CD127 expression inversely correlates with FoxP3 and suppressive function of CD4.SUP.+ Tregs
11435349 · 2022-09-06
Assignee
Inventors
- Jeffrey A. Bluestone (San Francisco, CA)
- Weihong Liu (San Francisco, CA, US)
- Amy Putnam (San Francisco, CA, US)
Cpc classification
G01N2333/70596
PHYSICS
A61K2035/122
HUMAN NECESSITIES
A61K35/17
HUMAN NECESSITIES
A61P37/06
HUMAN NECESSITIES
A61K39/0008
HUMAN NECESSITIES
International classification
A61K39/00
HUMAN NECESSITIES
G01N33/50
PHYSICS
Abstract
The invention provides methods of isolating CD127.sup.lo/− immunosuppressive regulatory T cells which can be greatly enriched for FoxP3, methods of expanding the isolated cells, pharmaceutical compositions of such cells, and methods of their use in the treatment of autoimmune and other immune system mediated disorders.
Claims
1. A pharmaceutical composition comprising an expanded population of immunosuppressive regulatory T-cells and a pharmaceutically acceptable parenteral vehicle for administration by injection, wherein the expanded population of immunosuppressive regulatory T-cells is obtained according to a method comprising: screening a sample comprising human T cells for the levels of cell surface expression of a CD4 marker and a CD127 marker to detect CD4.sup.+CD127.sup.lo/−cells, wherein the CD4.sup.+CD127.sup.lo/−cells have reduced or no levels of cell surface-expressed CD127 compared to other cells in the sample expressing greater amounts of CD127, isolating the CD4.sup.+CD127.sup.lo/−cells from a sample to provide an isolated population of immunosuppressive regulatory T-cells, expanding the isolated T-cell population of immunosuppressive regulatory T-cells to obtain the expanded population of immunosuppressive regulatory T-cells, and formulating the expanded population of immunosuppressive regulatory T-cells with a pharmaceutically acceptable parenteral vehicle for administration by injection, wherein the vehicle comprises one or more additives in an effective amount to maintain isotonicity, physiological pH, or stability.
2. The pharmaceutical composition of claim 1, wherein the screening comprises screening for the CD4 marker and the CD127 marker simultaneously.
3. The pharmaceutical composition of claim 1, wherein the screening comprises screening for the CD4 marker and the CD127 marker sequentially.
4. The pharmaceutical composition of claim 1, wherein the screening comprises contacting the sample with an anti-CD4 antibody and an anti-CD127 antibody.
5. The pharmaceutical composition of claim 4, wherein the anti-CD4 antibody is a monoclonal antibody and/or the anti-CD127 antibody is a monoclonal antibody.
6. The pharmaceutical composition of claim 4, wherein the anti-CD4 antibody is a fluorescently labeled CD4 antibody and/or the anti-CD127 antibody is a fluorescently labeled CD127 antibody.
7. The pharmaceutical composition of claim 4, wherein the anti-CD4 antibody is a magnetic bead-labeled anti-CD4 antibody and/or the anti-CD127 antibody is a magnetic bead-labeled anti-CD127 antibody.
8. The pharmaceutical composition of claim 1, wherein the CD4.sup.+CD127.sup.lo/−cells are cells that fall below the 50.sup.th percentile of fluorescence intensity for cells in the sample when contacted with a fluorescently labeled anti-CD127 antibody.
9. The pharmaceutical composition of claim 1, wherein at least 25% of the isolated population of immunosuppressive regulatory T-cells is CD25.sup.+ cells.
10. The pharmaceutical composition of claim 1, wherein the sample is a blood sample.
11. The pharmaceutical composition of claim 1, wherein the sample is a leukapheresis sample.
12. The pharmaceutical composition of claim 1, wherein the sample is a peripheral blood mononuclear cell (PBMC) sample.
13. The pharmaceutical composition of claim 1, wherein the expanding step comprises contacting the isolated population of immunosuppressive regulatory T-cells with an antigen-specific or non-specific T cell receptor (TCR) stimulatory agent and a costimulatory agent.
14. The pharmaceutical composition of claim 13, wherein the TCR stimulatory agent is an anti-CD3 antibody and the costimulatory agent is an anti-CD28 antibody.
15. The pharmaceutical composition of claim 13, wherein the expanding step further comprises contacting the isolated population of immunosuppressive regulatory T-cells with a cytokine.
16. The pharmaceutical composition of claim 13, wherein the expanding step occurs in the presence of TGFβ or rapamycin.
17. The pharmaceutical composition of claim 1, wherein at least 90% of the isolated population is CD4.sup.+CD127.sup.lo/−cells.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
DETAILED DESCRIPTION OF THE INVENTION
(15) Definitions
(16) Unless otherwise stated, the following terms used in the specification and claims have the meanings given below.
(17) It is noted here that as used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural reference unless the context clearly dictates otherwise.
(18) By a “population of cells” is meant a plurality of cells, preferably at least 10.sup.3, 10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10, or 10.sup.11 cells. The population in some embodiments has from 10.sup.5 to 10.sup.7 cells, 10.sup.6 to 10.sup.8 cells, or from 10.sup.8 to 10.sup.11 cells, or 10.sup.10 to 10.sup.12 cells.
(19) A therapeutically effective amount of isolated or expanded isolated CD127.sup.Lo/− regulatory T-cells provided by the invention is generally between 10.sup.7 to 10.sup.11 cells, and more preferably 10.sup.7 to 10.sup.9 cells.
(20) Immune conditions, diseases, disorders and reactions or responses to be treated according to the methods and compositions of the invention means a disease in which the immune system contributes to pathogenesis. These reactions include, but are not limited to, autoimmune conditions, disorders or diseases and persistent and progressive immune reactions to infectious non self antigens from bacterial, viral (e.g., HCV), fungal, or parasitic organisms which invade and persist within mammals and humans. Such conditions and disorders include allergies and/or asthma. The allergies and asthma may be due to sensitization with foreign or non-self antigens as pollen, animal dander and food proteins. The source of the provoking foreign antigen can be plant, fungal, mold, or other environmental contaminant.
(21) Autoimmunity and Autoimmune Disorders and Diseases. Autoimmunity is defined as persistent and progressive immune reactions to non infectious self antigens, as distinct from infectious non self antigens from bacterial, viral, fungal, or parasitic organisms which invade and persist within mammals and humans. Autoimmune conditions include scleroderma, Grave's disease, Crohn's disease, Sjorgen's disease, multiple sclerosis, Hashimoto's disease, psoriasis, myasthenia gravis, Autoimmune Polyendocrinopathy syndromes, Type I diabetes mellitus (TIDM), autoimmune gastritis, autoimmune uveoretinitis, polymyositis, colitis, and thyroiditis, as well as in the generalized autoimmune diseases typified by human Lupus. “Autoantigen” or “self-antigen” as used herein refers to an antigen or epitope which is native to the mammal and which is immunogenic in said mammal disease.
(22) A patient with an autoimmune disease may be diagnosed as known to one of ordinary skill in the art. Such patients may be identified symptomatically and/or by obtaining a sample from a patient and isolating autoreactive T cells and comparing the level of autoreactive T cells in a patient to a control (see, U.S. Patent Application Publication No. 20060105336). For instance, type 1 diabetes may be identified by age of on-set and dependence on insulin injections to maintain glucose homeostasis.
(23) The response of a patient with an autoimmune disease to treatment may be monitored by determining the severity of their symptoms or by determining the frequency of autoreactive T cells in a sample from a patient with an autoimmune disease. The severity of symptoms of the autoimmune disease may correlate with the number of autoreactive T cells (see, U.S. Patent Application Publication No. 20060105336). In addition, an increase in the number of autoreactive T cells in the sample may be used as an indication to apply treatments intended to minimize the severity of the symptoms and/or treat the disease before the symptoms appear.
(24) “CD,” “cluster of differentiation” or “common determinant” as used herein refers to cell surface molecules recognized by antibodies. Expression of some CDs (e.g., CD4, CD8, CD25, CD127) is specific for cells of a particular lineage or maturational pathway, and the expression of others varies according to the state of activation, position, or differentiation of the same cells. Preferably, in some embodiments, the CD determinants are human when the isolated cells are to be administered to a human or a human immune response is being studied.
(25) As used herein, the term “CD127” refers to the “interleukin-7 receptor,” present on a Treg cell surface. The IL-7 receptor alpha chain is described in the literature. See, e.g., Goodwin et al. (1990) Cell 60:941-951; GenBank Accession Nos. NP.sub.-032398 and NP.sub.-002176. IL-7R is also referred to in the literature as CD127. (see
(26) As used herein, the term “CD4” refers to a cell-surface glycoprotein typically found on the mature helper T cells and immature thymocytes, as well as on monocytes and macrophages. On T cells, CD4 is the co-receptor for the T cell receptor (TCR) and recruits the tyrosine kinase 1ck. With its D1-portion, CD4 can attach to the β2-domain of MHC class II molecules. CD4.sup.+ refers to cells which stain brightly when contacted with labeled anti-CD4 antibody, and CD4.sup.− refers to cells of a type which stain the least brightly, dull or not at all, when contacted with a fluorescently labeled CD4 antibody. Generally, the cells are distinguished according to their CD4 expression levels based upon a readily discernible differences in staining intensity as the CD4 staining is clearly bimodal. In some embodiments, the frequency distribution of the CD4 staining is obtained for all the cells and the population curve fit to a higher staining and lower staining population, and cells assigned to the population to which they most statistically are likely to belong in view of a statistical analysis of the respective population distributions. In some embodiments, the CD4.sup.− cells stain two to three fold less intensely than the CD4.sup.+ cells. Particularly preferred methods are also exemplified in the Examples.
(27) Methods of segregating CD8 T cells into + and − categories are known to persons of ordinary skill in the art. In some embodiments, the frequency distribution of the CD8 staining is obtained for all the cells and the population curve fit to a higher staining and lower staining population, and cells assigned to the population to which they most statistically are likely to belong in view of a statistical analysis of the respective population distributions. In some embodiments, the CD8.sup.+ cells stain two to three fold more intensely than the CD8.sup.− cells. Particularly preferred methods are also exemplified in the Examples.
(28) As used herein, the term “CD25” refers to the alpha subunit of interleukin-2 receptor, a single-chain glycoprotein with a molecular weight of 55 kD. Following the activation of T cells with antigen or mitogen in the presence of the monokine interleukin-1, interleukin 2 (IL-2) is rapidly synthesised and secreted. In response to this, a subpopulation of T cells expresses high affinity receptors for IL-2. These cells proliferate, expanding the T cell population which is capable of mediating helper, suppressor and cytotoxic functions. IL-2 receptor is not uniquely found on T cells. CD25.sup.hi refers to cells which stain brightly when contacted with labeled anti-CD25 antibody, CD25.sup.+ refers to cells which stain less brightly when contacted with labeled anti-CD25 antibody, and CD25.sup.lo/− refers to cells which are of a type which stains the least brightly dull or null when contacted with a labeled CD25 antibody. Generally, the cells are distinguished according to their CD25 expression levels based upon differences in staining intensity as is known to one of ordinary skill in the art. In some embodiments, the cut off for designating a cell as a CD25 expression category hi, +, lo, or .sup.− cell can be set in terms of the fluorescent intensity distribution observed for all the cells. Generally, cells in the top 2, 3, 4, or 5% of staining intensity are designated “hi”, with those falling in the top half of the population categorized as being “+”. Those cells falling below 50%, of fluorescence intensity are designated as CD25.sup.lo cells and below 5% as CD25.sup.− cells. Suitable methods of identifying and categorizing regulatory T-cells with respect to their expression of CD25 are described further in Baecher-Allen (41), which is incorporated by reference with respect to same. Particularly preferred methods are also exemplified in the Examples.
(29) A CD127.sup.lo/− cell accordingly is of a type which stains the least brightly, dull or null when contacted with a labeled CD127 antibody. Most preferably, the CD127.sup.lo/− cells are FoxP3.sup.+ cells. In some embodiments the CD127.sup.lo/− cells are CD127.sup.− cells, CD4.sup.+CD127.sup.lo/− cells, CD25.sup.+CD4.sup.−CD127.sup.− cells, CD25.sup.−CD4.sup.+CD127.sup.− cells, CD25.sup.hi−CD4.sup.+CD127.sup.− cells, or CD25.sup.hi−CD4.sup.+CD127.sup.lo/− cells. The designation of a cell type with respect to its levels of expression of a recited biomarker or CD is meant to describe the cell being referenced by its biomarker expression phenotype and is not necessarily an indicator that expression levels were actually determined for the referenced cell. In preferred embodiments, the CD expression pattern of the CD127.sup.lo/− cell was determined only with respect to CD127.
(30) CD127.sup.lo/− regulatory T-cell populations for use according to the invention are cell populations which have been negatively selected for the CD127 biomarker. In some embodiments, the cells have been further characterized with respect to other CD determinants, particularly the CD4, CD8 and CD25 determinants (e.g., positively selected for with respect to CD4, CD8 and/or CD25). In other embodiments, the cells have been further characterized according to their expression of common determinants other than CD4 and/or CD25. In preferred embodiments, the cell populations are substantially the selected cell type.
(31) In some embodiments, the immunosuppressive T-cell inhibits the production of IL-2 or the proliferation of T-cells in an assay (e.g., MLR). These and other methods of assaying T cells for immunosuppressive activity are known to persons of ordinary skill in the art.
(32) As used herein, the term “sample” or “biological sample” refers to tissues or body fluids removed from a mammal, preferably human, and which contain regulatory T cells, including, but not limited to, FoxP3.sup.+ T cells and/or CD127.sup.lo/− regulatory T-cells. In some embodiments, the samples are taken from individuals with an immune response which needs to be suppressed. In some embodiments, the individual has an allergy, Graft vs. Host Disease, an organ transplant, or autoimmune disorder. Samples preferably are blood and blood fractions, including peripheral blood. The biological sample is drawn from the body of a mammal, such as a human, and may be blood, bone marrow cells, or similar tissues or cells from an organ afflicted with the unwanted immune response. Methods for obtaining such samples are well known to workers in the fields of cellular immunology and surgery. They include sampling blood in well known ways, or obtaining biopsies from the bone marrow or other tissue or organ. In preferred embodiments, the sample is a T-cell enriched sample in which the sample cells are substantially T-cells.
(33) Enriched T-cell samples refer to those samples or biological samples that have been enriched for T cells by positive selection of the T cells bearing the CD4 marker and/or positive selection of the CD8 marker by determining the levels of expression of the CD4 and CD8 markers, respectively. Other enriched T-cell samples have been enriched for T-cells by negative selection of (i.e., selecting against) non-T-cells which can be distinguished by their levels of expression of other common determinants exclusive of CD25. Most preferably, the enrichment of the sample for T-cells is not specifically according to their level of expression of CD25. Accordingly, in preferred embodiments, the enriched sample substantially comprises a regulatory T-cell population which comprises at least 2, 4, 6, 8, 10, 12, or 20% CD25.sup.+ cells or CD25.sup.lo or CD25.sup.− cells.
(34) “Inhibitors,” “activators,” and “modulators” of expression or of activity are used to refer to inhibiting, activating, or modulating cells, respectively, and are identified using in vitro and in vivo assays for expression or activity. The term “modulator” includes inhibitors and activators. A modulator can be an antibody or a soluble ligand which binds a protein of interest. Inhibitors are agents that, e.g., inhibit expression of a polypeptide or polynucleotide of the invention or bind to, partially or totally block stimulation or enzymatic activity, decrease, prevent, delay activation, inactivate, desensitize, or down regulate the activity of a polypeptide or polynucleotide of the invention, e.g., antagonists. Preferred modulators according to the invention, inhibit or suppress immune responses to an antigen or alloantigen. Assays to identify inhibitors and activators include, e.g., applying putative modulators to immune cells and then determining the functional effects of the cell on the immune response (e.g., MLR). Inhibitors or modulators are compared to control samples without the inhibitor or modulator to examine the extent of effect. Control samples (untreated with modulators) are assigned a relative activity value of 100%. Inhibition is achieved when the activity value of a polypeptide or polynucleotide of the invention relative to the control sample is about 80%, optionally 50% or 25 to 1%, or less. Activation is achieved when the activity value of a polypeptide or polynucleotide of the invention relative to the control sample is 110%, optionally 150%, optionally 200-500%, or 1000-3000%, or higher.
