probes, i.e. Capture Probes Hybridized to Surface Probes)

(78) 50 μl of a mixture containing: 1× TdT buffer (20 mM Tris-acetate (pH 7.9), 50 mM Potassium Acetate and 10 mM Magnesium Acetate) (New England Biolabs, www.neb.com); 0.1 μg/μl BSA (New England Biolabs); and 0.1 U/μl USER Enzyme (New England Biolabs) was preheated to 95° C. The mixture was then added to each well and incubated for 5 minutes at 95° C. with mixing (3 seconds at 300 rpm, 6 seconds at rest) (Thermomixer comfort; Eppendorf). The reaction mixture containing the released probes was then recovered from the wells.

(79) Capture Probe Release with Heated TdT (Terminal Transferase) Buffer (Hybridized in Situ Synthesized Capture Probes, i.e. Capture Probes Hybridized to Surface Probes)

(80) 50 μl of a mixture containing: 1× TdT buffer (20 mM Tris-acetate (pH 7.9), 50 mM Potassium Acetate and 10 mM Magnesium Acetate) (New England Biolabs, www.neb.com); 0.1 μg/μl BSA (New England Biolabs); and 0.1 U/μl USER Enzyme (New England Biolabs) was preheated to 95° C. The mixture was then added to each well and incubated for 5 minutes at 95° C. with mixing (3 seconds at 300 rpm, 6 seconds at rest) (Thermomixer comfort; Eppendorf). The reaction mixture containing the released probes was then recovered from the wells.

(81) The efficacy of treating the array with the USER enzyme and water heated to 99° C. can be seen in FIG. 3. Enzymatic cleavage using the USER enzyme and the Rsal enzyme was performed using the “in-house” arrays described above (FIG. 4). Hot water mediated release of DNA surface probes was performed using commercial arrays manufactured by Agilent (see FIG. 5).

(82) Probe Collection and Linker Introduction

(83) The experiments demonstrate that first strand cDNA released from the array surface may be modified to produce double stranded DNA and subsequently amplified.

(84) Whole Transcriptome Amplification by the Picoplex Whole Genome Amplification Kit (Capture Probe Sequences Including Positional Domain (Tag) Sequences not Retained at the Edge of the Resulting dsDNA)

(85) Capture probes were released with uracil cleaving USER enzyme mixture in PCR buffer (covalently attached capture probes) or with heated PCR buffer (hybridized in situ synthesized capture probes, i.e. capture probes hybridized to surface probes).

(86) The released cDNA was amplified using the Picoplex (Rubicon Genomics) random primer whole genome amplification method, which was carried out according to manufacturers instructions.

(87) Whole Transcriptome Amplification by dA Tailing with Terminal Transferase (TdT) (Capture Probe Sequences Including Positional Domain (Tag) Sequences Retained at the End of the Resulting dsDNA)

(88) Capture probes were released with uracil cleaving USER enzyme mixture in TdT (terminal transferase) buffer (covalently attached capture probes) or with heated TdT (terminal transferase) buffer (hybridized in situ synthesized capture probes, i.e. capture probes hybridized to surface probes).

(89) 38 μl of cleavage mixture was placed in a clean 0.2 ml PCR tube. The mixture contained: 1× TdT buffer (20 mM Tris-acetate (pH 7.9), 50 mM Potassium Acetate and 10 mM Magnesium Acetate) (New England Biolabs, www.neb.com), 0.1 μg/μl BSA (New England Biolabs); 0.1 U/μl USER Enzyme (New England Biolabs) (not for heated release); released cDNA (extended from surface probes); and released surface probes. To the PCR tube, 0.5 μl RNase H (5 U/μl, final concentration of 0.06 U/μl), 1 μl TdT (20 U/μl, final concentration of 0.5 U/μl), and 0.5 μl dATPs (100 mM, final concentration of 1.25 mM), were added. For dA tailing, the tube was incubated in a thermocycler (Applied Biosystems) at 37° C. for 15 min followed by an inactivation of TdT at 70° C. for 10 min. After dA tailing, a PCR master mix was prepared. The mix contained: 1× Faststart HiFi PCR Buffer (pH 8.3) with 1.8 mM MgCl.sub.2 (Roche); 0.2 mM of each dNTP (Fermentas); 0.2 μM of each primer, A (complementary to the amplification domain of the capture probe) and B_(dT)24 (Eurofins MWG Operon) (complementary to the poly-A tail to be added to the 3′ end of the first cDNA strand); and 0.1 U/μl Faststart HiFi DNA polymerase (Roche). 23 μl of PCR Master mix was placed into nine clean 0.2 ml PCR tubes. 2 μl of dA tailing mixture were added to eight of the tubes, while 2 μl water (RNase/DNase free) was added to the last tube (negative control). PCR amplification was carried out with the following program: Hot start at 95° C. for 2 minutes, second strand synthesis at 50° C. for 2 minutes and 72° C. for 3 minutes, amplification with 30 PCR cycles at 95° C. for 30 seconds. 65° C. for 1 minutes, 72° C. for 3 minutes, and a final extension at 72° C. for 10 minutes.

(90) Post-Reaction Cleanup and Analysis

(91) Four amplification products were pooled together and were processed through a Qiaquick PCR purification column (Qiagen) and eluted into 30 μl EB (10 mM Tris-Cl, pH 8.5). The product was analyzed on a Bioanalyzer (Agilent). A DNA 1000 kit was used according to manufacturers instructions.

(92) Sequencing

(93) Illumina Sequencing

(94) dsDNA library for Illumina sequencing using sample indexing was carried out according to manufacturers instructions. Sequencing was carried out on an HiSeq2000 platform (Illumina).

(95) Bioinformatics

(96) Obtaining Digital Transcriptomic Information from Sequencing Data from Whole Transcriptome Libraries Amplified Using the dA Tailing Terminal Transferase Approach

(97) The sequencing data was sorted through the FastX toolkit FASTQ Barcode splitter tool into individual files for the respective capture probe positional domain (tag) sequences. Individually tagged sequencing data was then analyzed through mapping to the mouse genome with the Tophat mapping tool. The resulting SAM file was processed for transcript counts through the HTseq-count software.

(98) Obtaining Digital Transcriptomic Information from Sequencing Data from Whole Transcriptome Libraries Amplified Using the Picoplex Whole Genome Amplification Kit Approach

(99) The sequencing data was converted from FASTQ format to FASTA format using the FastX toolkit FASTQ-to-FASTA converter. The sequencing reads was aligned to the capture probe positional domain (tag) sequences using Blastn and the reads with hits better than 1e.sup.−6 to one of tag sequences were sorted out to individual files for each tag sequence respectively. The file of tag sequence reads was then aligned using Blastn to the mouse transcriptome, and hits were collected.

(100) Combining Visualization Data and Expression Profiles

(101) The expression profiles for individual capture probe positional domain (tag) sequences are combined with the spatial information obtained from the tissue sections through staining. Thereby the transcriptomic data from the cellular compartments of the tissue section can be analyzed in a directly comparative fashion, with the availability to distinguish distinct expression features for different cellular subtypes in a given structural context

EXAMPLE 2

(102) FIGS. 8 to 12 show successful visualisation of stained FFPE mouse brain tissue (olfactory bulb) sections on top of a bar-coded transcriptome capture array, according to the general procedure described in Example 1. As compared with the experiment with fresh frozen tissue in Example 1, FIG. 8 shows better morphology with the FFPE tissue. FIGS. 9 and 10 show how tissue may be positioned on different types of probe density arrays.

EXAMPLE 3

(103) Whole Transcriptome Amplification by Random Primer Second Strand Synthesis Followed by Universal Handle Amplification (Capture Probe Sequences Including Tag Sequences Retained at the End of the Resulting dsDNA)

(104) Following capture probe release with uracil cleaving USER enzyme mixture in PCR buffer (covalently attached probes)

(105) OR

(106) Following capture probe release with heated PCR buffer (hybridized in situ synthesized capture probes)

(107) 1 μl RNase H (5 U/μl) was added to each of two tubes, final concentration of 0.12 U/μl, containing 40 μl 1× Faststart HiFi PCR Buffer (pH 8.3) with 1.8 mM MgCl.sub.2 (Roche, www.roche-applied-science.com). 0.2 mM of each dNTP (Fermentas, www.fermentas.com), 0.1 μg/μl BSA (New England Biolabs, www.neb.com), 0.1 U/μl USER Enzyme (New England Biolabs), released cDNA (extended from surface probes) and released surface probes. The tubes were incubated at 37° C. for 30 min followed by 70° C. for 20 min in a thermo cycler (Applied Biosystems, www.appliedbiosystems.com). 1 μl Klenow Fragment (3′ to 5′ exo minus) (Illumina, www.illumina.com) and 1 μl handle coupled random primer (10 μM) (Eurofins MWG Operon, www.eurofinsdna.com) was added to the two tubes (B_R8 (octamer) to one of the tubes and B_R6 (hexamer) to the other tube), final concentration of 0.23 μM. The two tubes were incubated at 15° C. for 15 min, 25° C. for 15 min, 37° C. for 15 min and finally 75° C. for 20 min in a thermo cycler (Applied Biosystems). After the incubation, 1 μl of each primer, A_P and B (10 μM) (Eurofins MWG Operon), was added to both tubes, final concentration of 0.22 μM each. 1 μl Faststart HiFi DNA polymerase (5 U/μl) (Roche) was also added to both tubes, final concentration of 0.11 U/μl. PCR amplification were carried out in a thermo cycler (Applied Biosystems) with the following program: Hot start at 94° C. for 2 min, followed by 50 cycles at 94° C. for 15 seconds, 55° C. for 30 seconds, 68° C. for 1 minute, and a final extension at 68° C. for 5 minutes. After the amplification, 40 μl from each of the two tubes were purified with Qiaquick PCR purification columns (Qiagen, www.qiagen.com) and eluted into 30 μl EB (10 mM Tris-Cl, pH 8.5). The Purified products were analyzed with a Bioanalyzer (Agilent, www.home.agilent.com), DNA 7500 kit were used. The results are shown in FIGS. 13 and 14.

