RNA-coded antibody

Abstract

The present application describes an antibody-coding, non-modified or modified RNA and the use thereof for expression of this antibody, for the preparation of a pharmaceutical composition, in particular a passive vaccine, for treatment of tumours and cancer diseases, cardiovascular diseases, infectious diseases, auto-immune diseases, virus diseases and monogenetic diseases, e.g. also in gene therapy. The present invention furthermore describes an in vitro transcription method, in vitro methods for expression of this antibody using the RNA according to the invention and an in vivo method.

Claims

1. A composition comprising isolated purified single-stranded linear mRNAs encoding an antibody, comprising RNA sequences encoding: (i) a first polypeptide comprising the variable domain of the antibody heavy chain (VH), linked to a heterologous secretory signal coding sequence; and (ii) a second polypeptide comprising the variable domain of the antibody light chain (VL), linked to a heterologous secretory signal coding sequence, wherein the mRNA has been purified by reverse phase chromatography, and wherein the composition is pharmaceutically acceptable.

2. The composition according to claim 1, wherein the antibody is a humanized antibody or a bispecific antibody.

3. The composition according to claim 1, wherein the mRNA is modified, wherein the modification is a sequence modification compared to a wild type mRNA that encodes the antibody.

4. The composition according to claim 3, wherein the mRNA has a G/C content in the coding region which is greater than the G/C content of the coding region of the wild type mRNA sequence, the coded amino acid sequence being unchanged with respect to the native mRNA.

5. The composition according to claim 3, wherein the coding region of the mRNA is modified compared with the coding region of the wild type mRNA such that at least one codon of the wild type mRNA which codes for a tRNA which is relatively rare in the cell is exchanged for a codon which codes for a tRNA which is relatively frequent in the cell and which carries the same amino acid as the relatively rare tRNA.

6. The composition according to claim 1, wherein the mRNA includes at least one base-modified nucleotide chosen from the group consisting of 2-amino-6-chloropurine riboside 5′-triphosphate, 2-aminoadeno sine 5′-triphosphate, 2-thiocytidine 5′-triphosphate, 2-thiouridine 5′-triphosphate, 4-thiouridine 5′-triphosphate, 5-aminoallylcytidine 5′-triphosphate, 5-aminoallyluridine 5′-triphosphate, 5-bromocytidine 5′-triphosphate, 5-bromouridine 5′-triphosphate, 5-iodocytidine 5′-triphosphate, 5-iodouridine 5′-triphosphate, 5-methylcytidine 5′-triphosphate, 5-methyluridine 5′triphosphate, 6-azacytidine 5′-triphosphate, 6-azauridine 5′-triphosphate, 6-chloropurine riboside 5′-triphosphate, 7-deazaadenosine 5′-triphosphate, 7-deazaguanosine 5′-triphosphate, 8-azaadenosine 5′-triphosphate, 8-azidoadenosine 5′-triphosphate, benzimidazole riboside 5′-triphosphate, N1-methyladenosine 5′-triphosphate, N1-methylguanosine 5′-triphosphate, N6-methyladenosine 5′-triphosphate, 06-methylguanosine 5′-triphosphate, pseudouridine 5′-triphosphate, puromycin 5′-triphosphate and xanthosine 5′-triphosphate.

7. The composition according to claim 6, wherein the base-modified nucleotides are chosen from the group consisting of 5-methylcytidine 5′-triphosphate and pseudouridine 5′-triphosphate.

8. The composition according to claim 1, wherein the mRNA additionally has a 5′ cap structure chosen from the group consisting of m7G(5′)ppp (5′(A,G(5′)ppp(5′)A and G(5′)ppp(5′)G.

9. The composition according to claim 1, wherein the mRNA additionally has a poly-A tail of 10 to 200 adenosine nucleotides (SEQ ID NO: 62).

10. The composition according to claim 1, wherein the mRNA additionally has a poly-C tail of 10 to 200 cytosine nucleotides (SEQ ID NO: 54).

