Construction of accumulating <i>Mucor circinelloides </i>strain and industrial application of constructed strain

Abstract

The present invention relates to the technical field of gene engineering and particularly relates to a method for constructing non-de novo synthesized Mucor circinelloides recombinant strain with high lipid yield, recombinant strain constructed by method, and application of recombinant strain. According to the present invention, a diacylglycerol acyltransferase gene (DGAT) is overexpressed in Mucor circinelloides WJ11 by a homologous recombination technology, and exogenous oil is added for fermentation, such that the non-de novo synthesized Mucor circinelloides recombinant strain with high lipid yield is constructed. Compared with the control strain Mc2075, the fat yield of the Mucor circinelloides is increased; and when the diacylglycerol acyltransferase (DGAT) is transformed into the uracil defective type of Mucor circinelloides WJ11, the fatty acid composition changes after fermentation, and the lipid content may reach 53% of dry cell weight after the fermentation condition is optimized.

Claims

1. A method for constructing a synthesized Mucor circinelloides recombinant strain, comprising: (a) inserting a polynucleotide encoding a diacylglycerol acyltransferase into a plasmid, (b) transforming a uracil defective Mucor circinelloides strain with the plasmid obtained in step (a), and (c) screening for clones that express the diacylglycerol acyltransferase and produce lipids, wherein the polynucleotide comprises SEQ ID NO: 1.

2. The method according to claim 1, wherein the uracil defective Mucor circinelloides is a variant of the Mucor circinelloides WJ11 strain that is uracil defective.

3. A Mucor circinelloides recombinant strain which has been deposited in the China General Microbiological Culture Collection Center (CGMCC) on Sep. 23, 2020 under deposit number CGMCC No. 20730.

4. A method for producing a lipid by fermentation of the Mucor circinelloides recombinant strain according to claim 3, wherein the method comprises culturing the Mucor circinelloides recombinant strain in a fermentation medium that comprises fat as a carbon source, and polypropylene glycol 2000 as a defoaming agent, wherein the fermentation conditions are 28° C. and 600 rpm, the air inflow is 1 v/v min.sup.−1, and the pH is maintained at 6.0.

5. The method according to claim 4, wherein one liter of the fermentation medium consists of 40 g glucose, 21.6 g of fat, 1.5 g of MgSO.sub.4.Math.7 H.sub.2O, 100 μL of metal mother liquid, 2 g of ammonium tartrate, 7.0 g of KH.sub.2PO.sub.4, 2 g of NaHPO.sub.4, 1.5 g of yeast extract, 0.1 g of CaCl.sub.2.Math.2H.sub.2O and water, and wherein 100 mL of the metal mother liquid consists of 8 g of FeCl.sub.3.Math.6H.sub.2O, 1 g ZnSO.sub.4.Math.7H.sub.2O, 0.1 g of CuSO.sub.4.Math.5H.sub.2O, 0.1 g of Co(NO.sub.3).sub.2.Math.6 H.sub.2O, 0.1 g of MnSO.sub.4.Math.5 H.sub.2O and water.

6. The method according to claim 4, wherein the fat is soybean oil.

7. The method according to claim 4, wherein the fat is added after being emulsified, wherein the emulsification comprises (i) emulsifying the fat by adding 1 wt % of Tween 80 and a small amount of water into the fat to form a mixture, (ii) homogenizing the mixture of (i) for 5 minutes at 8000 rpm, (iii) applying ultrasound to the mixture for 5 minutes, and (iv) performing homogenization for 3 minutes.

Description

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

(1) FIG. 1 is a Mucor circinelloides recombinant plasmid pMAT2075-DGAT diagram;

(2) FIG. 2 is a PCR verification result of a Mucor circinelloides recombinant strain (M: standard protein molecular weight; DGAT: a plasmid fragment containing DGAT);

(3) FIG. 3 is the content of total intracellular fat of a recombinant strain Mc-DGAT through fermentation culture and a control strain Mc2075;

(4) FIG. 4 is the content of total fatty acids produced by a non-de novo synthesized Mucor circinelloides recombinant strain Mc-DGAT with high lipid yield through fermentation;

(5) FIG. 5 is the content of different types of fatty acids fermented by a non-de novo synthesized Mucor circinelloides recombinant strain Mc-DGAT with high lipid yield; and

(6) FIG. 6 is the content of different types of fatty acids fermented by a control strain Mc2075.