(108) This Example demonstrates the use of random hexamer and random octamer second strand synthesis, followed by amplification to generate the population from the released cDNA molecules.

EXAMPLE 4

(109) Amplification of ID-Specific and Gene Specific Products after cDNA Synthesis and Probe Collection

(110) Following capture probe release with uracil cleaving USER enzyme mixture in PCR buffer (covalently attached probes).

(111) The cleaved cDNA was amplified in final reaction volumes of 10 μl. 7 μl cleaved template, 1 μl ID-specific forward primer (2 μM), 1 μl gene-specific reverse primer (2 μM) and 1 μl FastStart High Fidelity Enzyme Blend in 1.4× FastStart High Fidelity Reaction Buffer with 1.8 mM MgCl.sub.2 to give a final reaction of 10 μl with 1× FastStart High Fidelity Reaction Buffer with 1.8 mM MgCl.sub.2 and 1 U FastStart High Fidelity Enzyme Blend. PCR amplification were carried out in a thermo cycler (Applied Biosystems) with the following program: Hot start at 94° C. for 2 min, followed by 50 cycles at 94° C. for 15 seconds, 55° C. for 30 seconds, 68° C. for 1 minute, and a final extension at 68° C. for 5 minutes.

(112) Primer sequences, resulting in a product of approximately 250 bp,

(113) TABLE-US-00002 Beta-2 microglobulin (B2M) primer 5′-TGGGGGTGAGAATTGCTAAG-3′ (SEQ ID NO: 43) ID-1 primer 5′-CCTTCTCCTTCTCCTTCACC-3′ (SEQ ID NO: 44) ID-5 primer 5′-GTCCTCTATTCCGTCACCAT-3′ (SEQ ID NO: 45) ID-20 primer 5′-CTGCTTCTTCCTGGAACTCA-3′ (SEQ ID NO: 46)

(114) The results are shown in FIG. 15. This shows successful amplification of ID-specific and gene-specific products using two different ID primers (i.e. specific for ID tags positioned at different locations on the microarray and the same gene specific primer from a brain tissue covering all the probes. Accordingly this experiment establishes that products may be identified by an ID tag-specific or target nucleic acid specific amplification reaction. It is further established that different ID tags may be distinguished. A second experiment, with tissue covering only half of the ID probes (i.e. capture probes) on the array resulted in a positive result (PCR product) for spots that were covered with tissue.

EXAMPLE 5

(115) Spatial Genomics

(116) Background. The method has as its purpose to capture DNA molecules from a tissue sample with retained spatial resolution, making it possible to determine from what part of the tissue a particular DNA fragment stems.

(117) Method. The principle of the method is to use microarrays with immobilized DNA oligos (capture probes) carrying spatial labeling tag sequences (positional domains). Each feature of oligos of the microarray carries a 1) a unique labeling tag (positional domain) and 2) a capture sequence (capture domain). Keeping track of where which labeling tag is geographically placed on the array surface makes it possible to extract positional information in two dimensions from each labeling tag. Fragmented genomic DNA is added to the microarray, for instance through the addition of a thin section of FFPE treated tissue. The genomic DNA in this tissue section is pre-fragmented due to the fixation treatment.

(118) Once the tissue slice has been placed on the array, a universal tailing reaction is carried out through the use of a terminal transferase enzyme. The tailing reaction adds polydA tails to the protruding 3′ ends of the genomic DNA fragments in the tissue. The oligos on the surface are blocked from tailing by terminal transferase through a hybridized and 3′ blocked polydA probe.

(119) Following the terminal transferase tailing, the genomic DNA fragments are able to hybridize to the spatially tagged oligos in their vicinity through the polydA tail meeting the polydT capture sequence on the surface oligos. After hybridization is completed a strand displacing polymerase such as Klenow exo− can use the oligo on the surface as a primer for creation of a new DNA strand complementary to the hybridized genomic DNA fragment. The new DNA strand will now also contain the positional information of the surface oligo's labeling tag.

(120) As a last step the newly generated labeled DNA strands are cleaved from the surface through either enzymatic means, denaturation or physical means. The strands are then collected and can be subjected to downstream amplification of the entire set of strands through introduction of universal handles, amplification of specific amplicons, and/or sequencing.

(121) FIG. 16 is a schematic illustration of this process.

(122) Materials and Methods

(123) Preparation of In-House Printed Microarray with 5′ to 3′ Oriented Probes

(124) 20 DNA-capture oligos with individual tag sequences (Table 1) were spotted on glass slides to function as capture probes. The probes were synthesized with a 5′-terminus amino linker with a C6 spacer. All probes where synthesized by Sigma-Aldrich (St. Louis, Mo., USA). The DNA-capture probes were suspended at a concentration of 20 μM in 150 mM sodium phosphate, pH 8.5 and were spotted using a Nanoplotter NP2.1/E (Gesim, Grosserkmannsdorf, Germany) onto CodeLink™ Activated microarray slides (7.5 cm×2.5 cm; Surmodics, Eden Prairie, Minn., USA). After printing, surface blocking was performed according to the manufacturers instructions. The probes were printed in 16 identical arrays on the slide, and each array contained a pre-defined printing pattern. The 16 sub-arrays were separated during hybridization by a 16-pad mask (ChipClip™ Schleicher & Schuell BioScience, Keene, N.H., USA).

(125) Preparation of In-House Printed Microarray with 3′ to 5′ Oriented Probes and Synthesis of 5′ to 3′ Oriented Capture Probes

(126) Printing of oligos was performed as in the case with 5′ to 3′ oriented probes above.

(127) To hybridize primers for capture probe synthesis hybridization solution containing 4×SSC and 0.1% SDS, 2 μM extension primer (A_primer) and 2 μM thread joining primer (p_poly_dT) was incubated for 4 min at 50° C. Meanwhile the in-house array was attached to a ChipClip (Whatman). The array was subsequently incubated at 50° C. for 30 min at 300 rpm shake with 50 μL of hybridization solution per well.

(128) After incubation, the array was removed from the ChipClip and washed with the 3 following steps: 1) 50° C. 2×SSC solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2×SSC for 1 min at 300 rpm shake and 3) 0.1×SSC for 1 min at 300 rpm shake. The array was then spun dry and placed back in the ChipClip.

(129) For extension and ligation 50 μL of enzyme mix containing 10× Ampligase buffer, 2.5 U AmpliTaq DNA Polymerase Stoffel Fragment (Applied Biosystems), 10 U Ampligase (Epicentre Biotechnologies), dNTPs 2 mM each (Fermentas) and water, is pipetted to each well. The array is subsequently incubated at 55° C. for 30 min. After incubation the array is washed according to previously described array washing method but the first step has the duration of 10 min instead of 6 min.

(130) Hybridization of polydA Probe for Protection of Surface Oligo Capture Sequences from dA Tailing

(131) To hybridize a 3′-biotin blocked polydA probe for protection of the surface oligo capture sequences a hybridization solution containing 4×SSC and 0.1% SDS, 2 μM 3′ bio-polydA was incubated for 4 min at 50° C. Meanwhile the in-house array was attached to a ChipClip (Whatman). The array was subsequently incubated at 50° C. for 30 min at 300 rpm shake with 50 μL of hybridization solution per well.

(132) After incubation, the array was removed from the ChipClip and washed with the 3 following steps: 1) 50° C. 2×SSC solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2×SSC for 1 min at 300 rpm shake and 3) 0.1×SSC for 1 min at 300 rpm shake. The array was then spun dry and placed back in the ChipClip.

(133) Preparation of Formalin-Fixed Paraffin-Embedded (FFPE) Tissue

(134) Mouse brain tissue was fixed in 4% formalin at 4° C. for 24 h. After that it was incubated as follows: 3× incubation in 70% ethanol for 1 hour, 1× incubation in 80% ethanol for 1 hour, 1× incubation in 96% ethanol for 1 hour, 3× incubation in 100% ethanol for 1 hour, 2× incubation in xylene at room temperature for 1 h.

(135) The dehydrated samples were then incubated in liquid low melting paraffin 52-54° C. for up to 3 hours, during which the paraffin in changed once to wash out residual xylene. Finished tissue blocks were then stored at RT. Sections were then cut at 4 μm in paraffin with a microtome onto each capture probe array to be used.

(136) The sections are dried at 37° C. on the array slides for 24 hours and store at RT.