11. The composition according to claim 1, wherein the mRNA additionally codes a tag for purification chosen from the group consisting of a polyhistidine tag (HIS tag), a hexahistidine tag (SEQ ID NO: 59), a streptavidin tag (Strep tag), an SBP tag (streptavidin-binding tag), a GST (glutathione S-transferase) tag, a Myc tag, a Swa11 epitope, a FLAG tag and an HA tag.

12. The composition according to claim 3, wherein the modified mRNA comprises sequences encoding the antibody codes for the heavy chains according to SEQ ID NO: 12 and the light chains according to SEQ ID NO: 14.

13. The composition according to claim 1, wherein the mRNA comprises a coding sequence according to SEQ ID NO: 15.

14. The composition according to claim 3, wherein the mRNA comprises a sequence at least 90% identical to the sequence SEQ ID NO: 15 over the total length of the nucleic acid sequence of SEQ ID NO: 15.

15. The composition according to claim 1, wherein the sequences encoding the VH and VL polypeptides are encoded on the same mRNA molecule and are separated by an internal ribosomal entry site (IRES).

16. The composition according to claim 15, wherein the mRNA comprises a poly-A sequence of 10 to 200 adenosine nucleotides and a poly-C sequence of 10 to 200 cytosine nucleotides.

17. The composition according to claim 1, wherein the VH and VL polypeptides comprise the variable domains of Trastuzumab, wherein the antibody binds to HER-2/neu.

18. The composition according to claim 17, wherein: (i) sequences encoding the VH and VL polypeptides are encoded on the same mRNA molecule and are separated by an internal ribosomal entry site (IRES); and (ii) the mRNA comprises a poly-A sequence of 10 to 200 adenosine nucleotides and a poly-C sequence of 10 to 200 cytosine nucleotides.

19. The composition according to claim 1, wherein the mRNA is modified, wherein the modification is a modification chosen from modifications of the nucleotide compared with a wild type mRNA by introduction of a non-native nucleotide and/or a chemically modified nucleotide.

20. The composition of claim 1, wherein the chromatography is over a porous stationary phase comprising non-alkylated polystyrene-divinylbenzene.

21. The composition according to claim 1, wherein the RNA has been additionally purified by affinity chromatography or gel filtration.

22. The composition according to claim 1, wherein, when expressed in a cell, the composition induces production of a CD-20 binding antibody.

23. The composition according to claim 1, wherein the composition comprises a mRNA encoding: (i) a first polypeptide comprising the variable domain heavy chain (VH) of a CD20-binding antibody; and (ii) a second polypeptide comprising the variable domain light chain (VL) of a CD20-binding antibody.

24. The composition according to claim 7, wherein the antibody is a bispecific antibody.

25. The composition according to claim 24, wherein the antibody binds to CD40.

26. The composition according to claim 7, wherein the antibody binds to CD40.

27. The composition according to claim 24, wherein the antibody binds to CD3.

28. The composition according to claim 7, wherein the antibody binds to CD3.

29. The composition according to claim 19, wherein the mRNA has a lipid modification.

30. The composition according to claim 19, wherein the mRNA contains on at least one nucleotide of the RNA a modification of a nucleotide, wherein the nucleotides are chosen from 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methylcytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), pseudouracil, 1-methyl-pseudouracil, queosine, β-D-mannosyl-queosine, wybutoxosine, phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine and inosine.

31. The composition of claim 30, wherein the modified nucleotide is 1-methyl-pseudouracil.

Description

FIGURES

(1) FIG. 1 illustrates the structure of an IgG antibody. IgG antibodies are built up from in each case two identical light and two heavy protein chains which are bonded to one another via disulfide bridges. The light chain comprises the N-terminal variable domain V.sub.L and the C-terminal constant domain C.sub.L. The heavy chain of an IgG antibody can be divided into an N-terminal variable domain V.sub.H and three constant domains C.sub.H1, C.sub.H2 and C.sub.H3.

