REDUCING BLOOD GLUCOSE, INSULIN RESISTANCE, OR HYPERLIPIDEMIA THROUGH RLIP76 PARTIAL DEPLETION
20220340892 · 2022-10-27
Inventors
Cpc classification
C07K2317/73
CHEMISTRY; METALLURGY
C12N9/00
CHEMISTRY; METALLURGY
C12N15/1024
CHEMISTRY; METALLURGY
C07K2317/34
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C12N15/10
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Partial depletion of RLIP76 in p53 deficient living subject has shown many health benefits. In one embodiment, partical Rlip depletion is used to prevent or treat cancer in p53 deficient living subjects. In another embodiment, partial Rlip depletion is used for reversion of DNA-methylation abnormalities caused by the lack of p53 to normal in p53 deficient living subjects. In yet another embodiment, partial Rlip depletion is used in reduction of blood glucose, insulin-resistance, hyperlipidemina, or any combination thereof in p53 deficient living subjects. Methods of using liposome containing anti-sense nucleic acid or double stranded siRNA to partially deplete RLIP76 and thus treat p53 deficient subject are disclosed. The approaches described herein can be especially helpful in preventing cancer in Li-Fraumeni patients.
Claims
1. A method of reducing blood glucose, insulin resistance, hyperlipidemia, or any combination thereof in a subject, the method comprising administering an effective amount of a composition comprising a liposome inhibitory RNA molecule into the subject to at least partially inhibit RLIP76 in the subject.
2. The method of claim 1, wherein the liposome inhibitory RNA molecule targets nucleotides encoding a region of RLIP76 having a sequence of SEQ ID NO.: 1.
3. The method of claim 1, wherein the liposome inhibitory RNA molecule is an anti-sense molecule having a nucleic acid sequence of SEQ ID NO.: 2, and wherein the anti-sense molecule targets nucleotides encoding a region of RLIP76 having a sequence of SEQ ID NO.: 1.
4. The method of claim 1, wherein the liposome inhibitory RNA molecule is an siRNA molecule comprised of SEQ ID NO: 3 and SEQ ID NO: 6, and wherein the siRNA molecule targets nucleotides encoding a region of RLIP76 having a sequence of SEQ ID NO.: 1.
5. The method of claim 1, wherein the liposome inhibitory RNA molecule is complementary to an mRNA that encodes SEQ ID NO.: 4, and wherein the inhibitory RNA molecule targets nucleotides encoding a region of RLIP76 having a sequence of SEQ ID NO.: 1.
6. The method of claim 1, wherein at least 20% of the total RLIP76 in the subject is inhibited.
7. The method of claim 1, wherein at least 22.5-25%, 22.5-27.5%, 27.5-30%, 30-32.5%, 32.5-35%, 35-37.5%, 37.5-40%, 40-42.5%, 42.5-45%, 45-47.5%, 47.5-50%, 50-52.5%, 52.5-55%, 55-57.5%, 57.5-60%, 60-62.5%, 62.5-65%, 65-67.5%, 67.5-70%, 70-72.5%, 72.5-75%, 75-77.5%, or 77.5-80% of the total RLIP76 in the subject is inhibited.
8. The method of claim 1, wherein administering an effective amount of a composition comprising a liposome inhibitory RNA molecule into the subject to at least partially inhibit RLIP76 in the subject reduces blood glucose, and wherein blood glucose is reduced by at least 50%.
9. The method of claim 1, wherein administering an effective amount of a composition comprising a liposome inhibitory RNA molecule into the subject to at least partially inhibit RLIP76 in the subject reduces insulin resistance, and wherein insulin resistance is reduced by at least 50%.
10. The method of claim 1, wherein administering an effective amount of a composition comprising a liposome inhibitory RNA molecule into the subject to at least partially inhibit RLIP76 in the subject reduces hyperlipidemia, and wherein hyperlipidemia is reduced by at least 50%.
11. The method of claim 1, wherein administering an effective amount of a composition comprising a liposome inhibitory RNA molecule into the subject to at least partially inhibit RLIP76 in the subject reduces blood glucose and insulin resistance, and wherein blood glucose and insulin resistance are reduced by at least 50%.
12. The method of claim 1, wherein administering an effective amount of a composition comprising a liposome inhibitory RNA molecule into the subject to at least partially inhibit RLIP76 in the subject reduces blood glucose and hyperlipidemia, and wherein blood glucose and hyperlipidemia are reduced by at least 50%.
13. The method of claim 1, wherein administering an effective amount of a composition comprising a liposome inhibitory RNA molecule into the subject to at least partially inhibit RLIP76 in the subject reduces insulin resistance and hyperlipidemia, and wherein insulin resistance and hyperlipidemia are reduced by at least 50%.
14. The method of claim 1, wherein administering an effective amount of a composition comprising a liposome inhibitory RNA molecule into the subject to at least partially inhibit RLIP76 in the subject reduces blood glucose, insulin resistance, and hyperlipidemia, and wherein blood glucose, insulin resistance, and hyperlipidemia are reduced by at least 50%.
15. The method of claim 1, wherein the effective amount comprises a dose of 0.1-30 mg/kg of the subject.
16. The method of claim 1, wherein the composition further comprises a pharmaceutically acceptable carrier.
17. The method of claim 1, wherein administration of the composition is repeated at predetermined intervals to effect chronic partial inhibition of RLIP76 in the subject such that blood glucose, insulin resistance, hyperlipidemia, or any combination thereof in the subject is chronically reduced.
18. The method of claim 17, wherein the total RLIP76 in the subject is chronically inhibited by at least 20%.
19. The method of claim 1, wherein the composition is administered every day, every week, every month, or every year.
20. A method of reducing blood glucose, insulin resistance, hyperlipidemia, or any combination thereof in a subject, the method comprising administering an effective amount of a composition comprising an anti-RLIP antibody into the subject to at least partially inhibit RLIP76 in the subject.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0009] The drawing figures are not necessarily to scale and certain features may be shown exaggerated in scale or in a somewhat generalized or schematic form in the interest of clarity and conciseness. For more complete understanding of the features and advantages of the present invention, reference is now made to the detailed description of the invention along with the accompanying figures, wherein:
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
DETAILED DESCRIPTION
Definitions
[0026] The terms “a” and “an” are defined as one or more unless this disclosure explicitly requires otherwise. The term “substantially” is defined as largely but not necessarily wholly what is specified (and includes what is specified; e.g., substantially 90 degrees includes 90 degrees and substantially parallel includes parallel), as understood by a person of ordinary skill in the art. In any disclosed embodiment, the terms “substantially,” “approximately,” and “about” may be substituted with “within [a percentage] of” what is specified, where the percentage includes 0.1, 1, 5, and 10 percent.
[0027] The terms “comprise” (and any form of comprise, such as “comprises” and “comprising”), “have” (and any form of have, such as “has” and “having”), “include” (and any form of include, such as “includes” and “including”) and “contain” (and any form of contain, such as “contains” and “containing”) are open-ended linking verbs. As a result, a composition that “comprises,” “has,” “includes” or “contains” one or more elements possesses those one or more elements, but is not limited to possessing only those elements. Likewise, a method that “comprises,” “has,” “includes” or “contains” one or more steps possesses those one or more steps, but is not limited to possessing only those one or more steps.
[0028] Any embodiment of any of the apparatuses, systems, and methods can consist of or consist essentially of — rather than comprise/include/contain/have — any of the described steps, elements, and/or features. Thus, in any of the claims, the term “consisting of” or “consisting essentially of” can be substituted for any of the open-ended linking verbs recited above, in order to change the scope of a given claim from what it would otherwise be using the open-ended linking verb.
[0029] The feature or features of one embodiment may be applied to other embodiments, even though not described or illustrated, unless expressly prohibited by this disclosure or the nature of the embodiments.
[0030] As used throughout, by a “subject” is meant an individual. Thus, the “subject” can include domesticated animals, such as cats, dogs, etc., livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), laboratory animals (e.g., mouse, rabbit, rat, guinea pig, etc.) and birds. In some embodiments, the subject is a mammal such as a primate, for example, a human.
[0031] “Amount effective” and “effective amount” in the context of a composition or dosage form for administration to a subject refers to an amount of the composition or dosage form that produces one or more desired responses in the subject, for example, prevent cancer in p53 deficient patients. Therefore, in some embodiments, an amount effective is any amount of a composition provided herein that produces one or more of these desired responses. The amount is one that a clinician believes to have a clinical benefit for a p53 deficient subject in need of cancer prevention or treatment.
[0032] Effective amount can involve only improving the patient's condition, although in some embodiments, it involves restoring patient's condition. An amount that is effective can also be an amount of a composition provided herein that produces a desired therapeutic endpoint or a desired therapeutic result. Effective amount result in cancer treatment or prevention in a subject after the administration of the compositions disclosed herein. The achievement of any of the foregoing are monitored by routine methods.