(137) Deparaffinization of FFPE Tissue

(138) Formalin fixed paraffinized mouse brain 10 μm sections attached to CodeLink slides were deparaffinised in xylene twice for 10 min, 99.5% ethanol for 2 min, 96% ethanol for 2 min, 70% ethanol for 2 min and were then air dried.

(139) Universal Tailing of Genomic DNA

(140) For dA tailing a 50 μl reaction mixture containing 1× TdT buffer (20 mM Tris-acetate (pH 7.9), 50 mM Potassium Acetate and 10 mM Magnesium Acetate) (New England Biolabs, www.neb.com), 0.1 μg/μl BSA (New England Biolabs), 1 μl TdT (20 U/μl) and 0.5 μl dATPs (100 mM) was prepared. The mixture was added to the array surface and the array was incubated in a thermo cycler (Applied Biosystems) at 37° C. for 15 min followed by an inactivation of TdT at 70° C. for 10 min. After this the temperature was lowered to 50° C. again to allow for hybridization of dA tailed genomic fragments to the surface oligo capture sequences.

(141) After incubation, the array was removed from the ChipClip and washed with the 3 following steps: 1) 50° C. 2×SSC solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2×SSC for 1 min at 300 rpm shake and 3) 0.1×SSC for 1 min at 300 rpm shake. The array was then spun dry.

(142) Extension of Labeled DNA

(143) A 50 μl reaction mixture containing 50 μl of a mixture containing 1× Klenow buffer, 200 μM dNTPs (New England Biolabs) and 1 μl Klenow Fragment (3′ to 5′ exo minus) and was heated to 37° C. and was added to each well and incubated at 37° C. for 30 min with mixing (3 s. 300 rpm. 6 s. rest) (Thermomixer comfort; Eppendorf).

(144) After incubation, the array was removed from the ChipClip and washed with the 3 following steps: 1) 50° C. 2×SSC solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2×SSC for 1 min at 300 rpm shake and 3) 0.1×SSC for 1 min at 300 rpm shake. The array was then spun dry.

(145) Removal of Residual Tissue

(146) The slides with attached formalin fixed paraffinized mouse brain tissue sections were attached to ChipClip slide holders and 16 well masks (Whatman). For each 150 μl Proteinase K Digest Buffer from the RNeasy FFPE kit (Qiagen) 10 μl Proteinase K Solution (Qiagen) was added. 50 μl of the final mixture was added to each well and the slide was incubated at 56° C. for 30 min.

(147) Capture Probe Release with Uracil Cleaving USER Enzyme Mixture in PCR Buffer (Covalently Attached Probes)

(148) A 16 well mask and CodeLink slide was attached to the ChipClip holder (Whatman). 50 μl of a mixture containing 1× FastStart High Fidelity Reaction Buffer with 1.8 mM MgCl.sub.2 (Roche), 200 μM dNTPs (New England Biolabs) and 0.1 U/1 μl USER Enzyme (New England Biolabs) was heated to 37° C. and was added to each well and incubated at 37° C. for 30 min with mixing (3 s. 300 rpm, 6 s. rest) (Thermomixer comfort; Eppendorf). The reaction mixture containing the released cDNA and probes was then recovered from the wells with a pipette.

(149) Amplification of ID-Specific and Gene Specific Products after Synthesis of Labelled DNA and Probe Collection

(150) Following capture probe release with uracil cleaving USER enzyme mixture in PCR buffer (covalently attached probes).

(151) The cleaved DNA was amplified in final reaction volumes of 10 μl. 7 μl cleaved template, 1 μl ID-specific forward primer (2 μM), 1 μl gene-specific reverse primer (2 μM) and 1 μl FastStart High Fidelity Enzyme Blend in 1.4× FastStart High Fidelity Reaction Buffer with 1.8 mM MgCl.sub.2 to give a final reaction of 10 μl with 1× FastStart High Fidelity Reaction Buffer with 1.8 mM MgCl.sub.2 and 1 U FastStart High Fidelity Enzyme Blend. PCR amplification were carried out in a thermo cycler (Applied Biosystems) with the following program: Hot start at 94° C. for 2 min, followed by 50 cycles at 94° C. for 15 seconds, 55° C. for 30 seconds, 68° C. for 1 minute, and a final extension at 68° C. for 5 minutes.

(152) Whole Genome Amplification by Random Primer Second Strand Synthesis Followed by Universal Handle Amplification (Capture Probe Sequences Including Tag Sequences Retained at the End of the Resulting dsDNA)

(153) Following capture probe release with uracil cleaving USER enzyme mixture in PCR buffer (covalently attached probes).

(154) A reaction mixture containing 40 μl 1× Faststart HiFi PCR Buffer (pH 8.3) with 1.8 mM MgCl.sub.2 (Roche, www.roche-applied-science.com), 0.2 mM of each dNTP (Fermentas, www.fermentas.com), 0.1 μg/μl BSA (New England Biolabs, www.neb.com), 0.1 U/μl USER Enzyme (New England Biolabs), released DNA (extended from surface probes) and released surface probes. The tubes were incubated at 37° C. for 30 min followed by 70° C. for 20 min in a thermo cycler (Applied Biosystems, www.appliedbiosystems.com). 1 μl Klenow Fragment (3′ to 5′ exo minus) (Illumina, www.illumina.com) and 1 μl handle coupled random primer (10 μM) (Eurofins MWG Operon, www.eurofinsdna.com) was added to the tube. The tube was incubated at 15° C. for 15 min, 25° C. for 15 min, 37° C. for 15 min and finally 75° C. for 20 min in a thermo cycler (Applied Biosystems). After the incubation, 1 μl of each primer, A_P and B (10 μM) (Eurofins MWG Operon), was added to the tube. 1 μl Faststart HiFi DNA polymerase (5 U/μl) (Roche) was also added to the tube. PCR amplification were carried out in a thermo cycler (Applied Biosystems) with the following program: Hot start at 94° C. for 2 min, followed by 50 cycles at 94° C. for 15 seconds, 55° C. for 30 seconds, 68° C. for 1 minute, and a final extension at 68° C. for 5 minutes. After the amplification, 40 μl from the tube was purified with Qiaquick PCR purification columns (Qiagen, www.qiagen.com) and eluted into 30 μl EB (10 mM Tris-Cl, pH 8.5). The Purified product was analyzed with a Bioanalyzer (Agilent, www.home.agilent.com), DNA 7500 kit were used.

(155) Visualization

(156) Hybridization of Fluorescent Marker Probes Prior to Staining

(157) Prior to tissue application fluorescent marker probes are hybridized to designated marker sequences printed on the capture probe array. The fluorescent marker probes aid in the orientation of the resulting image after tissue visualization, making it possible to combine the image with the resulting expression profiles for individual capture probe tag sequences obtained after sequencing. To hybridize fluorescent probes a hybridization solution containing 4×SSC and 0.1% SDS, 2 μM detection probe (P) was incubated for 4 min at 50° C. Meanwhile the in-house array was attached to a ChipClip (Whatman). The array was subsequently incubated at 50° C. for 30 min at 300 rpm shake with 50 μL of hybridization solution per well.

(158) After incubation, the array was removed from the ChipClip and washed with the 3 following steps: 1) 50° C. 2×SSC solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2×SSC for 1 min at 300 rpm shake and 3) 0.1×SSC for 1 min at 300 rpm shake. The array was then spun dry.

(159) General Histological Staining of FFPE Tissue Sections Prior to or Post Synthesis of Labeled DNA

(160) FFPE tissue sections immobilized on capture probe arrays are washed and rehydrated after deparaffinization prior to synthesis of labeled as described previously, or washed after synthesis of labeled DNA as described previously. They are then treated as follows: incubate for 3 minutes in Hematoxylin, rinse with deionized water, incubate 5 minutes in tap water, rapidly dip 8 to 12 times in acid ethanol, rinse 2×1 minute in tap water, rinse 2 minutes in deionized water, incubate 30 seconds in Eosin, wash 3×5 minutes in 95% ethanol, wash 3×5 minutes in 100% ethanol, wash 3×10 minutes in xylene (can be done overnight), place coverslip on slides using DPX, dry slides in the hood overnight.

(161) General Immunohistochemistry Staining of a Target Protein in FFPE Tissue Sections Prior to or Post Synthesis of Labeled DNA

(162) FFPE tissue sections immobilized on capture probe arrays are washed and rehydrated after deparaffinization prior to synthesis of labeled DNA as described previously, or washed after synthesis of labeled DNA as described previously. They are then treated as follows without being let to dry during the whole staining process: Dilute primary antibody in blocking solution (1×TBS (Tris Buffered Saline (50 mM Tris, 150 mM NaCl, pH 7.6), 4% donkey serum, 0.1% triton-x), incubate sections with primary antibody in a wet chamber overnight at RT, rinse 3× with 1×TBS, incubate section with matching secondary antibody conjugated to a fluorochrome (FITC, Cy3 or Cy5) in a wet chamber at RT for 1 h, Rinse 3× with 1×TBS, remove as much as possible of TBS and mount section with ProLong Gold+DAPI (Invitrogen) and analyze with fluorescence microscope and matching filter sets.

