Polynucleotide responsible of haploid induction in maize plants and related processes
11445671 · 2022-09-20
Assignee
- Institut National De La Recherche Agronomique (Inra) (Paris, FR)
- LIMAGRAIN EUROPE (Saint-Beauzire, FR)
- Centre National De La Recherche Scientifique (Paris, FR)
Inventors
- Jean-Pierre Martinant (Vertaizon, FR)
- Jordi COMADRAN (Riom, FR)
- Jean-Baptiste Laffaire (Mozac, FR)
- Peter Rogowsky (Lyons, FR)
- Thomas Widiez (Lyons, FR)
Cpc classification
C12N15/8218
CHEMISTRY; METALLURGY
International classification
A01H1/08
HUMAN NECESSITIES
C12N15/82
CHEMISTRY; METALLURGY
A01H1/04
HUMAN NECESSITIES
Abstract
The present invention concerns an isolated polynucleotide responsible of haploid induction in maize plants and related processes. Additionally, the invention relates to plants that have been genetically transformed with the polynucleotide of the invention. The invention also relates to a process for screening a mutant plant population for enhanced haploid induction by using said isolated polynucleotide. The invention further relates to molecular markers associated with haploid induction in maize plants and their use in quality control for inducer lines.
Claims
1. A process for isolating a mutant haploid inducer sequence in a plant other than maize comprising: (1) determining the presence in a plant population of a sequence that is orthologous to: (a) a polynucleotide comprising or consisting of SEQ ID NO: or (b) a polypeptide encoded by the polynucleotide of (a); and selecting said sequence as an orthologous sequence if it codes for a polypeptide which is expressed in pollen or a pollen tube of the plant, and which comprises a lipid anchor domain in its C-terminal and N-terminal polypeptide sequence; (2a) screening a mutant plant population, other than maize, to identify a mutant haploid inducer of the orthologous sequence determined in (1); or (2b) generating a mutant, haploid inducer, of the orthologous sequence selected in (1) by using a gene editing method, wherein said mutant haploid inducer of the orthologous sequence codes for a polypeptide which does not comprise a lipid anchor domain in its C-terminal polypeptide sequence; and (3) isolating said mutant haploid inducer sequence.
2. The process according to claim 1, wherein the orthologous sequence identified in (2a) is a fragment.
3. A plant other than maize having a mutant haploid inducer sequence isolated by the method according to claim 1.
4. The process according to claim 1, wherein the plant other than maize is not a cereal.
Description
FIGURES
(1)
(2)
(3)
(4)
(5)
(6) Promoter activity of gene GRMZM2G471240 was visualized in transgenic maize plants by histochemical detection of the GUS reporter. In mature anthers of hemizygous plants (A) blue GUS staining was found in about 50% of the pollen grains, whereas no GUS staining was observed in the anther. Observations of isolated pollen (B) and of wild type silk and ovule (C) after pollination with transgenic pollen revealed GUS activity in the pollen tube (arrow) and the fertilized embryo sac (arrow head).
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
EXAMPLES
Example 1
(19) Map Based Cloning of the Gene Involved in Haploid Induction
(20) Fine Mapping
(21) For fine mapping of the ggi1 locus, a previously identified QTL for haploid induction (Barret et al., 2008), 96 highly-recombinant F2i3S2 plants (F2 intermated for 3 generations followed by 2 selfs) and 18 single seed descendants (selected for induction over 7 generations) of the HD99×PK6 cross were genotyped with 10 markers in the umc1144/bnlg1811 interval and tested for haploid induction. Phenotyping was carried out by pollinating the hybrid F564×HD7 homozygous for the recessive glossy1 mutation with pollen of the plants of interest (all wildtype for the GLOSSY1 locus) and counting the percentage of seedlings with a mutant glossy1 phenotype (percentage of glossy) by visual inspection, assuming that the percentage of glossy reflected the percentage of haploid plants. The left border of the QTL interval was determined between markers umc1144 (pos 64.2 Mb) and AY110477 (pos 66.9) and the right border between markers GRMZM2G120587 (pos 68.1 Mb) and CL424968 (pos 70.6 Mb). N1078 (SSD) and SMH37 (F2i3S2), the two inducing lines with the smallest PK6 region at the locus were backcrossed to HD99. After a selfing step a total of 10275 F2 have been generated and screened for recombination within the QTL interval.
First, 130 SNP markers located on chromosome 1 between pos. 65 and 70 Mbp (comprising 34 SNPs discovered by candidate gene re-sequencing) were evaluated for polymorphism between the parents using a KASP genotyping platform (http://www.lgcgenomics.com). From those, 26 polymorphic markers (Table 1) evenly distributed in the region were validated in a subset of 192 F2 plants comprising 96 derived from N1078 and 96 derived from SMH37.
QTL analysis has been reprocessed with these extra marker data on the 114 initial plants and results suggested a putative interval for the underlying determinant of the QTL between SYN24144 (67.72 Mb) and PZE-101081844 (69.28 Mb). Based on this information, three markers flanking the ggi1 interval (GRMZM2G100497_10, GRMZM2G152877_6 and SYN35770) located on chromosome 1 at positions 65734188, 66958748 and 69889217 bp on the B73 reference map v2, respectively, were chosen to screen the 10275 F2 plants for recombination in the interval.
(22) TABLE-US-00001 TABLE 1 SNP markers used in the genotyping of 114 initial recombinants (96 F2i3S2 + 18 SSD). The two SNP markers in italics mark the limit of the putative interval for the underlying determinant of the ggi1 QTL. Chr1_bp KASP Markers id (B73 RefMap V2) Polymorphism GRMZM2G100497_10 * 65734188 A/G GRMZM2G100497_9 65734040 T/C GRMZM2G152877_16 66958261 G/T GRMZM2G152877_6 * 66958748 G/T SYN17701 67056433 A/C PZE-101080848 67646656 A/C GRMZM2G051879_48 67646723 /TTTGTTTTGCA SYN24145 67727585 T/C SYN24144 67727790 T/C SYN24142 67727977 A/C SYN25767 67850058 T/C PZE-101081233 68179267 A/G PZE-101081269 68241700 T/G SYN6864 68437034 A/G SYN6867 68437046 T/C SYN20148 68555034 T/C SYN20145 68557798 A/G PZE-101081484 68558721 A/G SYN25793 68670617 T/C PZE-101081844 69289243 T/G SYN2042 69587711 T/C GRMZM2G117513_1 69888509 A/G ASSAY954_00198 69887082 A/G ASSAY954_00197 69887083 T/G PUT-163a-74233607-3597 69887397 A/C SYN35770 * 69889217 A/G “*” identifies markers used to screen the entire F2 population for recombinants.
The screening of the 10275 F2 plants with SNP markers GRMZM2G100497_10, GRMZM2G152877_6 and SYN35770 identified 531 recombinant plants on the ggi1 interval.
Fine Mapping of the Distortion Bias Trait
The PK6 allele is counter selected compared to a normal allele with a Mendelian segregation. Thus, progeny derived from a plant heterozygous at this locus is distorted and has less than the theoretical rate of 50% of PK6 type alleles. Assuming that the same PK6 locus was responsible for haploid induction and distortion bias, the gene of haploid induction can be fine mapped based on the distortion score of genetic markers at this locus.