(35) The term “isolated” with regard to a population of cells as used herein refers to a cell population which either has no naturally-occurring counterpart or has been separated or purified from other components, including other cell types, which naturally accompany it, e.g., in normal or diseased tissues such as lung, kidney, or placenta, tumor tissue such as colon cancer tissue, or body fluids such as blood, serum, or urine. Typically, an isolated cell population is at least two-fold, four-fold, or eight-fold enriched for a specified cell type when compared to the natural source from which the population was obtained.
(36) A population or subpopulation of cells which is “substantially” of a specified cell type is one which has a count of the specified cell type which is at least 50%, 75%, 80%, 90%, 95% or, most preferably, 98% or 99% of the total cell count of the population or subpopulation or one which is at least two-fold, four-fold, eight-fold, ten-fold or 20-fold enriched for a specified cell type as compared to a source population of the specified cell type.
(37) An “anti-X antibody” or “X antibody” according to the invention is an antibody which can specifically bind to X. For instance, the anti-CD127 antibody or CD127 antibody is capable of binding CD127. The antibodies for use according to the invention include, but are not limited to, recombinant antibodies, polyclonal antibodies, monoclonal antibodies, chimeric antibodies, human monoclonal antibodies, humanized or primatized monoclonal antibodies, and antibody fragments. A great many lymphocyte biomarker specific antibodies are commercially available. These include anti-CD127, anti-CD4, and anti-CD25 antibodies.
(38) “Antibody” refers to a polypeptide comprising a framework region from an immunoglobulin gene or fragments thereof that specifically binds and recognizes an antigen. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively. Typically, the antigen-binding region of an antibody will be most critical in specificity and affinity of binding.
(39) An exemplary immunoglobulin (antibody) structural unit comprises a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one “light” (about 25 kD) and one “heavy” chain (about 50-70 kD). The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The terms variable light chain (V.sub.L) and variable heavy chain (V.sub.H) refer to these light and heavy chains respectively.
(40) Antibodies exist, e.g., as intact immunoglobulins or as a number of well-characterized fragments produced by digestion with various peptidases. Thus, for example, pepsin digests an antibody below the disulfide linkages in the hinge region to produce F(ab)′.sub.2, a dimer of Fab which itself is a light chain joined to V.sub.H-C.sub.H1 by a disulfide bond. The F(ab)′.sub.2 may be reduced under mild conditions to break the disulfide linkage in the hinge region, thereby converting the F(ab)′.sub.2 dimer into an Fab′ monomer. The Fab′ monomer is essentially Fab with part of the hinge region (see Fundamental Immunology (Paul ed., 3d ed. 1993). While various antibody fragments are defined in terms of the digestion of an intact antibody, one of skill will appreciate that such fragments may be synthesized de novo either chemically or by using recombinant DNA methodology. Thus, the term antibody, as used herein, also includes antibody fragments either produced by the modification of whole antibodies, or those synthesized de novo using recombinant DNA methodologies (e.g., single chain Fv) or those identified using phage display libraries (see, e.g., McCafferty et al., Nature 348:552-554 (1990)). In some embodiments, a high affinity ligand of a target may be used in place of the antibody.
(41) The phrase “specifically (or selectively) binds” to an antibody or “specifically (or selectively) immunoreactive with,” when referring to a protein or peptide, refers to a binding reaction that is determinative of the presence of the protein, often in a heterogeneous population of proteins and other biologics. Specific binding to an antibody under such conditions requires an antibody that is selected for its specificity for a particular protein. For example, polyclonal antibodies can be selected to obtain only those polyclonal antibodies that are specifically immunoreactive with the selected antigen and not with other proteins. This selection may be achieved by subtracting out antibodies that cross-react with other molecules.
(42) Preferably a “label” or a “detectable moiety” is covalently or noncovalently attached to the antibody. A label may be detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. Particularly useful labels are fluorescent dyes. Methods of attaching labels to antibodies are well known to those of ordinary skill in the art. Particularly preferred labels are those which are attached to the antibody by a linker which can be readily cleaved or separated or subject to hydrolysis by contact with a predetermined enzyme under physiological conditions. The antibody may also be conjugated with a magnetic particle, such as a paramagnetic microbead (Miltenyi Biotec, Germany). An activated T cell bound by a magnetically labeled antibody may be isolated using techniques including, but not limited to, magnetic cell sorting. Suitably labeled antibodies to CD127, CD4 and CD25, as well as many other CDs, are commercially available and known to one of ordinary skill in the art. The antibody may be labeled before or after contact with the sample or before or after contact with the CD. The CD antibody may be labeled by contacting with an a labeled antibody which binds to the CD-antibody.
(43) The term “test compound” or “candidate molecule” or “modulator” or grammatical equivalents as used herein describes any molecule, either naturally occurring or synthetic, e.g., protein, polypeptide, oligopeptide (e.g., from about 5 to about 25 amino acids in length, preferably from about 10 to 20 or 12 to 18 amino acids in length, preferably 12, 15, or 18 amino acids in length), small organic molecule, polysaccharide, lipid, fatty acid, polynucleotide, RNAi, oligonucleotide, etc. The test compound can be in the form of a library of test compounds, such as a combinatorial or randomized library that provides a sufficient range of diversity. Test compounds are optionally linked to a fusion partner, e.g., targeting compounds, rescue compounds, dimerization compounds, stabilizing compounds, addressable compounds, and other functional moieties. Conventionally, new chemical entities with useful immunosuppressive properties are generated by identifying a test compound (called a “lead compound”) with some desirable property or activity, e.g., inhibiting expression of CD127, upregulating expression of FoxP3, and creating variants of the lead compound, and evaluating the property and activity of those variant compounds. Often, high throughput screening (HTS) methods are employed for such an analysis.
(44) A “small organic molecule” refers to an organic molecule, either naturally occurring or synthetic, that has a molecular weight of more than about 50 Daltons and less than about 2500 Daltons, preferably less than about 2000 Daltons, preferably between about 100 to about 1000 Daltons, more preferably between about 200 to about 500 Daltons.
(45) “Determining the functional effect” refers to assaying for a compound that increases or decreases the expression of CD127. Such functional effects can be measured by any means known to those skilled in the art, e.g., changes in spectroscopic (e.g., fluorescence, absorbance, refractive index), hydrodynamic (e.g., shape), chromatographic, or solubility properties for the protein; measuring inducible markers or transcriptional activation of the protein; measuring binding activity or binding assays, e.g. binding to antibodies; measuring changes in ligand binding affinity; e.g., via chemiluminescence, fluorescence, colorimetric reactions, antibody binding, inducible markers, and ligand binding assays.
(46) Samples or assays for identifying immunosuppressive agents or drugs are conducted in the presence of the candidate inhibitor of CD127 expression and then the results are compared to control samples without the inhibitor to examine for the desired activity or to determine the functional effect of the candidate inhibitor. A positive reference control which is an agent having the desired activity may be used. Control samples (untreated with inhibitors) are assigned a relative of 100%. Inhibition is achieved when the activity value relative to the control is about 80%, preferably 50%, more preferably 25 to 1%, or even less (e.g., 0.2%, 0%).
(47) Discoveries and Findings
(48) We have discovered that CD127, even in the absence of CD25 selection, is an excellent marker of Tregs in human peripheral blood. The cell surface marker is expressed at low levels on an overwhelming majority of Tregs and distinguishes up to 20% of CD4.sup.+ T cells as potential Tregs. Moreover, the cell surface marker can be used, without determining the expression of levels of CD25 on the regulatory T-cells, to separate a suppressive T cell subset and will thus be a useful tool for the selection and expansion of T cell for diagnostics and therapeutic applications. Reliance upon the CD127 marker expression alone, has the advantage of convenience and can afford a substantially greater yield of FoxP3+ cells when compared to methods relying on, for instance positive selection of both the CD4 and CD25 biomarkers.
(49) As noted earlier, regulatory T cells (Treg) are critical regulators of immune tolerance. Most Treg are defined based on expression of CD4, CD25 and the transcription factor, FoxP3. Recent information has identified the importance of the gene Foxpro3 which is induced by thymus epithelium to cause T cells to develop CD25.sup.+CD4.sup.+ regulatory T cells, in animal models of autoimmune diseases. Deficiency of this gene may lead to wide spread autoimmune phenomena and diseases. However, these markers have proven problematic for uniquely defining this specialized T cell subset in humans. We have found that IL-7 receptor (CD127) is down-regulated on a subset of CD4.sup.+ regulatory T cells in peripheral blood. We demonstrate that the majority of these cells are FoxP3+, including those that express low levels or no CD25. A combination of CD4, CD25 and CD127 resulted in a highly purified population of Tregs accounting for significantly more cells that previously identified based on other cell surface markers. These cells were highly suppressive in functional suppressor assays. In fact, cells separated based solely on CD4 and CD127 expression were anergic and, although representing at least 3-times the number of cells (including both CD25.sup.+CD4.sup.− and CD25.sup.−CD4.sup.+ T cell subsets), were as suppressive as the “classic” CD4.sup.+CD25.sup.hi Treg subset. Finally, we show that CD127 can be used to quantitate Treg subsets in individuals with Type 1 diabetes supporting the use of CD127 as a biomarker for human Treg.
(50) In an effort to define new biomarkers of human Tregs, we have combined gene expression microarray, flow cytometry and function assays to identify new cell surface proteins that distinguish human Tregs. We observed that IL-7R (CD127) is downregulated on all human T cells after activation. In contrast to the reported re-expression of CD127 on the majority of effector and memory T cells (32-35), FoxP3.sup.+ T cells remain CD127.sup.lo/−. In fact, the CD127.sup.lo/−, FoxP3.sup.− T cells accounted for a significant percentage of CD4.sup.+ T cells in the peripheral blood. We demonstrate that FoxP3 interacts with the CD127 promoter and given its purported repressor function likely contributes to the reduced expression of CD127 in Tregs. Finally, we show that isolated CD4.sup.+CD127.sup.lo/− T cell subset is anergic and suppresses alloantigen responses in vitro. Together, these data suggest a dichotomy between memory T cells which are IL-2R.sup.loIL-7R.sup.hi and regulatory FoxP3.sup.+ T cells which in most instances up-regulate IL-2R while remaining IL-7R.sup.lo/− (30). Thus, the CD127 biomarker can be used to selectively enrich human Tregs for in vitro functional studies and in vivo therapy.
(51) Embodiments
(52) Accordingly, in a first aspect, the invention provides methods of identifying whether a regulatory T-cell is a suppressive regulatory T-cell by detecting only one cell surface antigen of the T-cell, CD127 in an enriched T cell sample. In some embodiments, the invention provides methods of determining whether a regulatory T-cell is highly likely to be a FoxP3.sup.+ suppressive T regulatory cell by detecting only one cell surface antigen of the T-cell, CD127 in an enriched T-cell sample. In preferred embodiments, the CD127.sup.lo/− cells are identified by contacting regulatory T-cells in the sample with fluorescently-labeled monoclonal antibodies which specifically bind to CD127.sup.+ and identifying cells having a reduced level of fluorescent label attached thereto. The CD127.sup.lo/− T-cells in large proportion are immunosuppressive or FoxP3.sup.+ cells. In further embodiments, the CD127.sup.lo/− T-cells are CD127.sup.− T-cells. In further embodiments, the invention provides methods of estimating the number of FoxP3 positive regulatory T-cells in a sample by detecting only one cell surface antigen of the T-cell, CD127. In other embodiments, the invention provides methods of identifying regulatory T-cells by identifying CD4.sup.+CD127.sup.lo/− T cells according to their level of expression of the CD4 and CD127 biomarkers in a biological sample. In some embodiments, the invention provides methods of identifying regulatory T-cells in a sample by identifying CD8.sup.+CD127.sup.lo/− T cells according to their level of expression of the CD8 and CD127 biomarkers.
(53) In a second aspect, the invention, provides methods of making an isolated population of an immunosuppressive regulatory T-cells which are substantially FoxP3.sup.+ by obtaining a biological sample comprising regulatory T-cells including, but not limited to, CD127.sup.lo/− and CD127.sup.+ cells and determining the level of expression of CD127, on the surface of the T-cells and isolating the immunosuppressive CD127.sup.Lo/− or CD127.sup.− T-cells from those T-cells which are CD127.sup.+. In some embodiments, the sample is an enriched T-cell sample. In some embodiments, the T-cell populations so made have at least 4, 8, 10, or 20% CD25.sup.+ and/or CD25.sup.− regulatory T cells. In some embodiments, the isolated population is obtained by providing an enriched T-cell sample and determining the level of expression of only one common determinant, CD127, on cells in the enriched sample and isolating CD127.sup.lo/− cells from the enriched T-cell sample. In some preferred embodiment, the isolated population is substantially CD8.sup.+CD127.sup.lo/− T cells and/or CD4.sup.+CD127.sup.lo/− T cells which are Fox 3.sup.+ cells.
(54) In a third aspect, the invention provides methods of making expanded populations of isolated immunosuppressive regulatory T-cell populations which are substantially FoxP3.sup.+ by expanding an isolated T-cell population obtained by the above methods. In some embodiments, the isolated FoxP3.sup.+ T cell population is expanded by contacting the isolated T-cells of the population with antigen, alloantigen, or anti-CD3/anti-CD28 antibodies in the presence of TGFbeta or rapamycin. Alternatively, in this aspect, the T-cells in the biological sample can first be expanded and then isolated by the above methods. In preferred embodiments of either approach, the expanded isolated immunosuppressive T-cell populations comprise at least 2, 4, 8, 10, or 20% CD25.sup.− and or CD25.sup.+ T regulatory cells. In preferred embodiments, the CD127.sup.lo/− cells are identified by contacting regulatory T-cells in the sample with fluorescently-labeled monoclonal antibodies which specifically bind to CD127.sup.+ and sorting the regulatory T-cells according to their level of expression of CD127 using a fluorescently activated cell sorter (FACS). In some preferred embodiment, the isolated expanded population is substantially CD8.sup.+CD127.sup.lo/− T cells and/or CD4.sup.+CD127.sup.lo/− T cells which are FoxP3.sup.− cells.
(55) In yet another aspect the invention provides methods of modulating an immune response in a subject, wherein the isolated or expanded, isolated immunosuppressive regulatory T-cell populations obtained by the above methods are administered to the subject. The biological sample from which the regulatory T-cells are obtained may be autologous in that the biological sample itself was obtained from the subject to be treated. The subject can be any mammal (e.g., human, primate) in which modulation of an immune reaction is desired. In some embodiments, a human or mammalian subject has immune disorder, disease or condition or an autoimmune disease to be treated. There are numerous, established animal models for using T cell epitopes of autoantigens to induce tolerance, including multiple sclerosis (EAE: experimental autoimmune encephalomyelitis), myasthenia gravis (EMG: experimental myasthenia gravis) and neuritis (EAN: experimental autoimmune neuritis). In another embodiment, the subject is a human afflicted with an autoimmune disease or disorder, such as any of the diseases/disorders listed in Table A.
(56) In still another aspect, the invention provides, pharmaceutical compositions comprising isolated or expanded immunosuppressive FoxP3.sup.+ T-cell populations obtained according to the above methods.