[0033] In some embodiments of any of the compositions and methods provided, the effective amount is one in which the subject is symptom free, such as cancer free, has reversed DNA-methylation abnormalities to normal for at least 1 week, at least 2 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 9 months, at least 1 year, at least 2 years, at least 5 years, or longer. In other embodiments of any of the compositions and methods provided, the effective amount is one which produces a measurable desired response, for example, a measurable decrease or disappearance of cancer in the patient for at least 1 week, at least 2 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 9 months, at least 1 year, at least 2 years, at least 5 years, or longer.
[0034] Effective amount will depend, of course, on the particular subject being treated; the severity of a condition, disease or disorder; the individual patient parameters including age, physical condition, size and weight; the duration of the treatment; the nature of concurrent therapy (if any); the specific route of administration and like factors within the knowledge and expertise of the health practitioner. The effective amount can be 0.1 -30 mg per kg of a living subject, for example, 0.1-0.2 mg/kg, 0.2-0.3 mg/kg, 0.3-0.4 mg/kg, 0.4-0.5 mg/kg, 0.5-0.6 mg/kg, 0.6-0.7 mg/kg, 0.7-0.8 mg/kg, 0.8-0.9 mg/kg, 0.9-1 mg/kg, 1-2 mg/kg, 2-3 mg/kg, 3-4 mg/kg, 4-5 mg/kg, 5-6 mg/kg, 6-7 mg/kg, 7-8 mg/kg, 8-9 mg/kg, 9-10 mg/kg, 10-11 mg/kg, 11-12 mg/kg, 12-13 mg/kg, 13-14 mg/kg, 14-15 mg/kg, 15-16 mg/kg, 16-17 mg/kg, 17-18 mg/kg, 18-19 mg/kg, 19-20 mg/kg, 20-21 mg/kg, 21-22 mg/kg, 22-23 mg/kg, 23-24 mg/kg, 24-25 mg/kg, 25-26 mg/kg, 26-27 mg/kg, 27-28 mg/kg, 28-29 mg/kg, 29-30 mg/kg, 1.5-25 mg/kg, 2-20 mg/kg, 2.5-15 mg/kg, 3-10 mg/kg, or 4-7 mg/kg.
[0035] The partial depletion of Rlip disclosed herein means at least 20% of the total Rlip present in a living subject has been inactivated or inhibited, for example 20-22.5%, 22.5-25%, 22.5-27.5%, 27.5-30%, 30-32.5%, 32.5-35%, 35-37.5%, 37.5-40%, 40-42.5%, 42.5-45%, 45-47.5%, 47.5-50%, 50-52.5%, 52.5-55%, 55-57.5%, 57.5-60%, 60-62.5%, 62.5-65%, 65-67.5%, 67.5-70%, 70-72.5%, 72.5-75%, 75-77.5%, or 77.5-80%.
[0036] The predetermined interval to effect chronical treatment results means every day to every year, for example, every two days, every three days, every four days, every five days, every six days, every week, every 1.5 week, every two weeks, every 2.5 weeks, every three weeks, every 3.5 weeks, every 4 weeks, every 5 weeks, every 6 weeks, every 7 weeks, every 8 weeks, every 9 weeks, every 10 weeks, every 11 weeks, every 12 weeks, every 13 weeks, every 14 weeks, every 15 weeks, every 16 weeks, every 17 weeks, every 18 weeks, every 19 weeks, every 20 weeks, every 21 weeks, every 22 weeks, every 23 weeks, every 24 weeks, every 25 weeks, every 26 weeks, every 27 weeks, every 28 weeks, every 29 weeks-every 30 weeks, every 31 weeks, every 32 weeks, every 33 weeks, every 34 weeks, every 35 weeks, every 36 weeks, every 37 weeks, every 38 weeks, every 39 weeks, every 40 weeks, every 41 weeks, every 42 weeks, every 43 weeks, every 44 weeks, every 45 weeks, every 46 weeks, every 47 weeks, every 48 weeks, every 49 weeks, every 50 weeks, every 51 week, or every 52 weeks.
[0037] “Dosage form” means a pharmacologically and/or immunologically active material in a medium, carrier, vehicle, or device suitable for administration to a subject.
[0038] “Pharmaceutically acceptable excipient” means a pharmacologically inactive material used together with the liposomes disclosed herein and carriers to formulate the compositions disclosed herein. Pharmaceutically acceptable excipients comprise a variety of materials known in the art, including but not limited to saccharides (such as glucose, lactose, and the like), preservatives such as antimicrobial agents, reconstitution aids, colorants, saline (such as phosphate buffered saline), and buffers.
[0039] As used herein, a “proteoliposome” is generally a protein and lectin or glyco-or phospholipid combination that forms a spherical micellular-like or vesicular structure. The structures may form spontaneously or by chemical or mechanical manipulation, or combinations thereof Proteoliposomes take advantage of the amphipathic nature of the lipid (or lectin) that causes them to form bilayers when in solution resulting in at least one of several shapes, including: (a) spherical micelle with the tails inward, or (b) bimolecular sheets that are bilayers with hydrophobic tails sandwiched between hydrophilic head groups. In general, proteoliposomes may reseal themselves when torn or broken. Proteoliposomes may contain only one lectin or lipid or a variety and combination of each. Examples of phospholipids include phosphatidylcholine, sphingomyelin, phosphatidylserine, inositol phospholipids, and phosphatidylethanolamine. When used, proteoliposomes may be charged or electrically neutral and are generally used at physiological pH. They may also be structures mixed with detergent (e.g., detergent/lipid/protein, detergent/lectin/protein). Methods for preparing proteoliposomes of defined lipid-protein or lectin-protein ratios and size are well-known to one of ordinary skill in the art of molecular biology and protein/lipid biochemistry.
[0040] Abbreviations used are defined as follows: TP53: tumor protein 53, referred to herein as p53; RLIP76: 76 kDa splice variant protein encoded by the human RALBP1 gene (18p11.22), originally identified as dinitrophenyl S-glutathione ATPase (DNP-SG ATPase), is referred to herein as Rlip; CAS: control antisense; R508: Rlip-antisense; GS-E: GSH-electrophile conjugate; CDE: clathrin-dependent endocytosis; 4-HNE: 4-hydroxy-trans-2-nonenal; GS-HNE: thioether of GSH and 4-HNE; B[a]P: benzo[a]pyrene; WGBS: whole-genome bisulfite sequencing; 8OHdG: 8-hydroxydeoxyguanosine; PLA: proximity ligation assay; DAVID: Database for Annotation, Visualization and Integrated Discovery; GO: gene ontology; KEGG: Kyoto Encyclopedia of Genes and Genomes; IPA: Integrated Pathways Analysis; RPKM: reads per kilobase of transcript per million mapped reads; SINE/LINE: small and large interspersed nuclear elements; MEF: mouse embryonic fibroblast; FGF: fibroblast growth factor; HSF1: heat shock factor 1; DMR: differentially methylated regions. The gene name abbreviations used are according to official gene nomenclature (http://www.genecards.org).
[0041] Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this pertains. The references disclosed are also individually and specifically incorporated by reference herein for the material contained in them that is discussed in the sentence in which the reference is relied upon.
[0042] The present disclosure may be understood more readily by reference to the following detailed description of embodiments and to the Figures and their previous and following description.
General
[0043] Disclosed herein are methods of preventing cancer in a TP53 (p53) deficient living subject. Rlip deficiency strongly inhibited spontaneous as well as benzo[a]pyrene-induced carcinogenesis in p53.sup.−/− mice. Rlip deficiency induced by weekly administration of an Rlip-specific phosphorothioate antisense molecule, R508, effectively prevented methylomic and transcriptomic abnormalities found in cancer-bearing p53.sup.−/− mice. R508-treated cancer-free p53.sup.−/− mice had reduced expression of genes associated with inflammation, immune activation, stem cell maintenance, and cancer. Abnormalities of gene promoter methylation found in cancer bearing p53.sup.−/− mice were nearly absent in R508-treated mice. Cancer suppression by Rlip depletion was not associated with reduction in oxidative DNA damage, indicating that Rlip regulates late events in malignant transformation. The efficiency with which Rlip deficiency suppresses spontaneous malignancy in p53.sup.−/− mice has not been observed with any previously reported pharmacological or genetic intervention. The methods disclosed herein offer tumor suppression in p53 deficient living subject. For example, a method for suppression of spontaneous malignancy in hereditary cancer syndromes such as Li-Fraumeni is disclosed herein.