A subset of 48 recombinants plants, having a crossing over between GRMZM2G305400b_2 and SYN20148 (Table 2), have been selected and selfed. For each family a set of 48 derived seeds, or less if the selfing was not successful, have been sown and plantlets have been genotyped for the 16 SNP listed in Table 2. Analyses have been done by comparing for each marker the total number of homozygotes plants for Pk6 and HD99 alleles, respectively. The strongest bias was observed for the marker GRMZM2G471240_1 (Table 2 and
(23) TABLE-US-00002 TABLE 2 Observed segregation bias against PK6 allele for 48 recombinants in the subset of 531 recombinants using 16 SNP markers evenly distributed in the region. Column Chr1_bp (V2) represents the physical position on the B73 reference genome v2. The segregation bias is the number of PK6 alleles divided by the number of HD99 alleles. Segregation Bias (nb allele Chr1_bp PK6/nb allele KASP Markers id Polymorphism (V2) HD99) GRMZM2G100497_10 A/G 65734188 0.31 GRMZM2G152877_6 G/T 66958748 0.33 GRMZM2G051879_48 /TTTGTTTTGCA 67646723 0.33 SYN24142 A/C 67727977 0.33 SYN25767 T/C 67850058 0.33 GRMZM2G305400b_2 T/G 67993670 0.33 GRMZM2G120587_2 /GCA 68134724 0.25 PZE-101081233 A/G 68179267 0.18 GRMZM2G471240_1 TACG/ 68241668 0.167 GRMZM2G003530_2 T/C 68437955 0.41 SYN20148 T/C 68555034 0.42 PZE-101081484 A/G 68558721 0.42 SYN25793 T/C 68670617 0.42 PZE-101081844 T/G 69289243 0.42 SYN2042 T/C 69587711 0.44 SYN35770 A/G 69889217 0.42
A set of 48 recombinants comprising 20 recombinants located within the interval with strong segregation bias against PK6 (within 68134724 and 68437955 on the B73 reference genome v2) and 28 extra recombinants in the flanking regions (within 67993670 and 68555034 on the B73 reference genome v2) were considered for further studies.
Analysis of the 48 Recombinants at the Locus
Amongst the 48 families selected to take forward, only 31 produced F2 seeds. For each one of those 31 recombinants producing seeds, 48 seeds (less in a few cases, if not available) were germinated and genotyped in order to select homozygous recombinant plants (HomoRec). Between 3 and 5 plants (preferentially homozygous recombinant plants) per recombinant family were further grown and self-pollinated.
For the initial screening of 31 families (up to 48 plants per family) only 4 markers were used: SYN25767, GRMZM2G305400b_2, SYN20148 and SYN25793 (see Table 2). The detected homozygous recombinants plants were further genotyped with a set of 78 markers.
Gene Content of the ggi1 Region
Preliminary analysis of the gene content in the maize B73 reference genome v2 highlighted 13 gene models (Table 3). Two of the putative gene models (GRMZM2G471240 and GRMZM2G062313) were expressed in anthers. Expression data have been obtained by interrogation of an eFP browser, Winter et al., 2007, Li et al., 2010 and Sekhon et al., 2011. Sequence analysis of the two gene models revealed the two corresponding genes are homologues from the Acyl transferase/acyl hydrolase/lysophospholipase family. The second one appeared to be a pseudogene and is then likely not expressed and the result obtained from the eFP browser should be an artefact due to the homology with the GRMZM2G471240 gene. This pseudogene may have arisen by duplication of the first one. The expression of GRMZM2G471240 in anthers (Table 3) made of it the best candidate gene which may be responsible for the ggi1 phenotype. Moreover, the marker GRMZM2G471240_1 developed on the gene GRMZM2G471240 exhibits the strongest PK6 allele segregation bias among the tested markers (
(24) TABLE-US-00003 TABLE 3 Genome position and expression data available for the 13 gene models identified within the ggi1 interval. The filtered gene set (FGS, solid evidence for gene) contains the 32540 genes of the maize genome published by Schnable et al., 2009. The working gene set (WGS) contains more than 30000 additional gene models, many of which are mere informatic predictions without further evidence. Expression data comes from interrogation of an eFP browser, Winter et al., 2007, Li et al., 2010 and Sekhon et al., 2011. Id Chr1_Pos(bp-V2) Set Expression data GRMZM2G544129 68212317 WGS not in eFP browser database GRMZM2G544135 68215141 WGS not in eFP browser database GRMZM2G703616 68236616 WGS Constitutive GRMZM2G471240 68240862 FGS Anthers GRMZM2G062320 68318898 FGS constitutive GRMZM2G062313 68323867 WGS Anthers GRMZM2G062304 68365105 WGS not in eFP browser database AC213048.3_FG003 68398780 WGS germinating seed GRMZM2G520395 68404999 WGS not in eFP browser database AC213048.3_FG002 68409826 FGS not in eFP browser database GRMZM2G047877 68415868 WGS not in eFP browser database GRMZM2G047843 68419166 WGS Constitutive GRMZM2G510681 68428105 WGS not in eFP browser database
GRMZM2G471240 Specific Expression is Confirmed by qRT-PCR Experiments in Maize Tissues
Since cross-hybridisation between closely related genes cannot be excluded in the micro-array data used to generate the eFP browser (Sekhon et al., 2011), gene specific primers Pat_qRT_F1 and Pat_qRT_R1 (see Table 9 for SEQ ID No 6 and SEQ ID No 7), were used to do qRT-PCR on different maize tissues of genotype A188 (
Approximately 100 mg of fresh tissue was quick frozen in liquid nitrogen and ground to powder with mortar and pestle. Total RNA was extracted with 1 mL of Tri-reagent according to the instructions of the supplier (Invitrogen). After ethanol precipitation, the RNA was resuspended in 30 μL of RNase-free water and treated with RNase-free DNase. The DNase was inactivated according to the instructions of the supplier (Ambion). Approximately 5 μg of total RNA were reverse transcribed using random hexamers (Amersham Biosciences) and reverse transcriptase without RNaseH activity (Fermentas) in a final volume of 20 μL. A total of 2.5×10.sup.5 copies of GeneAmplimer pAW109 RNA (Applied Biosystems) were added to the RT reaction. The cDNA was diluted 50 times, and 2 μL was used in a volume of 20 μL containing 10 μL of the FastStart SYBR Green Master mix (Roche) on a StepOne Real-Time PCR System (Applied Biosystems). According to the manufacturer's protocol, the following program was used: 10 min at 95° C., followed by 40 cycles of 95° C. for 10 sec and 60° C. for 30 sec. Data were analysed using the StepOne Software v2.3 (Applied Biosystems). Expression levels were calculated using Actin as reference gene. The primers used are actin-q-F and actin-q-R respectively of SEQ ID No 8 and SEQ ID No 9 listed in Table 9.
The data confirmed the anther-specific expression suggested by the eFP browser and demonstrated in addition that the GRMZM2G471240 gene was (i) only expressed in mature tassels and not in immature tassels and (ii) expressed in pollen. The data did not allow to determine whether the GRMZM2G471240 gene was expressed only in pollen or also in other parts of mature tassels, for example the tapetum.
GRMZM2G471240 Specific Expression is Confirmed by Promoter Fusion in Transgenic Maize Plants.