(57) In another aspect, the invention provides methods for producing an antigen-specific regulatory T cell enriched composition, and resultant compositions and methods of use. In one embodiment, the invention provides a method of modulating an immune reaction in a subject, said method comprising (a) obtaining a population of subject-compatible cells including CD4.sup.+ and CD4.sup.− cells and CD127.sup.+ and CD127.sup.− cells and CD25.sup.+ and CD25.sup.− cells; (b) producing an antigen-specific regulatory CD127.sup.lo/− or FoxP3.sup.+ T cell enriched composition from said population of cells by sorting the cells solely on the basis of the CD127 antigen, and (c) introducing said composition into said subject to modulate said immune reaction in said subject. In some preferred embodiments, the immune response is an autoimmune response and the antigen is an autoantigen. In other embodiments, the immune response is a graft vs. host immune response and the antigen is an autoantigen. In other embodiments, the immune response is allergy, asthma, tissue or organ transplant rejection, or a graft vs. host immune response and the antigen is a purified or unpurified component of the allergen or transplanted tissue or organ provoking the harmful immune response. In preferred embodiments of any of the above, as the enriched composition was not directly selected for on the basis of the presence or absence of CD25 biomarker on the cells, the enriched composition comprises at least 2%, 4%, 6%, 8%, 10% or 20% of CD25.sup.− cells.
(58) In yet further embodiments of any of the above aspects, the selection is not based solely on the determining of the expression level of the CD127 biomarker, but can include determining the expression levels of secondary T-cell surface antigen biomarkers or common determinants, including the CD4, and CD8 and CD25 biomarkers. In some such further such embodiments, there is a proviso that no secondary T-cell surface antigen biomarker used isolating the cells is CD4. In still further other embodiments, there is a proviso that no secondary T-cell surface antigen used in isolating the cells is CD25. In some such further embodiments, there is a proviso that no secondary T-cell surface antigen biomarker is CD4 or CD25. In further embodiments of any of the above aspects, the selection is not based solely on the expression level of the CD127 biomarker, but can include T-cell expression levels of the CD25 biomarker. In some other embodiments of any of the above aspects, the selection is not based solely on the expression level of the CD127 biomarker, but can include T-cell expression levels of the CD4 biomarker. In still some further embodiments of the above, the selection is not based solely on the expression level of the CD127 biomarker, but can include T-cell expression levels of both the CD4 biomarker and CD25 biomarkers. Generally, in these embodiments, the CD4 and CD25 biomarkers are positively selected for and the CD127 biomarker is negatively selected for. To enhance enrichment, positive selection may be combined with selection against cells comprising surface makers specific to non-regulatory T-cell types, such as depletion of CD8, CD11b, CD16, CD19, CD36 and CD56-bearing cells as known to one or of ordinary skill in the art. Accordingly, the selection in any of the above embodiment be practiced on an enriched T-cell sample.
(59) In accordance with these further embodiments, the invention also provides methods for producing an antigen-specific regulatory T cell enriched composition, and resultant compositions and methods of use. In one embodiment, the invention provides a method of modulating an immune reaction in a subject, said method comprising (a) obtaining a population of subject-compatible cells containing CD4.sup.− and CD4.sup.− cells and CD127.sup.+ and CD127.sup.− cells and CD25.sup.+ and CD25.sup.− cells; (b) producing an antigen-specific regulatory CD4+CD127.sup.lo/− T cell enriched composition from said population of cells and (c) introducing said composition into said subject to modulate said immune reaction in said subject. In some preferred embodiments, the immune response is an autoimmune response and the antigen is an autoantigen. In other embodiments, the immune response is a graft vs. host immune response and the antigen is an autoantigen. In other embodiments, the immune response is allergy, asthma, tissue or organ transplant rejection, or a graft vs. host immune response and the antigen is a purified or unpurified component of the allergen transplanted tissue or organ provoking the immune response. In preferred embodiments of any of the above, the enriched composition was not directly selected for on the basis of the presence or absence or expression of CD25 biomarker on the cells. In some embodiments, accordingly, the enriched composition comprises at least 2%, 4%, 6%, 8%, 10% or 20% of CD25.sup.− or CD25.sup.+ cells. In some embodiments, the enriched composition was also enriched for CD25.sup.+ cells by sorting the cells on the basis of the presence or absence of the CD25 biomarker on the cells.
(60) In still a further aspect, the invention provides kits comprising materials specifically useful in performing the above methods.
(61) In still another aspect, the invention provides methods for identifying immunosuppressive drugs by determining their effect on only one T-cell surface marker, CD127, or on a plurality of markers including CD127 and optionally one or the other or both of CD4 and CD25. Drugs which are immunosuppressive reduce the number of CD127.sup.lo/− cells in a sample T-cell population when contacted with a sample of such cells as compared to a suitable control sample contacted with vehicle or a non-immunomodulatory substance.
(62) In some embodiments, the invention further provides, an isolated population of regulatory T cells which are substantially CD4.sup.+ and CD127.sup.lo/−. In other embodiments, the Treg cells were isolated from a sample comprising the CD4.sup.+ and CD127.sup.lo/− Treg cells and further comprising CD4.sup.− cells and CD127.sup.+ Treg cells by sorting the cells in the sample according to their expression of the CD4 biomarker and according to their expression of the CD127 biomarker. In some further embodiments, the isolated population is obtained by contacting a sample containing Treg cells with a labeled antibody specific for the CD4 biomarker and with a labeled antibody specific for the CD127 biomarker to identify Treg cells which are CD4.sup.+ and CD127.sup.lo/−, and isolating the identified cells. In some embodiments, the CD4 antibody and the CD127 antibody are each labeled with a different label. In further such embodiments, the CD4 antibody label and the CD127 antibody label are each a fluorescent label. In some further embodiments of any of the above, the sample is not contacted with an antibody specific for the CD25 biomarker or for the CD4 biomarker, or both. Preferably, the CD4.sup.+ and CD127.sup.lo/− cells are identified and isolated in a fluorescence activated cell sorter. In some embodiments, of any of the above, the sample is a sample of peripheral blood. Preferably, in some embodiments, at least 2, 4, 8, 10, or 20% of the CD4.sup.+ CD127.sup.lo/− T-cells, of the population are also CD25.sup.lo/− or CD25.sup.−. In other embodiments, the isolated population of Treg cells are substantially CD4.sup.+ and CD127.sup.−.
(63) In some embodiments, the invention further provides, an isolated population of regulatory T cells which are substantially CD8.sup.+ and CD127.sup.lo/−. In other embodiments, the Treg cells were isolated from a sample comprising the CD8.sup.+ and CD127.sup.lo/− Treg cells and further comprising CD8.sup.− cells and CD127.sup.+ Treg cells by sorting the cells in the sample according to their expression of the CD8 biomarker and according to their expression of the CD127 biomarker. In some further embodiments, the isolated population is obtained by contacting a sample containing Treg cells with a labeled antibody specific for the CD8 biomarker and with a labeled antibody specific for the CD127 biomarker to identify Treg cells which are CD8.sup.+ and CD127.sup.lo/−, and isolating the identified cells. In some embodiments, the CD8 antibody and the CD127 antibody are each labeled with a different label. In further such embodiments, the CD8 antibody label and the CD127 antibody label are each a fluorescent label. In some further embodiments of any of the above, the sample is not contacted with an antibody specific for the CD25 biomarker or for the CD8 biomarker, or both. Preferably, the CD8.sup.+ and CD127.sup.lo/− cells are identified and isolated in a fluorescence activated cell sorter. In some embodiments, of any of the above, the sample is a sample of peripheral blood. Preferably, in some embodiments, at least 2, 4, 8, 10, or 20% of the CD8.sup.+CD127.sup.lo/− T-cells, of the population are also CD25.sup.+− or CD25.sup.−. In other embodiments, the isolated population of Treg cells are substantially CD8.sup.+ and CD127.sup.−.
(64) In other embodiments, the invention provides an expanded, isolated population of Treg cells which are substantially CD4.sup.+ and CD127.sup.lo/− or CD8.sup.+ and CD127.sup.lo/− wherein said expanded population is obtained by contacting the isolated population as described above with alloantigen or anti-CD3/anti-CD28 antibodies in the presence of IL2 plus TGFbeta or rapamycin.
(65) In other embodiments, the invention provides a pharmacological composition comprising isolated cell populations obtained as described above. In related embodiments, the invention provides for the use of a population of any one of the above claims in the manufacture of a medicament for suppressing the immune response in a subject in need thereof. The subject can have an immune disease or disorder, an autoimmune disease, a graft versus host reaction, an organ transplant, asthma, or allergy. In particular embodiments, the subject has Type I diabetes.
(66) Further in view of the above, the invention provides a method of obtaining a population of anergic Treg cells, said method comprising obtaining a sample containing Treg cells and sorting the cells according to the absence or presence of the CD127 biomarker, the CD4 biomarker and/or the CD8 biomarker, and optionally the CD25 biomarker. In further such methods the anergic Tregs are substantially FoxP3.sup.+ cells.
(67) In yet other embodiments within this view, the invention provides a method of obtaining an expanded population of anergic T-cells, said method comprising the step of obtaining a sample containing Treg cells, expanding a CD4.sup.+CD127.sup.lo/− Treg or CD4.sup.8CD127.sup.lo/− Treg cell population therein and sorting the cells according to the absence or presence or level of expression of the CD127 and CD4 or CD8 biomarkers wherein the suppressive T.sup.− cell subset consists substantially of the expanded population of CD8.sup.+CD127.sup.lo/− Treg or CD4.sup.+CD127.sup.lo/− T-cells. In some further embodiments, the cells of the expanded population are not further sorted with respect to the presence of absence of the CD25 biomarker and the suppressive T.sup.− cell subset consists substantially of CD4.sup.+CD127.sup.lo/− T-cells, with at least 2% of the CD4.sup.−CD127.sup.lo/− T-cells, being CD25.sup.−. In other embodiments, if sorted according their level of CD25 expression, CD25.sup.+ cells in addition to Cd25.sup.hi cells are positively selected for.
(68) In yet other embodiments within this view, the invention provides a method of obtaining an expanded population of anergic T-cells, said method comprising the step of obtaining an enriched T-cell sample and isolating and expanding or expanding and isolating a CD127.sup.Lo/− Treg cell population therein. In some further embodiments, the cells of the expanded population are not further sorted with respect to the presence of absence of the CD25 biomarker and the suppressive T-cell subset consists substantially of CD4.sup.+CD127.sup.lo/− T-cells, with at least 2% of the CD4.sup.−CD127.sup.lo/− T-cells, being CD25.sup.−. In other embodiments, if sorted according their level of CD25 expression, CD25.sup.+ cells in addition to Cd25.sup.hi cells are positively selected for.
(69) In another embodiment with this view, the invention provides a method of obtaining an expanded population of anergic T-cells, said method comprising the step of obtaining a sample containing Treg cells, sorting the cells according to the absence or presence of the CD127 and CD4 or CD8 biomarkers to obtain an isolated population of CD4.sup.+CD127.sup.lo/− Treg cells and expanding the isolated population of CD4.sup.+CD127.sup.lo/− Treg cells to obtain the expanded population of anergic T-cells. In yet other embodiments of such, the cells of the expanded population are not further sorted with respect to the presence of absence of the CD25 biomarker and the suppressive T.sup.− cell subset consists substantially of CD4.sup.+CD127.sup.lo/− T-cells, with at least 2% of the CD4.sup.−CD127.sup.lo/− T-cells, being CD25.sup.−.
(70) Methods of Modulating an Immune Reaction Using Expanded Populations of CD127.sup.lo/− Tregs.
(71) In another aspect, the invention provides methods for producing an antigen-specific regulatory T cell enriched composition, and resultant compositions and methods of use. In one embodiment, the invention provides a method of modulating an immune reaction in a subject, said method comprising (a) obtaining a population of subject-compatible cells containing CD4.sup.+ and CD4.sup.− cells and CD127.sup.+ and CD127.sup.− cells and CD25.sup.+ and CD25.sup.− cells; (b) producing an antigen-specific regulatory CD127.sup.lo/− T and/or FoxP3.sup.− cell enriched composition from said population of cells by use of methods described above and (c) introducing said composition into said subject to modulate said immune reaction in said subject. In some preferred embodiments, the immune response is an autoimmune response and the antigen is an autoantigen. In other embodiments, the immune response is a graft vs. host immune response and the antigen is an autoantigen. In other embodiments, the immune response is allergy, asthma, tissue or organ transplant rejection, or a graft vs. host immune response and the antigen is a purified or unpurified component of the allergen transplanted tissue or organ provoking the immune response. In preferred embodiments of any of the above, the enriched composition was not directly selected for on the basis of the presence or absence of CD25 biomarker on the cells. In some embodiments, accordingly, the enriched composition comprises at least 2%, 4%, 6%, 8% of CD25.sup.− cells. In some embodiments, the enriched composition was also enriched for CD25.sup.+ cells by sorting the cells on the basis of the presence or absence of the CD25 biomarker on the cells.
(72) In particular embodiments, the population of cells is obtained from said subject, obtained from a donor distinct from said subject, and/or harvested from peripheral blood. The population of cells obtained comprises antigen or autoantigen-specific regulatory T (Treg) cells, and may be derived from any source in which antigen or autoantigen-specific Treg cells exist, such as peripheral blood, the thymus, lymph nodes, spleen, and bone marrow. In certain embodiments, the source of Treg cells may be from cadaveric tissue.
(73) In other embodiments, the producing step comprises expanding said antigen-specific regulatory T cells, and/or enriching the antigen-specific regulatory T cells from said obtained population of cells.
(74) In some embodiments, the expanding is achieved by contacting said population of cells with an antigen-specific regulatory T cell stimulatory composition.
(75) In particular embodiments, the isolated CD127.sup.lo/−, CD4.sup.+CD127.sup.lo/− and/or FoxP3.sup.+ T cells are isolated from said population of cells prior to said expanding step, or after said expanding step. In some embodiments, accordingly, the isolated cells comprise at least 2%, 4%, 6%, 8% of CD25.sup.− cells.
(76) In particular embodiments, the stimulatory composition comprises an MHC class II/autoantigenic peptide complex, a co-stimulatory agent or a second regulatory T cell stimulatory agent. In other embodiments, the isolated CD127.sup.lo/−, CD4.sub.+CD127.sup.lo/− cells with or without the inclusion of CD25 as an additional positive selection marker are isolated from said population of cells prior to said expanding step, or after said expanding step.
(77) In yet another embodiment, the co-stimulatory agent is an agonist antibody (e.g., an agonist antibody which binds to CD28). In still another embodiment, the second stimulating agent is a cytokine, (e.g, an interleukin, (e.g., interleukin-2)). In some embodiments, the co-stimulatory agent is an agonist antibody (e.g., an agonist antibody which binds to CD28 in the presence or absence of a second stimulating agent which can be a cytokine (e.g., an interleukin, interleukin-2).
(78) In particular embodiments, the stimulatory composition is immobilized on a substrate, such as a cell or bead.
(79) The invention also provides compositions comprising a population of cells wherein the cells are substantially antigen- or auto-antigen specific regulatory CD127.sup.lo/−, CD4.sup.+CD127.sup.lo/− T-cells and/or FoxP3.sup.+ T-cells which comprise at least 2, 4, 6, 8, or 10% of CD25.sup.− T cells.
(80) The invention also provides compositions comprising a population of cells wherein the cells are substantially antigen- or auto-antigen specific regulatory CD127.sup.lo/−, CD8.sup.+CD127.sup.lo/− T-cells and/or FoxP3.sup.+ T-cells which comprise at least 2, 4, 6, 8, or 10% of CD25.sup.− T cells.
