Whole avian-origin reverse genetic system and recombinant H5N2 subtype avian influenza virus, vaccine and uses thereof
11512117 · 2022-11-29
Assignee
Inventors
- Wenbao Qi (Guangdong, CN)
- Ming Liao (Guangdong, CN)
- Yiqun Chen (Guangdong, CN)
- Jiahao Zhang (Guangdong, CN)
- Bo Li (Guangdong, CN)
- Jinyu Huang (Guangdong, CN)
- Huanan Li (Guangdong, CN)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2760/16134
CHEMISTRY; METALLURGY
C12N2760/16152
CHEMISTRY; METALLURGY
C12N2760/16122
CHEMISTRY; METALLURGY
A61K39/00
HUMAN NECESSITIES
International classification
A61K39/00
HUMAN NECESSITIES
C12N7/00
CHEMISTRY; METALLURGY
Abstract
The present disclosure discloses a whole avian-origin reverse genetic system, a recombinant H5N2 subtype avian influenza virus, a vaccine containing the virus, and a preparation method and application thereof. The genome of the recombinant virus is comprised of a modified HA gene derived from a highly pathogenic H5N6 subtype avian influenza virus strain, as well as PB2, PB1, PA, NP, NA, M and NS genes derived from H5N2 subtype avian influenza D7 virus strain. The recombinant virus is a recombinant H5N2 avian influenza virus rescued from the D7 virus strain as a backbone, which is an avirulent virus strain with the original immunogenicity, and can maintain a high virus titer during the chick embryo culture process. The recombinant virus fully meets the biological safety requirements and has a good application prospect.
Claims
1. A recombinant H5N2 subtype avian influenza virus, wherein the genome of the recombinant virus is comprised of a modified HA gene derived from a highly pathogenic H5N6 subtype avian influenza virus strain, as well as PB2, PB1, PA, NP, NA, M and NS genes derived from H5N2 subtype avian influenza D7 virus strain; the modified HA gene has a sequence as shown in SEQ ID NO: 9; the PB2, PB1, PA, NP, NA, M and NS genes derived from D7 strain have nucleotide sequences as shown in SEQ ID NOs: 1-3 and 5-8, respectively; the H5N6 subtype avian influenza virus strain is A/Duck/Guangdong/19123/2019 (H5N6); and the recombinant virus has a deposit accession number of CCTCC NO: V202218.
2. A preparation method of the recombinant virus according to claim 1, comprising recombining a modified HA gene derived from a highly pathogenic H5N6 subtype avian influenza virus strain and PB2, PB1, PA, NP, NA, M and NS genes derived from H5N2 subtype avian influenza D7 virus strain to obtain the recombinant virus.
3. The preparation method according to claim 2, wherein the method comprises: constructing plasmids expressing a protein encoded by PB2, PB1, PA, NP, NA, M and NS genes derived from H5N2 subtype avian influenza D7 virus strain, respectively; constructing a plasmid expressing a modified HA protein encoded by SEQ ID NO: 9; and mixing the above 8 plasmids, mixing the mixed plasmids with a transfection reagent, and then adding to 293T cells to obtain the recombinant H5N2 subtype avian influenza virus.
4. The preparation method according to claim 2, wherein the method comprises steps of: S1. Constructing a reverse genetic system comprising 8 plasmids based on H5N2 subtype avian influenza D7 virus strain, the 8 plasmids respectively contain 8 genes derived from H5N2 subtype avian influenza D7 virus strain, PB2, PB1, PA, HA, NP, NA, M and NS genes, and the 8 genes have nucleotide sequences as shown in SEQ ID NOs: 1-8, respectively; S2. constructing a plasmid expressing the modified HA protein encoded by SEQ ID NO: 9; and S3. mixing 7 plasmids containing PB2, PB1, PA, NP, NA, M and NS genes derived from H5N2 subtype avian influenza D7 virus strain in step S1 with the plasmid expressing the modified HA protein in step S2, mixing the mixed plasmids with a transfection reagent and adding to 293T cells, and culturing the cells to obtain the recombinant H5N2 subtype avian influenza virus.