[0044] Rlip (encoded by RALBP1 [18p11.22]) is a stress-responsive ATPase enzyme of the mercapturic acid pathway that catalyzes the transmembrane efflux of the exogenous (xenobiotic) and endogenous (lipid-hydroperoxide-derived alkenal) electrophilic toxins after glutathione S-transferases (GSTs) catalyze the formation of GSH-electrophile thioether conjugates (GS-E) (9-33). Its ATPase activity is coupled with clathrin-dependent endocytosis (CDE), the RAL-regulated first step in the internalization, trafficking, and recycling of membrane vesicles that contain membrane receptors bound to a broad array of extracellular ligands that promote cancer. CDE regulates signaling down-stream of receptors for insulin, EGF, TNFα, FGF1 and many other peptide hormones; Rlip, a key component of CDE, links RAL, RAS, RHO and RAC signaling. CDE as well as GS-E transport are severely deficient (<80%) in Rlip.sup.−/− mice. Rlip regulates the activity of upstream mercapturic acid pathway enzymes that metabolize xenobiotic and endogenous electrophiles by preventing product/feedback-inhibition exerted by GS-E. Oxidative metabolism of co-6 polyunsaturated fatty acids in response to radiant (x-ray, UV light, heat) or oxidative stress yields lipid hydroperoxides, which degrade to toxic lipid alkenals, principally 4-hydroxynonenal (4HNE). 4HNE is metabolized primarily to a glutathione conjugate (GS-HNE) that is removed from cells by Rlip. Recombinant Rlip protein is the most potent biological agent for defending cells and animals from toxicity of stressors that generate massive amounts of 4HNE, ionizing radiation, and chemical warfare agents. Interestingly, the apoptotic activity of 4HNE is directed selectively towards malignant cells, evident from apoptosis of cancer cells and dramatic regression of melanoma, neuroblastoma, and cancers of the lung, colon, kidney, pancreas, and prostate in mouse models. An existential need of cancer cells for Rlip is underscored by resistance to chemical carcinogenesis in Rlip.sup.−/− mice to a degree exceeding that for any other previously reported genetic intervention.
[0045] TP53 (p53) functions as a stress-responsive, genome protective, tumor suppressor whose functions are lost or altered in most malignancies. p53 homozygous knockout (p53.sup.−/−) mice uniformly die of spontaneous malignancy, typically T-cell lymphoma. RALBP1 (RLIP76, Rlip) is a stress-protective, mercapturic acid pathway transporter protein that also functions as a Ral-effector involved in clathrin-dependent endocytosis. In stark contrast to p53.sup.−/− mice, Rlip.sup.−/− mice are highly resistant to carcinogenesis. The relationship between Rlip and p53 in carcinogenesis has been found to be functionally opposed as further described below. Although p53.sup.−/− mice are used as examples throughout the present disclosure, it is believed that the observation made on p53.sup.−/− mice can be extrapolated to other living subjects that suffer from p53 deficiency, for example cancer patients who suffers from p53 deficiency.
Rlip Deficiency Suppresses Malignancy in p53.SUP.−/− Mice
[0046] A single 200 μg intraperitoneal dose of R508 given to wt mice reduced Rlip protein to 56±12% of control in the liver, and to a lesser extent in all other tissues, at 24 h (p<0.001), with gradual recovery to 91±4% (p=ns) at day 7. Reduction of blood glucose by 26%, triglycerides by 32%, and cholesterol by 48% upon R508 treatment showed expected pharmacodynamic effects, given that these metabolic alterations are characteristic of Rlip knockout mice. Treatment of C57B1/6 p53.sup.−/− mice with weekly intraperitoneal injections of 200 μg R508 or control scrambled antisense (CAS) beginning at age 8 weeks reduced Rlip protein to 47±7% (p<0.0001) and Rlip mRNA to 49±13% (p<0.001), and prevented malignancy in 100% of R508-treated p53.sup.−/− mice, whereas all control mice died of T-cell lymphomas before 24 weeks of age as shown in
The Transcriptome of R508-Treated p53.SUP.−/− .Mice Resembled Wild-Type
[0047] The hepatic transcriptome of R508 and CAS-treated p53.sup.−/− mice were compared using RNA-Seq. The RNA-Seq results were validated by results of qRT-PCR (Pearson R=0.876, p<0.0001). Unsupervised hierarchical clustering analyses of RNA-Seq results on hepatic tissues revealed that the transcriptome of R508 treated p53.sup.−/− mouse was very similar to wt as shown in
DNA-Methylation Abnormalities of p53.SUP.−/− Mice Were Corrected by Rlip Depletion
[0048] Considering that the dramatic switch in the transcriptome of R508-treated p53.sup.−/− mice could be mediated through epigenetic mechanisms known to be involved in malignancy, we conducted whole-genome bisulfite sequencing (WGBS). Conventional bisulfite sequencing (CBS) and alignment with RNA-Seq results confirmed the validity of WGBS results and indicated a close correlation between the transcriptomic and methylomic changes that occur in p53.sup.−/− mice with age and carcinogenesis. This is depicted in representative examples for PTPN6 gene as show in
[0049] CpG island hypermethylation, repetitive element (SINE/LINE) hypomethylation, and gains or losses of DNA methylation in promoters and gene-bodies of key cancer developmental genes in p53.sup.−/− were also prevented by R508. Promoter hypomethylation of critical immune system genes involved in leukocyte activation, T cell proliferation, and cytokine production found in control p53.sup.−/− was essentially absent in R508-treated p53.sup.−/− mice. Compared with 31 hypermethylated DMRs in promoters of genes within the ontology term embryonic morphogenesis (including HOXA-D clusters), only 3 were hypermethylated in R508-treated p53.sup.−/− mice. Ontology terms related to Rlip function enriched in R508 treated p53.sup.−/− mice included GSH metabolism, xenobiotic metabolism, oxidative stress, transport, endocytosis, vesicular transport, mitochondrial abnormalities, cell cycling, mitosis, PI3K and MAPK signaling, angiogenesis and cancer pathways. Reduced representation bisulfite sequencing of DNA from wt and p53.sup.−/− MEF in cell culture revealed over 15,000 DMRs. Because the lymphoma-associated cytokine storm present in the control p53.sup.−/− mice was absent in cultured MEF, accelerated accumulation of methylomic aberration appeared to be a function of p53 deficiency itself rather than simply a consequence of lymphoma.
TABLE-US-00001 TABLE 1 DNA Methylation Comparison of wt, Rlip.sup.−/− and CAS vs. R508-treated p53.sup.−/− mice.sup.1 Methylation Sample Comparison Change Promoter Intragenic Intergenic Total wt vs. Rlip.sup.−/− (32 wk) Hyper 2 23 39 64 Hypo 1 7 10 18 wt (9 wk vs. aged) Hyper 5 33 23 61 Hypo 27 134 69 230 wt vs. p53.sup.−/− (9 wk) Hyper 32 106 92 230 Hypo 10 71 48 129 p53.sup.−/− CAS vs. PBS (aged) Hyper 8 26 25 59 Hypo 4 16 11 31 p53.sup.−/− CAS vs. R508 (aged) Hyper 1177 3869 2600 7646 Hypo 364 3717 2640 6721 P53.sup.−/− CAS vs. wt (aged) Hyper 1523 6561 4375 12459 Hypo 595 5403 3996 9994 P53.sup.−/− -R508 vs. wt (aged) Hyper 37 298 201 536 Hypo 32 165 136 333 .sup.1All mm9 Refseq mRNAs were considered in the annotation. There were totally >21 million CpG sites analyzed. Results indicate almost no difference between wt and Rlip.sup.−/−, and the CAS-treated p53.sup.−/− methylome has more sites loss of methylation than gain of methylation. A small but significant number of regions of methylation loss or gain in p53.sup.−/− were in promoters. Most remarkably, methylation pattern of R508 treated p53.sup.−/− mice were very like both wt and Rlip.sup.−/− mice. Hyper: Greater methylation in wt than the other sample; Hypo: Greater methylation in the other sample than in sample 1.
Rlip Regulates the Activity of Cancer-signaling and Cytokine Pathways
[0050] Since Rlip is a rate determinant of CDE, a process that broadly regulates peptide hormone signaling, we compared the activity of several key cancer signaling pathways between control vs. R508-treated p53.sup.−/− mice. Activation or protein content of PI3K, AKT, mTOR, p70S6K, RB and BCL2 was reduced and that of HSF1, JNK, p27 (CDK1B) and BCL.sub.XL was increased in hepatic tissues of R508 treated mice. That this was a specific consequence of Rlip depletion was evident from similar effects of Rlip depletion in p53.sup.−/− MEF by shRNA on AKT, PI3K, CDK4, JNK, BCL2, BAX, mTOR, P70S6K, RB and p27. Furthermore, Rlip depletion modulated cytokine signaling down-stream of TNFα. Rlip depletion alone increased TNF-receptor protein 2 (TNFR2) and activated p38 preferentially in p53.sup.−/− MEF. Rlip depletion also lowered Rb phosphorylation in p53.sup.−/− MEFs and increased p19.sup.ARF (mouse homolog of human p14.sup.ARF) levels independent of TNFα, a potential mechanism for inhibition of carcinogenesis. Through a series of studies to examine the role of Rlip in CDE, we confirmed its rate determining role in benign as well as malignant cells and showed for the first time that STAT3 signaling down-stream of FGF is regulated by Rlip.