(81) In particular embodiments, autoantigen-specific regulatory T cells are specific for peptides presented in MHC class II molecules including those shown in Table A. In other embodiments, the autoantigen-specific regulatory T cells are effective at modulating an autoimmune reaction when administered to a subject.
(82) TABLE-US-00001 TABLE A MHC class II molecule/peptide(s) Autoimmune disease Autoantigen bound (SEQ ID NO:) Lupus erythematosus giantin golgin-245/p230 golgin-160/GCP170 golgin-95/GM130 golgin-97 golgin-67 transferrin 119-VVKKGTDFQLNQLEGKK (3) 119-VVKKGTDFQLNQLGKK (4) [see Freed et al., J. Immunol. (2000) 164: 4697-4705 A.sub.β.sup.k (37-51 major; YVRFDSDVGEYRAVTE (5) (37-52 minor) Lysozyme c (48-63) GDQSTDYGIFQINSRY (6) nucleoporin NUP155 RQVRFYSGVIEL (7) (120-) Saposin D (37-) LPDPYQKQCDDFVAE (8) 26S proteasome IFLDDPQAVSDVL (9) p112 (224-) 14-3-3 protein β, δ, KTAFDEAIAELD (10) ζ, θ, or τ (95-) A.sub.β.sup.k (146-) STQLIRNGDWTFQVLVMLEM (11) (110-) HHNTLVCSVTDFYPAKIKVR (12) Ig γ 1-chain (141-) SMVTLGCLVKGYFPEPVTVT (13) Thrombocytopenic GPIIb/IIIa HLA-DR purpura (Kuwana et al., J Clin Invest. 1998 Oct 1;102(7); 1393-402) platelet integrin Goodpasture's human glomerular syndrome basement membrane Graves disease thyroglobulin thyroperoxidase sodium-iodide symporter TSH receptor Type I diabetes Insulin, proinsulin DQ0601/insulin B ss5-15 mellitus aa1-15: FVNQHLCGSHLVEAL (14) (see Ettinger and Kwok, J. Immunol. 1998 Mar 1; 160(5):2365-73) HLA-DR3 glutamic acid HLA-DR4 (DRB1*0401)/271-285 decarboxylase (PRLIAFTSEHSHFSL) (15), (GAD65) 116-130 (NILLQYVVKSFDRST) (16); HLA-DR4 (DRA1*0101)/356-370 (KYKIWMHVDAAWGGG) (17), 376- 390 (KHKWKLNGVERANSV) (18), 481-495 (LYNIIKNREGYEMVF) (19), 511-525 (PSLRVLEDNEERMSR) (20), 546-560 (SYQPLGDKVNFFRMV) (21), 556-570 (FFRMVISNPAATHQD) (22), and 566-580 (ATHQDIDFLIEEIER) (23); HLA-DQ8/206-220 (TYEIAPVFVLLEYVT) (24) (see Peng, Y. Chin Med J 2001; 114(10):229-242) tyrosine phosphatase IA-2 tyrosine phosphatase 2b IGRP Human protein: Q9UN79- SOX-13 protein (Type 1 diabetes autoantigen ICA12) (Islet cell antigen 12). ICA69 Mysasthenia gravis Gravin muscle nicotinic 121-126 (PAIFKSYCEIIVTHFP) (25), acetylcholine 129-145 (EIIVTHFPFDEQNCSMK) receptor (AChR) (26) [see J Immunol 159(3):1570-7] p195-212 (DTPYLDITYHFVMQRLPL) (27) [see Scand J Immun. 44(5):512-21] Pemphigus vulgaris desmoglein 1, desmoglein 3, Human desmocollin 1 (Dsc1) bullous pemphigoid BP 180 Autoimmune Formiminotransferase hepatitis cyclodeaminase Autoimmine atrophic parietal cell H,K- corpus gastritis adenosine triphosphatase (ATPase) Addison's diesease CYP21 CYP17 CYP11A1 Rheumatoid arthritis endoplasmic reticulum molecular chaperone immunoglobulin binding protein (BiP) human cartilage HLA-DR4 (DRB1*0401)/aa259-271 glycoprotein-39 (PTFGRSFTLASSE) (28) (YKL40) (see Vos et al, Rheumatology (2000) 39:1326-1331) type II collagen glucose-6-phosphate isomerase Multiple sclerosis alpha β-Crystallin DRB1*1501 myelin HLA-DR4(DRB1*0401)/97-108 oligodendrocyte (TCFFRDHSYQEE) (29) glycoprotein (MOG) (see Forsthuber et al, J Immunol. 2001 Dec 15; 167(12):7119-25) Myelin basis protein 111-119 (SLSRFSWGA) (30) and 87-95 (MBP) (VVHFFKNIV) (31) presented in HLA- A2 and HLA-A24) [see JI, 172(8):5120-7] X2MBP Psoriasis Cytokeratin 17 cutaneous lymphocyte antigen (CLA) Autoimmune anion channel 861-874 (CLAVLWVVKSTPAS) (32) hemolytic anemia protein band 3 [see Blood 15;102(10):3800-6] Uveitis S-antigen 341-354 (FLGELTSSEVATEV) (33) [see Int. Immun., 15(8):927-935] interphotoreceptor retinoid-binding protein (IRBP) HLA-B(B27PD) 125-138 ALNEDLSSQTAADT (34) [see Int. Immun., 15(8):927-935]
(83) The invention also provides kits for producing a composition of antigen-specific and antigen non-specific regulatory T cells. The kit can include (a) CD127 antibody, (b) an antigen-specific or non-specific T cell receptor stimulatory agent; and (c) a costimulatory agent. In particular embodiments, the stimulatory agent is an MHC class II/autoantigenic peptide complex. In some embodiments, the costimulatory agent is an agonist antibody, such as an antibody which binds to CD28. The kit may further comprise a second regulatory T cell stimulating agent, such as a cytokine, such as an interleukin, such as interleukin-2 or interleukin-15. The stimulatory agent and said costimulatory agent can be immobilized on a substrate, such as a cell or bead in some embodiments. The kit may also contain a CD4 antibody and/or a CD25 antibody. The antibodies preferably are fluorescently or magnetically labeled and monoclonal. The kit preferably will also contain instructions as to how to isolate CD127.sup.lo/− cells and how to store or formulate them for in vitro or in vivo use. Such kits may also provide instructions as to how to select for the CD127.sup.lo/− cells using a CD127 antibody. In some embodiments, there is a proviso that the kit does not have means for detecting the CD25 marker.
(84) The invention provides methods and compositions for ex vivo expansion of therapeutic regulatory T cells, and resultant compositions and methods of use. The expansion methods generally comprise the steps of: isolating from a mixed population of T cells a subpopulation enriched in CD127.sup.lo/ T cells (Treg cells) by sorting the cells according to the presence or absence or expression of biomarkers as set forth above; expanding the Treg cells of the subpopulation by contacting the subpopulation with effective amounts of (i) a TCR/CD3 activator (ii) a TCR costimulator activator and (iii) IL-2, to obtain ex vivo expanded Treg cells, wherein the expanded Treg cells demonstrate immune suppression, wherein the isolating step is typically prefaced by extracting the population from a person or patient, typically suffering or in remission from an autoimmune or other immune (e.g., graft vs. host disease, asthma, allergy, transplant rejection) disease amenable to therapy as described herein. In some embodiments, the isolating from a mixed population of T cells of a subpopulation enriched in CD4.sup.+CD127.sup.lo/− T cells (Treg cells) by sorting the cells according to the presence or absence or expression level of the CD127 biomarkers is performed without regard to the presence or absence of CD25 or CD4 on the cells. In other embodiments, the Treg cells are also enriched for CD25.sup.+ cells by selection according to the absence or presence of the CD25 biomarker.
(85) In particular embodiments, the subpopulation comprises greater than 90, 95, 98 or 99% CD127.sup.lo/− Treg cells; the isolation step comprises both negative and positive immuno-selection and cell sorting; preferably the expanding step effects at least a 100-fold expansion of the subpopulation; the TCR/CD3 activator is a multivalent antibody or ligand for TCR/CD3; the TCR costimulator activator is a multivalent antibody or ligand for CD28, GITR, B7-1/2, CD5, ICOS, OX40 or CD40; the effective amount of IL-2 is 200 to 2500 IU IL-2/ml; and/or the Treg cells suppress proliferation of anti-CD3 or alloantigen stimulated CD25.sup.− T cells in vitro, or allergic immunity or autoimmunity, including graft-versus-host disease in vivo.
(86) In more particular embodiments:
(87) an effective amount of the ex vivo expanded Treg cells is introduced into the patient diagnosed with diabetes mellitus and presenting an indication of impaired glucose homoeostasis selected from fasting plasma glucose (FPG), post-prandial glucose (PPG), and glucose tolerance (GTT) and the introduction provides a resultant improvement in the impaired glucose homoeostasis, wherein the improvement is preferably selected from an FPG of 110 mg/dL or less, a 2-hour PPG of 140 mg/dL or less, and a GTT of 140 mg/dL or less 2 hours after a 75-g glucose load;
(88) the TCR/CD3 activator is an anti-CD3 antibody, and the TCR costimulator activator is an anti-CD28 antibody, wherein the anti-CD3 and anti-CD28 antibodies are immobilized on paramagnetic beads provided in a Treg cell:bead ratio of between 1:1 and 1:2;
(89) the TCR/CD3 activator and the expanded Treg cells are antigen-specific, preferably wherein the TCR/CD3 activator is an MHC-peptide multimer, wherein the peptide is a diabetes-associated autoantigen peptide and the diabetes-associated autoantigen is selected from glutamic acid decarboxylase (GAD), an islet cell autoantigen (ICA) and insulin, and the TCR costimulator activator is an anti-CD28 antibody.
(90) The invention also provides methods and compositions for adoptive cellular immunotherapy comprising the step of introducing into a patient in need thereof an effective amount of the subject ex vivo expanded CD4.sup.+CD127.sup.lo/− or CD4.sup.+FoxP3.sup.+ Treg cells or CD127.sup.lo/− or FoxP3.sup.+ Treg cells. These methods generally comprise the steps of: extracting a mixed population of T cells from a person; isolating from the population a subpopulation enriched in CD127.sup.lo/− regulatory T-cells; expanding the regulatory T-cells of the subpopulation by contacting the subpopulation with effective amounts of (i) a TCR/CD3 activator, (ii) a TCR costimulator activator, and (iii) IL-2, to obtain ex vivo expanded regulatory T-cells; introducing into a patient an effective amount of the ex vivo expanded regulatory T-cells; and detecting a resultant suppression of autoimmunity.
(91) In particular embodiments, the person and patient is a patient diagnosed with diabetes mellitus and presenting an indication of impaired glucose homoeostasis selected from fasting plasma glucose (FPG), post-prandial glucose (PPG), and glucose tolerance (GTT); the subpopulation comprises >98% Treg cells; the subpopulation comprises >98% CD4.sup.+CD127.sup.lo/− Treg cells; the isolation step comprises negative and positive immuno-selection and cell sorting; the expanding step effects at least a 100-fold expansion of the subpopulation; the TCR/CD3 activator is selected from a multivalent antibody or ligand for TCR/CD3; the TCR costimulator activator is a multivalent antibody or ligand for CD28, GITR, CD5, ICOS, OX40 or CD40L; the effective amount of IL-2 is 200 to 2500 IU IL-2/ml; the Treg cells suppress proliferation of anti-CD3 or alloantigen stimulated CD25.sup.-T cells, and/or the resultant suppression of autoimmunity is detected as a resultant improvement in the impaired glucose homoeostasis.
(92) In more particular embodiments:
(93) the improvement is selected from an FPG of 110 mg/dL or less, a 2-hour PPG of 140 mg/dL or less, and a GTT of 140 mg/dL or less 2 hours after a 75-g glucose load;
(94) the TCR/CD3 activator is an anti-CD3 antibody, and the TCR costimulator activator is an anti-CD28 antibody, wherein the anti-CD3 and anti-CD28 antibodies are immobilized on paramagnetic beads provided in a Treg cell:bead ratio of between 1:1 and 1:2; and/or the TCR/CD3 activator is an MHC-peptide multimer, wherein the peptide is a diabetes-associated autoantigen peptide and the diabetes-associated autoantigen is selected from glutamic acid decarboxylase (GAD), an islet cell autoantigen (ICA) and insulin, and the TCR costimulator activator is an anti-CD28 antibody.
(95) The population of cells may be obtained from the subject into which the isolated or isolated and expanded Treg-enriched composition is subsequently introduced. The subject can be any mammal in which modulation of an autoimmune reaction is desired. Mammals of interest include, but are not limited to: rodents, e.g. mice, rats; livestock, e.g. pigs, horses, cows, etc., pets, e.g. dogs, cats; and primates, e.g. humans. In one embodiment, the subject is an animal model of an autoimmune disease. There are numerous, established animal models for using T cell epitopes of autoantigens to induce tolerance, including multiple sclerosis (EAE: experimental autoimmune encephalomyelitis), myasthenia gravis (EMG: experimental myasthenia gravis) and neuritis (EAN: experimental autoimmune neuritis). In another embodiment, the subject is a human afflicted with an autoimmune disease or disorder, such as any of the diseases/disorders listed in Table A.
(96) In an alternate embodiment, the population of cells is obtained from a donor distinct from the subject. The donor is preferably syngeneic, but can also be allogeneic, or even xenogeneic provided the cells obtained are subject-compatible in that they can be introduced into the subject, optionally in conjunction with an immunosuppressive therapy, without resulting in extensive chronic graft versus host disease (GvHD). Allogeneic donor cells are preferably human-leukocyte-antigen (HLA)-compatible, and are typically administered in conjunction with immunosuppressive therapy. To be rendered subject-compatible, xenogenic cells may be subject to gamma irradiation or PEN10 treatment (Fast, L D et al, Transfusion. 2004 February; 44(2):282-5).
(97) The producing step can provide a predetermined antigen- or autoantigen-specific regulatory T cell enriched composition from said population of cells, preferably specific for a predetermined antigen or autoantigen associated with the targeted allergic or autoimmune reaction, preferably predetermined to be associated with the targeted allergic or autoimmune reaction. In particular embodiments, the producing step comprises expanding said antigen-specific regulatory T cells, and/or enriching said autoantigen-specific regulatory T cells from said obtained population of cells.
(98) An antigen or autoantigen-specific regulatory T (Treg) cell enriched composition is one in which the percentage of antigen or autoantigen-specific CD127.sup.lo/− Treg cells is higher than the percentage of antigen or autoantigen-specific CD127.sup.lo/− Treg cells in the originally obtained population of cells. In particular embodiments, at least 75%, 85%, 90%, 95%, or 98% of said cells of the composition are antigen or autoantigen-specific regulatory T cells. In particular embodiments, the producing step comprises expanding the antigen-specific regulatory CD127.sup.lo/− T cells, and/or enriching said autoantigen-specific regulatory CD127.sup.lo/− T cells from said obtained population of cells. In some embodiments, the composition is further enriched by positive selection for CD4 and/or CD25 biomarkers.
(99) In particular embodiments, the regulatory CD127.sup.lo/− T cells are enriched from said population of cells prior to said expanding step, or after said expanding step. CD127.sup.lo/− Treg cells can be enriched by targeting for selection of cell surface markers specific for immune suppressive CD127.sup.lo/− Tregs and separating using automated cell sorting such as fluorescence-activated cell sorting (FACS), solid-phase magnetic beads, etc, as is known to one of ordinary skill in the art (see, U.S. Patent Application Publication No. 2005/0186207) which is assigned to the same assignee as the present invention and incorporated by reference in its entirety. To enhance enrichment, positive selection for T-reg cells may be combined with selection against cells comprising surface makers specific to non-Treg cell types, such as depletion of CD8, CD11b, CD16, CD19, CD36 and CD56-bearing cells as known to one or of ordinary skill in the art.