The use of transgenic maize plants harboring fusions of the promoter of gene GRMZM2G471240 from genotype PK6 or B73 with the GUS reporter gene allowed to determine the spatial expression pattern of the gene during male reproduction. Based on the blue staining indicative of GUS activity, the gene has a strict gametophytic expression in pollen and pollen tube. It is not expressed in the sporophytic tissues of the anther (
Materials and Methods
Promoter regions of 2657 bp (ZmPL.sub.B73) corresponding to SEQ ID No 50 and of 2534 bp (ZmPL.sub.PK6) corresponding to SEQ ID No 51 were amplified with primer pairs attB4_prom_PL_2576_B73 corresponding to SEQ ID No 46/attB1r_prom_PL_2576_B73 corresponding to SEQ ID No 47 and attB4_promoPL_2534_PK6 corresponding to SEQ ID No 48/attB1r_promoPL_2534_PK6 corresponding to SEQ ID No 49, respectively, and introduced into pENTR P4-P1R (Invitrogen) by BP reaction. The prom ZmPL::GUS cassette in plasmids L1542 (pZmPL.sub.B73full::GUS::pmock3′),
SNP Densification of the QTL
In order to densify the region, online available resources related to the HAPMAP2 project (Chia et al., 2012) were used to develop 60 new SNP markers between 68180000 pb and 68420000 pb on the physical B73 reference genome v2. Among the 60 newly developed markers (Table 4), only 3 were polymorphic between HD99 and PK6, 18 markers were monomorphic and 39 revealed a presence/absence polymorphism (Presence/Absence Variant or PAV) without amplification in PK6. Even if the use of endpoint PCR protocol to detect absence of the locus is less accurate than use of quantitative PCR, thanks to the high density of markers and the high frequency of absence of amplification at this locus for the PK6 allele, it can be assumed that there is a deletion of at least 100 kb downstream of the GRMZM2G471240 candidate gene in PK6 compared to the reference sequences of genotype B73 and the parental line HD99. This data suggests that the pseudogene GRMZM2G062313 would be absent in PK6.
(25) TABLE-US-00004 TABLE 4 HAPMAP2 extra markers within the ggi1 interval and marker allele for HD99 and PK6. NA is for absence of the allele, marker type is defined between the lines HD99 and PK6. KASP Markers id Chr1_bp (V2) Marker type HD99 PK6 PZE0166358891 68180209 Monomorphic G:G G:G PZE0166359231 68180549 Polymorphic T:T C:C PZE0166359596 68180914 PAV C:C NA PZE0166380893 68202211 PAV G:G NA PZE0166393715 68215033 Monomorphic A:A A:A PZE0166394286 68215604 Polymorphic G:G A:A PZE0166394451 68215769 Monomorphic T:T T:T PZE0166394686 68216004 PAV C:C NA PZE0166394709 68216027 Monomorphic A:A A:A PZE0166394976 68216294 PAV G:G NA PZE0166407328 68228646 Polymorphic T:T G:G PZE0166408365 68229683 PAV A:A A:A PZE0166422350 68243668 PAV C:C NA PZE0166435898 68257216 Monomorphic G:G G:G PZE0166437099 68258417 PAV A:A NA PZE0166480583 68301901 PAV T:T NA PZE0166480678 68301996 PAV C:C NA PZE0166480837 68302155 PAV C:C NA PZE0166481099 68302417 PAV G:G NA PZE0166481496 68302814 PAV A:A NA PZE0166487364 68308682 PAV G:G NA PZE0166488186 68309504 PAV G:G NA PZE0166488255 68309573 PAV G:G NA PZE0166497519 68318837 PAV A:A NA PZE0166500667 68321985 Monomorphic C:C C:C PZE0166502346 68323664 PAV C:C NA PZE0166502392 68323710 PAV C:C NA PZE0166502746 68324064 PAV A:A NA PZE0166503514 68324832 PAV C:C NA PZE0166504940 68326258 PAV G:G NA PZE0166505171 68326489 PAV C:C NA PZE0166505239 68326557 PAV C:C NA PZE0166505408 68326726 PAV C:C NA PZE0166505464 68326782 PAV A:A NA PZE0166507774 68329092 PAV A:A NA PZE0166507883 68329201 PAV A:A NA PZE0166508182 68329500 PAV A:A NA PZE0166508227 68329545 PAV C:C NA PZE0166508604 68329922 PAV G:G NA PZE0166508796 68330114 PAV C:C NA PZE0166509054 68330372 PAV T:T NA PZE0166540610 68361928 PAV T:T NA PZE0166540778 68362096 PAV C:C NA PZE0166540846 68362164 PAV T:T NA PZE0166542974 68364292 PAV G:G NA PZE0166544802 68366120 PAV C:C NA PZE0166544973 68366291 Monomorphic A:A A:A PZE0166546986 68368304 PAV A:A NA PZE0166576167 68397485 PAV T:T NA PZE0166578457 68399775 Monomorphic G:G G:G PZE0166578493 68399811 Monomorphic A:A A:A PZE0166586633 68407951 Monomorphic G:G G:G PZE0166587074 68408392 Monomorphic G:G G:G PZE0166588267 68409585 Monomorphic C:C C:C PZE0166588497 68409815 Monomorphic C:C C:C PZE0166588562 68409880 Monomorphic G:G G:G PZE0166594311 68415629 Monomorphic C:C C:C PZE0166594370 68415688 Monomorphic G:G G:G PZE0166597249 68418567 Monomorphic G:G G:G PZE0166598227 68419545 Monomorphic G:G G:G
Re-sequencing data of the candidate gene GRMZM2G471240 in the PK6 and HD99 parental lines allowed to develop 17 markers on the gene in addition to the previously developed marker GRMZM2G471240_1 (Table 5a). Moreover, a quantitative real time PCR marker named qPCR2313 was developed to follow the presence/absence of the pseudogene GRMZM2G062313 (not present in PK6).
(26) TABLE-US-00005 TABLE 5a Molecular markers developed on GRMZM2G471240 by re-sequencing. Chr1_bp KASP Markers id (V2) HD99 PK6 GRMZM2G471240_2 68241270 C:C T:T GRMZM2G471240_3 68241339 T:T C:C GRMZM2G471240_1 68241668 TACG:TACG — GRMZM2G471240_5 68241700 A:A C:C GRMZM2G471240_7 68241902 G:G C:C GRMZM2G471240_8 68241910 G:G A:A GRMZM2G471240_9 68242070 G:G C:C GRMZM2G471240_10 68242166 T:T C:C GRMZM2G471240_11 68242296 G:G A:A GRMZM2G471240_13 68242401 A:A C:C GRMZM2G471240_14 68242433- — CGAG:CGAG 68242434 GRMZM2G471240_15 68242448 T:T C:C GRMZM2G471240_16 68242452 C:C A:A GRMZM2G471240_17 68242547 A:A C:C GRMZM2G471240_18 68242553 G:G A:A GRMZM2G471240_19 68242566 T:T C:C GRMZM2G471240_20 68242569 G:G C:C GRMZM2G471240_21 68242602 G:G A:A
(27) TABLE-US-00006 TABLE 5b Molecular markers developed on GRMZM2G382717 and GRMZM5G866758 by re-sequencing. KASP Markers id Chr1_bp (V2) Polymorphism GRMZM2G382717_1 68113455 G/T GRMZM5G866758_1 68430654 C/A
Marker Analysis on a Diversity Panel
A diversity panel was assembled, consisting of 127 lines containing 116 lines from diverse origins representative of the diversity in the maize lines gene-pool, and 11 inducer lines of various origin including PK6 and stock6. The panel was genotyped with a subset of 59 markers (Table 6) previously described (from HAPMAP2 project data and genes re-sequencing data, Table 5a and 5b) between positions 67850001 and 68430000.