Lymphoma Prevention by Rlip Depletion is Independent of Effects on Oxidative DNA Damage
[0051] Since oxidative stress promotes carcinogenesis and can regulate DNA methylation, we considered the possibility that reduced oxidative DNA damage underlies cancer prevention. 4HNE level, a surrogate for overall oxidative stress, was ˜8-fold higher in control p53.sup.−/− mice than in R508-treated mice, largely reflecting the presence of tissue damage. 4HNE level in R508 treated p53.sup.−/− mice were significantly lower than control p53.sup.−/− mice, like those in Rlip.sup.−/− mice but still significantly greater than wt as shown in
Rlip, p53 and HSF1 Interactions
[0052] The abrupt switch in cancer susceptibility phenotype of p53.sup.−/− mice upon Rlip depletion to only a hemizygous level suggests a haploinsufficiency phenomenon, in which deficiency of a protein with multiple binding partners simultaneously alters the quantity and relative ratios of multiple heterodimers resulting in disproportionate phenotypic effects. HSF1 was an obvious candidate in haploinsufficiency interactions because HSF1 binds p53 during stress-induced nuclear translocation, Rlip regulates chaperone expression by inhibiting the nuclear translocation of HSF, and HSF1 deficiency alters the histological profile of malignancy in p53.sup.−/− mice. Because binding of p53 with HSF1 or with Rlip has been reported in ex-vivo and in-vitro but not in-vivo, we examined this possibility in present studies. Co-immunoprecipitation studies in wt, p53+/−, and p53.sup.−/− MEFs demonstrated Rlip can specifically bind p53 and HSF1 as shown in
Preventative and Therapeutic Implications of Targeting Rlip
[0053] Humanized monoclonal antibodies may be more pharmacologically suitable than antisense for treatment of p53-deficient malignancy or cancer prevention in Li-Fraumeni syndrome. Using polyclonal antibodies specific for the N.sup.171-185 peptide and a cleavable biotinylation reagent (Sulfo-NHS-SS-Biotin) we observed the presence of the Rlip.sup.171-185 epitope on the cell surface. This was confirmed by flow-cytometry on melanoma cells and the specificity of the cell surface detection was confirmed using competitive inhibition by the N.sup.171-185 peptide as shown in
Discussion
[0054] Results of present studies showed that pharmacologically mediated partial suppression of Rlip protein prevented the appearance of lymphoma or any other malignancy in p53.sup.−/− mice. Normalization of the methylome and transcriptome of R508 treated mice strongly supported the results of gross, histological and immunohistochemical findings of the absence of any malignancy at necropsy. In-vivo studies showing diminished activation of key cell cycling, cell growth, replication checkpoint and cytokine signaling pathways at the protein level was also consistent with absence of malignancy in R508 treated mice. R508-induced hypoglycemia and hypolipidemia, and the overlap of transcriptomic effects of R508 treatment in p53.sup.−/− mice with Rlip knockout mice confirm target specificity, showing predicted pharmacodynamic endpoints that reflect Rlip deficiency. Finally, the cancer suppressive effect of Rlip deficiency in spontaneous and chemically induced malignancy models of mice with congenital deficiency of Rlip provide essentially incontrovertible evidence of specificity and rule our off-target effects in mechanisms of therapeutic actions of R508.
[0055] The pleiotropic involvement of p53 and Rlip in cancer-promoting biological processes, together with the global effects of Rlip deficiency on signaling, transcriptomic and epigenomic mechanisms that promote malignancy prevented determination of a specific mechanism of action for R508. Achievement of a near normal gene expression and DNA methylation profile in Rlip-deficient p53.sup.−/− mice and lack of malignancy in these mice despite high levels of oxidative stress indicates that p53 loss or oxidative stress are not the ultimate determinants of either epigenomic changes or malignant transformation. Rlip is an ATPase that catalyzes the efflux of pro-apoptotic electrophilic metabolites arising from lipid peroxidation and xenobiotic exposure. Potent anti-apoptotic function of Rlip have been established through development of recombinant Rlip protein as the most effective drug for treatment and prevention of radiation and chemical weapons poisoning. Thus, an existential requirement of its anti-apoptotic effect after malignant transformation could potentially explain lack of lymphoma in Rlip-deficient mice. Because Rlip regulates the rate of CDE and consequently the intensity of cancer-promoting signals down-stream of cell growth hormones, its deficiency could delay the appearance of lymphoma by slowing growth after malignant transformation. Cytokine signaling is regulated by CDE and promotes lymphoma growth. Rlip has been shown to be an effector in mitochondrial replication as well as in CDK1 functions during the cell-cycle, thus slowing cell growth or proliferation could be another mechanism that would delay the appearance of lymphoma. Rlip functions intersect with those of p53 at multiple levels including stress-response, drug/xenobiotic/radiation-resistance, transcriptional control of chaperones, apoptosis, and cell cycling. Regulation of CDE by p53 suggests another possible site of direct interaction. Thus, Rlip deficiency would affect multiple mechanisms that are also regulated by p53 and inhibit the survival and growth after malignant transformation. The question of whether Rlip deficiency acts after or prior to malignant transformation could not be directly answered, perhaps because it is semantic, depending on a precise definition of a developmental point at which transformation is clearly and irreversibly established
[0056] Narrowing the key cancer promoting processes or the subset of genes whose expression is critical for lymphoma formation would have been possible by subtraction of expression profiles of R508 treated p53.sup.−/− with malignancy from aged p53.sup.−/− mice with altered transcriptomes but no malignancy; unfortunately, we observe no such cases. For the same reasons, our results cannot establish a cause-effect relationship between methylomic aberrations and lymphomagenesis in p53.sup.−/− mice or between correction of methylomic aberrations and lymphoma suppression by R508-treatment. However, a nearly normal methylome in cancer-free R508-treated p53.sup.−/− mice despite persistent extensive oxidative DNA damage clearly shows that methylomic aberrations are not an obligatory consequence of either p53 deficiency or oxidative DNA damage in the setting of partial Rlip deficiency. Interestingly, we found <50 DMRs between Rlip.sup.−/− vs. wt mice (data not presented), ruling out any direct role of Rlip in enzymatic mechanisms that catalyze DNA methylation or de-methylation. The absence of an Rlip-p53 heterodimer in both Rlip.sup.−/− and the p53.sup.−/− mice, by definition, also rules out any direct role of such a heterodimer in mechanisms of DNA-methylation. By the same reasoning, the opposite cancer susceptibility phenotype of Rlip.sup.−/− and p53.sup.−/− mice can also not be explained by a direct effect of such a heterodimer. Thus, additional factors are believed to operate through haploinsufficiency mechanisms.
[0057] HSF1 interacts with both p53 and Rlip. The HSF1-p53 complex translocates to the nucleus in response to stress. HSF1 loss in p53.sup.−/− mice switches the cancer phenotype, from primarily lymphoma to primarily adenocarcinoma or sarcoma without altering the overall incidence of malignancy. Rlip inhibits chaperone transcription by sequestering HSF1 in a tubulin-bound complex that dissociates upon stress exposure, releasing HSF1 for nuclear translocation. Consistent with this, numerous chaperones are unregulated in Rlip.sup.−/− mice. A mutually inhibitory relationship is evident from inhibition of transport and anti-apoptotic activities of Rlip by HSF1. The Rlip-p53 interactions were indicated by inhibition of the transport activity of Rlip by p53 and reduced binding of Rlip to mutant p53 in neuroblastoma cells. Present studies show an Rlip-p53 complex exists in-vitro and in-vivo. The three proteins are believed to coordinately regulate transcriptional responses to stress, while Rlip serves as an anti-apoptotic effector and feedback inhibitor of p53 and HSF1. Only the p53-HSF1 dimer can exist in the absence of Rlip, which is believed to prevent cancer and only the Rlip-HSF1 can exist in the absence of p53, which is believed to promote cancer. There are numerous other examples of haploinsufficiency interactions that cause abrupt changes cancer susceptibility of p53.sup.−/− mice. However, none of these result in the dramatic phenotypic switch from universal cancer susceptibility to nearly complete resistance to spontaneous as well as chemically induced carcinogenesis as observed in present studies.
[0058] In conclusion, our studies establish a strong dominant negative effect of Rlip-deficiency on the cancer susceptibility phenotype conferred by Rlip loss and support an existential need of Rlip for cancer formation in the mouse model. A new paradigm for defining the role of p53 in carcinogenesis and epigenetics is disclosed herein. The methods disclosed herein can be applied to broad cancer prevention as well as therapy because of abnormal p53 function in most human cancers. Further disclosed is a method of using chronic partial Rlip deficiency to prevent or treat malignancy in individuals with Li-Fraumeni syndrome. Because targeted depletion of Rlip causes regression of malignancy in pre-clinical models regardless of the p53 status of the neoplasm, the methods disclosed herein are believed to exert a very broad-spectrum therapeutic effect. The potent anti-apoptotic and stress-defense functions of Rlip indicate application in drug- or radiation-resistant malignancy. Because only a hemizygous state of Rlip deficiency is needed, the likelihood of adverse effects is mitigated. Indeed, collateral health benefit could also be realized through reduction of blood glucose, insulin-resistance, and hyperlipidemia.