(100) In particular embodiments, the expanding is achieved by contacting the population of cells with an antigen- or autoantigen-specific regulatory CD127.sup.lo/− T cell stimulatory composition. The antigen or autoantigen-specific regulatory CD127.sup.lo/− T cells are preferably expanded at least 50-fold, and preferably at least 100, 200, 300, 500 and 800-fold. Antigen and autoantigen-specific regulatory CD127.sup.lo/− T cell stimulatory compositions promote the survival, growth, and/or expansion of the antigen or autoantigen-specific regulatory CD127.sup.lo/− T cells that express T cell receptor(s) that recognize the desired antigen or autoantigen.
(101) Preferred stimulatory compositions stimulate the CD127.sup.lo/− T cell by antigen-specifically binding and activating the T cell receptor complex. A variety of antigen-specific TCR-binding reagents may be used, including cross-linked peptide-bound MHC molecules, antibodies, and mimetics. In a preferred embodiment, the compositions comprises an MHC class I/autoantigenic peptide complex, particularly an aggregate of such MHC/peptide complexes. These complexes comprises at least the extracellular peptide binding domain of an MHC class II molecule in which is functionally bound an autoantigenic peptide. The complexes can be in solution or suspension or immobilized on a substrate, such as presented on the surface of a cell, particularly an APC. Numerous applicable methods are known in the art for generating functional MHC class I/peptide complexes, such as may be found in literu In one embodiment, the autoantigenic peptide is a peptide of the naturally occurring autoantigen that is capable of complexing with an MHC class II molecule. Exemplary MHC class II molecules/peptide complexes are listed in Table A. In an alternative embodiment, the autoantigenic peptide is a mimotope peptide capable of complexing with an MHC class II molecule.
(102) In another embodiment the autoantigenic peptide is a mimotope peptide that is capable of complexing with an MHC class II molecule. Mimotope peptides are described in the literature, further below, and in Examples 1. Protocols for using autoantigen peptides to expand Tregs from otherwise conventional T cells include the use of autoantigen-specific MHC-peptide tetramers, peptide-pulsed DCs (Yamazaki, et al, 2003, J Exp Med 198:235-47) or artificial APCs (Maus et al. Nat. Biotechnol. 20:143-8, 2002) to expand Tregs from patients independent of the cell surface phenotype. In addition, a combination of in vitro and in vivo approaches can enhance the effects of the therapy. For example, recent studies have shown that administration of self antigens, altered peptide ligands and even non-specific stimuli such as FcR non-binding anti-CD3 mAbs can promote antigen-specific Treg activity (Apostolou et al. J. Exp. Med. 199:1401-8, 2003; Belghith et al. Nat. Med. 9:1202-8, 2003). Hence, combining in vivo immunization to induce the Tregs with ex vivo expansion or visa versa may be advantageous.
(103) The stimulatory composition may further include one or more additional agents, e.g., a costimulatory agent, a second regulatory T cell stimulatory agent, or agents that generally promote the survival and/or growth of T cells.
(104) The costimulatory agent is an antibody or ligand specific for a TCR costimulator, such as CD28 or GITR, as described below. In particular embodiments, the costimulatory agent is an agonist antibody, such as an agonist antibody which binds to CD28.
(105) The stimulatory composition alternatively comprises a second regulatory T cell stimulatory agent. Exemplary stimulatory agents include granulocyte colony stimulating factor, interleukins such as IL-2, IL-6, IL-7, IL-13, and IL-15, and hepatocyte growth factor (HGF). In particular embodiments, the second stimulating agent is a cytokine, such as an interleukin, such as interleukin-2.
(106) In some embodiments, one or more components of the stimulatory composition is immobilized on a substrate, such as a cell or bead. Cells suitable for use as substrates include artificial antigen-presenting cells (aAPCs) (Kim, J V et al, Nat Biotechnol. 2004 April; 22(4):403-10; and Thomas, A K et al, Clin Immunol. 2002 December; 105(3):259-72). Beads can be plastic, glass, or any other suitable material, typically in the 1-20 micron range. Paramagnetic beads are preferred.
(107) Optimal concentrations of each component of the stimulatory compositions, culture conditions and duration can be determined empirically using routine experimentation.
(108) The expanded and/or enriched antigen- or autoantigen-specific regulatory CD127.sup.lo/− T cells are introduced into the subject to modulate an immune or autoimmune reaction. For example, the subject may be afflicted with a disease or disorder characterized by having an ongoing or recurring autoimmune reaction, such as the diseases/disorders listed in Table A. In particular embodiments, the said modulating comprises inhibiting. CD127.sup.lo/− Tregs may serve as a “Trojan Horse” to deliver suppressive or other biologic factors to sites of inflammation, such as IL-4 (Yamamoto et al. J. Immunol. 166:4973-80, 2001), stem cell growth factors, angiogenesis regulators, genetic deficiencies, etc. For example, overexpression of foxp3 has been shown to transform otherwise pathogenic T cells into Tregs (Jaeckel et al. Diabetes. 2004 Dec. 10; [Epub]), and polyclonally expanded Tregs can be transduced with genes encoding an antigen-specific TCR plus FoxP3 to generate potent antigen-specific Tregs in very high numbers and efficiency (Mekala, et al., Blood. 2004 Nov. 4; [Epub]). Thus, these antigen-specific approaches decrease the requirement for high cell numbers while maximizing Treg specificity and function.
(109) Antigen-specific CD127.sup.lo/− Tregs are particularly indicated in infectious diseases in which the pathogenicity of the infections is not a result of the cytopathic effects of the pathogen but rather the tissue damage caused by the immunoinflammatory response to the infectious agent. In diseases, such as hepatitis C or HSV-induced corneal inflammation, CD4.sup.+CD127.sup.lo/− Treg therapy provides a unique opportunity to control viral-induced immunoinflammatory disease (Suvas et al. J. Immunol. 172: 4123-4132, 2004). Viruses, such as Coxsackie, are known to cause pancreatitis and have been associated with the development of Type 1 Diabetes. Thus, CD127.sup.lo/− Tregs that target expressed viral antigens can be used to suppress local tissue damage caused by the infection and reduce the inflammation that incites autoimmune disease development.
(110) The invention also provides compositions comprising a population of cells wherein at least 50% of said cells of said composition are natural (nontransformed), preferably expanded antigen or autoantigen-specific CD127.sup.lo/− Treg cells, wherein the antigen or autoantigen-specificity is preferably predetermined, preferably predetermined to a targeted immune or autoimmune reaction antigen. The compositions are made by the methods described herein. The percentage of the antigen or autoantigen-specific regulatory CD127.sup.lo/− Treg cells in the composition can be ascertained using the methodology described in the Examples. Preferably, at least 75%, 85%, 90%, 95%, or 98% of said cells of the composition are antigen or autoantigen-specific regulatory T cells.
(111) In addition, the autoantigen-specific regulatory CD127.sup.lo/− T cells, in some embodiments, are specific for an MHC class II molecule/peptide complex listed in Table A.
(112) In some embodiments, the autoantigen-specific regulatory CD127.sup.lo/− T cells are effective at modulating an autoimmune reaction when administered to a subject. Effective and optimized dosages and treatment regimes using the expanded and/or enriched autoantigen-specific regulatory cells are informed from vast clinical experience with existing T-cell infusion therapies, and can be further determined empirically.
(113) The subject methods find use in the treatment of a variety of different conditions in which the modulation of an aberrant immune response in the host is desired. By aberrant immune response in a host is meant any immune reaction in a subject characterized as an unwanted immune or autoimmune response (e.g., an autoimmune disease). In general, autoimmune responses occur when the immune system of a subject recognizes self-antigens as foreign, leading to the production of self-reactive effector immune cells. Self reactive effector immune cells include cells from a variety of lineages, including, but not limited to, cytotoxic T cells, helper T cells, and B cells. While the precise mechanisms differ, the presence of autoreactive effector immune cells in a host suffering from an autoimmune disease leads to the destruction of tissues and cells of the host, resulting in pathologic symptoms. Numerous assays for determining the presence of such cells in a host, and therefore the presence of an autoimmune disease, such as an antigen specific autoimmune disease in a host, are known to those of skill in the art and readily employed in the subject methods. Assays of interest include, but are not limited to, those described in: Autoimmunity. 2003 September-November; 36(6-7):361-6; J Pediatr Hematol Oncol. 2003 December; 25 Suppl 1:S57-61; Proteomics. 2003 November; 3(11):2077-84; Autoimmun Rev. 2003 January; 2(1):43-9.
(114) By treatment is meant that at least an amelioration of the symptoms associated with the aberrant immune response in the host is achieved, where amelioration is used in a broad sense to refer to at least a reduction in the magnitude of a parameter, e.g. symptom, associated with the condition being treated. As such, treatment also includes situations where the pathological condition, or at least symptoms associated therewith, are completely inhibited, e.g. prevented from happening, or stopped, e.g. terminated, such that the host no longer suffers from the condition, or at least the symptoms that characterize the condition.
(115) A therapeutically effect amount of a composition or cell population is an amount which is sufficient to treat or ameliorate the subject condition.
(116) A variety of hosts are treatable according to the subject methods. In certain embodiments, such hosts are “mammals” or “mammalian,” where these terms are used broadly to describe organisms which are within the class mammalia, including the orders carnivore (e.g., dogs and cats), rodentia (e.g., mice, guinea pigs, and rats), and primates (e.g., humans, chimpanzees, and monkeys). In preferred embodiments, the hosts will be humans.
(117) In further embodiments, the methods include a step of diagnosing the presence of an autoimmune disease to be treated. By diagnosing is meant that the autoimmune response of a subject is generally classified, e.g, diabetes mellitus, SLE, MS, etc. Further, at least one autoantigen may be identified to which the aberrant immune response is directed.
(118) Also provided are reagents and kits thereof for practicing one or more of the above-described methods. The subject reagents and kits thereof may vary greatly. In certain embodiments, the kits include at least a CD127 antibody, and an antigen specific regulatory T cell stimulatory composition. In other embodiments, the kit includes another regulatory T cell stimulating agent, such as a cytokine, such as an interleukin, such as interleukin-2 or interleukin-15. In certain embodiments, the kits may further include reagents for performing the antigen specific regulatory T cell expansion step, including culture dishes or flasks, culture medium, or any necessary buffers, factors, etc. In yet other embodiments, the kits include the means to harvest the sample containing the regulatory T cells and the reagents necessary to perform regulatory T cell enrichment/purification. The antibody may be labeled or the kit may provide reagents for labeling the antibody. In some embodiments of the above, the kits further comprise a CD4 and/or a CD25 antibody and, optionally, selecting for cells which are CD127.sup.lo/−, CD4.sup.+.
(119) In addition to the above components, the subject kits will further include instructions for practicing the subject methods. These instructions may be present in the subject kits in a variety of forms, one or more of which may be present in the kit. One form in which these instructions may be present is as printed information on a suitable medium or substrate, e.g., a piece or pieces of paper on which the information is printed, in the packaging of the kit, in a package insert, etc. Yet another means would be a computer readable medium, e.g., diskette, CD, etc., on which the information has been recorded. Yet another means that may be present is a website address which may be used via the internet to access the information at a removed site. Any convenient means may be present in the kits.
(120) In some embodiments, the stimulatory agent is an MHC class I/autoantigenic peptide complex. Exemplary MHC class II molecules/peptide complexes are listed in Table A. In other embodiments, the stimulatory agent is an antigen which prompts an unwanted immune response in the subject or patient.
(121) The costimulatory agent can be an antibody or ligand specific for a TCR costimulator, such as CD28 or GITR, as described below. In particular embodiments, the costimulatory agent is an agonist antibody, such as an antibody which binds to CD28. In some embodiments, the stimulatory agent and said costimulatory agent are immobilized on a substrate, such as a cell or bead.
(122) The invention also provides methods and compositions for ex vivo expansion of therapeutic regulatory CD127.sup.lo/− T cells, and the use of such expanded Treg cells for adoptive cellular immunotherapy to suppress autoimmunity.
(123) The expansion methods generally comprise first extracting a mixed population of T cells from a person or patient, and isolating from the population a subpopulation enriched in CD127.sup.lo/− Treg cells. To maximize efficacy, the subpopulation is enriched to at least 90%, preferably at least 95%, and more preferably at least 98% CD127.sup.lo/− Treg cells. Cells are generally enriched by targeting for selection cell surface markers specific for immune suppressive CD127.sup.lo/− Tregs and separating using automated cell sorting such as fluorescence-activated cell sorting (FACS), solid-phase magnetic beads, etc. To enhance enrichment, positive selection may be combined with negative selection against cells comprising surface makers specific to non-Treg cell types, such as by depletion of CD8, CD11b, CD16, CD19, CD36 and CD56-bearing cells, and as exemplified below.
(124) The CD127.sup.lo/− Treg-enriched subpopulation is then expanded ex vivo by culturing the cells in the presence of effective amounts of a TCR/CD3 activator, a TCR costimulator activator, and IL-2. The TCR/CD3 activator is selected from a multivalent antibody or ligand for TCR/CD3, including antigen non-specific activators such as an anti-CD3 antibody, and antigen-specific activators, such as an MHC-peptide multimer (see, e.g. Yee, et al., Adoptive T cell therapy using antigen-specific CD8+ T cell clones for the treatment of patients with metastatic melanoma: In vivo persistence, migration, and antitumor effect of transferred T cells. Proc Natl Acad Sci USA, Dec. 10, 2002; 99(25): 16168-16173; Butterfield, et al., T-Cell responses to HLA-A*0201 immunodominant peptides derived from a-fetoprotein in patients with hepatocellular cancer, Clin. Cancer Res., Dec. 1, 2003; 9(16): 5902-5908; and Yee, et al., Isolation of high avidity melanoma-reactive CTL from heterogeneous populations using peptide-MHC tetramers, J Immunol, 1999, 162: 2227-223), wherein the peptide is typically an autoimmune disease associated peptide, such as a diabetes-associated autoantigen peptide wherein suitable diabetes-associated autoantigens include glutamic acid decarboxylase (GAD), an islet cell autoantigen (ICA) and insulin, wherein combinations of such peptides may also be used.
(125) The costimulator activator can be a multivalent antibody or ligand specific for a TCR costimulator, preferably CD28 or GITR (Shimizu et al., Stimulation of CD25(+)CD4(+) regulatory T cells through GITR breaks immunological self-tolerance, Nat Immunol. 2002 February; 3(2): 135-42. Epub 2002 Jan. 22; Tone et al., Mouse glucocorticoid-induced tumor necrosis factor receptor ligand is costimulatory for T cells, Proc Natl Acad Sci USA. 2003 Dec. 9; 100(25):15059-64. Epub 2003 Nov. 7), though alternative TCR costimulators such as CD5, ICOS, OX40 and CD40L may also be targeted where suitable expansion is so obtained, as may be determined empirically. To promote activation and expansion, the TCR/CD3 and TCR costimulator activators can be typically immobilized on a 3-dimensional solid surface, such as a host cell (e.g. Thomas et al, December 2002, Clin Immunol 105, 259-72) or bead. In a particular embodiment, the activators may be immobilized on paramagnetic beads provided in a Treg cell:bead ratio of between 2:1 and 1:5, preferably between 1:1 and 1:3. Optimal bead size can be empirically determined, though typically the size falls in the range of 1 to 20 micron diameters.
(126) The IL-2 is typically presented in recombinant form, wherein effective amounts of IL-2 can be typically 200 to 2500 IU IL-2/ml. Maximal expansions are determined empirically and will vary by cell type, incubation conditions, etc. For embodiments, maximal expansions may be about 300, 500 and 800-fold.