5. The preparation method according to claim 4, wherein a vector used for constructing the plasmid in step S1 is pSMC vector, and the 8 plasmids obtain by construction are named pSMC-PB2, pSMC-PB1, pSMC-PA, pSMC-HA, pSMC-NP, pSMC-NA, pSMC-M and pSMC-NS, respectively.
6. The preparation method according to claim 5, wherein the pSMC vector is constructed by: removing BsmBI restriction enzyme site in pCI vector to obtain pCI-NEW vector; synthesizing a nucleotide fragment containing transcriptional promoter and terminator sequences; performing double enzyme digestion on the pCI-NEW vector and the nucleotide fragment containing transcriptional promoter and terminator sequences with XhoI and MluI, followed by ligation and transformation to obtain a recombinant plasmid; and performing enzyme digestion identification and DNA sequencing to obtain a positive plasmid as pSMC vector.
7. A recombinant H5N2 subtype avian influenza vaccine based on reverse genetic technique, comprising an immunizing amount of the recombinant H5N2 subtype avian influenza virus according to claim 1 as an antigen.
8. Use of the recombinant H5N2 subtype avian influenza virus according to claim 1 in the manufacture of a vaccine for preventing H5N2 subtype avian influenza.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
DETAILED DESCRIPTION
(6) The present disclosure is further described below in conjunction with the accompanying drawings and specific examples. However, the examples do not limit the present disclosure in any form. Unless otherwise specified, the reagents, methods and equipment used in the present disclosure are conventional reagents, methods and equipment in the technical field.
(7) Unless otherwise specified, the reagents and materials used in the following examples are commercially available.
(8) Polynucleotides encoding viral proteins can be synthesized artificially according to the sequences disclosed in the present invention, and commonly used promoters, transcription terminators, resistance genes, etc. can be synthesized according to the prior art.
(9) The avian influenza virus strain A/Duck/Guangdong/D7/2007 (H5N2, referred to as the D7 strain or D7 virus strain) is isolated and preserved by the National and Regional Joint Engineering Laboratory for Medicament of Zoonoses Prevention and Control.
(10) The highly pathogenic avian influenza strain A/Duck/Guangdong/19123/2019 (H5N6, referred to as GD123 strain or GD123 virus strain) was isolated and preserved by the National and Regional Joint Engineering Laboratory for Medicament of Zoonoses Prevention and Control.
(11) The construction flow chart and uses of the avian influenza vaccine H51901 of the present disclosure are shown in
(12) Deposit information: The recombinant H5N2 subtype avian influenza virus rGD123 was deposited under a deposit accession number of CCTCC NO: V202218 in the China Center for Type Culture Collection (Address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, China) on Mar. 8, 2022.
Example 1 Construction of a Whole Avian-Origin Reverse Genetic System Based on D7 Strain for Avian Influenza Vaccine
(13) 1. Construction of the Reverse Genetic System Vector pSMC (
(14) (1) Engineering of pCI Vector
(15) The pCI vector was a product of Promega (Cat. No. BR180). In order to remove the BsmBI restriction enzyme site in the pCI vector, the pCI vector was digested with the restriction endonuclease EarI to obtain a long fragment A and a short fragment B. The amplification primers pCI-EarI-1 and pCI-EarI-2 were designed according to the sequence of short fragment B.
(16) pCI-EarI-1: 5′-TAGCGAGAGGCCGCACG-3′ (SEQ ID NO: 10);
(17) pCI-EarI-2: 5′-TCTTCGTTCGGTCACAGCTTCTGTAAG-3′ (SEQ ID NO: 11).
(18) PCR amplification was carried out using short fragment B as a template to obtain fragment C, which was recovered. Fragment C and fragment A were digested and recovered with EarI respectively, and then ligated. After transformation and plasmid extraction, enzyme digestion with BsmBI and identification by sequencing was performed, and the plasmid verified to be correct was named as pCI-NEW vector.
(19) (2) Acquisition of Transcription Elements
(20) DNA fragments containing transcription elements (pol I promoter and common transcription terminator) were obtained by gene synthesis. The sequence of the terminator is CCAGGGTACTGGTCCTGACCACGTTGGAGGGGG GA (SEQ ID NO: 12).