(2) FIG. 2 shows the gene cluster for the light and the heavy chains of an antibody: (A): Gene cluster for the light chain κ. (B): Gene cluster for the light chain λ. (C): and (D): Gene cluster for the heavy chain. In this context, the variable region of a heavy chain is composed of three different gene segments. In addition to the V and J segments, additional D segments are also found here. The V.sub.H, D.sub.H and J.sub.H segments can likewise be combined with one another virtually as desired to form the variable region of the heavy chain.

(3) FIG. 3 illustrates in the form of a diagram the differences in the light and heavy chains of murine (i.e. obtained in the mouse host organism), chimeric, humanized and human antibodies.

(4) FIG. 4 shows an overview of the structure of various antibody fragments. The constituents of the antibody fragments are shown on a dark grey background.

(5) FIG. 5 shows various variants of antibodies and antibody fragments in FIGS. 5A, 5B and 5C: (A) shows a diagram of an IgG antibody of two light and two heavy chains. (B) shows an Fab fragments from the variable and a constant domain in each case of a light and a heavy chain. The two chains are bonded to one another via a disulfide bridge. (C) shows an scFv fragment from the variable domain of the light and the heavy chain, which are bonded to one another via an artificial polypeptide linker.

(6) FIG. 6 shows a presentation of an antibody-coding (modified) RNA according to the invention as an expression construct. In this: V.sub.H=variable domain of the heavy chain; C.sub.H=constant domain of the heavy chain; V.sub.L=variable domain of the light chain; C.sub.L=constant domain of the light chain; SIRES=internal ribosomal entry site (IRES, superlRES) muag=mutated form of the 3′ UTR of the alpha-globin gene; and A70C30=polyA-polyC tail.

(7) FIG. 7 shows a diagram of the detection of an antibody coded by an RNA according to the invention by means of ELISA on the example of the antigen Her2.

(8) FIG. 8 shows the wild-type DNA sequence of the heavy chain of the antibody rituximab (=Rituxan, MabThera) (wild-type: GC content: 56.5%, length: 1,344) (SEQ ID NO: 1).

(9) FIG. 9 shows the GC-optimized DNA sequence of the heavy chain of the antibody rituximab (=Rituxan, MabThera) (GC content: 65.9%, length: 1,344) (SEQ ID NO: 2).

(10) FIG. 10 shows the wild-type DNA sequence of the light chain of the antibody rituximab (=Rituxan, MabThera) (wild-type: GC content: 58.5%, length: 633) (SEQ ID NO: 3).

(11) FIG. 11 shows the GC-optimized DNA sequence of the light chain of the antibody rituximab (=Rituxan, MabThera) (GC content: 67.2%, length: 633) (SEQ ID NO: 4).

(12) FIG. 12 shows the total construct of the GC-optimized DNA sequence of the antibody rituximab (=Rituxan, MabThera) with the light and heavy chains (SEQ ID NO: 5). The total construct contains the following sequences and cleavage sites (see also alternative cleavage sites of FIG. 25, SEQ ID No. 51):

(13) TABLE-US-00004 ACC linker for an optimum Kozak sequence AAGCTT HindIII TGA stop codon ACTAGT SpeI AGATCT BglII ATGCAT NsiI CATCATCATCATCATCAT (SEQ ID NO: 60) His tag Signal peptide, HLA-A*0201: GC-rich ATGGCCGTGATGGCGCCGCGGACCCTGGTCCTCCTGCTGAGCGGCGCCCT CGCCCTGACGCAGACCTGGGCCGGG (SEQ ID NO: 61). The coding region of the heavy chain sequence starts with the signal peptide as given above (italic). This region is G/C enriched as well. The subsequent sequence starting with CAG represents the actual antibody coding sequence (see FIG. 9) for the heavy chain, which ends with AAG and is followed by the above described His tag sequence. Finally, the open reading frame for the heavy chain ends with the stop codon TGA () The coding region for the light chain sequence starts 3′ upstream with the signal peptide's ATG as given above followed by the light chain's coding region for the light chain starting with CAG running to the stop codon TGA () (see FIG. 11). Both coding regions for the light and the heavy chain are separated by an IRES element () The inventive RNA coded by the construct given in FIG. 12 may or may not contain a (His) tag sequence and may contain a signal peptide sequence different from the above peptide sequence or may even have no signal peptide sequence. Accordingly, the inventive RNA molecule contains preferably the coding region (with or without a signal peptide sequence at its beginning) of the heavy and/or the light chain (e.g. as shown in FIG. 12), preferably in combination with at least one ribosomal entry site.