(127) The suppressive function of the expanded CD127.sup.lo/− Treg cells may be detected in vitro or in vivo. For example, in vitro, the expanded CD127.sup.lo/− Treg cells may be shown to suppress proliferation of CD25.sup.− T cells stimulated with anti-CD3 in the presence of Fc-receptor-bearing cells, or CD25.sup.− T cells stimulated with irradiated allogeneic splenocytes. Suitable exemplary in vivo animal model and human clinical immune suppression protocols are described in U.S. Patent Application Publication No. 2005/0186207 which is herein incorporated by reference with respect to same.
(128) In some embodiments, the TCR/CD3 activator and the expanded CD127.sup.lo/− Treg cells are autoantigen-specific. For example, in a particular such embodiment, an effective amount of the ex vivo expanded CD127.sup.lo/− Treg cells introduced into the patient diagnosed with diabetes mellitus (see, e.g. Mayfield et al., Diagnosis and classification of diabetes mellitus: new criteria, Am Fam Physician. 1998 Oct. 15; 58(6):1355-62, 1369-70) and presenting an indication of impaired glucose homoeostasis, such as fasting plasma glucose (FPG), post-prandial glucose (PPG), and glucose tolerance (GTT) provide a resultant improvement in the impaired glucose homoeostasis, particularly wherein the improvement is selected from an FPG of 110 mg/dL or less, a 2-hour PPG of 140 mg/dL or less, and a GTT of 140 mg/dL or less 2 hours after a 75-g glucose load.
(129) Accordingly, the invention provides methods and compositions for adoptive cellular immunotherapy comprising introducing into a patient in need thereof an effective amount of the subject ex vivo expanded CD127.sup.lo/− Treg cells. These applications generally involve reintroducing expanded CD127.sup.lo/− Treg cells extracted from the same patient, though the methods are also applicable to adoptive cellular immunotherapy for treatment of graft-versus-host disease associated with transplantation, particularly bone marrow transplantation using CD127.sup.lo/− Tregs derived from donor tissue.
(130) Adoptive transfer of CD127.sup.lo/− Tregs expanded as disclosed herein can be effective to suppress a wide variety of pathogenic autoimmune responses, including diabetes, GVHD, Lupus, rheumatoid arthritis, psoriasis, multiple sclerosis, degenerative heart disease (e.g. Ziad Mallat, et al. Induction of a Regulatory T Cell Type 1 Response Reduces the Development of Atherosclerosis in Apolipoprotein EBKnockout Mice, Circulation. 2003 Sep. 9; 108(10):1232-7), inflammatory bowel disease (Crohn's disease), etc.
(131) In adoptive cell transfer protocols, a mixed population of T cells is initially extracted from a target donor. Depending on the application, the T cells may be extracted during a period of remission, or during active disease. Typically this is done by withdrawing whole blood and harvesting granulocytes by leukapheresis (leukopheresis). For example, large volume leukapheresis (LVL) has been shown to maximize blood leukocyte yield. Harvests reach 20×10.sup.6 cells/L using a continuous flow apheresis device (Spectra, COBE BCT). Symptoms of hypocalcemia are avoided by a continuous infusion of calcium administrated throughout leukapheresis. Typically 15-45 liters of fluid corresponding to about 4 total blood volumes are harvested during a period of time ranging from about 100 to 300 minutes.
(132) The harvested lymphocytes are separated by flow cytometry or other cell separation techniques based on Treg-specific cell markers such as CD127 and expanded as described herein, and then transfused to a patient, typically the cell donor (except in GVHD where the donor and recipient are different), for adoptive immune suppression. Alternatively, the cells may be frozen for storage and/or transport prior to and/or subsequent to expansion. In some embodiments for antigen non-specific expansions, approximately 10.sup.9 to 10.sup.11 Tregs are transfused; for antigen-specific expansions, therapeutically effective transfusions typically may use about 10.sup.7 to 10.sup.9 Treg cells.
(133) Method of Sorting Cells.
(134) The biomarkers used for positive or negative selection of the regulatory T cells of the present invention may be identified by immunoselection techniques known to those in the art which utilize antibodies including, but not limited to, fluorescence activated cell sorting (FACS), magnetic cell sorting, panning, and chromatography. Immunoselection of two or more markers on activated T cells may be performed in one or more steps, wherein each step positively or negatively selects for one or more markers. When immunoselection of two or more markers is performed in one step using FACS, the two or more different antibodies may be labeled with different fluorophores.
(135) Methods of sorting cells are well known to persons of ordinary skill in the art. Cell sorters generally are capable of separating a complex mixture of cells into fractions of a single cell type. Typically, the cells to be sorted are introduced as a thin jet of carrier liquid emanating from a small nozzle orifice. Shortly after leaving the nozzle, the fluid passes through the waist of one or more tightly focused laser beams. The scattered and fluorescence light from these interactions can be collected and analyzed to determine if there are events (e.g., the presence of a fluorescence signal indicating that a fluorophore-labeled monoclonal antibody is bound to the surface of a cell) that prompt the sorting of the cell by various means. More than one label can be monitored at a time. FACS (fluorescence activated cell sorters) can easily analyze cells at speeds greater than 200,000 events per second. Generally, the physics of the carrier fluid, however, and the statistics of distributing the cells among the droplets limits sort rates to about 50,000 cells per second. This combination of speed and reliable separation allows individual cells to be isolated for other uses.
(136) Magnetic cell sorting may be performed using super-paramagnetic microbeads composed of iron oxide and a polysaccharide coat. Preferably the microbeads may be approximately 50 nanometers in diameter, and have a volume about one-millionth that of a typical mammalian cell. The microbeads are preferably small enough to remain in colloidal suspension, which permits rapid, efficient binding to cell surface antigens. The microbeads preferably do not interfere with flow cytometry, are biodegradable, and have negligible effects on cellular functions. The antibody coupling to the microbeads may be direct or indirect, via a second antibody to a ligand such as fluorescein.
(137) Methods of Administration of the Isolated and Isolated, Expanded Cell Populations.
(138) The cells can be administered in a variety of ways. By way of nonlimiting example, the cells may be delivered intravenously, or into a body cavity adjacent to the location of an immune response to be suppressed, such as the intraperitoneal cavity, or injected directly within or adjacent to the site of the immune reaction. Intravenous administration, for example, is advantageous in the treatment of many such conditions.
(139) The medicaments and pharmaceutical compositions may be formulated using conventional pharmaceutically acceptable parenteral vehicles for administration by injection. These vehicles may be nontoxic and therapeutic, and a number of formulations are set forth in Remington's Pharmaceutical Sciences. Nonlimiting examples of excipients are saline, Ringer's solution, saline-dextrose solution, and Hank's balanced salt solution. Pharmaceutical compositions may also contain minor amounts of additives such as substances that maintain isotonicity, physiological pH, and stability.
(140) The medicaments and compositions may be in unit dose format. Generally, the unit dose will contain a therapeutically effective amount of CD127.sup.lo/− regulatory T-cells. The amount will generally depend on the age, size, gender of the patient, the condition to be treated and its severity, the condition of the cells, and their original characteristics as obtained from the donor of the sample. Methods of titrating dosages to identify those which are therapeutically effective are known to persons of ordinary skill in the art. Generally, a therapeutically effective amount of the cells can be from 10.sup.7 to 10.sup.11.
(141) The following examples are included to illustrate the invention and methods used in practicing the invention, and not to limit the invention.
EXAMPLES
Example 1
Antibodies
(142) Human Antibodies: PE-conjugated anti-CD127, APC-conjugated anti-CD25, PerCP-conjugated anti-CD4 used for staining and in sorting was provided by Becton-Dickenson (BD Pharmingen, San Diego, Calif.). Alexa488-conjugated anti-FoxP3 was purchased from BioLegend (San Diego, Calif.) and intracellular staining was performed according to manufacturer's instructions as modified as follows: 5×10.sup.5 cells were stained with cell surface markers for 30 min at 4° C. and fixed for 30 min using 1× Fix/Perm buffer. After 3 washes cells were permeabilized in Perm buffer with DNase I (Sigma-Aldrich, St. Louis, Mo.) for 30 min followed by 3 washes. Then cells were blocked with human IgG and stained with anti-human FoxP3-Alexa488 conjugated (BioLegend, San Diego, Calif. clone 206D). The following anti-mouse antibodies were purchased from the indicated sources: anti-CD4, anti-CD25 and mouse IgG.sub.1 (isotype control) (BD Pharmingen, San Diego, Calif.); and anti-IL-7R (eBioscience, San Diego, Calif.).
Example 2
Subjects
(143) A total of 16 patients with longstanding type 1 diabetes mellitus were studied. Patients (age range 16-56 years, mean age 34, with a disease duration longer than 5 years) were recruited from the Barbara Davis Center for Childhood Diabetes, Denver, Colo., USA. Diagnosis of type 1 diabetes was made primarily by the presence of biochemical autoantibodies or presentation of hyperglycemia with ketosis in childhood. None of the diabetic subjects had severe nephropathy or neuropathy. As controls, 10 subjects (age range 20-50 years, mean age 29) with no family history of diabetes mellitus were also tested. Blood samples were obtained with informed consent under Institutional Review Board approved protocols at either the University of Colorado Health Sciences Center or UCSF as needed.
Example 3
Sorting of CD4+ T Cell Subsets for Flow Cytometry and Functional Studies
(144) Human T cells were isolated from leukopacs (Blood Centers of the Pacific). In some cases, negative selection using RosetteSep human CD3 depletion Cocktail (Stemcell Technologies, Seattle, Wash.) was performed. 100-120×10.sup.6 PBMC cells were washed once, counted and resuspended in sorting buffer (PBS+0.1% BSA+1 mM EDTA) at 100×10.sup.6 per ml in a 15 ml conical tube. After addition of 1 μl/1 million cells volume PerCP conjugated anti-CD4, 1 μl/1 million cells PE conjugated anti-CD127, and 0.7 μl/million cells APC conjugated anti-CD25 antibodies, the cell suspension was mixed gently and incubated at 4 C for 30 min. Cold FACS sorting buffer was added up to a volume of 15 ml, T cells were pelleted and resuspended at 20×10.sup.6 per ml. Labeled T cells were sorted using an Aria high-speed cell sorter. The sort gates for the various T cell subsets were set to include only those events exhibiting the CD4-specific fluorescence that were also within the lowest density region of a scatter plot. This amounted to between 11.4% and 33.9% (mean 20.87%) (n=22) of the total number of events for the CD4.sup.+ T cells. Based on the CD4 gate, cells were then further gated based on CD127 and/or CD25 expression (CD4.sup.−CD127.sup.+/−CD25.sup.+/− and CD4.sup.+CD127.sup.+/− alone independent of CD25 as well as CD25.sup.hi conventional Tregs). Cells were collected into 100% human AB serum (Cambrex, Walkersville, Md.) and washed once with media (RPMI/5% human serum) until ready to be plated in suppression assay. Sorted Treg were 95-98% CD4.sup.+CD25.sup.hi with a typical yield of 5-12×10.sup.5 T cells per sort whereas CD4+CD127−CD25+ cells had a typical yield of 0.9-1.2×10.sup.6 and 98% purity.
Example 4
Isolation of CD4.SUP.+.CD25.SUP.hi .and CD4.SUP.+.CD25.SUP.neg .Cells for GeneChip Arrays
(145) Human CD4.sup.+ T cells were isolated by negative selection from leukopacs (Stanford University Blood Center) using RosetteSep Human CD4.sup.+ T cell Cocktail (Stemcell Technologies, Seattle, Wash.). 7.5-1.25×10.sup.8 CD4.sup.+ T cells (>90% purity by FACS) were washed once, counted and resuspended in FACS staining buffer (PBS+0.1% BSA) at 10×10.sup.6 per ml in a 50 ml conical tube. After addition of 1/90 volume Cy-5 conjugated anti-CD4 (BD Pharmingen) and 1/100 FITC-conjugated anti-CD25 (DakoCytomation, Chicago, Ill.) antibodies, the cell suspension was mixed gently and incubated on ice for 45 min. Cold FACS staining buffer was added to a volume of 50 ml, T cells were pelleted and resuspended at 20×10.sup.6 per ml. Labeled T cells were incubated on ice for 45 min and then submitted to flow sorting on a DakoCytomation MoFlo high-speed cell sorter. The sort gates were set to include only those events exhibiting the highest levels of CD25-specific fluorescence (CD4.sup.+CD25.sup.hi cells) or lowest levels (CD4.sup.+CD25.sup.neg cells) that were also within the lowest density region of a scatter plot. This amounted to between 0.8% and 1.4% of the total number of events for the CD4.sup.+ T cells for each sub set.
Example 5
RNA Isolation
(146) Total RNA was isolated from Treg using the total RNA isolation protocol from the RNA RT-PCR Miniprep kit (Stratagene, La Jolla, Calif.) with the following modifications: 100,000 cells were lysed in 150 μl of lysis buffer. To digest DNA, two units of DNAse were added/ug nucleic acid, and Phenol/CHCl.sub.3 (Sigma-Aldrich, St. Louis, Mo.) was used to purify total RNA followed by ethanol precipitation. The quantity of total RNA was measured using Nanodrop ND 100 (Nanodrop Technologies, Rockland, Del.). 100 ng of each RNA sample was used for target labeling by a two-round amplification protocol. This protocol was modified from the Affymetrix eukaryotic small sample prep by using 6 pMol of T7 primer and 3 μg/μl of the random primer.
Example 6
GeneChip Arrays and Data Analysis
(147) A total 16 of human HG-U133A GeneChip arrays were used in this study (Affymetrix, Santa Clara, Calif.). Ten ug of fragmented cRNA per GeneChip hybridization were processed on the Affymetrix Fluidic station 450 (Affymetrix, Santa Clara, Calif.) and GeneChip scanner GCS2500 (Hewlett-Packard Company, Palo Alto, Calif.). Gene expression profile was analyzed with MAS5.0 (Microarray Suite version 5.0 (Affymetrix, Santa Clara, Calif.) was used for data acquisition and normalization. Present genes were defined by selecting genes that were present in 3 of 4 arrays. Signal intensities of all present genes for the activated and control groups were combined and analyzed by T-test. Significant genes were selected with p<0.05. The “signal log ratio” (SLR) and “Increase” or “Decrease” call was generated by comparison analysis MAS5.0 and then used for calculating fold changes between groups. We selected 9 out of 16 pair-wise comparisons for particular genes that showed increase or decrease at fold change >2.0. In the second step, signal intensities of present genes were analyzed with Significance Analysis of Microarrays (SAM) was applied for analyzing and determining the gene list based number of significant genes that were identified by T-test and fold change. The final significant genes were combined from the above two steps. Two-dimensional hierarchical clusters are generated using GeneSpring 6.0 software (Silicon Genetics, Redwood City, Calif.).
Example 7
Real-Time PCR Analysis
(148) RNA was isolated using RNeasy mini kits (Qiagen, Valencia, Calif.) according to the manufacturer's instructions. For cDNA synthesis, 500 ng total RNA was transcribed with cDNA transcription reagents using SuperScriptIII reverse transcriptase and oligo(dT)12-18 (InVitrogen, Inc.), according to the manufacturer's instructions. Gene expression was measured in real-time with the GeneAmp 7900 Sequence Detection System (Applied Biosystems) using primers and QuantiTect SYBR Green PCR Kit purchased from Qiagen. The expression level of a gene in a given sample was represented as 2.sup.−ΔΔCt where ΔΔCT=[ΔCT.sub.(experimental)]−[ΔCT.sub.(medium)] and ΔCT=[CT.sub.(experimental)]−[CT.sub.(housekeeping)]. Data is presented normalized to the glyceraldehyde phosphate dehydrogenase (GADP).