(28) TABLE-US-00007 TABLE 6 SNP Marker set used on the diversity panel. Marker type refers to the polymorphism between line PK6 and HD99. Marker id (KASP and Marker real time PCR) Chr1_bp (V2) type SYN25767 67850058 SNP GRMZM2G382717_1 68113455 SNP PZE0166359596 68180914 PAV PZE0166380893 68202211 PAV PZE0166394686 68216004 PAV PZE0166394976 68216294 PAV PZE0166408365 68229683 PAV GRMZM2G471240_2 68241270 SNP GRMZM2G471240_3 68241339 SNP GRMZM2G471240_7 68241902 SNP GRMZM2G471240_8 68241910 SNP GRMZM2G471240_9 68242070 SNP GRMZM2G471240_10 68242166 SNP GRMZM2G471240_11 68242296 SNP GRMZM2G471240_13 68242401 SNP GRMZM2G471240_14 68242433 INDEL GRMZM2G471240_15 68242448 SNP GRMZM2G471240_16 68242452 SNP GRMZM2G471240_17 68242547 SNP GRMZM2G471240_18 68242553 SNP GRMZM2G471240_19 68242566 SNP GRMZM2G471240_20 68242568 SNP GRMZM2G471240_21 68242602 SNP PZE0166422350 68243668 PAV PZE0166437099 68258417 PAV PZE0166480583 68301901 PAV PZE0166480678 68301996 PAV PZE0166480837 68302155 PAV PZE0166481099 68302417 PAV PZE0166481496 68302814 PAV PZE0166487364 68308682 PAV PZE0166488186 68309504 PAV PZE0166488255 68309573 PAV PZE0166497519 68318837 PAV PZE0166502346 68323664 PAV PZE0166502392 68323710 PAV PZE0166502746 68324064 PAV qPCR2313 68324620 PAV PZE0166503514 68324832 PAV PZE0166504940 68326258 PAV PZE0166505171 68326489 PAV PZE0166505239 68326557 PAV PZE0166505408 68326726 PAV PZE0166505464 68326782 PAV PZE0166507774 68329092 PAV PZE0166507883 68329201 PAV PZE0166508182 68329500 PAV PZE0166508227 68329545 PAV PZE0166508604 68329922 PAV PZE0166508796 68330114 PAV PZE0166509054 68330372 PAV PZE0166540610 68361928 PAV PZE0166540778 68362096 PAV PZE0166540846 68362164 PAV PZE0166542974 68364292 PAV PZE0166544802 68366120 PAV PZE0166546986 68368304 PAV PZE0166576167 68397485 PAV GRMZM5G866758_1 68430654 SNP
Genotyping data obtained on the panel indicated that the large deletion downstream the GRMZM2G471240 candidate gene is present on 11.5% of the 116 maize lines, which are not haploid inducers, suggesting that this large deletion and the presence/absence of the pseudogene GRMZM2G062313 contained in it is not the causal factor of haploid induction.
Among the markers developed on the candidate gene GRMZM2G471240 and tested on the diversity panel, the marker GRMZM2G471240_14 (INS/DEL of 4 bp CGAG/) is the only one having an allele exclusively present on the PK6 genotype and the 10 other inducing lines, which could mean that this is the causal polymorphism of the ggi1 QTL. The insertion of 4 bp targeted by the marker GRMZM2G471240_14 is specific to the original inducing line stock6 and all its tested derivatives including PK6 and is absent in all the non-inducer lines tested. This insertion of 4 bp in the 4.sup.th intron of the GRMZM2G471240 gene PK6 causes a translation frameshift resulting in a shorter protein with the last 20 amino acids differing completely from the original protein sequence. None of the other polymorphisms tested were exclusive to PK6 or absent from all non-inducer lines.
Description of Recombinants for the Candidate Gene GRMZM2G471240
Homozygous recombinant plants were obtained and genotyped for 28 of the 31 recombinant families. Two recombinants families appeared to have recombination breakpoints inside the candidate gene GRMZM2G471240 (see
Phenotyping for Haploid Induction Capacity of Recombinants Families
All the 28 homozygous recombinant families from the previous step have been evaluated for inducing ability together with two positive controls (PK6 and RWS), and five negative controls (HD99, F2, WPP112, Nys302 and EM1201).
Each line has been crossed with a tester (female line), and the resulting ear obtained from each cross has been evaluated for their rate of haploid and diploid kernels by counting the percentage of ligule-less or glossy seedlings amongst the progeny (Lashermes and beckert 1988, Neuffer, 1997; Prigge, 2011). The glossy test has been described within example 1. The ligule-less test involves a recessive trait that can be used as alternative to the glossy test as a visual marker for the identification of haploid plants. The induction tests were duplicated and carried out in Limagrain and INRA using the ligule-less and glossy systems respectively.
Both duplicates provided the same results. The phenotypic results of both tests show that all the plants that are PK6 at the marker GRMZM2G471240_14 (INS:INS) are clear haploid inducers and that the plants that are HD99 at the marker GRMZM2G471240_14 (DEL:DEL) are not haploid inducers.
Example 2
(29) Comparison of the GRMZM2G471240 Alleles
(30) Sequencing of GRMZM2G471240 Alleles
(31) The genomic sequence of the GRMZM2G471240 candidate gene in genotype PK6 was determined by PCR amplification of overlapping fragments from reference sequence B73, which were arbitrarily named A, C and D, with primers G471240_A_F and G471240_A_R (sequences SEQ ID No 10 and SEQ ID No 11), G471240_C_F and G471240_C_R (sequences SEQ ID No 12 and SEQ ID No 13), and G471240_D_F and G471240_D_R3 (or G471240_B_R), respectively of sequences SEQ ID No 14, SEQ ID No 15 and SEQ ID No 16 (see Table 9 for primer sequences). PCR fragments obtained with a proof reading enzyme were either sequenced directly or after prior subcloning (SEQ ID No 1).
The genomic sequence of the GRMZM2G471240 candidate gene in genotype HD99 was determined by PCR amplification of overlapping fragments, which were arbitrarily named A, C and B with primers G471240_A_F and G471240_A_R, G471240_C_F and G471240_C_R and G471240_B_F and G471240_B_R, respectively sequences SEQ ID No 10, SEQ ID No 11, SEQ ID No 12, SEQ ID No 13, SEQ ID No 17 and SEQ ID No 16 (see Table 9 for primer sequences). PCR fragments obtained with a proof reading enzyme were either sequenced directly or after prior subcloning (SEQ ID No 2). An extraction of the corresponding region from the reference genome of genotype B73 (Schnable et al., 2009) is also presented in the sequence listing (SEQ ID No 23).