(14) FIG. 13 shows the wild-type DNA sequence of the heavy chain of the antibody cetuximab (=Erbitux) (wild-type: GC content: 56.8%, length: 1,359) (SEQ ID NO: 6).

(15) FIG. 14 shows the GC-optimized DNA sequence of the heavy chain of the antibody cetuximab (=Erbitux) (GC content: 65.9%, length: 1,359) (SEQ ID NO: 7).

(16) FIG. 15 shows the wild-type DNA sequence of the light chain of the antibody cetuximab (=Erbitux) (wild-type: GC content: 58.2%, length: 642) (SEQ ID NO: 8).

(17) FIG. 16 shows the GC-optimized DNA sequence of the light chain of the antibody cetuximab (=Erbitux) (GC content: 65.7%, length: 642) (SEQ ID NO: 9).

(18) FIG. 17 shows the total construct of the GC-optimized DNA sequence of the antibody cetuximab (=Erbitux) with the light and heavy chains (SEQ ID NO: 10). The total construct contains the following sequences and cleavage sites (see also alternative cleavage sites of FIG. 26, SEQ ID No 52):

(19) TABLE-US-00005 ACC linker for an optimum Kozak sequence AAGCTT HindIII TGA stop codon ACTAGT SpeI AGATCT BglII ATGCAT NsiI CATCATCATCATCATCAT (SEQ ID NO: 60) His tag Signal peptide, HLA-A*0201: GC-rich ATGGCCGTGATGGCGCCGCGGACCCTGGTCCTCCTGCTGAGCGGCGCCCT CGCCCTGACGCAGACCTGGGCCGGG (SEQ ID NO: 61). The coding region of the heavy chain sequence starts with the signal peptide as given above (italic). This region is G/C enriched as well. The subsequent sequence starting with CAG represents the actual antibody coding sequence (see FIG. 14) for the heavy chain, which ends with AAG and is followed by the above described His tag sequence. Finally, the open reading frame for the heavy chain ends with the stop codon TGA () The coding region for the light chain sequence starts 3′ upstream with the signal peptide's ATG as given above followed by the light chain's coding region for the light chain starting with GAC running to the stop codon TGA () (see FIG. 16). Both coding regions for the light and the heavy chain are separated by an IRES element () The inventive RNA coded by the construct given in FIG. 17 may or may not contain a (His) tag sequence and may contain a signal peptide sequence different from the above peptide sequence or may even have no signal peptide sequence. Accordingly, the inventive RNA molecule contains preferably the coding region (with or without a signal peptide sequence at its beginning) of the heavy and/or the light chain (e.g. as shown in FIG. 17), preferably in combination with at least one ribosomal entry site.

(20) FIG. 18 shows the wild-type DNA sequence of the heavy chain of the antibody trastuzumab (=Herceptin) (wild-type: GC content: 57.8%, length: 1,356) (SEQ ID NO: 11).

(21) FIG. 19 shows the GC-optimized DNA sequence of the heavy chain of the antibody trastuzumab (=Herceptin) (GC content: 67.0%, length: 1,356) (SEQ ID NO: 12).

(22) FIG. 20 shows the wild-type DNA sequence of the light chain of the antibody trastuzumab (=Herceptin) (wild-type: GC content: 56.9%, length: 645) (SEQ ID NO: 13).

(23) FIG. 21 shows the GC-optimized DNA sequence of the light chain of the antibody trastuzumab (=Herceptin) (GC content: 66.4%, length: 645) (SEQ ID NO: 14).