DETAILED DESCRIPTION OF THE INVENTION

(7) Terms used in the present invention, unless otherwise specified, generally have meanings commonly understood by those of ordinary skill in the art.

(8) The present invention will be described in detail below in combination with the specific embodiments and with reference to data. The following embodiments are only intended to illustrate the present invention, rather than to limit the scope of the present invention in any way.

(9) Embodiment 1

(10) (1) Cloning of Mucor circinelloides diacylglycerol acyltransferase (DGAT)

(11) Mucor circinelloides WJ11 was inoculated into a 500 mL conical flask with a baffle containing 100 mL of Kendrick culture medium (glucose: 30 g/L, MgSO.sub.4.Math.7H.sub.2O: 1.5 g/L, ammonium tartrate: 3.3 g/L, KH.sub.2PO.sub.4: 7.0 g/L, Na.sub.2HPO.sub.4: 2.0 g/L, yeast extract: 1.5 g/L, CaCl.sub.2.Math.2H.sub.2O: 0.01 g/L, FeCl.sub.3.Math.6H.sub.2O: 8 mg/L, ZnSO.sub.4.Math.7H.sub.2O: 1 mg/L, CuSO.sub.4.Math.5H.sub.2O: 0.1 mg/L, Co(NO.sub.3).sub.2.Math.6H.sub.2O: 0.1 mg/L, and MnSO.sub.4.Math.5H.sub.2O: 0.1 mg/L) for cultivation under the conditions of 28° C. and 150 rpm for 48 h, and thalluses were collected through suction filtration. The mRNA of the Mucor circinelloides strain was extracted and was reversely transcripted into cDNA, referring to the instruction of a reverse transcription kit. Diacylglycerol acyltransferase (DGAT) (K14457, 1086 bp) was found according to the genome information of the measured WJ11, specific primers DGAT-F and DGAT-R were designed according to the gene sequence, and PCR was conducted by taking the Mucor circinelloides cDNA obtained above as a template.

(12) TABLE-US-00001 (SEQ ID NO: 2) DGAT-F: 5′-AGTCGCTAGCATGAACAGCTCTTCTGAGAC-3′ (SEQ ID NO: 3) DGAT-R: 5′-AGTCGCTAGCTCAATCGGTGATACGCAGTT-3′

(13) PCR reaction was conducted in a 50 μL system: 5×PS buffer 10 μL, dNTPs Mixture (each 2 mM) 5 μL, upstream primer 1 μL, downstream primer 1 μL, total cDNA 100-200 ng, PrimeSTAR HS DNA Polymerase 1 μL, and ddH.sub.2O supplemented to 50 μL.

(14) The reaction conditions are as follows: after denaturation was conducted at 95° C. for 3 min, circulation started, denaturation was conducted at 95° C. for 30 sec, annealing was conducted at 55° C. for 30 sec, extension was conducted at 72° C. for 1.5 min, and after 30 cycles, extension was conducted at 72° C. for 10 min and the temperature was reduced to 4° C. kept for 5 min. A PCR fragment of 1265 bp was obtained through amplification, wherein the nucleotide sequence is as shown in SEQ ID NO: 1.