EXAMPLES
Example 1. Rlip Deficiency Prevents Carcinogenesis and Reverts Transcriptomic and Methylomic Abnormalities in p53 Knockout Mice
[0059] Treatment of p53−/− Mice With R5.circle-solid.8 Phosphorothioate Antisense Oligonucleotide
[0060] Animal experiments were performed under approved IACUC protocol #11016 on eight-week old male C57BL/6J p53.sup.−/− mice on a B6.129S2-Trp53.sup.tm1Tyj/J background purchased from Jackson Laboratory (Bar Harbor, Me.). Mice with homozygous knockout of RALBP 1 (referred to here as Rlip.sup.+/−) were generated by Lexicon genetics (The Woodlands, Tx.), and mice born of Rlip.sup.+/−×Rlip.sup.+/− mating, were genotyped by PCR strategy as described previously by Awasthi et al. in Cancer Res. 2005; 65: 6022-6028. R508 is based on the unique Rlip gene nucleotide sequence .sup.508 GGCTCCTGAATTGGCTITTTC.sup.529 SEQ ID NO.: 1 with least homology to nucleotide sequences in the human or mouse genome. Control scrambled phosphorothioate oligonucleotide (CAS) sequence, generated using GenScript software was CATCGAAATCGTTGCAGTTAC SEQ ID NO.: 7. CAS does not deplete Rlip or cause apoptosis, xenograft regression, hypoglycemia, hypolipidemia, or insulin sensitivity. R508 or CAS were dissolved in PBS (1 mg/mL) and 0.2 mL was administered weekly for 24 weeks by i.p. injection starting at 8 week age.
Spontaneous and Chemical Carcinogenesis in p53 and Rlip Knockout Mice
[0061] Cross breeding of p53.sup.+/− C57B16 mice with Rlip.sup.+/− was performed to obtain colonies of mice with the genotypes: p53.sup.−/−Rlip.sup.+/+, p53.sup.−/−Rlip.sup.−/−, and p53.sup.+/−Rlip.sup.+/−. For spontaneous carcinogenesis, mice were monitored 3 times per week for distress or overt malignancy and all surviving mice were euthanized at age 48 wk. Chemical carcinogenesis was studied in mice administered 3 mg B[a]P in 1 mL corn-oil by gavage at the age of 8 and 12 weeks.
Cell Culture
[0062] MEF were derived and maintained in culture at 12 to 13-day gestation by previously described methods by Singhal et al. in Int J Radiat Oncol Biol Phys. 2008; 72:553-561. p53.sup.−/− MEFs were provided by Dr. Arnold J. Levine, Cancer Institute of New Jersey/UMDNJ, New Brunswick, N.J. All malignant cell lines were purchased from ATCC except for the mouse Raji and human LCL lymphoma cell lines, which were a gift from Prof. Stephen J. Forman, City of Hope, Duarte, Calif. Mycoplasma testing was done using Universal Mycoplasma Detection kit. Malignant cells were grown in RPMI1640 medium and MEFs in DMEM containing 10% FBS and 1% penicillin/streptomycin at 37° C. in 5% CO.sub.2. Cytotoxicity, signaling, and endocytosis studies were performed in serum free medium after washing cells in Hanks' PBS.
Histological and Immunohistochemical Analyses
[0063] Tissues were fixed with formalin-B5 fixative and 5 μm thick histological sections were stained with hematoxylin/eosin by standard methods in the City of Hope Animal Pathology Core facilities. Universal ABC detection kit was purchased from Vector (Burlingame, Calif.). Primary antibodies and secondary horseradish peroxidase antibodies used in immunohistochemistry (IHC) were purchased from Abcam Inc. (Cambridge, Mass.). Light microscopy was performed using an Olympus Provis AX70 microscope interfaced with a Nikon camera and ImagePro software by a veterinary pathologist blinded to treatment groups.
Western Blot Analyses of Signaling Proteins
[0064] Western blotting was performed by standard methods using the Chemiluminescence ECL kit with a horseradish peroxidase conjugated anti-IgG secondary antibody (Amersham Life Sciences). Sources of primary antibodies are indicated in figure descriptions. GAPDH and β-acting were loading controls. Densitometry was performed using Alpha Imager HP. Rlip shRNA pSR/puro/Ralbp1 (plasmid 31115) and scrambled shRNA (plasmid 1864) used to deplete Rlip to examine the effects on signaling proteins in cultured MEFs were purchased from Addgene (Cambridge, Mass.). Invitrogen Lipofectamine 2000 purchased from Thermo Fisher Scientific (Waltham, Mass.) was used for shRNA plasmid transfection and cells were lysed with cell lysis buffer from Cell Signal Technology (Danvers, Mass.).
RNA-Seq Studies and Validation of Results by qRT-PCR
[0065] RNA samples were prepared using the RNeasy mini kit from Qiagen (Valencia, Calif.) according to manufacturer instructions. RNA quality was assessed by microfluidic capillary electrophoresis using an Agilent 2100 Bioanalyzer. The RNA 6000 Nano Chip kit from Agilent Technologies (Santa Clara, Calif.) was used for subsequent library preparation. Sequencing libraries were prepared with the TruSeq RNA Sample Prep Kit V2 from Illumina (San Diego, Calif.) according to the manufacturer's protocol. Removal of ribosomal RNA was carried out from 500 ng total RNA using the RiboZero kit from Illumina and resulting RNA ethanol precipitated. First-strand cDNA synthesis was performed using DNA polymerase I and RNase H. cDNA was end repaired, and 3′ end adenylated. Universal adapters were ligated followed by 10 cycles of PCR using Illumina PCR Primer Cocktail and Phusion DNA polymerase from Illumina. Subsequent library purification with Agencourt AMPure XP beads was validated with Agilent Bioanalyzer 2100, and quantified with Life Technologies' Qubit purchased from ThermoFisher (Waltham, Mass.). Sequencing was conducted on Illumina HiSeq 2500 with single end 50 bp reads. Reads were aligned using Tophat v2.0 to mouse reference genome mm9. Expression level of RefSeq genes were counted and normalized using TMM method and differential expression analysis was conducted using a linear model based on negative binomial distribution using “edgeR”. RPKM (reads per kilobase per million mapped reads)=# of reads/(gene length/1000*total number of reads/1,000,000). Analyses were performed by censoring the lowest expressed genes or using log.sub.2(RPKM+0.1) expression levels. To satisfy the criteria for differential expression, a p value <=0.01, fold change >=2, and RPKM>=1 in at least 2 samples was required. RNA-Seq results were confirmed using real-time quantitative PCR. cDNA using gene primers was performed on an ABI-7500 fast real-time PCR system using SYBR Green master mix. 1 μg of total RNA from liver was used to synthesize cDNA by reverse transcription using the RT kit (Applied Biosystems). To validate RNA-Seq results, qRT-PCR was conducted with primers purchased pre-validated from BioRad (PrimePCR, cat. 10025636) for the following genes: Cib3, Dlk1, Cyp4a32, Fzd10, Gpr3, Tff1, and Six3. The internal control primer sequences for ZZZ3 were AGACCATTGCTGTACTTGAGG SEQ ID NO.: 8 and GGTATGGAAGCCCTATGTCAG SEQ ID NO.: 9. Reactions were conducted in triplicate for each biological replicate and data is expressed as loge fold change in p53.sup.−/− CAS or R508 treated mice relative to wild-type using the comparative Ct method. RNA-Seq data was normalized using the above internal reference genes and linear regression was used to determine correlation between RNA-Seq and qRT-PCR data. GO pathway terms were ranked by p-value (EASE score).
Whole-Genome Bisulfite Sequencing and Reduced Representation Bisulfite Sequencing (RRBS)
[0066] The amount of input material for the BS-Seq libraries was between 5 ng and 20 ng genomic DNA. The input DNA was sonicated, and end repair and A-tailing were performed using the NEB Next kit according to the manufacturers' instructions. Illumina's Early Access Methylation Adaptor Oligo Kit was used for the adaptor ligation. The adaptor-ligated DNA was treated with sodium-bisulfite using the Imprint DNA Modification Kit from Invitrogen according to the manufacturer's instructions for the two-step protocol. Bisulfite-treated DNA was amplified using PfuTurbo Cx Hotstart DNA Polymerase from Agilent Technologies with 14-18 cycles depending on the input amount. Size selection was performed by gel extraction for DNA fragments between 200 bp and 250 bp. The resulting library was sequenced on an Illumina HiSeq 2000 sequencer, with image analysis and base calling done using the default RTA analysis software. Reads were aligned to in silico bisulfite converted mm9 genome using Bismark aligner (CITE) using default settings. The methylation level of each CpG site was calculated as the number of non-converted cytosine divided by the sum of converted and non-converted cytosine. CpG sites with less than 3× coverage were excluded. Methylated regions were defined as those with ≥5 pairs of CpG sites merged if they were <200-bp apart. Those with p≤0.05 and average difference ≥0.25 were considered significant. To determine the methylation levels of CpG sites within promoters, we used the RefSeq gene's promoter region (defined as ±1000 bp of transcription start site) to calculate average promoter methylation level. Promoters having at least one sample with >50% methylation level and range of methylation level across the four samples >25% were selected for analyses. To identify the regions that were hyper-methylated in sample A vs. B (differential methylated regions), the regions had to satisfy three criteria: 1) methylation level in sample A was >60%; 2) methylation level in sample B was <50%; and 3) the methylation difference was >45%. DMRs were annotated using the mm9 RefSeq database. Regions between 1 kb from transcription start site to transcription end site were categorized as “gene body”; regions not overlapping with above regions were categorized as “intergenic”.