(21) (3) Enzyme Digestion of pCI-NEW Vector and Transcription Element Fragments
(22) The pCI-NEW vector and the DNA fragment synthesized in step (2) were subjected to double digestion with XhoI and MluI.
(23) (4) Ligation and Transformation of Digestion Products from pCI-NEW Vector and Transcription Element Fragments
(24) The digestion products from the pCI-NEW vector and transcription element fragments in step (3) were recovered, and subjected to ligation, transformation, plasmid extraction, and enzyme digestion identification.
(25) (5) Enzyme Digestion Identification
(26) The plasmids extracted in step (4) were identified by single digestion with BsmBI and double digestion with XhoI and MluI, respectively.
(27) (6) Sequencing Identification
(28) The plasmids identified as positive by enzyme digestion in step (5) were sequenced, and the plasmid whose sequence was verified to be correct was named pSMC vector.
(29) 2. Construction of D7 Reverse Genetics System
(30) Eight gene fragments of D7 strain (PB2, PB1, PA, HA, NP, NA, M and NS genes) were amplified with reference to universal primers of 8 gene sequences of influenza virus (Universal primer set for the full-length amplification of all influenza A viruses. Arch Virol. 2001 December; 146 (12):2275-89). The 8 gene fragments derived from the D7 virus strain obtained by amplification were inserted into the reverse genetic vector pSMC according to the conventional molecular biology operation method, and the obtained 8 plasmids were named pSMC-PB2, pSMC-PB1, pSMC-PA, pSMC-HA, pSMC-NP, pSMC-NA, pSMC-M and pSMC-NS. A D7 reverse genetic system vaccine development platform was established to provide the required genes for vaccine strains. After 8 plasmids were co-transfected into 293T cells, the H5N2 avian influenza virus with hemagglutination activity could be successfully assembled, and could be stably passaged on chick embryos. After sequencing identification, it was proved that the reverse genetic system was successfully constructed.
Example 2 Construction of Recombinant H5N2 Subtype Avian Influenza Virus
(31) 1. Extraction and Reverse Transcription of Viral RNA
(32) Total RNA from virus-containing allantoic fluid was extracted using a total RNA extraction kit. cDNA was obtained by reverse transcription according to the instructions of M-MLV reverse transcriptase.
(33) 2. Design of Segmented Primers
(34) Overlap primers (SEQ ID NO: 13 and SEQ ID NO: 14) for modifying the cleavage site of the HA gene were designed based on the HA sequence of the GD123 strain. The specific sequence is as follows.
(35) GD123-HA1-F:
(36) 5′-CTCAGAAATAGTCCTCTAAGAGAAAGAGGACTGTTTGGAGCT-3′ (SEQ ID NO: 13);
(37) GD123-HA2-R:
(38) 5′-AAACAGTCCTCTTTCTCTTAGAGGACTATTTCTGAGCC-3′ (SEQ ID NO: 14).
(39) 3. Modification, Amplification and Purification of HA Fragment
(40) Fragmented PCR amplification and fusion PCR amplification of the HA gene of GD123 strain were carried out using high-fidelity DNA polymerase and fragmented primers.
(41) The upstream and downstream universal primers with BsmBI restriction sites were paired with segmented primers, respectively, and two fragments, HA1 and HA2, were amplified. Finally, fusion PCR was performed to amplify the complete modified HA fragment. After PCR amplification, the amplified products were preliminarily detected by 1% agarose gel electrophoresis (the amplification results are shown in
(42) 4. Construction, Screening and Purification of the Target Plasmid
(43) The amplified target fragment rHA and pSMC expression vector were digested with restriction endonuclease BsmBI (55° C. water bath for 3 h).
(44) The digested products were recovered, ligated and transformed into DH5a competent cells, which were cultured at 37° C. overnight, and the positive clones were initially screened by PCR (bacteria suspension as template). The specific operation is as follows: a single colony was picked out and transferred into an EP tube containing 500 μL of LB medium (ampicillin-resistant), which was then placed on a shaker at 37° C. and cultured with shaking for 3-4 h. 2 μL of bacterial suspension was used for PCR amplification, and 10 μL of PCR product was subjected to electrophoresis detection. The PCR-positive clones were identified by sequencing. The clones with correct sequencing were further expanded and cultured, and the plasmids were extracted. The concentration and purity of the plasmids were determined, and stored at −40° C. for future use.