Sequence Alignment of Alleles at the GRMZM2G471240 Locus
Alignment with the reference sequence of genotype B73 (SEQ ID No 23) revealed numerous polymorphisms between PK6, HD99 and B73. Among them was a 4 bp insertion in exon 4 of the GRMZM2G471240 candidate gene in genotype PK 6 (
Subcellular Localization of the ZmPL Protein
The subcellular localization of the ZmPL protein from genotypes PK6 and HD99 was determined in a heterologous system by in frame fusions to citrine fluorescent protein, stable transformation of Arabidopsis thaliana and observation of transgenic root tips by confocal microscopy. Based on the fluorescence of the chimeric proteins the wildtype ZmPL.sub.HD99 protein was mainly located in the cytoplasmic membrane but also present in the cytoplasm, whereas the truncated ZmPL.sub.PK6 protein was absent from the cytoplasmic membrane and almost entirely located in the cytoplasm (
Materials and Methods: Arabidopsis ecotype Col-0 was transformed with the floral-dip method (Clough and Bent, 1998) and a modified procedure for Agrobacterium preparation (Logemann et al., 2006); ZmPL CDS (without STOP codon) from HD99 and PK6 were PCR amplified from cDNA made from mature anther tissues using respectively primers pair PL-CDS-F_Dtopo corresponding to SEQ ID No 52/PL-CDS-HD99-R2 corresponding to SEQ ID No 53 and PL-CDS-F_Dtopo/PL-CDS-PK6-R2 corresponding to SEQ ID No 54, and cloned into pENTR/D-topo (Invitrogen). The cassettes pUBQ10::ZmPL-CDS::CITRINE were obtained by LR reaction between the fragments pUBQ10, ZmPL CDS, mCITRINE and the destination vector pK7m34GW (Karimi et al., 2005). The fragments for pUBQ10 and mCITRINE were gifts of Yvon Jallais (Jaillais et al., 2011) plasmid L1540 (pUBQ10::CDS-ZmPL.sub.HD99::Citrine) is described in
Fluorescence was detected with a Zeiss LSM 710 Laser Scanning Microscope: mCITRINE was excited with a 510-nm laser signal and fluorescence was detected using 520-580 nm bandpass filters. Image data were analyzed by using Image J software.
Example 3
(32) Creation of New Inducer Alleles by Transgenesis
(33) Transformation Protocol
(34) The plasmids used for the production of ZmPL.sub.PK6-OE, ZmPL.sub.HD99-OE and ZmPL.sub.A188-RNAi plants contained the backbone of vector pSB11 (Ishida et al., 1996), a Basta resistance cassette (Oryza sativa (rice) Actin promoter and intron, Bar gene and Nos terminator) next to the right border, a GFP cassette (CsVMV promoter and FAD2 intron, GFP gene and Nos terminator) and either the ZmPL coding sequence (primers see Table 9) under the control of the constitutive rice Actin promoter and intron, or a unique gene fragment (primers see Table 9) separated by the rice Tubulin intron in hairpin configuration and followed by the AtSac66 terminator. Agrobacterium-mediated transformation of maize inbred line A188 was executed according to a published protocol (Ishida et al., 2007). For each transformation event the number of T-DNA insertions was evaluated by qPCR, and the integrity of the transgene was verified by PCR with primers situated in the AtSac66 terminator near the end of the construct of interest next to the left border.
Inhibition of the PL Gene by RNAi (L1465) ZmPL.sub.A188-RNAi
The gene encoded by gene model GRMZM2G471240 was named PL (phospholipase) and the respective genotype indicated by an extension in subscript.
The PL.sub.A188-RNAi construct tests whether (i) the inducing capacity of genotype PK6 was linked to a loss-of-function of the PL gene and whether a (ii) a knockdown of the PL gene could yield a stronger phenotype or other phenotypes than the 4 bp insertion in the PK6 allele.
For the RNAi construct primers G471240-attB1 and G471240-attB2 of SEQ ID No 18 and SEQ ID No 19 (see Table 9) were used to amplify an intronless fragment of 363 bp in exon 4 on genomic DNA of genotype A188, the genotype used for maize transformation. Contrary to the beginning of the PL gene, the chosen fragment shared no sequence homology with the related pseudogene GRMZM2G062313. The fragment was recombined (BP Gateway reaction) into the vector pDONR221 (Invitrogen) to yield the entry clone L1457 (
Subsequently the fragment was recombined (LR Gateway reaction) into the vector pBIOS 898 (gift of W. Paul, Biogemma). The resulting plasmid L1465 was used for maize transformation (
The lines to be tested for haploid induction were crossed as male parent with hybrid F564×DH7 homozygous for the glossy1 mutation. A minimum of 100 kernels was germinated and scored for the glossy (bright leaf surface, adhering water droplets) phenotype indicative of haploid plantlets. Haploid induction rate was determined as the percentage of glossy plantlets among germinated plantlets.
Hemizygous transgenic lines were either selfed or crossed with the glossy tester. At least 50 kernels were sown and sprayed with Basta herbicide (glufosinate-ammonium solution at 1.5 g/L) 10 days after germination. Segregation distortion was determined as the number of Basta resistant transgenic plantlets divided by the number of wild-type plantlets.
For five independent transformation events (U261 to U265) fertile plants with offspring were obtained. Event U265 provoked some haploid induction both using a heterozygous T1 plant (1 haploid plantlet among 197 T2 seedlings) and a homozygous T2 plant (1 haploid plantlet among 1000 T3 seedlings). It needs to be recalled that other loci than ggi1 influence haploid induction rate and that the genotype A188 used for maize transformation has an extremely low haploid induction rate (0 haploid plantlets among over 3000 seedlings tested) compared to other genotypes. Finally, event U264 showed a strong segregation bias (8.3% and 3.6% instead of the 50% transgenics expected) both in T1 and T2 seedlings and some haploid induction (1 haploid plantlet among 1177 T2 seedlings). All results for event U264 are based on heterozygous plants, since so far no confirmed homozygous plants have been obtained for this event.
Ectopic Over Expression (OE) of the PL.sub.PK6 Allele (L1482)
For the PL.sub.PK6-OE construct genomic DNA containing the entire coding sequence of genotype PK6 was amplified with primers PLPK6_HDPK_F1 and PLPK6_PK6_R1, of sequences SEQ ID No 20 and SEQ ID No 21 (see Table 9). The PCR product was recombined (BP Gateway reaction) into the vector pDONR221 (Invitrogen) to yield the entry clone L1478 (
The lines to be tested for haploid induction were crossed as male parent with hybrid F564×DH7 homozygous for the glossy1 mutation. A minimum of 100 kernels was germinated and scored for the glossy (bright leaf surface, adhering water droplets) phenotype indicative of haploid plantlets. Haploid induction rate was determined as the percentage of glossy plantlets among germinated plantlets.
Hemizygous transgenic lines were either selfed or crossed with the glossy tester. At least 50 kernels were sown and sprayed with Basta herbicide (glufosinate-ammonium solution at 1.5 g/L) 10 days after germination. Segregation distortion was determined as the number of Basta resistant transgenic plantlets divided by the number of wild-type plantlets.
Ectopic Over Expression of the PL.sub.HD99 Allele (L1483), Complementation of PK6 Allele
In genotype PK6 a 4 bp insertion in the PL gene causes a truncation of the predicted protein. If this truncated protein was not functional at all, then the introduction of the non-inducing wild type allele PL.sub.HD99 should complement the mutation and block the induction of gynogenesis.