[0067] Quantitative validation was carried out for the PTPN6 and HOXAS gene promoters by conventional bisulfite sequencing. Bisulfite conversion of genomic DNA was performed with EpiTect Bisulfite Kit (Qiagen). Primers were designed with MethPrimer software using genomic coordinates of identified regions of differential methylation (MO). The forward/reverse primer sequences were as follows: PTPN6-ATTTAAGGTGGATGATGGTGTTATT SEQ ID NO.: 10/TCCAAAACTCAAAAAACTTCTATAACC SEQ ID NO.: 11; HOXAS—GTTTGATGATTTTTAGAGGTAAATT SEQ ID NO.: 12/CCATAATAAACTATAACCTCAATTC SEQ ID NO.:13; corresponding annealing temperatures were 53 and 52° C. Bisulfite PCR-amplified DNA was separated using 2% agarose gel electrophoresis and bands extracted with a Gel Extraction Kit (Qiagen). Purified target DNA was cloned into pDrive vector and EZ competent cells were transformed with plasmid DNA (PCR Cloning plus Kit; Qiagen). DNA was isolated from transformed bacteria (Qiaprep Spin Miniprep; Qiagen) and sequenced at City of Hope DNA sequencing core. Finally, DNA methylated sequence analysis was conducted with Bisulfite Sequencing DNA Methylation Analysis Software v9 (BISMA).
8-hydroxy-deoxyguanosine and 4-hydroxynonenal Measurements
[0068] ELISA assay kits (Cell Biolabs, San Diego, Calif.) were used to measure 8-hydroxydeoxyguanosine (8OHdG) and 4-hydroxynonenal (4HNE). A 96-well plate ELISA assay was used with spectrophotometric detection using a Tecan Pro200 plate reader at 450 nm. Analyte concentrations were estimated from standard curves generated from standards provided in the respective kits.
Studies of HSF1, Rlip and p53 Protein-Protein Interactions
[0069] Binding interactions of HSF1, Rlip and p53 in wt, p53.sup.−/− MEFs without or with Rlip depletion using R508 were studied by co-immunoprecipitation using protein A/G PLUS-Agarose immunoprecipitation reagent sc-2003 from Santa Cruz Biotechnology (Columbus, Ohio) according to the manufacture's protocol using whole-cell homogenates of wild-type, p53.sup.−/− or p53.sup.+/− MEFs. Primary anti-HSF1 rabbit monoclonal antibody (D3L8I) and anti-p53 mouse monoclonal antibody was from Cell Signaling Technology (Danvers, Mass.), and rabbit monoclonal anti-Rlip antibody was from Abcam (Cambridge, Mass.). The specificity of primary antibodies was tested using MEFs from either p53.sup.−/− or Rlip.sup.−/− MEFs. The corresponding probes of anti-rabbit PLUS and anti-mouse MINUS were provided in the kit and used per the manufacturer's instructions. wt, p53.sup.−/− and p53.sup.−/− MEFs were used. The Duolink.circle-solid. in-situ orange mouse/rabbit proximity ligation assay (PLA) from Sigma (St. Louis, Mo.) was used to study Rlip, p53 and HSF1 interactions in cultured MEF and mouse liver tissue sections per the manufacturer's instructions. For technical controls, we omitted one of the two primary antibodies. Purified polyclonal rabbit or mouse pre-immune IgG fractions were used as additional controls during assay optimization. Slides were visualized by fluorescence microscopy using an Olympus BX50 microscope, and photomicrographs were taken using a 40× objective.
Statistical Analyses
[0070] Statistical methods used for RNA-Seq, WGBS and expression array analyses are given above. Results for both types of studies were analyzed for effects on genes, pathways and processes using Integrated Pathways Analysis (IPA, Qiagen Inc.) and DAVIDv6.7 (Database for Annotation, Visualization and Integrated Discovery). GOTERM_BP_FAT, GOTERM_CC_FAT, GOTERM_MF_FAT, and KEGG_PATHWAY databases were included. Enriched ontology terms had to have >4 genes and an EASE score <0.05. Ontology results from each database were ranked by p-value. For analyses of DMRs lists, the genomic region had to exceed >100 identifiers. For other studies, experimental group comparisons were performed using two-tailed unpaired student's t test are expressed as the mean ±SD. The statistical significance of differences between control and treatment groups was determined by ANOVA followed by Bonferroni correction and Benjamin-Hochberg procedure with false discovery rate <0.05. The heat map of the p-values of top differentially expressed genes by Euclidean distance and an average linkage strategy for the four groups (wt, PBS-p53−/−, CAS-p53−/− and R508-p53−/−) are obtained. Changes in tumor size and body weight during the experiments were visualized by scatter plot. Differences were considered statistically significant if p<0.05.
[0071] Veterinary pathologists performed complete gross and histological necropsy on all euthanized mice. Tumor free-survival curve is shown in
Example 2 Effect of R5.circle-solid.8 on Oxidative Stress Damage and Stress-Responses
[0072] The 4-hydroxynonenal (4HNE) and 8-OH-deoxyguanosine (80HdG) levels were measured in liver homogenate using Oxiselect kits from Cell Biolabs, San Diego, Calif. by procedures described in Methods and the results are shown in
Example 3. Anticancer Effects of Targeting Rlip by Antibodies
[0073] Presence of the Rlip.sup.171-185 peptide epitope on the surface of the B16 melanoma cells was determine by flow-cytometry using pre-immune antibody, anti-Rlip.sup.171-155 antibody, and by including the Rlip.sup.171-185 peptide with anti-Rlip.sup.171-155 antibody to competitively inhibit specific binding as shown in
[0074] The selected siRNA sequence was blast-search (NCBI database) against EST libraries, to ensure that only one gene is targeted. Chemically synthesized siRNA duplex in the 2′ de-protected and desalted forms, was purchased from Dharmacon Research (Lafayette, CO). A 23 nucleotide long scrambled siRNA duplex was used as a control. The scrambled siRNA sequence was not homologous with RLIP76 mRNA in a blast-search against RLIP76. The siRNA duplex was re-suspended in lx universal buffer, provided by Dharmacon Research Laboratory. The targeted cDNA sequence (AAGAAAAAGCCAATTCAGGAGCC SEQ ID NO.: 5) corresponds to aa 170-176 (nt 508-528). The corresponding sense and antisense siRNA sequences are GAAAAAGCCAAUUCAGGAGCCdTdT SEQ ID NO.: 3 and GGCUCCUGAAUUGGCUUUUUCdTdT SEQ ID NO.: 6, respectively. The sequence of the scrambled siRNA in the sense and antisense directions are GUAACUGCAACGAUUUCGAUGdTdT SEQ ID NO.: 14 and CAUCGAAAUCGUUGCAGUUACdTdT SEQ ID NO.: 15, respectively. Transfection of siRNA duplexes was performed using Transmessenger Transfection Reagent kit (Qiagen) and assay for silencing 24 h after transfection.