EXAMPLE 6

(163) This experiment was conducted following the principles of Example 5, but using fragmented genomic DNA on the array rather than tissue. The genomic DNA was pre-fragmented to a mean size of 200 bp and 700 bp respectively. This experiment shows that the principle works. Fragmented genomic DNA is very similar to FFPE tissue.

(164) Amplification of Internal Gene Specific Products after Synthesis of Labelled DNA and Probe Collection

(165) Following capture probe release with uracil cleaving USER enzyme mixture in PCR buffer (covalently attached probes) containing 1× FastStart High Fidelity Reaction Buffer with 1.8 mM MgCl.sub.2 (Roche), 200 μM dNTPs (New England Biolabs) and 0.1 U/1 μL USER Enzyme (New England Biolabs).

(166) The cleaved DNA was amplified in a final reaction volume of 50 μl. To 47 μl cleaved template was added 1 μl ID-specific forward primer (10 μM), 1 μl gene-specific reverse primer (10 μM) and 1 μl FastStart High Fidelity Enzyme Blend. PCR amplification were carried out in a thermo cycler (Applied Biosystems) with the following program: Hot start at 94° C. for 2 min, followed by 50 cycles at 94° C. for 15 seconds, 55° C. for 30 seconds, 68° C. for 1 minute, and a final extension at 68° C. for 5 minutes.

(167) Amplification of Label-Specific and Gene Specific Products after Synthesis of Labelled DNA and Probe Collection

(168) Following capture probe release with uracil cleaving USER enzyme mixture in PCR buffer (covalently attached probes) containing 1× FastStart High Fidelity Reaction Buffer with 1.8 mM MgCl.sub.2 (Roche), 200 μM dNTPs (New England Biolabs) and 0.1 U/1 μl USER Enzyme (New England Biolabs).

(169) The cleaved DNA was amplified in a final reaction volume of 50 μl. To 47 μl cleaved template was added 1 μl label-specific forward primer (10 μM), 1 μl gene-specific reverse primer (10 μM) and 1 μl FastStart High Fidelity Enzyme Blend. PCR amplification were carried out in a thermo cycler (Applied Biosystems) with the following program: Hot start at 94° C. for 2 min, followed by 50 cycles at 94° C. for 15 seconds, 55° C. for 30 seconds, 68° C. for 1 minute, and a final extension at 68° C. for 5 minutes.

(170) TABLE-US-00003 Forward - Genomic DNA Human Primer 5′-GACTGCTCTTTTCACCCATC-3′ (SEQ ID NO: 47) Reverse - Genomic DNA Human Primer 5′-GGAGCTGCTGGTGCAGGG-3′ (SEQ ID NO: 48) P - label specific primer 5′-ATCTCGACTGCCACTCTGAA-3′ (SEQ ID NO: 49)

(171) The results are shown in FIGS. 17 to 20. The Figures show internal products amplified on the array—the detected peaks in FIGS. 17 and 18 are of the expected size. This thus demonstrates that genomic DNA may be captured and amplified. In FIGS. 19 and 20, the expected product is a smear given that the random fragmentation and terminal transferase labeling of genomic DNA will generate a very diverse sample pool.

EXAMPLE 7

(172) Alternative Synthesis of 5′ to 3′ Oriented Capture Probes Using Polymerase Extension and Terminal Transferase Tailing

(173) To hybridize primers for capture probe synthesis hybridization solution containing 4×SSC and 0.1% SDS and 2 μM extension primer (A_primer) was incubated for 4 min at 50° C. Meanwhile the in-house array (see Example 1) was attached to a ChipClip (Whatman). The array was subsequently incubated at 50° C. for 30 min at 300 rpm shake with 50 μL of hybridization solution per well.

(174) After incubation, the array was removed from the ChipClip and washed with the 3 following steps: 1) 50° C. 2×SSC solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2×SSC for 1 min at 300 rpm shake and 3) 0.1×SSC for 1 min at 300 rpm shake. The array was then spun dry and placed back in the ChipClip.

(175) 1 μl Klenow Fragment (3′ to 5′ exo minus) (Illumina, www.illumina.com) together with 10× Klenow buffer, dNTPs 2 mM each (Fermentas) and water, was mixed into a 50 μl reaction and was pipetted into each well.

(176) The array was incubated at 15° C. for 15 min, 25° C. for 15 min, 37° C. for 15 min and finally 75° C. for 20 min in an Eppendorf Thermomixer.

(177) After incubation, the array was removed from the ChipClip and washed with the 3 following steps: 1) 50° C. 2×SSC solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2×SSC for 1 min at 300 rpm shake and 3) 0.1×SSC for 1 min at 300 rpm shake. The array was then spun dry and placed back in the ChipClip.

(178) For dT tailing a 50 μl reaction mixture containing 1× TdT buffer (20 mM Tris-acetate (pH 7.9), 50 mM Potassium Acetate and 10 mM Magnesium Acetate) (New England Biolabs, www.neb.com), 0.1 μg/μl BSA (New England Biolabs), 0.50 μl RNase H (5 U/μl), 1 μl TdT (20 U/μl) and 0.5 μl dTTPs (100 mM) was prepared. The mixture was added to the array surface and the array was incubated in a thermo cycler (Applied Biosystems) at 37° C. for 15 min followed by an inactivation of TdT at 70° C. for 10 min.

EXAMPLE 8

(179) Spatial Transcriptomics Using 5′ to 3′ High Probe Density Arrays and Formalin-Fixed Frozen (FF-Frozen) Tissue with USER System Cleavage and Amplification Via Terminal Transferase

(180) Array Preparation

(181) Pre-fabricated high-density microarrays chips were ordered from Roche-Nimblegen (Madison, Wis., USA). Each capture probe array contained 135,000 features of which 132,640 features carried a capture probe comprising a unique ID-tag sequence (positional domain) and a capture region (capture domain). Each feature was 13×13 μm in size. The capture probes were composed 5′ to 3′ of a universal domain containing five dUTP bases (a cleavage domain) and a general amplification domain, an ID tag (positional domain) and a capture region (capture domain) (FIG. 22 and Table 2). Each array was also fitted with a frame of marker probes (FIG. 23) carrying a generic 30 bp sequence (Table 2) to enable hybridization of fluorescent probes to help with orientation during array visualization.

(182) Tissue Preparation—Preparation of Formalin-Fixed Frozen Tissue

(183) The animal (mouse) was perfused with 50 ml PBS and 100 ml 4% formalin solution. After excision of the olfactory bulb, the tissue was put into a 4% formalin bath for post-fixation for 24 hrs. The tissue was then sucrose treated in 30% sucrose dissolved in PBS for 24 hrs to stabilize morphology and to remove excess formalin. The tissue was frozen at a controlled rate down to −40° C. and kept at −20° C. between experiments. Similar preparation of tissue postfixed for 3 hrs or without post-fixation was carried out for a parallel specimen. Perfusion with 2% formalin without post-fixation was also used successfully. Similarly the sucrose treatment step could be omitted. The tissue was mounted into a cryostat for sectioning at 10 μm. A slice of tissue was applied onto each capture probe array to be used. Optionally for better tissue adherence, the array chip was placed at 50° C. for 15 minutes.

(184) Optional Control—Total RNA Preparation from Sectioned Tissue

(185) Total RNA was extracted from a single tissue section (10 μm) using the RNeasy FFPE kit (Qiagen) according to manufacturers instructions. The total RNA obtained from the tissue section was used in control experiments for a comparison with experiments in which the RNA was captured on the array directly from the tissue section. Accordingly, in the case where totalRNA was applied to the array the staining, visualization and degradation of tissue steps were omitted.

(186) On-Chip Reactions

(187) The hybridization of marker probe to the frame probes, reverse transcription, nuclear staining, tissue digestion and probe cleavage reactions were all performed in a 16 well silicone gasket (ArrayIt, Sunnyvale, Calif., USA) with a reaction volume of 50 μl per well. To prevent evaporation, the cassettes were covered with plate sealers (In Vitro AB, Stockholm, Sweden).

(188) Optional—Tissue Permeabilization Prior to cDNA Synthesis

(189) For permeabilization using Proteinase K, proteinase K (Qiagen, Hilden, Germany) was diluted to 1 μg/ml in PBS. The solution was added to the wells and the slide incubated at room temperature for 5 minutes, followed by a gradual increase to 80° C. over 10 minutes. The slide was washed briefly in PBS before the reverse transcription reaction.

(190) Alternatively for permeabilization using microwaves, after tissue attachment, the slide was placed at the bottom of a glass jar containing 50 ml 0.2×SSC (Sigma-Aldrich) and was heated in a microwave oven for 1 minute at 800 W. Directly after microwave treatment the slide was placed onto a paper tissue and was dried for 30 minutes in a chamber protected from unnecessary air exposure. After drying, the slide was briefly dipped in water (RNase/DNase free) and finally spin-dried by a centrifuge before cDNA synthesis was initiated.

cDNA Synthesis

(191) For the reverse transcription reaction the SuperScript III One-Step RT-PCR System with Platinum Taq (Life Technologies/Invitrogen, Carlsbad. Calif., USA) was used. Reverse transcription reactions contained 1× reaction mix, 1×BSA (New England Biolabs, Ipswich, Mass., USA) and 2 μl SuperScript III RT/Platinum Taq mix in a final volume of 50 μl. This solution was heated to 50° C. before application to the tissue sections and the reaction was performed at 50° C. for 30 minutes. The reverse transcription solution was subsequently removed from the wells and the slide was allowed to air dry for 2 hours.