(15) TABLE-US-00002    1 atgaacagctcttctgagacattggtcgcctctgagcctccccaaaccacaaaggagaag   60   61 cctagcaagcccacctctcaagtcagatgggctcccattcgtggcatccctatcgagaga  120  121 agactgcagatgctggctgtctgcacatggatcagcatgatgttcattttggtgtetttg  180  181 tttttcttcatggccacctacaagttcatgtggcccattctgatcgcctacatcagcttt  240  241 ttgtacgtcgacaaagcccccgaatctggtggccgtagatttgaaagcgccagacactgg  300  301 gctctgtggagatatttcgctgcctacttccccgctcaactgatcaaggagcacgatttg  360  361 gaccccaagaacaattatgtctttggttaccacccccacggcattatctcttacggtgcc  420  421 cagctggcctttgctaccgaggctaccggctttagcgagaagttccccggtatcacaccc  480  481 agcttgctgacattgaacagcaacttccgtatccctttctaccgtgacgtgatcatggct  540  541 ttgggcatcgcttctgtcagccgtcgttcttgcgagaacattctgtctagcggccccggt  600  601 agatctatcgctatcgtcgtcggtggcgccgctgaaagcttgaacgccagacccggtacc  660  661 gctgatctggtgttgcgtaaacgtctgggcttcatccgtctggccatcaagcacggcgct  720  721 tctttggtccccgtcttcagcttcggtgagaacgaagtctacgaccagctggacaacgcc  780  781 aagggctctaaggtcttcatgtaccagaagaagatgcaagctatgctgggcttcacaatg  840  841 cccttgttccatgcccgtggcatcttcaactacgacgtcggcatcatccccttcagacac  900  901 cagatcaccaccgtcgtcggtaagcctatccccgtccccgctttggaagagggccagacc  960  961 gaacccacacaagagcagatcttgcaagtccagaagctgtacatcgacgagttgttcacc 1020 1021 atttataataagtacaaggacgtgtacgccaaggaccgtaagcaagaactgcgtatcacc 1080 1081 gattga                                                       1086

(16) (2) Construction of a Recombinant Vector

(17) The fragment of SEQ ID NO: 1 obtained by PCR was recovered and was ligated to a pMAT 2075 vector, the ligation product was transformed into an Escherichia coli Top10 competent cell, and the transformation product was coated with an LB plate containing penbritin of 100 mg/L (peptone: 10 g/L, yeast extract: 5 g/L, NaCl: 10 g/L, and agar: 1.5%). After overnight culture at 37° C., colonies were selected and were inoculated into an LB liquid culture medium (peptone: 10 g/L, yeast extract: 5 g/L, and NaCl: 10 g/L), plasmid was extracted after 8-10 h for sequence determination, and the plasmid with correct sequence was named pMAT2075-DGAT, as shown in FIG. 1.

(18) (3) Preparation of Mucor circinelloides Protoplasm

(19) Spores of the Mucor circinelloides M65 strain (Mucor circinelloides WJ11 of uracil defective type) were inoculated into a plate of a YPG culture medium (yeast extract: 3 g/L, peptone: 10 g/L, glucose: 20 g/L, leucine: 20 μg/mL, uracil: 200 μg/mL, pH 4.5) to culture at 28° C. for 1 day. Monoclonal hyphae were planted on the plate of the YPG culture medium, and the spores could grow well after being cultured at 28° C. for 3-4 days. the plates where the spores grown well were taken, 5-6 mL of YPG culture medium was added to each plate, the spores were scraped with a sterilized coating rod, spore suspension liquid was collected into a sterilized 50 mL centrifugal tube, calculation was calculated by a hemocytometer, and the concentration of the spores was adjusted to 1×10.sup.7 pieces/mL by the YPG with pH 4.5. 12.5 mL of the above spore suspension liquid was put into a sterilized 250 mL conical flask, and the conical flask was place in a refrigerator at 4° C. overnight to make the spores fully absorb water and swell. The conical flask was placed on a table concentrator under the conditions of 30° C. and 250 rpm for culture until the spores germinated. After centrifugation at 1100 rpm, the above material was washed with 5 mL of PS buffer solution with pH 6.5 [18.22 g of sorbitol and 20 mL of PBS buffer solution (NaCl: 137 mM; KCl: 2.7 mM; Na.sub.2HPO.sub.4: 10 mM; and KH.sub.2PO.sub.4: 2 mM)] for twice to wash off the culture medium. The above material was resuspended in a 5 mL of PS buffer solution, lyase with the final concentration being 4 mg/mL and chitosanase of 0.06 U/ml were added, and then the material was placed in a table concentration under the conditions of 30° C. and 60 rpm to perform incubation for 90 min to remove cell walls. After centrifugation at 100×g, the above material was washed with 0.5 M 4° C. precooled sorbitol solution for twice, 800 μL of 0.5 M sorbitol was added to gently blow, suck and resuspend the precipitate to obtain protoplasts which were sub-packaged into 100 μL/tube for future use.