(24) FIG. 22 shows the total construct of the GC-optimized DNA sequence of the antibody trastuzumab (=Herceptin) with the light and heavy chains (SEQ ID NO: 15). The total construct contains the following sequences and cleavage sites (see also alternative cleavage sites of FIG. 27, SEQ ID No. 53):

(25) TABLE-US-00006 ACC linker for an optimum Kozak sequence AAGCTT HindIII TGA stop codon ACTAGT SpeI AGATCT BglII ATGCAT NsiI CATCATCATCATCATCAT  (SEQ ID NO: 60) His tag Signal peptide, HLA-A*0201: GC-rich ATGGCCGTGATGGCGCCGCGGACCCTGGTCCTCCTGCTGAGCGGCGCCC TCGCCCTGACGCAGACCTGGGCCGGG (SEQ ID NO: 61). The coding region of the heavy chain sequence starts with the signal peptide as given above (italic). This region is G/C enriched as well. The subsequent sequence starting with GAG represents the actual antibody coding sequence (see FIG. 19) for the heavy chain, which ends with AAG and is followed by the above described His tag sequence. Finally, the open reading frame for the heavy chain ends with the stop codon TGA (_) The coding region for the light chain sequence starts 3′ upstream with the signal peptide's ATG as given above followed by the light chain's coding region for the light chain starting with GAC running to the stop codon TGA (_) (see FIG. 21). Both coding regions for the light and the heavy chain are separated by an IRES element ( . . . ) The inventive RNA coded by the construct given in FIG. 22 may or may not contain a (His) tag sequence and may contain a signal peptide sequence different from the above peptide sequence or may even have no signal peptide sequence. Accordingly, the inventive RNA molecule contains preferably the coding region (with or without a signal peptide sequence at its beginning) of the heavy and/or the light chain (e.g. as shown in FIG. 22), preferably in combination with at least one ribosomal entry site.

(26) FIG. 23 shows RNA-mediated antibody expression in cell culture. CHO or BHK cells were transfected with 20 μg of antibody-encoding mRNA according to the invention which was produced (RNA, G/C enriched, see above) or mock-transfected. 24 hours after transfection protein synthesis was analysed by Western blotting of cell lysates. Cells harboured about 0.5 μg of protein as assessed by Western Blot analysis. Each lane represents 10% of total lysate. Humanised antibodies served as control and for a rough estimate of protein levels. The detection antibody recognises both heavy and light chains; moreover, it shows some unspecific staining with cell lysates (three distinct bands migrating much slower than those of the antibodies). A comparison with control antibodies clearly demonstrates that heavy and light chains were produced in equal amounts.

(27) FIG. 24 shows that RNA-mediated antibody expression gives rise to a functional protein (antibody). Functional antibody formation was addressed by FACS staining of antigen-expressing target cells. In order to examine the production of functional antibodies, cell culture supernatants of RNA-transfected (20 μg of Ab-RNA as defined above in Example 1) cells were collected after 48 to 96 hours. About 8% of total supernatant was used to stain target cells expressing the respective antigen. Humanised antibodies served as control and for a rough estimate of protein levels. Primary antibody used for cell staining: a) humanised antibody; b) none; c,d) supernatant from RNA-transfected cells expressing the respective antibody; e) supernatant from mock-transfected CHO cells. Calculations on the basis of the analysis shown in FIG. 24 reveal that cells secreted more than 12-15 μg of functional antibody within 48-96 hours. Accordingly, the present invention proves that RNA encoding antibodies may enter into cell, may be expressed within the cell and considerable amounts of RNA encoded antibodies are then secreted by the cell into the surrounding medium/extracellular space. Cell transfection in vivo or in vitro by the inventive RNA may therefore be used to provide antibodies acting e.g. therapeutically in the extracellular space.

(28) FIG. 25 shows an alternative sequence of the construct of FIG. 12 (antibody rituximab), wherein the restriction sites have been modified as compared to SEQ ID No. 5 of FIG. 12 (SEQ ID No.: 51). For closer information with regard to the description of various sequence elements it is referred to FIG. 12.