(192) Tissue Visualization

(193) After cDNA synthesis, nuclear staining and hybridization of the marker probe to the frame probes (probes attached to the array substrate to enable orientation of the tissue sample on the array) was done simultaneously. A solution with DAPI at a concentration of 300 nM and marker probe at a concentration of 170 nM in PBS was prepared. This solution was added to the wells and the slide was incubated at room temperature for 5 minutes, followed by brief washing in PBS and spin drying.

(194) Alternatively the marker probe was hybridized to the frame probes prior to placing the tissue on the array. The marker probe was then diluted to 170 nM in hybridization buffer (4×SSC, 0.1% SDS). This solution was heated to 50° C. before application to the chip and the hybridization was performed at 50° C. for 30 minutes at 300 rpm. After hybridization, the slide was washed in 2×SSC, 0.1% SDS at 50° C. and 300 rpm for 10 minutes, 0.2×SSC at 300 rpm for 1 minute and 0.1×SSC at 300 rpm for 1 minute. In that case the staining solution after cDNA synthesis only contained the nuclear DAPI stain diluted to 300 nM in PBS. The solution was applied to the wells and the slide was incubated at room temperature for 5 minutes, followed by brief washing in PBS and spin drying.

(195) The sections were microscopically examined with a Zeiss Axio Imager Z2 and processed with MetaSystems software.

(196) Tissue Removal

(197) The tissue sections were digested using Proteinase K diluted to 1.25 μg/μl in PKD buffer from the RNeasy FFPE Kit (both from Qiagen) at 56° C. for 30 minutes with an interval mix at 300 rpm for 3 seconds, then 6 seconds rest. The slide was subsequently washed in 2×SSC, 0.1% SDS at 50° C. and 300 rpm for 10 minutes, 0.2×SSC at 300 rpm for 1 minute and 0.1×SSC at 300 rpm for 1 minute.

(198) Probe Release

(199) The 16-well Hybridization Cassette with silicone gasket (Arraylt) was preheated to 37° C. and attached to the Nimblegen slide. A volume of 50 μl of cleavage mixture preheated to 37° C., consisting of Lysis buffer at an unknown concentration (Takara), 0.1 U/μl USER Enzyme (NEB) and 0.1 μg/μl BSA was added to each of wells containing surface immobilized cDNA. After removal of bubbles the slide was sealed and incubated at 37° C. for 30 minutes in a Thermomixer comfort with cycled shaking at 300 rpm for 3 seconds with 6 seconds rest in between. After the incubation 45 μl cleavage mixture was collected from each of the used wells and placed into 0.2 ml PCR tubes (FIG. 24).

(200) Library Preparation

(201) Exonuclease Treatment

(202) After cooling the solutions on ice for 2 minutes, Exonuclease I (NEB) was added, to remove unextended cDNA probes, to a final volume of 46.2 μl and a final concentration of 0.52 U/μl. The tubes were incubated in a thermo cycler (Applied Biosystems) at 37° C. for 30 minutes followed by inactivation of the exonuclease at 80° C. for 25 minutes.

(203) dA-Tailing by Terminal Transferase

(204) After the exonuclease step, 450 μl polyA-tailing mixture, according to manufacturers instructions consisting of TdT Buffer (Takara), 3 mM dATP (Takara) and manufacturers TdT Enzyme mix (TdT and RNase H) (Takara), was added to each of the samples. The mixtures were incubated in a thermocycler at 37° C. for 15 minutes followed by inactivation of TdT at 70° C. for 10 minutes.

(205) Second-Strand Synthesis and PCR-Amplification

(206) After dA-tailing, 23 μl PCR master mix was placed into four new 0.2 ml PCR tubes per sample, to each tube 2 μl sample was added as a template. The final PCRs consisted of ix Ex Taq buffer (Takara), 200 μM of each dNTP (Takara), 600 nM A_primer (MWG), 600 nM B_dT20VN_primer (MWG) and 0.025 U/μl Ex Taq polymerase (Takara)(Table 2). A second cDNA strand was created by running one cycle in a thermocycler at 95° C. for 3 minutes, 50° C. for 2 minutes and 72° C. for 3 minutes. Then the samples were amplified by running 20 cycles (for library preparation) or 30 cycles (to confirm the presence of cDNA) at 95° C. for 30 seconds, 67° C. for 1 minute and 72° C. for 3 minutes, followed by a final extension at 72° C. for 10 minutes.

(207) Library Cleanup

(208) After amplification, the four PCRs (100 μl) were mixed with 500 μl binding buffer (Qiagen) and placed in a Qiaquick PCR purification column (Qiagen) and spun for 1 minute at 17,900×g in order to bind the amplified cDNA to the membrane. The membrane was then washed with wash buffer (Qiagen) containing ethanol and finally eluted into 50 μl of 10 mM Tris-Cl, pH 8.5.

(209) The purified and concentrated sample was further purified and concentrated by CA-purification (purification by superparamagnetic beads conjugated to carboxylic acid) with an MBS robot (Magnetic Biosolutions). A final PEG concentration of 10% was used in order to remove fragments below 150-200 bp. The amplified cDNA was allowed to bind to the CA-beads (Invitrogen) for 10 min and were then eluted into 15 μl of 10 mM Tris-Cl, pH 8.5.

(210) Library Quality Analysis

(211) Samples amplified for 30 cycles were analyzed with an Agilent Bioanalyzer (Agilent) in order to confirm the presence of an amplified cDNA library, the DNA High Sensitivity kit or DNA 1000 kit were used depending on the amount of material.

(212) Sequencing Library Preparation

(213) Library Indexing

(214) Samples amplified for 20 cycles were used further to prepare sequencing libraries. An index PCR master mix was prepared for each sample and 23 μl was placed into six 0.2 ml tubes. 2 μl of the amplified and purified cDNA was added to each of the six PCRs as template making the PCRs containing 1× Phusion master mix (Fermentas), 500 nM InPE1.0 (Illumina), 500 nM Index 1-12 (Illumina), and 0.4 nM InPE2.0 (Illumina). The samples were amplified in a thermocycler for 18 cycles at 98° C. for 30 seconds, 65° C. for 30 seconds and 72° C. for 1 minute, followed by a final extension at 72° C. for 5 minutes.

(215) Sequencing Library Cleanup

(216) After amplification, the six PCRs (150μ) were mixed with 7500 μl binding buffer and placed in a Qiaquick PCR purification column and spun for 1 minute at 17,900×g in order to bind the amplified cDNA to the membrane (because of the large sample volume (900 μl), the sample was split in two (each 450 μl) and was bound in two separate steps). The membrane was then washed with wash buffer containing ethanol and finally eluted into 50 μl of 10 mM Tris-Cl, pH 8.5.

(217) The purified and concentrated sample was further purified and concentrated by CA-purification with an MBS robot. A final PEG concentration of 7.8% was used in order to remove fragments below 300-350 bp. The amplified cDNA was allowed to bind to the CA-beads for 10 min and were then eluted into 15 μl of 10 mM Tris-Cl, pH 8.5. Samples were analyzed with an Agilent Bioanalyzer in order to confirm the presence and size of the finished libraries, the DNA High Sensitivity kit or DNA 1000 kit were used according to manufacturers instructions depending on the amount of material (FIG. 25).

(218) Sequencing

(219) The libraries were sequenced on the Illumina Hiseq2000 or Miseq depending on desired data throughput according to manufacturers instructions. Optionally for read 2, a custom sequencing primer B_r2 was used to avoid sequencing through the homopolymeric stretch of 20 T.

(220) Data Analysis

(221) Read 1 was trimmed 42 bases at 5′ end. Read 2 was trimmed 25 bases at 5′ end (optionally no bases were trimmed from read 2 if the custom primer was used). The reads were then mapped with bowtie to the repeat masked Mus musculus 9 genome assembly and the output was formatted in the SAM file format. Mapped reads were extracted and annotated with UCSC refGene gene annotations. Indexes were retrieved with ‘indexFinder’ (an inhouse software for index retrieval). A mongo DB database was then created containing information about all caught transcripts and their respective index position on the chip.

(222) A matlab implementation was connected to the database and allowed for spatial visualization and analysis of the data (FIG. 26).

(223) Optionally the data visualization was overlaid with the microscopic image using the fluorescently labelled frame probes for exact alignment and enabling spatial transcriptomic data extraction.

EXAMPLE 9

(224) Spatial Transcriptomics Using 3′ to 5′ High Probe Density Arrays and FFPE Tissue with MutY System Cleavage and Amplification Via TdT

(225) Array Preparation

(226) Pre-fabricated high-density microarrays chips were ordered from Roche-Nimblegen (Madison, Wis., USA). Each used capture probe array contained 72 k features out of which 66,022 contained a unique ID-tag complementary sequence. Each feature was 16×16 μm in size. The capture probes were composed 3′ to 5′ in the same way as the probes used for the in-house printed 3′ to 5′ arrays with the exception to 3 additional bases being added to the upper (P′) general handle of the probe to make it a long version of P′, LP′ (Table 2). Each array was also fitted with a frame of probes carrying a generic 30 bp sequence to enable hybridization of fluorescent probes to help with orientation during array visualization.