(20) (4) Construction of a recombinant strain Mc-DGAT

(21) 100 μL of the prepared Mucor circinelloides protoplasts and 1 μg of recombinant plasmid pMAT2075-DGAT were mixed uniformly for electric shock transformation, the mixture was added into 1 mL of precooled YPGS (sorbitol: 0.5 mol/L; yeast extract: 3 g/L; peptone: 10 g/L; and glucose: 20 g/L) at once after electric shock to perform incubation for 1 h under the conditions of 26° C. and 100 rpm, the YPGS was removed through centrifugation at 100×g, and after the product was resuspended by YNBS [sorbitol: 91.1 g/L; glutamic acid: 1.5 g/L; (NH.sub.4).sub.2SO.sub.4: 1.5 g/L; yeast extract: 0.5 g/L; glucose: 10 g/L; and pH was adjusted to 4.5, and thiamine and niacin were added after sterilization until the final concentration is 1 μg/mL], an MMC culture medium [casamino acid: 10 g/L; yeast extract: 0.5 g/L; glucose: 20 g/L; agar: 15 g/L; and the pH was adjusted to 3.2, and thiamine and niacin were added after sterilization until the final concentration is 1 μg/mL] was coated with the product uniformly for lucifugal culture at 28° C. for 3-4 days. Single-colony hyphae grown on eight plates were randomly selected and put on a new MMC plate to culture 28° C. for 2-3 days to collect spores, about 200-300 spores were inoculated into the MMC and the uracil-containing MMC plate respectively to culture 28° C. for 2-3 days and the counting was conducted, and the above screening step was repeated until the number of the spores growing in the two plates was basically the same, indicating that a stable genetic transformant was obtained. After the stable genetic transformant hyphae were cultured in the YPG culture medium plate at 30° C. for 5-7 days, spores were collected, the concentration of the spores was adjusted to 1×10.sup.7pieces/mL, and the spores were stored in a 30% glycerinum tube at −80° C. The non-de novo synthesized Mucor circinelloides recombinant strain Mc-DGAT with high lipid yield was finally obtained; and the strain transformed into the pMAT2075 vector that did not integrate the DGAT nucleotide sequence serves as a control train Mc2075.

(22) The remaining thalluses cultivated by the table concentrator after coating were separated by vacuum filtration with a Buchner funnel, the genome DNA of the non-de novo synthesized Mucor circinelloides recombinant strain Mc-DGAT with high lipid yield was extracted (referring to the instruction of a plant rapid DNA extraction kit), and PCR verification was conducted by taking the DNA as a template and taking 2075-F and 2075-R as primers.

(23) TABLE-US-00003 (SEQ ID NO: 4) 2075-F: 5'-CGAGAACATTCTGTCTAGCG-3' (SEQ ID NO: 5) 2075-R: 5'-CATACACGGCCCACATTATC-3'

(24) The reaction system and the amplification condition are as follows: pre-denaturation at 95° C. for 3 min, denaturation at 95° C. for 30 sec, annealing at 60° C. for 30 sec, extension at 72° C. for 2 min, 30 cycles, and compensative extension at 72° C. for 10 min. The PCR verification result is shown in FIG. 2. The fragment obtained by the non-de novo synthesized Mucor circinelloides recombinant strain Mc-DGAT with high lipid yield is 964 bp, indicating that the recombinant plasmid pMAT2075-DGAT has been successfully transformed into the Mucor circinelloides.

(25) Embodiment 2

(26) A method for producing lipid by a non-de novo synthesized Mucor circinelloides recombinant strain with high lipid yield through fermentation includes:

(27) Seed fermentation liquid of the non-de novo synthesized Mucor circinelloides recombinant strain Mc-DGAT with high lipid yield was inoculated into a fermentation medium added with soybean oil as a carbon source according to the inoculation quantity of 10%; and during fermentation, a defoaming agent polypropylene glycol 2000 according to 2 mL/L was added, wherein the fermentation conditions are 28° C. and 600 rpm, the air inflow is v/v min.sup.−1, and the pH is maintained to be 6.0. After fermentation, all the fermentation liquid samples were collected, vacuum filtration was conducted by a Buchner funnel, the fermentation liquid and thalluses were separated, the fermentation liquid was collected to store at −20° C. for future use, and the thalluses were washed with distilled water for three times and then were freeze-dried for future use.