For the PL.sub.HD99-OE construct genomic DNA containing the entire coding sequence of genotype HD99 was amplified with primers PLPK6_HDPK_F1 and PLPK6_HD99_R1 of sequences SEQ ID No 20 and SEQ ID No 22 (Table 9). The PCR product was recombined (BP Gateway reaction) into the vector pDONR221 (Invitrogen) to yield the entry clone L1479 (
Subsequently the CDS of PL.sub.HD99 was recombined (LR Gateway reaction) into the vector pBIOS 895 (gift of W. Paul, Biogemma). The resulting plasmid L1483, in which the PL.sub.HD99 CDS is placed under the control of a rice Actin promoter and followed by a AtSac66 terminator, was used for maize transformation (
The lines to be tested for haploid induction were crossed as male parent with hybrid F564×DH7 homozygous for the glossyl mutation. A minimum of 100 kernels was germinated and scored for the glossy (bright leaf surface, adhering water droplets) phenotype indicative of haploid plantlets. Haploid induction rate was determined as the percentage of glossy plantlets among germinated plantlets.
Hemizygous transgenic lines were either selfed or crossed with the glossy tester. At least 50 kernels were sown and sprayed with Basta herbicide (glufosinate-ammonium solution at 1.5 g/L) 10 days after germination. Segregation distortion was determined as the number of Basta resistant transgenic plantlets divided by the number of wild-type plantlets.
Example 4
(35) Creation of Mew Inducer Alleles by Targeted Transgenesis Mutation of the PL.sub.A188 Allele
(36) The CAS9/CRISPR system allows to create small deletions at nearly any site in the genome. The system have been used to create two distinct deletions: one at the beginning of the gene to obtain a true knockout (as compared to the knockdown by RNAi) and a second one to obtain an independent frameshift towards the end of the gene copying the 4 bp insertion in the PL.sub.PK6 allele. TALEN system has also been used to create new mutants (Gaj et al., 2013).
Example 5
(37) Use of GRMZM2G471240_14 Marker for Control Quality of Seed Lots.
(38) Four seed stocks for inducer hybrids (RWS×RWK76) and five for inducer lines (RWS or RWK76) from different years and seasons of production have been tested for seed purity at the locus of PL gene, about 350 kernel by lot have been randomly selected from each lot, and tested with the GRMZM2G471240_14 marker by the KASP method (with the three primers of the following sequences: SEQ ID No 43: GAGGGCATCGGCATTGCTTCCTT (Common); SEQ ID No 44: GTCAACGTGGAGACAGGGAGC and SEQ ID No 45: GTCAACGTGGAGACAGGGAGG). The results are shown in Table 7 below.
(39) TABLE-US-00008 TABLE 7 wt means wild type and NA reflects missing data RWS × RWS × RWS × RWS × RWK76 RWK76 RWK76 RWK76 RWS RWS RWK76 RWK76 RWK76 Lot reference 2010 2010 2012 2012 2011 2012 2012 2012 2013 winter summer winter summer summer summer winter summer winter Number of 344 354 372 372 305 372 372 372 369 tested kernels wt:wt 9 10 0 0 0 0 0 0 0 (Homozygous wt) pk6:wt 50 56 1 4 0 0 0 0 0 (Heterozygous pk6/wt) pk6:pk6 284 282 371 368 305 368 367 368 360 (homozygous for pk6) NA 1 6 0 0 0 4 5 4 9
According to these results the two first lots show an insufficient purity to be further used to induce haploids. These findings corroborate the low induction rate of these lots that was below 5% when the normal rate is about 10%. Moreover the more recent lots can be used for inducing new haploid lines.
This molecular test can be done on each kernel individually, but also on a pool of kernel samples obtained by a puncher according to the method described in the patent application FR No. 1450486.
The method currently used for purity control is based on the sowing of these seeds, crossing of each plant with a female to test inducer ability, and sowing of seed obtained from this cross to identify haploid and diploids plants. The phenotypic markers ligule-less or glossy (Lashermes and Beckert 1988, Neuffer, 1997) are currently used for this last test. With the new method according to the invention, the time needed to obtain information on quality control of the lot is drastically reduced and thanks to the number of seeds that can be investigated the accuracy of the results is much higher.
Example 6
(40) Identification of a Zm PL Orthologues
(41) Analysis of the deduced amino acid sequences of the wildtype ZmPL.sub.b73 protein corresponding to SEQ ID No 26, revealed the presence of two S-palmitoylation sites at position 10 and position 423 as well as an S-farnesylation site at position 423 (Table 8a).
(42) The second site (423) is missing in the truncated ZmPL.sub.PK6 protein. Together with the fact that the truncated ZmPL.sub.PK6 protein is no longer localized in the cytoplasmis membrane, this suggests that the presence of a lipid anchor at the C-terminus of ZmPL may be essential for the correct subcellular localization of the protein.
A survey of the deduced amino acids from cereal orthologues showed that the proteins from Brachypodium dystachion (SEQ ID 29), Sorghum bicolor (SEQ ID 30), Panicum virgatum (SEQ ID 31 and SEQ ID 32), Setaria italica (SEQ ID 33) and Oryza sativa (SEQ ID 34) are all predicted to have lipid anchors at their N-terminus and C-terminus, whereas for Hordeum vulgare (SEQ ID 28) only a N-terminal lipid anchor was predicted. The data suggest that the presence of an N-terminal and a C-terminal lipid anchor by S-palmitoylation, S-farnesylation and/or S-geranylgeranylation may be necessary for subcellular localization in the cytoplasmic membrane (Tables 8b to 8h)
The presence of an N-terminal and C-terminal membrane anchor may be a useful additional criterion for the identification of functional orthologues in non-cereals, where phylogenetic analysis, even combined with the criterion of expression in the pollen, is often not sufficient.
Materials and Methods: For the prediction of lipid anchors allowing membrane association, the “GPS-lipid” web site predictor (http://lipid.biocuckoo.org/webserver.php) was used with the following parameters: “Search for palmitoylation, N-myristoylation, farnesylation geranylgeranylation post-translational modifications” and threshold setting “High”.