Example 8
Suppression Assays
(149) Suppression assays were performed in round bottom 96-well microtiter plates. 100,000 responder PBMC from same cell source as sorted populations, 30,000 sorted cells (one of 7 different sorted subtypes based on CD25 and/or CD127 expression), 100,000 allogeneic irradiated CD3-depleted PBMC were added as indicated. Responder ratio indicated refers to Treg to responder where 1 sorted:1 responder is 30,000 sorted cells:100,000 PBMC responder cells. APC consisted of allogeneic PBMC depleted of T cells using StemSep human CD3+ T cell depletion per manufacturer's recommendations (StemCell Technologies, Seattle, Wash.) and irradiated with 40 Gy. Cells were plated in the following order in 50 ul per well: sorted cells, responders, APC. No additional stimulus was added to the wells, however, additional media was added to each well so the final volume was 200 ul per well. Wells surrounding culture wells were filled with PBS in order to prevent evaporation. T cells were incubated for 7 days at 37° C. in 5% CO.sub.2. Sixteen hours before the end of the incubation, 1 uCi .sup.3H-thymidine was added to each well. Plates were harvested using a Tomtec cell harvester and .sup.3H-thymidine incorporation was determined using a 1450 microbeta Wallac Trilux liquid scintillation counter.
Example 9
Antibody Staining and FACS Analysis
(150) Five×10.sup.4 T cells per sample were washed once with FACS staining buffer (PBS+0.1% BSA) and resuspended in 100 μL buffer. 1 μL of fluorescence-conjugated specific antibodies (1 μg/million T cells) was added, T cells were lightly vortexed and incubated on ice for 20 min. 500 μL of staining buffer was added to each sample, T cells were pelleted and resuspended in 200 μL buffer and analyzed on a flow cytometer (Becton Dickinson, FACScalibur) Intracellular staining was conducted using the recommended procedure from the BD Pharmingen or eBioscience where indicated.
Example 10
Chromatin Immunoprecipitation—DNA Microarray (ChIP-Chip)
(151) Human CD4.sup.+CD25.sup.hi Tregs were expanded in vitro as described previously (37). Chromatin fixation and immunoprecipitation were performed using chromatin immunoprecipitation assay kit (Upstate Biotechnology, Inc.) as recommended by the manufacturer. Expanded human Treg were fixed in 1.1% formaldehyde. Protein-DNA cross-linked cell pellets were resuspended in SDS-Lysis Buffer (1 ml per 1×10.sup.8 cells) and incubated for 10 minutes on ice. Lysates were sonicated to shear DNA to lengths between 200 and 1000 basepairs and centrifuged for 10 minutes at 13,000 rpm at 4° C. to remove debris. The sonicated cell supernatant was diluted 10-fold in ChIP Dilution Buffer with protease inhibitors (Upstate Biotechnology, Inc) to reduce non-specific background, the diluted cell supernatant was pre-cleared with 40 μl of a Protein A Agarose-50% slurry per 1 ml lysate for 30 minutes at 4° C. with agitation. Cross-linked protein/DNA complexes were immunoprecipitated using control rabbit Ig or affinity-purified rabbit polyclonal anti-human FoxP3 (a generous gift of Roli Khattri and Fred Ramsdell, Celltech, Lt. Seattle, Wash.). The cross-linking of the material was reversed and Proteinase K treated to remove protein from the DNA. The remaining DNA was purified with QIAquick PCR Purification Kit (Qiagen, 28106) and amplified by LMPCR (ligation-mediated PCR) as described previously (49). Array hybridization and analysis were performed at Affymetrix as described previously (50). SYBR Green qPCR was carried out to verify the binding sites predicted by the arrays. Primers for the PCR reactions included: IL-7R promoter: 5′-primer, CAGGGAATATCCAGGAGGAA (SEQ ID NO:35); 3′-primer, TGTGTGAGCCAGTGTGTATGAA (SEQ ID NO:36); IL-7R 2K upstream: 5′-primer, TTTGGGATTTCTCCTTGAACA (SEQ ID NO:37); 3′-primer TCTCTGGGCATTTCAAAACC (SEQ ID NO:38); IL-7R intron 4:5′ primer, GAGGTGGCAGAAGAGTGGAG (SEQ ID NO:39); 3′-primer, TGCATCACACTGCAAACAAA (SEQ ID NO:40); IL7-R intron 7 and exon 8:5′-primer, ACATGCTGGCAATTCTGTGA (SEQ ID NO:41); 3′-primer, TCTGGCAGTCCAGGAAACTT (SEQ ID NO:42).
Example 11
Lack of Correlation Between FoxP3 and CD25 in Human CD4+ T Cells
(152) Previous studies in mouse using FoxP3-GFP knock-in mice have demonstrated that FoxP3 does not always correlate with CD25 expression (36). Since current efforts in humans have focused on the use of CD25 to isolate and quantify Tregs, we analyzed the expression of FoxP3 in the various CD4.sup.+ T cell subsets. Peripheral blood cells from normal subjects were purified on Ficoll gradients and cell surface stained with anti-CD4 and anti-CD25 mAbs. This staining was following by cell membrane permeabilization and intracellular staining with a monoclonal anti-FoxP3 mAb.
(153) As seen in
(154) An analysis of FoxP3 expression in the CD4.sup.+CD25.sup.− T cell subset showed that <5% of the CD25−CD4.sup.+ T cells expressed FoxP3, although that percentage was probably an overestimate due to some background staining using the isotype control Ig. However, given the large numbers of cells in this gate, there are likely to be at least some CD4.sup.+CD25.sup.− T cells that are FoxP3.sup.−. Thus, rather than <2% of the CD4.sup.+ T cells falling into a putative Treg subset, as many as 8-10% of the CD4.sup.+ T cells may be regulatory in nature.
Example 12
Analysis of Novel Treg-Specific Cell Surface Molecules
(155) To identify additional cell surface markers associated with function and phenotype of Treg, microarray analysis was performed comparing mRNA expressed by CD4.sup.+CD25.sup.hi T cells with CD4.sup.+CD25.sup.neg T cells isolated from healthy donor PBMC. mRNA was prepared from 3 blood donors, cRNA prepared and tested on Affymetrix U133A GeneChips. The sorting parameters were based on published studies in which the top 1-2% of CD4.sup.+CD25.sup.+ T cells were selected as the prototypic Treg subset (16, 37).
(156) Among the genes that differed between the two subsets, IL-7R (CD127) expression was noted to be expressed at 2.4-fold lower levels in CD4.sup.+CD25.sup.hi T cells as compared to CD4.sup.+CD25.sup.neg T cells. To confirm the findings, mRNA isolated from 3 independent CD4.sup.+CD25.sup.hi and CD4.sup.+CD25.sup.neg T cell preparations were examined by quantitative real time PCR (qPCR). Expression of CD127 mRNA was inversely correlated with CD25 expression. In fact, the level of expression was 3.14 lower in the CD4.sup.+CD25.sup.hi T cells as compared to CD4.sup.+CD25.sup.− T cells (range 2.26- to 4.21-fold).
(157) As predicted by the gene expression studies, the majority of the CD4.sup.+CD25.sup.+ cells, especially the CD4.sup.+CD25.sup.hi T cells had low expression of CD127 (
(158) Further studies were conducted to determine the relationship of CD4, CD127, FoxP3 and CD25 using multiparameter flow cytometry (
Example 13
ChIP-Chip Analysis of FoxP3 Interaction with CD127
(159) The data clearly showed a “general” relationship between FoxP3 expression and CD127 down-regulation. However, we were struck with the apparently inverse correlation between FoxP3 and CD127 protein (
(160) We performed ChIP-chip experiments on anti-CD3/anti-CD28-expanded CD4.sup.+CD25.sup.hi human Tregs (37). Anti-FoxP3 or control rabbit Ig was used to precipitate cross-linked protein-DNA complexes from nuclear lysates. The cross-linking of the immunoprecipitated material was removed, protease-treated, and the DNA was purified and amplified. The resultant material was hybridized to the whole genome using GeneChip® Human Tiling 1.0R Array Set (Affymetrix 900774) to identify the locations of binding sites for FoxP3. Statistical analysis was performed to determine sites that were selectively associated with FoxP3 protein and not rabbit Ig.
(161) The IL-7R promoter region scored among the various sites bound by the FoxP3 protein immunoprecipitates (data not shown). The CD127 promoter binding was confirmed by qPCR. Oligonucleotide primers spanning the CD127 promoter region were used on anti-FoxP3 immunoprecipitated DNA from CD4.sup.+CD25.sup.hi human Tregs (
Example 14
Suppression of Allogeneic Mixed Lymphocyte Response (MLR) Using Different CD4+ T Cell Subsets
(162) Although the low expression of CD127 correlated with FoxP3 expression, a number of studies have questioned whether FoxP3 is always a marker of Tregs in humans. Thus, we examined the ability of CD4.sup.+CD25.sup.−CD127.sup.lo/− T cells and other subsets to suppress an allogeneic MLR. PBMCs were sorted into 4 subsets based on CD127, CD25 and CD4 expression. First, we examined the ability of the individual subsets to respond to the allogeneic APCs. As can be seen in
(163) In addition, the Applicants compared gene expression profiles for a gene array in which mRNA from various T cell subsets were analyzed on an Affy whole genome chip and assessed for level of expression. CD4.sup.+CD127.sup.loCD25.sup.+ cells have closely the same overall fingerprint as the classical CD4.sup.+CD25.sup.bright cells which differs from CD25.sup.− cells (data not shown), including, particularly with respect to selected T-reg marker TNF-R75, CTLA4, IL2RB, CD58, and CCR6 gene expression (not shown).
Example 15
Frequency of CD4+CD25+CD127.SUP.lo/− T Cells from Patients with T1D
(164) Previous studies have suggested that Treg numbers might be deficient in patients with Type 1 diabetes (24). To investigate quantitative differences in the Treg populations in patients with T1D versus control subjects, peripheral blood T cells were stained with CD4, CD25, CD127 and FoxP3. The frequency of CD4.sup.+CD25.sup.+CD127.sup.lo/− Tregs was not significantly different between T1D (mean 66.1%, Std 11.3%, range 53.7-82.8%) and control subjects (mean 65.5%, Std 8.66%, range 45.4-76.2%) (
Example 16
CD4.SUP.+.CD127.SUP.lo/− Tregs are Suppressive and have Treg Phenotype
(165) Flow cytometric analyses showed that only 30-40% of the isolated CD4+CD127lo cells expressed Foxp3 at the beginning of culture, with even less Foxp3 expression (both based on percentage and MFI (mean fluorescence intensity)) after expansion. These results raised the question as to the functional activity of the Foxp3 negative T cells in the culture. As a first approach to determining the functional potential of the different cells grown in the culture, we separated CD4+CD127lo cells and cultured for 14 days with anti-CD3/anti-CD28+IL-2 plus/minus rapamycin. The cells expanded best in the absence of rapamycin and when re-stimulated with the mAb and IL-2 cocktail on day 9. The cell expanded with RAPA had the highest levels of Foxp3 and percentage of Foxp3+ cells. The majority of Foxp3-cells were CD25lo versus Foxp3+ cells in the same culture.
(166) We next compared CD4.sup.+CD127.sup.lo suppression for cells expanded in the presence of IL-2 or IL-2 rapamycin. At 14 days, expanded cells were separated and added to a CFSE (carboxyfluorescein succinimidyl ester) suppression assay. Interestingly, after culture both populations suppressed but those grown in Rapamycin suppressed better (see
(167) We next compared CD4.sup.+CD127.sup.lo suppression based upon CD25 separation after expansion (see,
(168) We also examined FoxP3 and CD127 expression and Treg function of fresh CD4.sup.+CD127.sup.loFoxP3.sup.+ and FoxP3.sup.− mouse T cells (see,
(169) Discussion of the Examples
(170) The above findings raise several critical issues. First, since the majority of CD4.sup.+FoxP3.sup.+ T cells may fall outside the typical gate for human Tregs, studies used for functional and immunophenotypic analyses are potentially missing a large number of putative Tregs. This has important implications in determining quantitative differences in patients with a variety of diseases. Second, the fact that CD4.sup.+CD127.sup.lo/−CD25.sup.− T cells suppress an allogeneic MLR call into question those studies suggesting that FoxP3 is not a “good” marker for Treg activity. It may be that FoxP3 is an excellent marker and the small populations that arise during normal T cell activation are indeed adaptive regulatory T cells expanding as a consequence of sub-optimal or supra-optimal TCR signaling. It should be emphasized, however, that not all FoxP3.sup.− T cells are necessarily Tregs and their activity may depend on the level of FoxP3 expression and isoforms of the protein expressed. However, these CD4.sup.+CD25.sup.+CD127.sup.lo/−, once isolated, may be treated in vivo with TGFβ or other factors to enhance Treg function in these cells. Third, efforts to select Tregs for in vitro expansion may be hindered by the underestimate of Tregs in any separation strategy based on CD25 expression. The ability to identify and select a significantly greater number of Tregs circulating in the peripheral blood of humans, especially those with autoimmune diseases, is likely to make it easier to expand sufficient cell numbers for immunotherapy. Finally, the identification of CD127 as a marker that distinguishes effector/memory from regulatory T cells indicates that anti-CD127 therapy might be appropriate for the treatment of autoimmune diseases such as Type 1 Diabetes, Systemic Lupus Erythematosis, or Multiple Sclerosis.
(171) The identification of CD127 as a useful marker can be related to genetic observations. First, microarray analysis of mRNA from individual T cell subsets showed that CD127 was expressed at significantly lower levels in CD4.sup.+CD25.sup.hi versus CD4.sup.+CD25.sup.− T cells. Unlike the majority of activated T cells, which rapidly re-express CD127 and memory T cells that express high levels of CD127, the Treg population remains CD127.sup.lo/−. There may be two reasons for this. First, Tregs may be constantly undergoing antigenic stimulation which is CD28-dependent resulting in continued signaling that shuts down CD127 mRNA transcription. In this regard, it is interesting to note that activation of nave T cells by anti-CD3 plus anti-CD28 but not anti-CD3 alone led to a rapid down-regulation of CD127 (J. Esensten, A. Weiss and J. A. Bluestone, unpublished data) suggesting that CD28 signals are uniquely involved in regulating CD127 down-regulation. Alternatively, and not mutually exclusive, is the possibility that FoxP3 expression in this T cell subset controls CD127 expression. There are a number of reasons to think that this may be the case As illustrated in the flow cytometric staining profiles, the more FoxP3 expression, the less CD127 (
(172) The CD4.sup.+CD127.sup.lo/−CD25.sup.− T cells suppress quite effectively although the percentage of FoxP3.sup.− T cells in this subset can be quite variable. These results suggested that the CD127 marker may be useful in identifying different subtypes of regulatory T cells including Tr1 and TH3 cells. In this regard, there are currently a number of settings, including the treatment of humans with T1D with anti-CD3 that induces T cells with a regulatory phenotype (11, 31, 42, 43). These studies, which mimic similar results in Treg-deficient mice treated with non-mitogenic anti-CD3 (10), indicate that it may be possible to identify an “adaptive” Treg response using CD127 as a biomarker in addition to lower CD25 expression previously observed on these cells.
(173) One of the more intriguing aspects of the results is the seeming dichotomy in cytokine receptor expression in memory T cells versus Tregs. Whereas a high percentage of Tregs now appear to be IL-7R low and IL-2R positive, memory T cells have the opposite phenotype, expressing high levels of IL-7R and low levels of IL-2R. The functional basis for this differential expression is unclear but it may reflect the evolution of distinct pathways for cell survival and expansion of these T cell subsets. For instance, it is possible that regulatory T cells may play a critical role in normal homeostasis. Thus, the cells attempt to regulate the earliest immune perturbation that may occur in the absence of a pathogenic response. Since IL-2 is an “early cytokine” produced rapidly by activate T cells in the draining lymph nodes, IL-2 may be a critical signal for awakening the Treg response which can effectively suppress T cell expansion in these lymphoid tissues (44). In contrast, IL-7 is commonly produced locally in sites of inflammation leading to increased survival and expansion of effector cells. If this localized IL-7 expression promoted Treg expansion it might be counterproductive. Moreover, avoiding competition for the use of the common γ chain by these receptors would enhance the functionality of the cytokine function. Finally, it should be noted that the situation might be quite distinct in thymus when all the pre-T and immature T cells are CD127.sup.+ and CD25.sup.+. At this stage in development other factors might come into play to determine the differentiation pathways that determine whether a T cell become a Treg or a naive conventional T cell.