(28) The fermentation medium (1L) consists of:

(29) 40 g of glucose, 21.6 g of soybean oil, 1.5 g of MgSO.sub.4.Math.7H.sub.2O, 100 μL of metal mother liquid, 2 g of ammonium tartrate, 7.0 g of KH.sub.2PO.sub.4, 2 g of NaHPO.sub.4, 1.5 g of yeast extract, 0.1 g of CaCl.sub.2.Math.2 H.sub.2O and the balance of water, wherein

(30) the metal mother liquid consists of: 8 g of FeCl.sub.3.Math.6H.sub.2O, 1 g of ZnSO.sub.4.Math.7H.sub.2O, 0.1 g of CuSO.sub.4.Math.5H.sub.2O, 0.1 g of Co(NO.sub.3).sub.2.Math.6H.sub.2O, 0.1 g of MnSO.sub.4.Math.5H.sub.2O and the balance of distilled water to prepare 100 mL.

(31) When the soybean oil was added into the fermentation medium, emulsification treatment was conducted in advance, wherein the emulsification process is as follows: 1 wt % of tween 80 and a small amount of water (about 5-10 mL) were added into the soybean oil, homogenization was conducted by a homogenizer for 5 min under the condition of 8000 rpm, ultrasonic treatment was conducted for 5 min and then homogenization was conducted for 3 min.

(32) Measurement of fermentation performance of a non-de novo synthesized Mucor circinelloides recombinant strain Mc-DGAT with high lipid yield

(33) (1) Measurement of content of fat produced by the non-de novo synthesized Mucor circinelloides recombinant strain Mc-DGAT with high lipid yield through fermentation

(34) Preparation of a to-be-measured sample: an optimized Kendrick culture medium was adopted in 1 L of fermentation tank, and soybean oil was added as a carbon source to culture the Mucor circinelloides recombinant strain Mc-DGAT. According to the oil production rule of the Mucor circinelloides, fermentation liquid was collected respectively at the 12 h, 24 h, 36 h, 48 h, 60 h, 72 h and 96 h during fermentation, and the fat content of the strain was measured by a method of double differences. The results are shown in Table 1 and FIG. 3. The intracellular fat content of the Mucor circinelloides recombinant strain Mc-DGAT with high lipid yield is increased compared with that of the control strain Mc2075.

(35) TABLE-US-00004 TABLE 1 Content of intracellular fat of a recombinant strain Mc-DGAT through fermentation culture and a control strain Mc2075 Fermentation Time (h) Strain 12 24 36 48 60 72 96 Mc-DGAT 16.5 23 41.5 50.5 50 53 49 Mc-DGAT 12 19.5 30 38 39 41 40.5

(36) (2) Measurement of content of fat acid produced by the non-de novo synthesized Mucor circinelloides recombinant strain Mc-DGAT with high lipid yield through fermentation

(37) Fermentation liquid was collected respectively at the 24 h, 36 h, 48 h, 60 h, 72 h and 96 h, 120 h during fermentation, and the content of the total fatty acids and the content of different types of fatty acids in the strain were measured by a gas phase. The results are shown in FIG. 4, FIG. 5 and FIG. 6.

(38) It can be seen from FIG. 4 that the non-de novo synthesized Mucor circinelloides recombinant strain Mc-DGAT with high lipid yield shows a continuous increase trend with the fermentation time; and in the control strain Mc2075, the content of the total fatty acids reaches the highest at the 48 h of fermentation and then shows a basically stable trend.

(39) It can be seen from FIG. 5 and FIG. 6 that with the fermentation time, compared with the control strain Mc2705, the content of other six fatty acids except PA and OA of the non-de novo synthesized Mucor circinelloides recombinant strain Mc-DGAT with high lipid yield has little change; when the recombinant strain Mc-DGAT is used for fermentation, the PA content decreases slowly with the fermentation time, and the PA content of the control strain Mc2075 decreases rapidly at the half stage of fermentation; and the OA content of the recombinant strain Mc-DGAT is higher than the OA content of the control strain Mc2075.

(40) The above description is only a preferred embodiment of the present invention, and is not intended to limit the present invention in other forms. Any person skilled in the art may change or modify the technical contents disclosed above into an equivalent embodiment with equivalent change. However, any simple amendment or equivalent change and modification of the above embodiments made according to the technical essence of the present invention without departing from the content of the technical solution of the present invention shall fall within the protection scope of the technical solution of the present invention.