(45) 5. Rescue and Identification of Recombinant Virus rGD123
(46) Cell preparation. One day before transfection, 293T cells were digested with trypsin and counted. Cells of appropriate concentration were added to a 12-well cell culture plate, which was then placed in a 37° C. incubator containing 5% CO.sub.2. The cells were used for experiments when the cell density reached about 90%.
(47) Transfection
(48) Eight plasmids (300 ng/plasmid) required for transfection were added into EP tubes containing 150 μL serum-free medium Opti-MEM, mixed well, and named as solution A; 4.8 μL Lipofectamine 2000 (Invitrogen) was added to another EP tube containing 150 μL of Opti-MEM, named solution B, mixed well, and allowed to stand at room temperature for 5 min. Solution A was added to solution B, mixed gently and allowed to stand for 20 min. The 12-well culture plate with 293T cells was taken out, and the original medium was discarded. The plate was then washed twice with sterilized PBS, the mixture of plasmid and liposome was added, and the plate was placed in a 37° C. incubator with 5% CO.sub.2 for 4-6 h of culture. Then the DMEM medium containing BSA (concentration of 0.2%) was used to replace the medium containing Lipofectamine 2000 to continue the culture. After 48 h, the supernatant and cells were collected, mixed well and inoculated to 9˜11-day-old SPF embryos. After 60 h of inoculation, the allantoic fluid was tested for hemagglutination activity. The presence of hemagglutination activity indicated that it contained influenza virus. Allantoic fluid with hemagglutination activity was harvested and sequenced to identify the virus sequence. The virus was continuously passaged for five generations, and after collection, it was aliquoted and stored at −80° C. for future use.
(49) Identification of the Recombinant Virus
(50) The RNA of the successfully rescued virus was extracted and subjected to whole genome sequencing by RT-PCR. After verification, the obtained recombinant virus was named rGD123.
Example 3 Preparation of Vaccine H51901 with Recombinant Virus rGD123
(51) 1. Preparation of Vaccine
(52) Large-scale preparation of antigens. The rGD123 virus used for vaccine preparation was diluted to about 1×10.sup.−4 TCID.sub.50/mL using sterile DMEM cell culture medium, and the diluted virus was inoculated to allantoic cavity of 9˜11-day-old SPF chick embryos at 0.2 mL/embryo under sterile conditions, sealed and placed in a 37° C. incubator. After 60 h of incubation, chick embryo allantoic fluid was collected in a biological safety cabin, and the hemagglutination (HA) titer was determined.
(53) Antigen Inactivation
(54) The virus collected above was inactivated with a final concentration of 0.1% formaldehyde, sealed, placed in a shaker, and incubated at 37° C. for 24 h; then the inactivated virus was inoculated to 9˜11-day-old SPF chick embryos at 0.2 mL/embryo. After culture at 37° C. for 48 h, the hemagglutination titer was tested to verify whether the virus had been completely inactivated.
(55) Preparation of Inactivated Oil Emulsion Vaccine H51901
(56) Preparation of water phase: 97 parts of the solution containing the inactivated rGD123 virus and 3 parts of Tween-80 were mixed well. Preparation of oil phase: 94 parts of Marcol-52 white mineral oil and 6 parts of Span-80 were mixed well and sterilized by autoclaving for future use. The oil phase and the water phase in a ratio of 2:1 were emulsified using an emulsifier at 25,000 r/min for 5 min. During the emulsification, a few drops of the mixture can be placed on the surface of cold water. In the case that only the first drop diffused and the others did not, the formulation is judged to be water-in-oil, and the preparation of the inactivated oil emulsion vaccine was completed. The prepared vaccine was put into a centrifuge to centrifuge at 3,000 r/min for 15 min, and the presence of stratification was observed. If absent, the preparation was successful. The vaccine, named H51901, was aliquoted and stored at 4° C.