(43) TABLE-US-00009 TABLE 8a ID Position Peptide Score Cutoff Type SEQ ID 10 SYSSRRPCNTCSTKA 3.817 3.076 S-Palmitoylation: No 26 Cluster B SEQ ID 423 INPRGSRCASYDI** 5.806 1.983 S-Palmitoylation: No 26 Cluster A SEQ ID 423 INPRGSRCASYDI** 12.801 4.003 S-Farnesylation: No 26 Non-consensus
(44) TABLE-US-00010 TABLE 8b ID Position Peptide Score Cutoff Type SEQ ID 11 YYSSRRPCNACSTKA 4.969 3.076 S-Palmitoylation: No 30 Cluster B SEQ ID 14 SRRPCNACSTKAMAG 3.224 3.076 S-Palmitoylation: No 30 Cluster B SEQ ID 141 KPRYNGKCLRNLIMS 2.223 1.983 S-Palmitoylation: No 30 Cluster A SEQ ID 430 GGASRRTCASKVSNV 6.338 4.003 S-Farnesylation: No 30 Non-consensus SEQ ID 430 GGASRRTCASKVSNV 6.329 1.617 S-Geranylgeranylation: No 30 Non-consensus
(45) TABLE-US-00011 TABLE 8c ID Position Peptide Score Cutoff Type SEQ ID 10 SYSSRRPCNACRTKA 4.493 3.076 S-Palmitoylation: No 33 Cluster B SEQ ID 13 SRRPCNACRTKAMAG 1.979 1.396 S-Palmitoylation: No 33 Cluster C SEQ ID 415 ACAGGSRCCSPVKT* 3.977 1.983 S-Palmitoylation: No 33 Cluster A SEQ ID 415 ACAGGSRCCSPVKT* 8.327 4.003 S-Farnesylation: No 33 Non-consensus SEQ ID 415 ACAGGSRCCSPVKT* 1.112 0.486 S-Geranylgeranylation: No 33 CC/CXC SEQ ID 416 CAGGSRCCSPVKT** 20.687 4.003 S-Farnesylation: No 33 Non-consensus SEQ ID 416 CAGGSRCCSPVKT** 4.008 0.486 S-Geranylgeranylation: No 33 CC/CXC
(46) TABLE-US-00012 TABLE 8d ID Position Peptide Score Cutoff Type SEQ ID 10 SYSSRRPCSVCRTKA 4.212 3.076 S-Palmitoylation: No 31 Cluster B SEQ ID 13 SRRPCSVCRTKAMAG 3.754 3.076 S-Palmitoylation: No 31 Cluster B SEQ ID 422 GAAGGSRCCSPVKLY 3.323 1.983 S-Palmitoylation: No 31 Cluster A SEQ ID 422 GAAGGSRCCSPVKLY 5.441 4.003 S-Farnesylation: No 31 Non-consensus SEQ ID 422 GAAGGSRCCSPVKLY 4.063 0.486 S-Geranylgeranylation: No 31 CC/CXC SEQ ID 423 AAGGSRCCSPVKLY* 21.309 4.003 S-Farnesylation: No 31 Non-consensus SEQ ID 423 AAGGSRCCSPVKLY* 4.572 0.486 S-Geranylgeranylation: No 31 CC/CXC
(47) TABLE-US-00013 TABLE 8e ID Position Peptide Score Cutoff Type SEQ ID 10 SYSSRRPCSVCRTKA 4.212 3.076 S-Palmitoylation: No 32 Cluster B SEQ ID 13 SRRPCSVCRTKAMAR 3.82 3.076 S-Palmitoylation: No 32 Cluster B SEQ ID 422 GCAGGSTCCSPVKT* 4.031 1.983 S-Palmitoylation: No 32 Cluster A SEQ ID 422 GCAGGSTCCSPVKT* 8.189 4.003 S-Farnesylation: No 32 Non-consensus SEQ ID 422 GCAGGSTCCSPVKT* 2.906 0.486 S-Geranylgeranylation: No 32 CC/CXC SEQ ID 423 CAGGSTCCSPVKT** 19.819 4.003 S-Farnesylation: No 32 Non-consensus SEQ ID 423 CAGGSTCCSPVKT** 4.822 0.486 S-Geranylgeranylation: No 32 CC/CXC
(48) TABLE-US-00014 TABLE 8f ID Position Peptide Score Cutoff Type SEQ ID 6 **MASYACRRPCESC 1.559 1.396 S-Palmitoylation: No 29 Cluster C SEQ ID 10 SYACRRPCESCRTRA 1.793 1.396 S-Palmitoylation: No 29 Cluster C SEQ ID 13 CRRPCESCRTRAMAG 1.727 1.396 S-Palmitoylation: No 29 Cluster C SEQ ID 423 PANGKSRC******* 10.896 4.003 S-Farnesylation: No 29 Non-consensus SEQ ID 423 PANGKSRC******* 4.688 1.617 S-Geranylgeranylation: No 29 Non-consensus
(49) TABLE-US-00015 TABLE 8g ID Position Peptide Score Cutoff Type SEQ ID 7 *MAASYSCRRTCEAC 1.542 1.396 S-Palmitoylation: No 34 Cluster C SEQ ID 11 SYSCRRTCEACSTRA 7.03 3.076 S-Palmitoylation: No 34 Cluster B SEQ ID 197 NALLSDICISTSAAP 3.092 3.076 S-Palmitoylation: No 34 Cluster B SEQ ID 430 GEPSGVACKR***** 8.222 4.003 S-Farnesylation: No 34 Non-consensus
(50) TABLE-US-00016 TABLE 8h ID Position Peptide Score Cutoff Type SEQ ID 6 **MASYWCRRPCESC 1.698 1.396 S-Palmitoylation: No 28 Cluster C SEQ ID 10 SYWCRRPCESCSTRA 6.059 3.076 S-Palmitoylation: No 28 Cluster B SEQ ID 13 CRRPCESCSTRAMAG 1.855 1.396 S-Palmitoylation: No 28 Cluster C SEQ ID 195 NARLADICIGTSAAP 3.494 3.076 S-Palmitoylation: No 28 Cluster B
Example 7
(51) Identification of a ZmPL Functional Orthologue from Arabidopsis thaliana.
(52) To identify the functional ortholog of ZmPL in the genome of the model plant Arabidopsis thaliana a phylogenetic tree of all patatin-like phospholipases was constructed. Using preferential expression in pollen and the prediction of an N-terminal and a C-terminal lipid anchor as additional criteria, the gene At1g61850.1 was identified as the best candidate. The mutants N642695, N657713 and N596745 (obtained from NASC), which were in a Col-0 wildtype background, were crossed as male parent to a glabra1 mutant line.
(53) TABLE-US-00017 TABLE 9 primers identification SEQ ID name Primer name Primer sequence (5′ to 3′) Primer use 18 G471240-attB1 GGGGACAAGTTTGTACAAAAAAGCAG RNAi fragment GCTTTCGACGTCCGAGCAGGGCC 19 G471240-attB2 GGGGACCACTTTGTACAAGAAAGCTG RNAi fragment GGTTCACCGAGGGCATCGGCATTGCT TCC 20 PLPK6_HDPK_F1 GGGGACAAGTTTGTACAAAAAAGCAG PL.sub.PK6-OE, PL.sub.HD99-OE GCTTAGGCAATGGCGAGCTACTC and PL.sub.HD99-fusion 21 PLPK6_PK6_R1 GGGGACCACTTTGTACAAGAAAGCTG PL.sub.PK6-OE GGTAGCCTTGTTCTCCTCTCCT 22 PLPK6_HD99_R1 GGGGACCACTTTGTACAAGAAAGCTG PL.sub.HD99-OE GGTAGCCACTTGTCTTAGATAT 6 Pat_qRT_F1 GAGAAGGAAGCAATGCCGATGCC qRT-PCR 7 Pat_qRT_R1 TGATTGACAGTAAAGCCACTTGTCTT qRT-PCR AGATATC 8 actin-q-F TACCCGATTGAGCATGGCA qRT-PCR 9 actin-q-R TCTTCAGGCGAAACACGGA qRT-PCR 10 G471240_A_F AGTTCATCACTAATCACACTTATTGT allelic sequencing GCC 11 G471240_A_R GGCGGACGTGCCAATGCA allelic sequencing 17 G471240_B_F GAACGCTCTGCTCTCGGACG allelic sequencing 16 G471240_B_R TATATTCAAGAACATATA allelic sequencing 12 G471240_C_F ATGTCCGCGCTGAGGAAGCCA allelic sequencing 13 G471240_C_R GAGCACTGCCGCGCCGTGTA allelic sequencing 14 G471240_D_F GGAGCTGTACCCAGTGAAGCCG allelic sequencing 15 G471240_D_R3 TTAGATATCGTACGACGCACATCTAG allelic sequencing A 46 attB4_prom_PL_2576_B73 GGGGACAACTTTGTATAGAAAAGTTG CTTCAAAATGGTTATGCGTAGGTTGA A 47 attB1r_prom_PL_2576_B73 GGGGACTGCTTTTTTGTACAAACTTG CTGCCGCCTTCGACAACAC 48 attB4_promoPL_2534_PK6 GGGGACAACTTTGTATAGAAAAGTTG CTTTTAGGATAAGCCAGAGTTTGT 49 attB1r_promoPL_2534_PK6 GGGGACTGCTTTTTTGTACAAACTTG CTGCCGCCTTCGACCGCAC 52 PL-CDS-F_Dtopo CACCATGGCGAGCTACTCGTCGCGGC GT 53 PL-CDS-HD99-R2 GATATCGTACGACGCACATCTAGAG 54 PL-CDS-PK6-R2 GCGAGCCCACCGAGGGCAT