(29) FIG. 26 shows an alternative sequence of the construct of FIG. 17 (antibody cetuximab), wherein the restriction sites have been modified as compared to SEQ ID No. 10 of FIG. 17 (SEQ ID No.: 52). For closer information with regard to the description of various sequence elements it is referred to FIG. 17.

(30) FIG. 27 shows an alternative sequence of the construct of FIG. 22 (antibody trastuzumab), wherein the restriction sites have been modified as compared to SEQ ID No. 15 of FIG. 22 (SEQ ID No.: 53). For closer information with regard to the description of various sequence elements it is referred to FIG. 22.

(31) The following examples explain the present invention in more detail, without limiting it.

EXAMPLES

1. Example

(32) 1.1 Cell Lines and Cell Culture Conditions Used:

(33) The cell lines HeLa (human cervix carcinoma cell line; Her2-positive), HEK293 (human embryonal kidney; Her2-negative) and BHK21 (Syrian hamster kidney; Her2-negative) were obtained from the DMSZ (Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH) in Braunschweig and cultured in RPMI medium enriched with 2 mM L-glutamine (Bio Whittaker) and 10 μg/ml streptomycin and 10 μml of penicillin at 37° C. under 5% CO.sub.2.

(34) 1.2 Preparation of Expression Vectors for Modified RNA Sequences According to the Invention:

(35) For the production of modified RNA sequences according to the invention, the GC-enriched and translation-optimized DNA sequences which code for a heavy chain and a light chain of an antibody (e.g. cetuximab (ERBITUX®), trastuzumab (HERCEPTIN®) and rituximab (RITUXAN®), cf. SEQ ID NO: 1-15, where SEQ ID NO: 1, 3, 6, 8, 11 and 13 represent the particular coding sequences which are not GC-optimized of the heavy and the light chains of these antibodies and SEQ ID NO: 2, 4, 5, 7, 9, 10, 12, 14 and 15 represent the coding GC-enriched sequences (see above)) were cloned into the pCV19 vector (Cure Vac GmbH) by standard molecular biology methods. To ensure equimolar expression of the two chains, an IRES (internal ribosomal entry site) was introduced. The mutated 3′ UTR (untranslated region) of the alpha-globin gene and a polyA-polyC tail at the 3′ end serve for additional stabilizing of the mRNA. The signal peptide of the HLA-A*0201 gene is coded for secretion of the antibody expressed. A His tag was additionally introduced for detection of the antibody. FIG. 6 shows the expression constructs used.

(36) 1.3 Preparation of the G/C-Enriched and Translation-Optimized Antibody-Coding mRNA

(37) An in vitro transcription was carried out by means of T7 polymerase (T7-Opti mRNA Kit, CureVac, Tubingen, Germany), followed by purification with Pure Messenger™ (CureVac, Tubingen, Germany). For this, a DNase digestion was first carried out, followed by an LiCl precipitation and thereafter an HPLC using a porous reverse phase as the stationary phase (PURE Messenger).

(38) 1.4 Detection of RNA-Antibody by Means of Flow Cytometry:

(39) 1 million cells were transfected with the mRNA according to one of SEQ ID NO: 5, 10 or 15 (see above), which codes for an antibody as described above, by means of electroporation and were then cultured in the medium for 16 h. The antibody expressed was detected by means of an FITC-coupled His tag antibody. Alternatively, the secreted antibody from the supernatant of transfected cells was added to non-transfected, antigen-expressing cells and, after incubation, detected by the same method.