Synthesis of 5′ to 3′ Oriented Capture Probes

(227) The synthesis of 5′ to 3′ oriented capture probes on the high-density arrays was carried out as in the case with in-house printed arrays, with the exception that the extension and ligation steps were carried out at 55° C. for 15 mins followed by 72° C. for 15 mins. The A-handle probe (Table 2) included an A/G mismatch to allow for subsequent release of probes through the MutY enzymatic system described below. The P-probe was replaced by a longer LP version to match the longer probes on the surface.

(228) Preparation of Formalin-Fixed Paraffin-Embedded Tissue and Deparaffinization

(229) This was carried out as described above in the in-house protocol.

cDNA Synthesis and Staining

(230) cDNA synthesis and staining was carried out as in the protocol for 5′ to 3′ oriented high-density Nimblegen arrays with the exception that biotin labeled dCTPs and dATPs were added to the cDNA synthesis together with the four regular dNTPs (each was present at 25× times more than the biotin labeled ones).

(231) Tissue Removal

(232) Tissue removal was carried out in the same way as in the protocol for 5′ to 3′ oriented high-density Nimblegen arrays described in Example 8.

(233) Probe Cleavage by MutY

(234) A 16-well Incubation chamber with silicone gasket (ArrayIT) was preheated to 37° C. and attached to the Codelink slide. A volume of 50 μl of cleavage mixture preheated to 37° C., consisting of 1× Endonucelase VIII Buffer (NEB), 10 U/μl MutY (Trevigen), 10 U/μl Endonucelase VIII (NEB), 0.1 μg/μl BSA was added to each of wells containing surface immobilized cDNA. After removal of bubbles the slide was sealed and incubated at 37° C. for 30 minutes in a Thermomixer comfort with cycled shaking at 300 rpm for 3 seconds with 6 seconds rest in between. After the incubation, the plate sealer was removed and 40 μl cleavage mixture was collected from each of the used wells and placed into a PCR plate.

(235) Library Preparation

(236) Biotin-Streptavidin Mediated Library Cleanup

(237) To remove unextended cDNA probes and to change buffer, the samples were purified by binding the biotin labeled cDNA to streptavidin coated C1-beads (Invitrogen) and washing the beads with 0.1M NaOH (made fresh). The purification was carried out with an MBS robot (Magnetic Biosolutions), the biotin labelled cDNA was allowed to bind to the C1-beads for 10 min and was then eluted into 20 μl of water by heating the bead-water solution to 80° C. to break the biotin-streptavidin binding.

(238) dA-Tailing by Terminal Transferase

(239) After the purification step, 18 μl of each sample was placed into new 0.2 ml PCR tubes and mixed with 22 μl of a polyA-tailing master mix leading to a 40 μl reaction mixture according to manufacturers instructions consisting of lysis buffer (Takara, Cellamp Whole Transcriptome Amplification kit), TdT Buffer (Takara), 1.5 mM dATP (Takara) and TdT Enzyme mix (TdT and RNase H) (Takara). The mixtures were incubated in a thermocycler at 37° C. for 15 minutes followed by inactivation of TdT at 70° C. for 10 minutes.

(240) Second-Strand Synthesis and PCR-Amplification

(241) After dA-tailing, 23 μl PCR master mix was placed into four new 0.2 ml PCR tubes per sample, to each tube 2 μl sample was added as a template. The final PCRs consisted of 1× Ex Taq buffer (Takara), 200 μM of each dNTP (Takara), 600 nM A_primer (MWG), 600 nM B_dT20VN_primer (MWG) and 0.025 U/μl Ex Taq polymerase (Takara). A second cDNA strand was created by running one cycle in a thermo cycler at 95° C. for 3 minutes, 50° C. for 2 minutes and 72° C. for 3 minutes. Then the samples were amplified by running 20 cycles (for library preparation) or 30 cycles (to confirm the presence of cDNA) at 95° C. for 30 seconds, 67° C. for 1 minute and 72° C. for 3 minutes, followed by a final extension at 72° C. for 10 minutes.

(242) Library Cleanup

(243) After amplification, the four PCRs (100 μl) were mixed with 500 μl binding buffer (Qiagen) and placed in a Qiaquick PCR purification column (Qiagen) and spun for 1 minute at 17,900×g in order to bind the amplified cDNA to the membrane. The membrane was then washed with wash buffer (Qiagen) containing ethanol and finally eluted into 50 μl of 10 mM Tris-HCl, pH 8.5.

(244) The purified and concentrated sample was further purified and concentrated by CA-purification (purification by superparamagnetic beads conjugated to carboxylic acid) with an MBS robot (Magnetic Biosolutions). A final PEG concentration of 10% was used in order to remove fragments below 150-200 bp. The amplified cDNA was allowed to bind to the CA-beads (Invitrogen) for 10 min and were then eluted into 15 μl of 10 mM Tris-HCl, pH 8.5.

(245) Second PCR-Amplification

(246) The final PCRs consisted of 1× Ex Taq buffer (Takara), 200 μM of each dNTP (Takara), 600 nM A_primer (MWG), 600 nM B_primer (MWG) and 0.025 U/μl Ex Taq polymerase (Takara). The samples were heated to 95° C. for 3 minutes, and then amplified by running 10 cycles at 95° C. for 30 seconds, 65° C. for 1 minute and 72° C. for 3 minutes, followed by a final extension at 72° C. for 10 minutes.

(247) Second library cleanup After amplification, the four PCRs (100 μl) were mixed with 500 μl binding buffer (Qiagen) and placed in a Qiaquick PCR purification column (Qiagen) and spun for 1 minute at 17,900×g in order to bind the amplified cDNA to the membrane. The membrane was then washed with wash buffer (Qiagen) containing ethanol and finally eluted into 50 μl of 10 mM Tris-Cl, pH 8.5.

(248) The purified and concentrated sample was further purified and concentrated by CA-purification (purification by super-paramagnetic beads conjugated to carboxylic acid) with an MBS robot (Magnetic Biosolutions). A final PEG concentration of 10% was used in order to remove fragments below 150-200 bp. The amplified cDNA was allowed to bind to the CA-beads (Invitrogen) for 10 min and were then eluted into 15 μl of 10 mM Tris-HCl, pH 8.5.

(249) Sequencing Library Preparation

(250) Library Indexing

(251) Samples amplified for 20 cycles were used further to prepare sequencing libraries. An index PCR master mix was prepared for each sample and 23 μl was placed into six 0.2 ml tubes. 2 μl of the amplified and purified cDNA was added to each of the six PCRs as template making the PCRs containing 1× Phusion master mix (Fermentas), 500 nM InPE1.0 (Illumina), 500 nM Index 1-12 (Illiumina), and 0.4 nM InPE2.0 (Illumina). The samples were amplified in a thermo cycler for 18 cycles at 98° C. for 30 seconds, 65° C. for 30 seconds and 72° C. for 1 minute, followed by a final extension at 72° C. for 5 minutes.

(252) Sequencing Library Cleanup

(253) After amplification, the samples was purified and concentrated by CA-purification with an MBS robot. A final PEG concentration of 7.8% was used in order to remove fragments below 300-350 bp. The amplified cDNA was allowed to bind to the CA-beads for 10 min and were then eluted into 15 μl of 10 mM Tris-HCl, pH 8.5.

(254) 10 μl of the amplified and purified samples were placed on a Caliper XT chip and fragments between 480 bp and 720 bp were cut out with the Caliper XT (Caliper). Samples were analyzed with an Agilent Bioanalyzer in order to confirm the presence and size of the finished libraries, the DNA High Sensitivity kit was used.

(255) Sequencing and Data Analysis

(256) Sequencing and Bioinformatic was carried out in the same way as in the protocol for 5′ to 3′ oriented high-density Nimblegen arrays described in Example 8. However, in the data analysis, read 1 was not used in the mapping of transcripts. Specific Olfr transcripts could be sorted out using the Matlab visualization tool (FIG. 27).

EXAMPLE 10

(257) Spatial Transcriptomics Using in House Printed 41-Tag Microarray with 5′ to 3′ Oriented Probes and Formalin-Fixed Frozen (FF-Frozen) Tissue with Permeabilization Through ProteinaseK or Microwaving with USER System Cleavage and Amplification Via TdT

(258) Array Preparation

(259) In-house arrays were printed as previously described but with a pattern of 41 unique ID-tag probes with the same composition as the probes in the 5′ to 3′ oriented high-density array in Example 8 (FIG. 28).

(260) All other steps were carried out in the same way as in the protocol described in Example 8.

EXAMPLE 11

(261) Alternative Method for Performing the cDNA Synthesis Step

(262) cDNA synthesis on chip as described above can also be combined with template switching to create a second strand by adding a template switching primer to the cDNA synthesis reaction (Table 2). The second amplification domain is introduced by coupling it to terminal bases added by the reverse transcriptase at the 3′ end of the first cDNA strand, and primes the synthesis of the second strand. The library can be readily amplified directly after release of the double-stranded complex from the array surface.