(174) Several studies have examined the number and function of Treg cells in humans with autoimmune diseases. In some settings, such as Multiple Sclerosis, Type 1 Diabetes and autoimmune polyglandular syndrome II, the data, based on the number and function of CD4+CD25.sup.hi Tregs, suggest that there are either fewer Tregs or less functional Tregs in diseased individuals (24, 45-47). However, in Type 1 Diabetes and other autoimmune diseases, there have been contradictory results (25, 48). In the present study, we re-evaluated Tregs in patients with T1D as compared to normal individuals. Using the new markers, FoxP3 and CD127, we analyzed the frequency of CD4.sup.+CD25.sup.+FoxP3.sup.+CD127.sup.lo/− T cells and the function of sorted CD4.sup.+CD25.sup.−CD127.sup.lo/− to alloantigen stimulation. In this study, it is clear that human Tregs as defined by CD4, CD25, CD127 and FoxP3 expression are present within the same range of percentages as control individuals with no autoimmunity. Moreover, the functionality of the Tregs isolated from the patients with T1D cannot be distinguished from healthy control subjects. We cannot explain the basis for differences between our studies and those of others in the T1D field. It had been suggested that the discrepancy might be due to subtle differences in flow cytometry-based techniques for cell separation or different mAbs used. However, our use of distinct markers that identify the overwhelming bulk of Tregs in human peripheral blood is likely to be a more definitive assessment of the Treg numbers and functional potential in this patient population. Lastly, it is interesting to note that several of the T1D patients had high Tregs numbers as compared to the bulk of the control and T1D subjects. This is consistent with some studies in other autoimmune diseases where the frequency of CD4.sup.+CD25.sup.hi T cells was reported to be increased as compared to controls. Moreover, these results fit with mouse studies demonstrating increased Treg number at the time of T1D disease onset as well as other immune disease settings (J. Adams, Q. Tang and J. A. Bluestone, unpublished data). We hypothesize that rather than a Treg-deficiency being the cause of disease precipitation, there is actually increased Treg activity in an attempt to stem the losing battle being waged against the increasingly aggressive effector cells that may indeed become more Treg resistant.
REFERENCES
(175) 1. Sakaguchi, S., N. Sakaguchi, J. Shimizu, S. Yamazaki, T. Sakihama, M. Itoh, Y. Kuniyasu, T. Nomura, M. Toda, and T. Takahashi. 2001. Immunologic tolerance maintained by CD25+CD4+ regulatory T cells: their common role in controlling autoimmunity, tumor immunity, and transplantation tolerance. Immunol Rev 182:18-32. 2. Chatenoud, L., B. Salomon, and J. A. Bluestone. 2001. Suppressor T cells—they're back and critical for regulation of autoimmunity! Immunol Rev 182:149-163. 3. Wood, K. J., and S. Sakaguchi. 2003. Regulatory T cells in transplantation tolerance. Nat Rev Immunol 3:199-210. 4. Singh, B., S. Read, C. Asseman, V. Malmstrom, C. Mottet, L. A. Stephens, R. Stepankova, H. Tlaskalova, and F. Powrie. 2001. Control of intestinal inflammation by regulatory T cells. Immunol Rev 182:190-200. 5. Curotto de Lafaille, M. A., and J. J. Lafaille. 2002. CD4(+) regulatory T cells in autoimmunity and allergy. Curr Opin Immunol 14:771-778. 6. Tang, Q., K. J. Henriksen, M. Bi, E. B. Finger, G. Szot, J. Ye, E. L. Masteller, H. McDevitt, M. Bonyhadi, and J. A. Bluestone. 2004. In vitro-expanded antigen-specific regulatory T cells suppress autoimmune diabetes. J Exp Med 199:1455-1465. 7. von Boehmer, H. 2005. Mechanisms of suppression by suppressor T cells. Nat Immunol 6:338-344. 8. Shevach, E. M. 2002. CD4+CD25+ suppressor T cells: more questions than answers. Nat Rev Immunol 2:389-400. 9. Thornton, A. M., C. A. Piccirillo, and E. M. Shevach. 2004. Activation requirements for the induction of CD4+CD25+ T cell suppressor function. Eur J Immunol 34:366-376. 10. Belghith, M., J. A. Bluestone, S. Barriot, J. Megret, J. F. Bach, and L. Chatenoud. 2003. TGF-beta-dependent mechanisms mediate restoration of self-tolerance induced by antibodies to CD3 in overt autoimmune diabetes. Nat Med 9:1202-1208. 11. Apostolou, I., and H. von Boehmer. 2004. In vivo instruction of suppressor commitment in naive T cells. J Exp Med 199:1401-1408. 12. Bluestone, J. A., and A. K. Abbas. 2003. Natural versus adaptive regulatory T cells. Nat Rev Immunol 3:253-257. 13. Levings, M. K., and M. G. Roncarolo. 2005. Phenotypic and functional differences between human CD4+CD25+ and type 1 regulatory T cells. Curr Top Microbiol Immunol 293:303-326. 14. Weiner, H. L. 2001. Oral tolerance: immune mechanisms and the generation of Th3-type TGF-beta-secreting regulatory cells. Microbes Infect 3:947-954. 15. Tarbell, K. V., S. Yamazaki, K. Olson, P. Toy, and R. M. Steinman. 2004. CD25+CD4+ T cells, expanded with dendritic cells presenting a single autoantigenic peptide, suppress autoimmune diabetes. J Exp Med 199:1467-1477. 16. Baecher-Allan, C., J. A. Brown, G. J. Freeman, and D. A. Hafler. 2001. CD4+CD25 high regulatory cells in human peripheral blood. J Immunol 167:1245-1253. 17. Takahashi, T., Y. Kuniyasu, M. Toda, N. Sakaguchi, M. Itoh, M. Iwata, J. Shimizu, and S. Sakaguchi. 1998. Immunologic self-tolerance maintained by CD25+CD4+ naturally anergic and suppressive T cells: induction of autoimmune disease by breaking their anergic/suppressive state. Int Immunol 10:1969-1980. 18. Shimizu, J., S. Yamazaki, T. Takahashi, Y. Ishida, and S. Sakaguchi. 2002. Stimulation of CD25(+)CD4(+) regulatory T cells through GITR breaks immunological self-tolerance. Nat Immunol 3:135-142. 19. Salomon, B., and J. A. Bluestone. 2001. Complexities of CD28/B7: CTLA-4 costimulatory pathways in autoimmunity and transplantation. Annu Rev Immunol 19:225-252. 20. McHugh, R. S., M. J. Whitters, C. A. Piccirillo, D. A. Young, E. M. Shevach, M. Collins, and M. C. Byrne. 2002. CD4(+)CD25(+) immunoregulatory T cells: gene expression analysis reveals a functional role for the glucocorticoid-induced TNF receptor. Immunity 16:311-323. 21. Kataoka, H., S. Takahashi, K. Takase, S. Yamasaki, T. Yokosuka, T. Koike, and T. Saito. 2005. CD25(+)CD4(+) regulatory T cells exert in vitro suppressive activity independent of CTLA-4. Int Immunol 17:421-427. 22. Tang, Q., E. K. Boden, K. J. Henriksen, H. Bour-Jordan, M. Bi, and J. A. Bluestone. 2004. Distinct roles of CTLA-4 and TGF-beta in CD4+CD25+ regulatory T cell function. Eur J Immunol 34:2996-3005. 23. Ronchetti, S., O. Zollo, S. Bruscoli, M. Agostini, R. Bianchini, G. Nocentini, E. Ayroldi, and C. Riccardi. 2004. GITR, a member of the TNF receptor superfamily, is costimulatory to mouse T lymphocyte subpopulations. Eur J Immunol 34:613-622. 24. Kukreja, A., G. Cost, J. Marker, C. Zhang, Z. Sun, K. Lin-Su, S. Ten, M. Sanz, M. Exley, B. Wilson, S. Porcelli, and N. Maclaren. 2002. Multiple immuno-regulatory defects in type-1 diabetes. J Clin Invest 109:131-140. 25. Putnam, A. L., F. Vendrame, F. Dotta, and P. A. Gottlieb. 2005. CD4+CD25 high regulatory T cells in human autoimmune diabetes. J Autoimmun 24:55-62. 26. Fontenot, J. D., M. A. Gavin, and A. Y. Rudensky. 2003. Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat Immunol 4:330-336. 27. Khattri, R., T. Cox, S. A. Yasayko, and F. Ramsdell. 2003. An essential role for Scurfin in CD4+CD25+ T regulatory cells. Nat Immunol 4:337-342. 28. Gambineri, E., T. R. Torgerson, and H. D. Ochs. 2003. Immune dysregulation, polyendocrinopathy, enteropathy, and X-linked inheritance (IPEX), a syndrome of systemic autoimmunity caused by mutations of FOXP3, a critical regulator of T-cell homeostasis. Curr Opin Rheumatol 15:430-435. 29. Hori, S., T. Nomura, and S. Sakaguchi. 2003. Control of regulatory T cell development by the transcription factor Foxp3. Science 299:1057-1061. 30. Ziegler, S. F. 2006. FOXP3: Of Mice and Men. Annu Rev Immunol 24:209-226. 31. Bisikirska, B., J. Colgan, J. Luban, J. A. Bluestone, and K. C. Herold. 2005. TCR stimulation with modified anti-CD3 mAb expands CD8+ T cell population and induces CD8+CD25+ Tregs. J Clin Invest 115:2904-2913. 32. Fuller, M. J., D. A. Hildeman, S. Sabbaj, D. E. Gaddis, A. E. Tebo, L. Shang, P. A. Goepfert, and A. J. Zajac. 2005. Cutting edge: emergence of CD127 high functionally competent memory T cells is compromised by high viral loads and inadequate T cell help. J Immunol 174:5926-5930. 33. Boettler, T., E. Panther, B. Bengsch, N. Nazarova, H. C. Spangenberg, H. E. Blum, and R. Thimme. 2006. Expression of the interleukin-7 receptor alpha chain (CD127) on virus-specific CD8+ T cells identifies functionally and phenotypically defined memory T cells during acute resolving hepatitis B virus infection. J Virol 80:3532-3540. 34. Huster, K. M., V. Busch, M. Schiemann, K. Linkemann, K. M. Kerksiek, H. Wagner, and D. H. Busch. 2004. Selective expression of IL-7 receptor on memory T cells identifies early CD40L-dependent generation of distinct CD8+ memory T cell subsets. Proc Natl Acad Sci USA 101:5610-5615. 35. Li, J., G. Huston, and S. L. Swain. 2003. IL-7 promotes the transition of CD4 effectors to persistent memory cells. J Exp Med 198:1807-1815. 36. Fontenot, J. D., J. P. Rasmussen, L. M. Williams, J. L. Dooley, A. G. Farr, and A. Y. Rudensky. 2005. Regulatory T cell lineage specification by the forkhead transcription factor foxp3. Immunity 22:329-341. 37. Earle, K. E., Q. Tang, X. Zhou, W. Liu, S. Zhu, M. L. Bonyhadi, and J. A. Bluestone. 2005. In vitro expanded human CD4+CD25+ regulatory T cells suppress effector T cell proliferation. Clin Immunol 115:3-9. 38. Fontenot, J. D., J. L. Dooley, A. G. Farr, and A. Y. Rudensky. 2005. Developmental regulation of Foxp3 expression during ontogeny. J Exp Med 202:901-906. 39. Schubert, L. A., E. Jeffery, Y. Zhang, F. Ramsdell, and S. F. Ziegler. 2001. Scurfin (FOXP3) acts as a repressor of transcription and regulates T cell activation. J Biol Chem 276:37672-37679. 40. Okada, E., M. Yamazaki, M. Tanabe, T. Takeuchi, M. Nanno, S. Oshima, R. Okamoto, K. Tsuchiya, T. Nakamura, T. Kanai, T. Hibi, and M. Watanabe. 2005. IL-7 exacerbates chronic colitis with expansion of memory IL-7R high CD4+ mucosal T cells in mice. Am J Physiol Gastrointest Liver Physiol 288:G745-754. 41. Baecher-Allan, C., E. Wolf, and D. A. Hafler. 2005. Functional analysis of highly defined, FACS-isolated populations of human regulatory CD4+CD25+ T cells. Clin Immunol 115:10-18. 42. Herold, K. C., W. Hagopian, J. A. Auger, E. Poumian-Ruiz, L. Taylor, D. Donaldson, S. E. Gitelman, D. M. Harlan, D. Xu, R. A. Zivin, and J. A. Bluestone. 2002. Anti-CD3 monoclonal antibody in new-onset type 1 diabetes mellitus. N Engl J Med 346:1692-1698. 43. Chen, W., K. C. Herold, and J. A. Bluestone. 2005. Achieving antigen-specific tolerance in diabetes: regulating specifically. Int Rev Immunol 24:287-305. 44. Tang, Q., J. Y. Adams, A. J. Tooley, M. Bi, B. T. Fife, P. Serra, P. Santamaria, R. M. Locksley, M. F. Krummel, and J. A. Bluestone. 2006. Visualizing regulatory T cell control of autoimmune responses in nonobese diabetic mice. Nat Immunol 7:83-92. 45. Cox, A. L., S. A. Thompson, J. L. Jones, V. H. Robertson, G. Hale, H. Waldmann, D. A. Compston, and A. J. Coles. 2005. Lymphocyte homeostasis following therapeutic lymphocyte depletion in multiple sclerosis. Eur J Immunol 35:3332-3342. 46. Viglietta, V., C. Baecher-Allan, H. L. Weiner, and D. A. Hafler. 2004. Loss of functional suppression by CD4+CD25+ regulatory T cells in patients with multiple sclerosis. J Exp Med 199:971-979. 47. Kriegel, M. A., T. Lohmann, C. Gabler, N. Blank, J. R. Kalden, and H. M. Lorenz. 2004. Defective suppressor function of human CD4+CD25+ regulatory T cells in autoimmune polyglandular syndrome type II. J Exp Med 199:1285-1291. 48. de Kleer, I. M., L. R. Wedderburn, L. S. Taams, A. Patel, H. Varsani, M. Klein, W. de Jager, G. Pugayung, F. Giannoni, G. Rijkers, S. Albani, W. Kuis, and B. Prakken. 2004. CD4+CD25 bright regulatory T cells actively regulate inflammation in the joints of patients with the remitting form of juvenile idiopathic arthritis. J Immunol 172:6435-6443. 49. Oberley, M. J., J. Tsao, P. Yau, and P. J. Farnham. 2004. High-throughput screening of chromatin immunoprecipitates using CpG-island microarrays. Methods Enzymol 376:315-334. 50. Cawley, S., S. Bekiranov, H. H. Ng, P. Kapranov, E. A. Sekinger, D. Kampa, A. Piccolboni, V. Sementchenko, J. Cheng, A. J. Williams, R. Wheeler, B. Wong, J. Drenkow, M. Yamanaka, S. Patel, S. Brubaker, H. Tammana, G. Helt, K. Struhl, and T. R. Gingeras. 2004. Unbiased mapping of transcription factor binding sites along human chromosomes 21 and 22 points to widespread regulation of noncoding RNAs. Cell 116:499-509.
(176) It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes. No reference to a publication herein should be construed as an admission that such is prior art.