REFERENCES
(54) Eyal, Y., Curie, C., and McCormick, S. (1995). Pollen specificity elements reside in 30 bp of the proximal promoters of two pollen-expressed genes. Plant Cell 7, 373-384;
(55) Barret P; Brinkmann M; Beckert M., (2008) A major locus expressed in the male gametophyte with incomplete penetrance is responsible for in situ gynogenesis in maize, Theoretical and Applied Genetics, 117(4): 581-594;
(56) Bordes J., Création de lignées haploldes doublées de maës par gynogenèse induite in situ: amélioration de la méthode et intégration dans les schémnas de sélection. Thèse, 2006;
(57) Chia J M, Song C, Bradbury P J, Costich D, de Leon N, Doebley J, Elshire R J, Gaut B, Geller L, Glaubitz J C, Gore M, Guill K E, Holland J, Hufford M B, Lai J, Li M, Liu X, Lu Y, McCombie R, Nelson R, Poland J, Prasanna B M, Pyhäjärvi T, Rong T, Sekhon R S, Sun Q, Tenaillon M I, Tian F, Wang J, Xu X, Zhang Z, Kaeppler S M, Ross-Ibarra J, McMullen M D, Buckler E S, Zhang G, Xu Y, Ware D., Maize HapMap2 identifies extant variation from a genome in flux. Nat Genet. 2012 Jun. 3;44(7): 803-7;
(58) Clough, S. J., and Bent, A. F. (1998). Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana. Plant J 16: 735-743.-Coe 1959. A line of maize with high haploid frequency. The American Naturalist, November-december 1959, p381;
(59) Deimling S, Röber F K, Geiger H H, (1997), Methodology and genetics of in vivo haploid induction in maize [in German]. Vortr Pflanzenz üchtg, 38: 203-224;
(60) Dong X; Xu X; Miao J; LI L; Zhang D; Mi X; Liu C; Tian X; Melchinger A E; Chen S., (2013) Fine mapping of qhir1 influencing in vivo haploid induction in maize. Theoretical And Applied Genetics, 126(7): 1713-1720;
(61) Gaj T., Gersbach C. A., and C. F. Barbas, ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends in Biotechnology, July 2013, Vol. 31, No. 7;
(62) Geiger H H; Gordillo G A., (2009) Doubled Haploids In Hybrid Maize Breeding, Maydica, 54(4): 485-499;
(63) Greenblatt I M; Bock M., A commercially desirable procedure for detection of monoploids in maize. JOURNAL OF HEREDITY, 58: 9-13;
(64) Ishida, Y., Saito, H., Ohta, S., Hiei, Y., Komari, T., and Kumashiro, T. (1996). High efficiency transformation of maize (Zea mays L) mediated by Agrobacterium tumefaciens. Nat. Biotechnol., 14, 745-750;
(65) Ishida, Y., Hiei, Y., and Komari, T., (2007). Agrobacterium-mediated transformation of maize. Nat Protoc 2, 1614-1621;
(66) Jaillais, Y., Hothorn, M., Belkhadir, Y., Dabi, T., Nimchuk, Z. L., Meyerowitz, E. M., and Chory, J., (2011). Tyrosine phosphorylation controls brassinosteroid receptor activation by triggering membrane release of its kinase inhibitor. Genes Dev., 25, 232-237;
(67) Karimi, M., Bleys, A., Vanderhaeghen, R., and Hilson, P., (2007). Building blocks for plant gene assembly. Plant Physiol., 145, 1183-1191;
(68) Lashermes P; Beckert M., Genetic Control Of Maternal Haploidy In Maize (Zea Maysl.) And Selection Of Haploid Inducing Lines. Theoritical And Applied Genetics, 76(3): 405-410;
(69) Li, P., Ponnala, L., Gandotra, N., Wang, L., Si, Y., Tausta, S. L., Kebrom, T. H., - Provart, N., Patel, R., Myers, C. R., Reidel, E. J., Turgeon, R., Liu, P., Sun, Q., Nelson T. & T. P. Brutnell. The developmental dynamics of the maize leaf transcriptome, NATURE GENETICS, 2010, 42(12): 10p.;
(70) Logemann, E., Birkenbihl, R. P., Ulker, B., and Somssich, I. E. (2006). An improved method for preparing Agrobacterium cells that simplifies the Arabidopsis transformation protocol. Plant Methods 2: 16.
(71) Needleman and Wunsch, 1970 A general method applicable to the search for similarities in the amino acid sequence of two proteins. J. Mol. Biol. 48:443-453
(72) Neuffer M G; Coe E H; Wessler S R. Mutants of maize; Neuffer M G; Coe E H; Wessler E R SR-1997-Vol: 468p;
(73) Prigge V; Sanchez C; Dhillon B S; Schipprack W; Araus J L; Banziger M; Melchinger A E., (2012) Doubled Haploids in Tropical Maize: I. Effects of Inducers and Source Germplasm on in vivo Haploid Induction Rates., Crop Science, 51(4): 1498-1506;
(74) Prigge V; Xu X W; Li L; Babu R; Chen S J; Atlin G N; Melchinger A E. (2011) New insights into the genetics of in vivo induction of maternal haploids, the backbone of doubled haploid technology in maize. Genetics, 190(2): 781-793;
(75) Rober F K; Gordillo G A; Geiger H H., (2005) In vivo haploid induction in maize—Performance of new inducers and significance of doubled haploid lines in hybrid breeding. Maydica, 50(3-4): 275-283;
(76) Schnable, P. S., Ware, D., Fulton, R. S., Stein, J. C., Wei, F., Pasternak, S., Liang, C., Zhang, J., Fulton, L., Graves, T. A., et al., (2009). The B73 maize genome: complexity, diversity, and dynamics. Science 326, 1112-1115;
(77) Sekhon, R. S., Lin, H., Childs, K. L., Hansey, C. N., Buell, C. R., de Leon, N., and Kaeppler, S. M. (2011)., Genome-wide atlas of transcription during maize development. Plant J. Cell Mol. Biol., 66, 553-563;
(78) Weber D F., (2014) Today's Use of Haploids in Corn Plant Breeding Advances In Agronomy, 123: 123-144;
(79) Winter D., Vinegar B., Nahal. H., Ammar R., Wilson G. V., and N. J. Provar. An “Electronic Fluorescent Pictograph” Browser for Exploring and Analyzing Large-Scale Biological Data Sets. 2007, PLoS One 2(8):e718;
(80) Xu X W; Li L; Dong X; Jin W W; Melchniger A E; Chen S J., (2013) Gametophytic and zygotic selection leads to segregation distortion through in vivo induction of a maternal haploid in maize. Journal Of Experimental Botany, 64(4): 1083-1096.