(40) 1.5 In Vitro Detection of an Antibody Coded by an RNA according to the Invention by Means of ELISA:

(41) A microtitre plate was loaded with a murine antibody (1) against a first antigen (HER-2). Cell lysate of antigen-expressing cells was then added to the plate. The antigen was bound here by the murine antigen-specific antibody (1). The supernatant of cells which were transfected with a modified mRNA according to the invention which codes for an HER-2-specific antibody was then added to the microtitre plate. The HER-2-specific antibody (2) contained in the supernatant likewise binds to the antibody-bound antigen, the two antibodies recognizing different domains of the antigen. For detection of the bound antibody (2), anti-human IgG coupled to horseradish peroxidase (3-HRP) was added, the substrate TMB being converted and the result determined photometrically.

(42) 1.6 In Vivo Detection of an Antibody Coded by an RNA according to the Invention:

(43) An antibody-coding (m)RNA according to the invention as described above was injected intradermally or intramuscularly into BALB/c mice. 24 h thereafter, the corresponding tissues were removed and protein extracts were prepared. The expression of the antibody was detected by means of ELISA as described here.

(44) 1.7 Detection of an Antibody Coded by an RNA according to the Invention by Means of Western Blotting:

(45) The expressed antibodies from the supernatant of cells which were transfected with a modified mRNA which codes for an antibody as described above were separated by means of a polyacrylamide gel electrophoresis and then transferred to a membrane. After incubation with anti-His tag antibody and a second antibody coupled to horseradish peroxidase, the antibody expressed was detected by means of chemoluminescence.

(46) 1.8 Tumour Model:

(47) SKOV-3 cells were injected subcutaneously into BALB/c mice. Within the following 28 days, eight portions of 10 μg of a modified mRNA which codes for an antibody as described above were injected into the tail vein of the mice. The tumour growth was monitored over a period of 5 weeks.

2. Example

(48) 2.1. Cell Lines

(49) RNA-based expression of humanised antibodies was done in either CHO-K1 or BHK-21 cells. The tumour cell lines BT-474, A-431 and Raji strongly expressing HER2, EGFR and CD20, respectively, were used to record antibody levels. All cell lines except CHO were maintained in RPMI supplemented with FCS and glutamine according to the supplier's information. CHO cells were grown in Ham's F12 supplemented with 10% FCS. All cell lines were obtained from the German collection of cell cultures (DSMZ).

(50) 2.2. Antibody Expression

(51) Various amounts of antibody-RNA (G/C enriched as defined by FIGS. 12, 17, 22, 25, 26, 27) encoding the humanised antibodies Herceptin, Erbitux, and Rituxan, respectively, (see the description given above for Example 1) were transfected into either CHO or BHK cells by electroporation. Conditions were as follows: 300 V, 450 μF for CHO and 300 V, 150 μF for BHK. After transfection, cells were seeded onto 24-well cell culture plates at a density of 2-400.000 cells per well. For collection of secreted protein, medium was replaced by 250 μl of fresh medium after cell attachment to the plastic surface. Secreted protein was collected for 24-96 hours and stored at 4° C. In addition, cells were harvested into 50 μl of phosphate buffered saline containing 0.5% BSA and broken up by three freeze-thaw cycles. Cell lysates were cleared by centrifugation and stored at −80° C.

(52) 2.3. Western Blot Analysis

(53) In order to detect translation of transfected RNA, proteins from either cell culture supernatants or cell lysates were separated by a 12% SDS-PAGE and blotted onto a nitrocellulose membrane. Humanised antibodies Herceptin (Roche), Erbitux (Merck KGAA), and Mabthera=Rituxan (Roche) were used as controls. After blotting was completed, membranes were consecutively incubated with biotinylated goat anti-human IgG (Dianova), streptavidin coupled to horseradish peroxidase (BD), and a chemiluminescent substrate (SuperSignal West Pico, Pierce). Staining was detected with a Fuji LAS-1000 chemiluminescence camera.

(54) 2.4. FACS Analysis

(55) 200.000 target cells expressing the respective antigen were incubated with either control antibodies (Herceptin, Erbitux, Mabthera) or cell culture supernatants. For detection of bound antibodies, cells were stained with biotinylated goat anti-human IgG (Dianova) and PE-labelled streptavidin (Invitrogen). Cells were analysed on a FACSCalibur (BD).