REFERENCES
[0075] 1. Lane D P. Cancer. p53, guardian of the genome. Nature. 1992 Jul. 2;358(6381):15-6. [0076] 2. Levine A J, Oren M. The first 30 years of p53: growing ever more complex. Nat. Rev. Cancer 2009; 9:749-758. [0077] 3. Zilfou J T, Lowe S W. Tumor Suppressive Functions of p53. Cold Spring Harb Perspect Biol. 2009 November; 1(5): a001883. [0078] 4. Donehower L A, Lozano G. 20 years studying p53 functions in genetically engineered mice. Nat. Rev. Cancer. 2009; 9:831-841 [0079] 5. Ariffin H, Hainaut P, Puzio-Kuter A, Choong S S, Chan A S, Tolkunov D, Rajagopal G, Kang W, Lim L L, Krishnan S, Chen K S, Achatz M I, Karsa M, Shamsani J, Levine A J, Chan CS. Whole-genome sequencing analysis of phenotypic heterogeneity and anticipation in Li-Fraumeni cancer predisposition syndrome. Proc Natl Acad Sci U S A. 2014 Oct. 28; 111(43):15497-501. [0080] 6. Villani A, Tabori U, Schiffman J, Shlien A, Beyene J, Druker H, Novokmet A, Finlay J, and Malkin D. Biochemical and imaging surveillance in germline TP53 mutation carriers with Li-Fraumeni syndrome: a prospective observational study. Lancet Oncol. 2011; 12, 559-567 [0081] 7. Nantasanti S, Toussaint M J, Youssef S A, Tooten P C, de Bruin A. Rb and p53 liver functions are essential for xenobiotic metabolism and tumor suppression. PLoS One. 2016 Mar. 11; 11(3): e0150064. [0082] 8. Sablina A A, Budanov A V, Ilyinskaya G V, Agapova L S, Kravchenko J E, Chumakov P M. The antioxidant function of the p53 tumor suppressor. Nat Med. 2005 December; 11(12):1306-13. [0083] 9. Shetzer Y, Solomon H, Koifman G, Molchadsky A, Horesh S, Rotter V. The paradigm of mutant p53-expressing cancer stem cells and drug resistance. Carcinogenesis. 2014 Jun.; 35(6):1196-208. [0084] 10. Awasthi S, Singhal S S, Srivastava SK, Zimniak P, Bajpai K K, Saxena M, Sharma R, Ziller S A III, Frenkel E, Singh S V, He N-G, Awasthi Y C. ATP-dependent transport of doxorubicin, daunomycin and vinblastine in human tissues by a mechanism distinct from the P-glycoprotein. J Clin Invest. 1994; 93:958-965. [0085] 11. Awasthi S, Singhal S S, Srivastava S K, Torman R T, Zimniak P, Bandorowicz-Pikula J, Singh S V, Piper J T, Awasthi Y C, Pikula S. ATP-dependent human erythrocyte glutathione-conjugate transporter. I. Purification, photoaffinity labeling and kinetic characteristics of ATPase activity. Biochemistry. 1998; 37: 5231-5238. [0086] 12. Awasthi S, Singhal S S, Pikula S, Piper J T, Srivastava S K, Torman R T, Bandorowicz-Pikula J, Lin J T, Singh S V, Zimniak P, Awasthi Y C. ATP-dependent human erythrocyte glutathione-conjugate transporter. II. Functional reconstitution of transport activity. Biochemistry. 1998; 37: 5239-5248. [0087] 13. Awasthi S, Cheng J, Singhal S S, Saini MK, Pandya U, Pikula S, Pikula J, Singh S V, Zimniak P, Awasthi Y C. Novel function of human RLIP76: ATP-dependent transport of glutathione-conjugates and doxorubicin. Biochemistry. 2000; 39:9327-9334. [0088] 14. Awasthi S, Cheng J, Singhal S S, Sharma R, Pandya U, Zimniak P, Awasthi Y C. Functional reassembly of xenobiotic transport from the N-terminal and C-terminal domains of RLIP76 and identification of ATP binding sequences. Biochemistry. 2001; 40: 4159-4168. [0089] 15. Sharma R, Singhal S S, Wickramarachchi D, Awasthi Y C, Awasthi S. RLIP76 (RALBP1) mediated transport of leukotrienes C4 (LTC4) in cancer cells: Implications in drug resistance. Int J Cancer, 2004;112: 934-942. [0090] 16. Cheng J, Sharma R, Yang Y, Singhal S S, Sharma A, Saini MK, Singh S V, Zimniak P, Awasthi S, Awasthi Y C. Accelerated metabolism and exclusion of 4-hydroxynonenal through induction of RLIP76 and hGST5.8 is an early adaptive response of cells to heat and oxidative stress. J Biol Chem. 2001; 276: 41213-41223. [0091] 17. Yang Y, Sharma A, Sharma R, Patrick B, Singhal S S, Zimniak P, Awasthi S, Awasthi Y C. Cells preconditioned with mild, transient UVA irradiation acquire resistance to oxidative stress and UVA-induced apoptosis: Role of 4-hydroxynonenal in UVA mediated signaling for apoptosis. J Biol Chem. 2003; 278: 41380-41388. [0092] 18. Yadav S, Singhal S S, Singhal J, Wickramarachchi D, Knutson E, Albrecht T B, Awasthi Y C, Awasthi S. Identification of Membrane Anchoring domains of RLIP76 using deletion mutant analyses. Biochemistry. 2004; 43: 16243-16253. [0093] 19. Awasthi S, Singhal S S, Yadav S, Singhal J, Drake K, Nadkar A, Zajac E, Wickramarachchi D, Rowe N, Yacoub A, Boor P, Dwivedi S, Dent P, Jarman W, John B, Awasthi Y C. RALBP1 is a major determinant of radiation sensitivity. Cancer Res. 2005; 65: 6022-6028. [0094] 20. Stuckler D, Singhal J, Singhal S S, Yadav S, Awasthi Y C, Awasthi S. RLIP76 Transports vinorelbine and mediates drug resistance in non-small cell lung cancer. Cancer Res. 2005; 65: 991-998. [0095] 21. Singhal S S, Awasthi Y C, Awasthi S. Regression of melanoma in a murine model by RLIP76 depletion. Cancer Res. 2006; 66: 2354-2360. [0096] 22. Singhal J, Singhal S S, Yadav S, Suzuki S, Warnke M M, Yacoub A, Dent P, Bae S, Sharma R, Awasthi Y C, Armstrong D W, and Awasthi S. RLIP76 in defense of radiation poisoning. Int J Radiat Oncol Biol Phys. 2008; 72:553-561. [0097] 23. Singhal S S, Singhal J, Yadav S, Dwivedi S, Boor P J, Awasthi Y C, Awasthi S. Regression of lung and colon cancer xenografts by depleting or inhibiting RLIP76 (Ral-binding protein 1. Cancer Res. 2007; 67:4382-9. [0098] 24. Singhal S S, Yadav S, Drake K, Singhal J, Awasthi S. Hsf1 and POB1 induce drug-sensitivity and apoptosis by inhibiting Ralbp1. J Biol Chem. 2008; 83:19741-29. [0099] 25. Singhal S S, Yadav S, Singhal J, Sahu M, Awasthi Y C, Awasthi S. RLIP76: A target for kidney cancer therapy. Cancer Res 2009; 69:4244-51. [0100] 26. Singhal S S, Roth C, Leake K, Singhal J, Yadav S, Awasthi S. Regression of prostate cancer xenografts by RLIP76 depletion. Biochem Pharmacol. 2009; 77(6): 1074-83. [0101] 27. Singhal S S, Sherawat A, Sahu M, Singhal P, Vatsyayan R, Lelsani PC, Yadav S, Awasthi S. RLIP76 transports sunitinib and sorafenib and mediates drug resistance in kidney cancer. Int J Cancer. 2010 Mar. 15; 126(6):1327-38. [0102] 28. Singhal S S, Wickramarachchi D, Yadav S, Leake K, Vatsyayan R, Lelsani P, Chaudhary P, Suzuki S, Awasthi Y C, Awasthi S. Glutathione-Conjugate Transport by RLIP76 is required for Clathrin-Dependent Endocytosis and Chemical Carcinogenesis. Mol Cancer Ther. 2011; 10(1):16-28. [0103] 29. Singhal J, Yadav S, Nagaprashantha LD, Vatsyayan R, Singhal S S, Awasthi S. Targeting p53-null neuroblastomas through RLIP76. Cancer Prey Res (Phila.). 2011 Jun.; 4(6):879-89. [0104] 30. Leake K, Singhal J, Nagaprashantha L D, Awasthi S, Singhal S S. RLIP76 regulates PI3KJAkt signaling and chemo-radiotherapy resistance in pancreatic cancer. PLoS One. 2012; 7(4):e34582. [0105] 31. Awasthi S, Singhal S S, Yadav S, Singhal J, Vatsyayan R, Zajac E, Luchowski R, Borvak J, Gryczynski K, Awasthi Y C. A central role of RLIP76 in regulation of glycemic control. Diabetes. 