(57) 2. Immune Challenge Protection Test of H51901 Vaccine Strain in SPF Chicken
(58) In order to verify the immune effect of the H51901 vaccine strain, SPF chickens aged 21-28 days were subcutaneously injected with the recombinant avian influenza inactivated vaccine H51901 through the neck at 0.3 mL/bird as the experimental group; another 5 chickens of the same batch were used as the non-immune blank control group. At 21 dpi (21 days after immunization), they were marked one by one and blood was collected to separate serum for HI (haemagglutination inhibition) antibody test. The H5N6 subtype avian influenza GD123 strain, 19147 strain, 19229 strain, 19245 strain, 19396 strain and 20090 strain were used to challenge the chickens of the experimental group and the control group, and the morbidity or death of the experimental chickens was observed very day and recorded in time for 14 days. At 5 dpc (5 days after the challenge), the throat and cloacal swabs of the experimental chickens were collected for virus isolation, and the protection status was counted.
(59) TABLE-US-00001 TABLE 1 Protection of H51901 vaccine against H5N6 subtype avian influenza HI (log2) Mean Protection Group Strain Antibody Titer Rate (%) H51901 GD123 10.5 100% (10/10) Treatment 19174 10.4 89% (8/9) group 19229 10.5 80% (8/10) 19245 10.1 80% (8/10) 19396 10.5 100% (10/10) 20090 8.6 100% (10/10) Control group 0 0% (0/30)
(60) The results of the challenge protection test of the recombinant avian influenza inactivated vaccine strain H51901 showed that the vaccine had a good immune effect on SPF chickens aged 21-28 days. After 21 days of immunization, serum from the SPF chicken can cross-react with highly pathogenic avian influenza virus GD123 strain, 19147 strain, 19229 strain, 19245 strain, 19396 strain and 20090 strain of H5N6 subtype, with HI titer ≥8.6 log 2, demonstrating that the vaccine induced high level of antibody in vivo, and produce complete protection against challenge from GD123 strain, 19396 strain and 20090 strain with a protection rate up to 100%. For other H5N6 circulating virus strains, 19174, 19229 or 19245, vaccine H51901 can also induce immunized chickens to produce high level of antibody, and the positive rate of virus isolation from throat and cloacal swabs of test chickens was extremely low, giving a protection rate of 80%-89%. In contrast, antibody was not detectable in SPF control chickens. The results showed that the vaccine H51901 had good immunogenicity, and the antibodies produced in the immunized animal had a good neutralization effect on the H5N6 viruses circulating in the recent two years.
(61) 3. Serum Hemagglutination Inhibition Test (HI Test) for Cross-Reactivity
(62) The serum from SPF chickens immunized with H51901 vaccine or the positive serum from chickens infected with donor strain GD123 and some H5N6 subtype virus strains were subjected to serum HI test for cross-reactivity. The test results are shown in Table 2. Both the positive serum produced after immunization with H51901 vaccine and the positive serum after GD123 virus infection can give hemagglutination inhibition with 8 highly pathogenic avian influenza H5N6 virus strains, indicating that the immunogenicity of the circulating highly pathogenic avian influenza H5N6 virus strain was basically consistent with that of GD123 wild-type virus. Therefore, the serum of SPF chickens immunized with H51901 vaccine can produce good serological cross-reaction with the circulating highly pathogenic H5N6 subtype avian influenza strains as well, with HI titer ≥5 log 2. According to the Chinese Veterinary Pharmacopoeia, the HI titer of avian influenza vaccine being ≥4 log 2 shows that the vaccine can induce the body to produce antibodies with protective effect. Therefore, the H51901 vaccine can induce the animal to produce enough antibodies to against the infection of the highly pathogenic H5N6 subtype avian influenza epidemic strains.
(63) TABLE-US-00002 TABLE 2 HI (log2) cross-test results Antigen Serum (virus strain) H51901 GD123 GD123 5 8 H51901 9 10 19046 6 8 19049(2) 6 9 19051(2) 6 9 19073(1) 7 9 19076 7 9 19134 6 9 19324(2) 7 9 19374 6 8
(64) In conclusion, H51901 can be used as an ideal inactivated vaccine for the prevention and control of the H5 subtype avian influenza, which is dominated by the H5N6 subtype widespread in recent years.
(65) The above-mentioned embodiments are preferred embodiments of the present disclosure, but the embodiments of the present disclosure are not limited by the above-mentioned embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present disclosure should be equivalent embodiments and are included within the protection scope of the present disclosure.