EXAMPLE 12

(263) Spatial Genomics Using in House Printed 41-Tag Microarray with 5′ to 3′ Oriented Probes and Fragmented Poly-A Tailed gDNA with USER System Cleavage and Amplification Via TdT-Tailing or Translocation Specific Primers

(264) Array Preparation

(265) In-house arrays were printed using Codelink slides (Surmodics) as previously described but with a pattern of 41 unique ID-tag probes with the same composition as the probes in the 5′ to 3′ oriented high-density in Example 8.

(266) Total DNA Preparation from Cells

(267) DNA Fragmentation

(268) Genomic DNA (gDNA) was extracted by DNeasy kit (Qiagen) according to the manufacturer's instructions from A431 and U2OS cell lines. The DNA was fragmented to 500 bp on a Covaris sonicator (Covaris) according to manufacturer's instructions.

(269) The sample was purified and concentrated by CA-purification (purification by super-paramagnetic beads conjugated to carboxylic acid) with an MBS robot (Magnetic Biosolutions). A final PEG concentration of 10% was used in order to remove fragments below 150-200 bp. The fragmented DNA was allowed to bind to the CA-beads (Invitrogen) for 10 min and were then eluted into 15 μl of 10 mM Tris-HCl, pH 8.5.

(270) Optional Control—Spiking of Different Cell Lines

(271) Through spiking of A431 DNA into U20S DNA different levels of capture sensitivity can be measured, such as from spiking of 1%, 10% or 50% of A431 DNA.

(272) dA-Tailing by Terminal Transferase

(273) A 45 μl polyA-tailing mixture, according to manufacturer's instructions consisting of TdT Buffer (Takara), 3 mM dATP (Takara) and TdT Enzyme mix (TdT and RNase H) (Takara), was added to 0.5 μg of fragmented DNA. The mixtures were incubated in a thermocycler at 37° C. for 30 minutes followed by inactivation of TdT at 80° C. for 20 minutes. The dA-tailed fragments were then cleaned through a Qiaquick (Qiagen) column according to manufacturer's instructions and the concentration was measured using the Qubit system (Invitrogen) according to manufacturer's instructions.

(274) On-Chip Experiments

(275) The hybridization, second strand synthesis and cleavage reactions were performed on chip in a 16 well silicone gasket (Arraylt, Sunnyvale. Calif., USA). To prevent evaporation, the cassettes were covered with plate sealers (In Vitro AB, Stockholm, Sweden).

(276) Hybridization

(277) 117 ng of DNA was deposited onto a well on a prewarmed array (50° C.) in a total volume of 45 μl consisting of 1×NEB buffer (New England Biolabs) and 1×BSA. The mixture was incubated for 30 mins at 50° C. in a Thermomixer Comfort (Eppendorf) fitted with an MTP block at 300 rpm shake.

(278) Second Strand Synthesis

(279) Without removing the hybridization mixture, 15 μl of a Klenow extension reaction mixture consisting of 1×NEB buffer 1.5 μl Klenow polymerase, and 3.75 μl dNTPs (2 mM each) was added to the well. The reaction mixture was incubated in a Thermomixer Comport (Eppendorf) 37° C. for 30 mins without shaking.

(280) The slide was subsequently washed in 2×SSC, 0.1% SDS at 50° C. and 300 rpm for 10 minutes. 0.2×SSC at 300 rpm for 1 minute and 0.1×SSC at 300 rpm for 1 minute.

(281) Probe Release

(282) A volume of 50 μl of a mixture containing 1× FastStart High Fidelity Reaction Buffer with 1.8 mM MgCl.sub.2 (Roche), 200 μM dNTPs (New England Biolabs), 1×BSA and 0.1 U/1 μl USER Enzyme (New England Biolabs) was heated to 37° C. and was added to each well and incubated at 37° C. for 30 min with mixing (3 seconds at 300 rpm, 6 seconds at rest) (Thermomixer comfort; Eppendorf). The reaction mixture containing the released DNA which was then recovered from the wells with a pipette.

(283) Library Preparation

(284) Amplification Reaction

(285) Amplification was carried out in 10 μl reactions consisting of 7.5 μl released sample, 1 μl of each primer and 0.5 μl enzyme (Roche, FastStart HiFi PCR system). The reaction was cycled as 94° C. for 2 mins, one cycle of 94° C. 15 sec, 55° C. for 2 mins, 72° C. for 2 mins, 30 cycles of 94° C. for 15 secs, 65° C. for 30 secs, 72° C. for 90 secs, and a final elongation at 72° C. for 5 mins.

(286) In the preparation of a library for sequencing the two primers consisted of the surface probe A-handle and either of a specific translocation primer (for A431) or a specific SNP primer coupled to the B-handle (Table 2).

(287) Library Cleanup

(288) The purified and concentrated sample was further purified and concentrated by CA-purification (purification by superparamagnetic beads conjugated to carboxylic acid) with an MBS robot (Magnetic Biosolutions). A final PEG concentration of 10% was used in order to remove fragments below 150-200 bp. The amplified DNA was allowed to bind to the CA-beads (Invitrogen) for 10 min and was then eluted into 150 μl of 10 mM Tris-HCl, pH 8.5.

(289) Library Quality Analysis

(290) Samples were analyzed with an Agilent Bioanalyzer (Agilent) in order to confirm the presence of an amplified DNA library, the DNA High Sensitivity kit or DNA 1000 kit were used depending on the amount of material.

(291) Library Indexing

(292) Samples amplified for 20 cycles were used further to prepare sequencing libraries. An index PCR master mix was prepared for each sample and 23 μl was placed into six 0.2 ml tubes. 2 μl of the amplified and purified cDNA was added to each of the six PCRs as template making the PCRs containing 1× Phusion master mix (Fermentas), 500 nM InPE1.0 (Illumina), 500 nM Index 1-12 (Illumina), and 0.4 nM InPE2.0 (Illumina). The samples were amplified in a thermo cycler for 18 cycles at 98° C. for 30 seconds, 65° C. for 30 seconds and 72° C. for 1 minute, followed by a final extension at 72° C. for 5 minutes.

(293) Sequencing Library Cleanup

(294) The purified and concentrated sample was further purified and concentrated by CA-purification with an MBS robot. A final PEG concentration of 7.8% was used in order to remove fragments below 300-350 bp. The amplified DNA was allowed to bind to the CA-beads for 10 min and were then eluted into 15 μl of 10 mM Tris-Cl, pH 8.5. Samples were analyzed with an Agilent Bioanalyzer in order to confirm the presence and size of the finished libraries, the DNA High Sensitivity kit or DNA 1000 kit were used according to manufacturers instructions depending on the amount of material (FIG. 29).

(295) Sequencing

(296) Sequencing was carried out in the same way as in the protocol for 5′ to 3′ oriented high-density Nimblegen arrays described in Example 8.

(297) Data Analysis

(298) Data analysis was carried out to determine the sensitivity of capture of the arrayed ID-capture probes. Read 2 was sorted based on its content of either of the translocation or SNP primers. These reads were then sorted per their ID contained in Read 1.

(299) Optional Control—Direct Amplification of Cell-Line Specific Translocations

(300) This was used to measure the capture sensitivity of spiked cell lines directly by PCR. The forward and reverse primers (Table 2) for the A431 translocations were used to try and detect the presence of the translocation in the second strand copied and released material (FIG. 30).