2010 Mar.; 59(3):714-725. [0106] 32. Singhal J, Nagaprashantha L, Vatsyayan R, Awasthi S, Singhal S S. RLIP76, a glutathione-conjugate transporter, plays a major role in the pathogenesis of metabolic syndrome. PLoS One. 2011; 6(9): e24688. [0107] 33. Singhal S S, Figarola J, Singhal J, Reddy M A, Liu X, Berz D, Natarajan R, Awasthi S. RLIP76 protein knockdown attenuates obesity due to a high-fat diet. J Biol Chem. 2013; 288:23394-406. [0108] 34. Brown MS, Goldstein J L. Receptor-mediated endocytosis: insights from the lipoprotein receptor system. Proc Natl Acad Sci U S A. 1979 July; 76(7):3330-7. [0109] 35. Sorkin A, Zastrow M. Endocytosis and signaling: intertwining molecular networks. Nat Rev Mol Cell Biol. 2009 September; 10(9):609-622. [0110] 36. Tsujimoto M, Yip Y K, Vilcek J. Tumor necrosis factor: specific binding and internalization in sensitive and resistant cells. Proc Natl Acad Sci U S A. 1985 November; 82(22):7626-30. [0111] 37. Pinilla-Macua I, Sorkin A. Methods to study endocytic trafficking of the EGF receptor. Methods Cell Biol. 2015; 130:347-67. [0112] 38. Jean S, Mikryukov A, Tremblay M G, Baril J, Guillou F, Bellenfant S, Moss T. Extended-synaptotagmin-2 mediates FGF receptor endocytosis and ERK activation in vivo. Dev Cell. 2010 Sep. 14; 19(3):426-39. [0113] 39. Jullien-Flores V, Dorseuil O, Romero F, Letoumeur F, Saragosti S, Berger R, Tavitian A, Gacon G, Camonis J H. Bridging Ral GTPase to Rho pathways. RLIP76, a Ral effector with CDC42/Rac GTPase-activating protein activity. J Biol Chem. 1995 Sep. 22; 270(38):22473-7. [0114] 40. Hinoi T, Kishida S, Koyama S, Ikeda M, Matsuura Y, Kikuchi A. Post-translational modifications of Ras and Ral are important for the action of Ral GDP dissociation stimulator. J Biol Chem. 1996 Aug. 16; 271(33):19710-6. [0115] 41. Nakashima S, Morinaka K, Koyama S, Ikeda M, Kishida M, Okawa K, Iwamatsu A, Kishida S, Kikuchi A. Small G protein Ral and its downstream molecules regulate endocytosis of EGF and insulin receptors. EMBO J. 1999 Jul. 1; 18(13):3629-42. [0116] 42. Yamaguchi A, Urano T, Goi T, Feig L A. An Eps homology (EH) domain protein that binds to the Ral-GTPase target, RalBP1. J Biol Chem. 1997 Dec. 12; 272(50):31230-4. [0117] 43. Morinaka K, Koyama S, Nakashima S, Hinoi T, Okawa K, Iwamatsu A, Kikuchi A. Epsin binds to the EH domain of POB1 and regulates receptor-mediated endocytosis. Oncogene. 1999 Oct. 21; 18(43):5915-22. [0118] 44. Jullien-Flores V, Mahe Y, Mirey G, Leprince C, Meunier-Bisceuil B, Sorkin A, Camonis J H. RLIP76, an effector of the GTPase Ral, interacts with the AP2 complex: involvement of the Ral pathway in receptor endocytosis. J Cell Sci. 2000 August; 113(Pt 16):2837-44. [0119] 45. Rosse C, L'Hoste S, Offner N, Picard A, Camonis J. RLIP, an effector of the Ral GTPases, is a platform for Cdk1 to phosphorylate epsin during the switch off of endocytosis in mitosis. J Biol Chem. 2003 Aug. 15; 278(33):30597-604. [0120] 46. Kashatus D F, Lim K H, Brady D C, Pershing N L, Cox A D, Counter C M. RALA and RALBP1 regulate mitochondrial fission at mitosis. Nat Cell Biol. 2011 Aug. 7; 13(9):1108-15. [0121] 47. Fillatre J, Delacour D, Van Hove L, Bagarre T, Houssin N, Soulika M, Veitia R A, Moreau J. Dynamics of the subcellular localization of RalBP1/RLIP through the cell cycle: the role of targeting signals and of protein-protein interactions. FASEB J. 2012 May; 26(5):2164-74. [0122] 48. Lee S, Wurtzel J G, Singhal S S, Awasthi S, Goldfinger L E. RALBP1/RLIP76 depletion in mice suppresses tumor growth by inhibiting tumor neovascularization. Cancer Res. 2012; 72(20):5165-73. [0123] 49. Lee S, Goldfinger L E. RLIP76 regulates HIF-1 activity, VEGF expression and secretion in tumor cells, and secretome transactivation of endothelial cells. FASEB J. 2014 Sep.; 28(9):4158-68. [0124] 50. Wurtzel J G, Lee S, Singhal S S, Awasthi S, Ginsberg M H, and Goldfinger L E. RLIP76 regulates Arf6-dependent cell spreading and migration by linking ARNO with activated R-Ras at recycling endosomes. Biochem Biophys Res Commun. 2015; 467: 785-791. [0125] 51. Burg D, Mulder G J. Glutathione conjugates and their synthetic derivatives as inhibitors of glutathione-dependent enzymes involved in cancer and drug resistance. Drug Metab Rev. 2002 November; 34(4):821-63. [0126] 52. Milkovic L, Cipak Gasparovic A, Zarkovic N. Overview on major lipid peroxidation bioactive factor 4-hydroxynonenal as pluripotent growth-regulating factor. Free Radic Res. 2015; 49(7):850-60. [0127] 53. Prasanna P G S, Narayanan D, Hallett K, Bernhard E J, Ahmed M M, Evans G, Vikram B, Weingarten M, Coleman N. Radioprotectors and radiomitigators for improving radiation therapy: The Small Business Innovation Research (SBIR) Gateway for Accelerating Clinical Translation. Radiat Res. 2015 September; 184(3): 235-248. [0128] 54. Morris S M, Akerman G S, Desai V G, Tsai C A, Tolleson W H, Melchior W B Jr, Lin C J, Fuscoe J C, Casciano D A, Chen J J. Effect of p53 genotype on gene expression profiles in murine liver. Mutat Res. 2008 Apr. 2; 640(1-2):54-73. [0129] 55. Uren A G, Kool J, Matentzoglu K, de Ridder J, Mattison J, van Uitert M, Lagcher W, Sie D, Tanger E, Cox T, Reinders M, Hubbard T J, Rogers J, Jonkers J, Wessels L, Adams D J, van Lohuizen M, Berns A. Large-scale mutagenesis in p19(ARF)- and p53-deficient mice identifies cancer genes and their collaborative networks. Cell. 2008 May 16; 133(4):727-41. [0130] 56. Kulis M, Esteller M. DNA methylation and cancer. Advances in genetics. 2010; 70:27-56. [0131] 57. Bates S, Phillips A C, Clark P A, Stott F, Peters G, Ludwig R L, Karen H V. p14.sup.ARF links the tumor suppressors Rb and p53. Nature, 1998; 395:124-125. [0132] 58. Tavana O, Gu W. p53 and DNA methylation suppress the TRAIN to cell death. Cell Cycle. 2013 Jan. 1; 12(1): 9-10. [0133] 59. Ames B N, Shigenaga M K, Gold L S. DNA lesions, inducible DNA repair, and cell division: three key factors in mutagenesis and carcinogenesis. Environ Health Perspect. 1993 Dec.; 101 Suppl 5:35-44. [0134] 60. Deferme L, Wolters J E, Claessen S M, Theunissen D H, van den Beucken T, Wagner J R, van Breda S G, Kleinjans J C, Briede J J. Dynamic Interplay between the Transcriptome and Methylome in Response to Oxidative and Alkylating Stress. Chem Res Toxicol. 2016 Sep. 19; 29(9):1428-38. [0135] 61. Esterbauer H, Schaur R J, Zollner H. Chemistry and biochemistry of 4-hydroxynonenal, malonaldehyde and related aldehydes. Free Radic Biol Med. 1991; 11(1):81-128. [0136] 62. Shigenaga M K, Gimeno C J, Ames B N. Urinary 8-hydroxy-2′-deoxyguanosine as a biological marker of in vivo oxidative DNA damage. Proc Natl Acad Sci U S A. 1989 December; 86(24):9697-701. [0137] 63. Li, Q., and Martinez, J. D. P53 is transported into the nucleus via an Hsf1-dependent nuclear localization mechanism. Mol. Carcinogenesis. 2011; 50:143-152. [0138] 64. Hu Y, Mivechi N F. HSF-1 interacts with Ral-binding protein 1 in a stress-responsive, multiprotein complex with HSP90 in vivo. J Biol Chem. 2003 May 9; 278(19):17299-306. [0139] 65. Min J N, Huang L, Zimonjic D B, Moskophidis D, Mivechi N F. Selective suppression of lymphomas by functional loss of Hsf1 in a p53-deficient mouse model for spontaneous tumors. Oncogene. 2007 Aug. 2; 26(35):5086-97. [0140] 66. Wang S S, Purdue M P, Cerhan J R, Zheng T, Menashe I, Armstrong B K, Lan Q, Hartge P, Kricker A, Zhang Y, Morton L M, Vajdic C M, Holford T R, Severson R K, Grulich A, Leaderer BP, Davis S, Cozen W, Yeager M, Chanock S J, Chatterjee N, Rothman N. Common gene variants in the tumor necrosis factor (TNF) and TNF receptor superfamilies and NF-kB transcription factors and non-Hodgkin lymphoma risk. PLoS One. 2009; 4(4):e5360. [0141] 67. Enari M, Ohmori K, Kitabayashi I, Taya Y. Requirement of clathrin heavy chain for p53-mediated transcription. Genes Dev. 2006 May 1; 20(9):1087-99. [0142] 68. Endo Y, Sugiyama A, Li S A, Ohmori K, Ohata H, Yoshida Y, Shibuya M, Takei K, Enari M, Taya Y. Regulation of clathrin-mediated endocytosis by p53. Genes Cells. 2008 April; 13(4):375-86. [0143] 69. Li R, Li Y, Kristiansen K, Wang J. SOAP: short oligonucleotide alignment program. Bioinformatics. 2008; 24:713-714. [0144] 70. Zhou Y, Lin N, Zhang B. An iteration normalization and test method for differential expression analysis of RNA-Seq data. BioData Min. 2014; 7:15. [0145] 71. Zhao, S., Fung-Leung, W. P., Bittner, A., Ngo, K., and Liu, X. Comparison of RNA-Seq and microarray in transcriptome profiling of activated T cells. PLOS One. 2014; 9: e78644 [0146] 72. Huang da W, Sherman, B T, Lempicki, R A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature protocols. 2009; 4, 44-57, doi:10.1038/nprot.2008.211.
[0147] The embodiments above are intended to be illustrative and not limiting. Additional embodiments are within the claims. In addition, although the present disclosure has been described with reference to particular embodiments, those skilled in the art will recognize that changes can be made in form and detail without departing from the spirit and scope of the disclosure. Any incorporation by reference of documents above is limited such that no subject matter is incorporated that is contrary to the explicit disclosure herein.