(301) TABLE-US-00004 TABLE 2 Oligos used for spatial transcriptomics and spatial genomics Example 8 Nimblegen 5′ to 3′ arrays with free 3′ end Array probes 5′ to 3′ Probe1 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTGTCCGATAT (SEQ ID NO: 50) GATTGCCGCTTTTTTTTTTTTTTTTTTTTVN Probe2 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTATGAGCCGG (SEQ ID NO: 51) GTTCATCTTTTTTTTTTTTTTTTTTTTTTVN Probe3 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTTGAGGCACT (SEQ ID NO: 52) CTGTTGGGATTTTTTTTTTTTTTTTTTTTVN Probe4 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTATGATTAGT (SEQ ID NO: 53) CGCCATTCGTTTTTTTTTTTTTTTTTTTTVN Probe5 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTACTTGAGGG (SEQ ID NO: 54) TAGATGTTTTTTTTTTTTTTTTTTTTTTTVN Probe6 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCAAT (SEQ ID NO: 55) ACTGTTATCTTTTTTTTTTTTTTTTTTTTVN Probe7 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTCGCTACCCT (SEQ ID NO: 56) GATTCGACCTTTTTTTTTTTTTTTTTTTTVN Probe8 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTGCCCACTTT (SEQ ID NO: 57) CGCCGTAGTTTTTTTTTTTTTTTTTTTTTVN Probe9 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTAGCAACTTT (SEQ ID NO: 58) GAGCAAGATTTTTTTTTTTTTTTTTTTTTVN Probel0 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTGCCAATTCG (SEQ ID NO: 59) GAATTCCGGTTTTTTTTTTTTTTTTTTTTVN Probe11 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTTCGCCCAAG (SEQ ID NO: 60) GTAATACATTTTTTTTTTTTTTTTTTTTTVN Probe12 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTTCGCATTTC (SEQ ID NO: 61) CTATTCGAGTTTTTTTTTTTTTTTTTTTTVN Probe13 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGCTAAAT (SEQ ID NO: 62) CTAACCGCCTTTTTTTTTTTTTTTTTTTTVN Probe14 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTGGAATTAAA (SEQ ID NO: 63) TTCTGATGGTTTTTTTTTTTTTTTTTTTTVN Probe15 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTCATTACATA (SEQ ID NO: 64) GGTGCTAAGTTTTTTTTTTTTTTTTTTTTVN Probe16 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTATTGACTTG (SEQ ID NO: 65) CGCTCGCACTTTTTTTTTTTTTTTTTTTTVN Probe17 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTATAGTATCT (SEQ ID NO: 66) CCCAAGTTCTTTTTTTTTTTTTTTTTTTTVN Probe18 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTGTGCGCCTG (SEQ ID NO: 67) TAATCCGCATTTTTTTTTTTTTTTTTTTTVN Probe19 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTGCGCCACTC (SEQ ID NO: 68) TTTAGGTAGTTTTTTTTTTTTTTTTTTTTVN Probe20 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTTATGCAAGT (SEQ ID NO: 69) GATTGGCTTTTTTTTTTTTTTTTTTTTTTVN Probe21 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTCCAAGCCAC (SEQ ID NO: 70) GTTTATACGTTTTTTTTTTTTTTTTTTTTVN Probe22 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTACCTGATTG (SEQ ID NO: 71) CTGTATAACTTTTTTTTTTTTTTTTTTTTVN Probe23 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTCAGCGCATC (SEQ ID NO: 72) TATCCTCTATTTTTTTTTTTTTTTTTTTTVN Probe24 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTTCCACGCGT (SEQ ID NO: 73) AGGACTAGTTTTTTTTTTTTTTTTTTTTTVN Probe25 UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTCGACTAAGT (SEQ ID NO: 74) ATGTAGCGCTTTTTTTTTTTTTTTTTTTTVN Frame probe Layout1 AAATTTCGTCTGCTATCGCGCTTCTGTACC (SEQ ID NO: 75) Fluorescent marker probe PS_1 GGTACAGAAGCGCGATAGCAG-Cy3 (SEQ ID NO: 76) Second strand synthesis and flrst PCR Amplification handles A_primer ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 77) B_dt20VN_primer AGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTTTTTTTTVN (SEQ ID NO: 78) Custom sequencing primer B _r2 TCA GAC GTG TGC TCT TCC GAT CTT TTT TTT TTT (SEQ ID NO: 79) TTT TTT TTT T Example 9 Nimblegen 3′ to 5′ arrays with free 5′ end Array probes 5′ to 3′ Probe1 GCGTTCAGAGTGGCAGTCGAGATCACGCGGCAATCATATCGGACAGA (SEQ ID NO: 80) TCGGAAGAGCGTAGTGTAG Probe2 GCGTTCAGAGTGGCAGTCGAGATCACAAGATGAACCCGGCTCATAGA (SEQ ID NO: 81) TCGGAAGAGCGTAGTGTAG Probe3 GCGTTCAGAGTGGCAGTCGAGATCACTCCCAACAGAGTGCCTCAAGA (SEQ ID NO: 82) TCGGAAGAGCGTAGTGTAG Probe4 GCGTTCAGAGTGGCAGTCGAGATCACCGAATGGCGACTAATCATAGA (SEQ ID NO: 83) TCGGAAGAGCGTAGTGTAG Probe5 GCGTTCAGAGTGGCAGTCGAGATCACAAACATCTACCCTCAAGTAGA (SEQ ID NO: 84) TCGGAAGAGCGTAGTGTAG Probe6 GCGTTCAGAGTGGCAGTCGAGATCACGATAACAGTATTGGCCATAGA (SEQ ID NO: 85) TCGGAAGAGCGTAGTGTAG Probe7 GCGTTCAGAGTGGCAGTCGAGATCACGGTCGAATCAGGGTAGCGAGA (SEQ ID NO: 86) TCGGAAGAGCGTAGTGTAG Probe8 GCGTTCAGAGTGGCAGTCGAGATCACACTACGGCGAAAGTGGGCAGA (SEQ ID NO: 87) TCGGAAGAGCGTAGTGTAG Probe9 GCGTTCAGAGTGGCAGTCGAGATCACATCTTGCTCAAAGTTGCTAGA (SEQ ID NO: 88) TCGGAAGAGCGTAGTGTAG Probe10 GCGTTCAGAGTGGCAGTCGAGATCACCCGGAATTCCGAATTGGCAGA (SEQ ID NO: 89) TCGGAAGAGCGTAGTGTAG Probe11 GCGTTCAGAGTGGCAGTCGAGATCACATGTATTACCTTGGGCGAAGA (SEQ ID NO: 90) TCGGAAGAGCGTAGTGTAG Probe12 GCGTTCAGAGTGGCAGTCGAGATCACCTCGAATAGGAAATGCGAAGA (SEQ ID NO: 91) TCGGAAGAGCGTAGTGTAG Probe13 GCGTTCAGAGTGGCAGTCGAGATCACGGCGGTTAGATTTAGCAAAGA (SEQ ID NO: 92) TCGGAAGAGCGTAGTGTAG Probe14 GCGTTCAGAGTGGCAGTCGAGATCACCCATCAGAATTTAATTCCAGA (SEQ ID NO: 93) TCGGAAGAGCGTAGTGTAG Probe15 GCGTTCAGAGTGGCAGTCGAGATCACCTTAGCACCTATGTAATGAGA (SEQ ID NO: 94) TCGGAAGAGCGTAGTGTAG Probe16 GCGTTCAGAGTGGCAGTCGAGATCACGTGCGAGCGCAAGTCAATAGA (SEQ ID NO: 95) TCGGAAGAGCGTAGTGTAG Probe17 GCGTTCAGAGTGGCAGTCGAGATCACGAACTTGGGAGATACTATAGA (SEQ ID NO: 96) TCGGAAGAGCGTAGTGTAG Probe18 GCGTTCAGAGTGGCAGTCGAGATCACTGCGGATTACAGGCGCACAGA (SEQ ID NO: 97) TCGGAAGAGCGTAGTGTAG Probe19 GCGTTCAGAGTGGCAGTCGAGATCACCTACCTAAAGAGTGGCGCAGA (SEQ ID NO: 98) TCGGAAGAGCGTAGTGTAG Probe20 GCGTTCAGAGTGGCAGTCGAGATCACAAGCCAATCACTTGCATAAGA (SEQ ID NO: 99) TCGGAAGAGCGTAGTGTAG Probe21 GCGTTCAGAGTGGCAGTCGAGATCACCGTATAAACGTGGCTTGGAGA (SEQ ID NO: 100) TCGGAAGAGCGTAGTGTAG Probe22 GCGTTCAGAGTGGCAGTCGAGATCACGTTATACAGCAATCAGGTAGA (SEQ ID NO: 101) TCGGAAGAGCGTAGTGTAG Probe23 GCGTTCAGAGTGGCAGTCGAGATCACTAGAGGATAGATGCGCTGAGA (SEQ ID NO: 102) TCGGAAGAGCGTAGTGTAG Probe24 GCGTTCAGAGTGGCAGTCGAGATCACACTAGTCCTACGCGTGGAAGA (SEQ ID NO: 103) TCGGAAGAGCGTAGTGTAG Probe25 GCGTTCAGAGTGGCAGTCGAGATCACGCGCTACATACTTAGTCGAGA (SEQ ID NO: 104) TCGGAAGAGCGTAGTGTAG Frame probe Layout1 AAATTTCGTCTGCTATCGCGCTTCTGTACC (SEQ ID NO: 105) Capture probe LP_Pol-y-dTVN GTGATCTCGACTGCCACTCTGAATTTTTTTTTTTTTTTTTTTTVN (SEQ ID NO: 106) Amplification handle probe A-handle ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 107) Second strand synthesis and first PCR amplification handles A_primer ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 108) B_dt20VN_primer AGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTTTTTTTTVN (SEQ ID NO: 109) Second PCR A_primer ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 110) B_primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 111) Example 11 Template switching Templateswitch_longB GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTATrGrGrG (SEQ ID NO: 112) Example 12 Spatial genomics A_primer ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 113) B_A431_Chr2 + 2_FW_A AGACGTGTGCTCTTCCGATCTTGGCTGCCTGAGGCAATG (SEQ ID NO: 114) B_A431_Chr2 + 2_RE_A AGACGTGTGCTCTTCCGATCTCTCGCTAACAAGCAGAGAGAAC (SEQ ID NO: 115) B_A431_Chr3 + 7_FW_B AGACGTGTGCTCTTCCGATCTTGAGAACAAGGGGGAAGAG (SEQ ID NO: 116) B_A431_Chr3 + 7_RE_B AGACGTGTGCTCTTCCGATCTCGGTGAAACAAGCAGGTAAC (SEQ ID NO: 117) B_NT_1_FW AGACGTGTGCTCTTCCGATCTCATTCCCACACTCATCACAC (SEQ ID NO: 118) B_NT_1_RE AGACGTGTGCTCTTCCGATCTTCACACTGGAGAAAGACCC (SEQ ID NO: 119) B_NT_2_FW AGACGTGTGCTCTTCCGATCTGGGGTTCAGAGTGATTTTTCAG (SEQ ID NO: 120) B_NT_2_RE AGACGTGTGCTCTTCCGATCTTCCGTTTTCTTTCAGTGCC (SEQ ID NO: 121)