Veterinary composition of marine algae and <i>Andrographis </i>sp extracts, which can be used to treat infections in fish

Abstract

Veterinary composition comprising an extract of seaweed containing at least 5% fucoidians and an Andrographis sp plant extract containing at least 5% of andrographolide, which is useful in the control and prevention of infections produced by intracellular microorganisms in fishes.

Claims

1. An immunostimulant composition administered to fish comprising: an extract of Andrographis sp containing andrographolide and a seaweed extract containing fucoidan, wherein the ratio of andrographolide:fucoidan is in the ratio of 100:450; wherein the seaweed extract comprises an aqueous extract of brown algae, wherein the brown algae is selected from the group consisting of Fucus vesiculosus, Fucus evanescens, Fucus distichus, Fucus serratus, Pelvetia wrightii, Ascophyllum nodosum, Himanthalia Lorea, Bifurcaria bifurcata, Sargassum stenophyllum, Hizikia fusiforme, Durvillaea antarctica, Lessonia nigrescens, Lessonia trabeculata, Lessonia vadosa, Macrocystis pyrifera, Undaria pinnatifida, Padina pavonica, Laminarfa angustata, Laminaria japonica, Ecklonia kurome, Adenocystis utricularis, Dictyota menstrualis, Spatoglossum schroederi and Chordaria; and wherein the brown algae belongs to either (1) a fucal order of algae, each member of the fucal order of algae comprising one or more binding fucose units having glycosidic bonds of type (1-3) or (1-4) and sulfated groups located at positions C-2, C-3, or C-4, or (2) a Laminare order of algae, each member of the Laminare order of algae comprising one or more binding fucose units having glycosidic bonds of type (1-2) or (1-3) and sulfated groups located at positions C-2 or C-4.

2. The composition of claim 1, wherein each member of the fucal order of algae and each member of the Laminare order of algae also comprises a galactan fraction in the bonds (1-3) and (1-6) of the sulphated groups at position C4.

3. The composition of claim 1, wherein said composition is formulated as an immunostimulant incorporated in fish food for treating infections.

4. The composition of claim 1, wherein said composition is a fish food additive having andrographolide and fucoidan.

5. The composition of claim 1, wherein the extract of Andrographis sp is selected from the group consisting of Andrographis paniculata, Andrographis affinis Nees, Andrographis beddomei, Andrographis echioides Nees, Andrographis elongata, Andrographis humifusa, Andrographis lineata Nees, Andrographis macrobotrys Nees, Andrographis nallamalayana, Andrographis neesiana, Andrographis ovata, Andrographis paniculata nees, Andrographis rothii, Andrographis serpyllifolia, Andrographis viscosula Nees, Andrographis viscosula var. explicata and Andrographis wightiana.

6. The composition of claim 1, wherein the seaweed extract is an extract of Macrocystes pyrifera.

7. A method for controlling and preventing infections caused by intracellular microorganisms in fishes which comprises mixing the composition of claim 1 with the fishes' food or diet.

8. The method of claim 7, comprising mixing the composition with the fishes' food or diet in a ratio in the range of 0.5 to 2.5 kg per ton of food.

9. The method of claim 8, comprising mixing the composition with the fishes' food or diet at a rate of 1 kg per ton of food.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1. It illustrates the conformation of distribution in fish ponds prior to challenge with P. salmonis, where (1) DE indicates the diet with the composition of the present invention and (2) C means the diet without the composition of the present invention.

(2) FIG. 2. It illustrates the conformation of distribution in the ponds during the challenge with P. salmonis, where (1) DE indicates the diet with the composition of the present invention, (2) C means the diet without the composition of the present invention and (3) T stands for trojans.

(3) FIG. 3. It illustrates the expression analysis of IL-12 in SHK-1 cells treated with algae extract (FUTERPENOL®, A composition of botanic extracts and derivated of seaweeds with bioactive molecules that promote immunity against intracellular pathogens), at different concentrations (0.01-1 μg/ml) and re-suspended in ethanol and water. Analysis of the effect of IL-12 expression was performed at 4 hours post-treatment in SHK-1 cells treated with the extract 0.001 μg/mL, 0.01 μg/mL and 0.1 μg/mL. The results show the averages±standard error of triplicate samples. The ⋅ indicate significant differences in relation to the control without stimulus, analyzed by t-student, p<0.05, ns, not significant.

(4) FIGS. 4A and 4B. Illustrates the analysis of the expression kinetics of IL-12 (4A) and IFN-1 (4B) in SHN-1 cells treated with 0.5 nM Andrographolide (AP), 1 μg/ml seaweed extract (BC), the composition of the invention (AP+BC) and diet alone as control (C). Analysis of the effect of IL-12 and IFN-1 expression was performed on SHK-1 cells treated with the composition of the present invention. The differences were statistically significant in relation to the t-Student control. ⋅p<0.05, n=3.

(5) FIG. 5. It illustrates the detection of P. salmonis in cells surviving the infection. The bacterial change was determined in SHK-1 cells treated with 0.5 nM Andrographolide (AP), 1 μg/ml seaweed extract (BlendC), the composition of the invention (AP+BlendC) and the diet alone as control (C). This analysis was determined based on the differences of Ct. The differences were statistically significant in relation to untreated cell control and infected with P. salmonis, t-Student. *p<0.05, n=3.

(6) FIGS. 6A and 6B. It illustrates the analysis of the expression of IL-12 (6A) and IFN-I (6B) on surviving cells to the infection with IPNv: The expression of IL-12 and IFN-I was done in SHK-1 cell treated with seaweed (BlendC) 1 μg/ml, the composition of the invention (AP+BlendC) and the diet alone as a control (C) and infected by the virus. The differences were statistically significant in relation to control *p<0.05, n=3.

(7) FIG. 7. It illustrates the detection of IPNv in surviving cell from the infection. The virus-shifting times were determined on SHK-1 cells treated with the seaweed extract (BlendC) 1 μg/ml, and the diet alones as a control (C). This analysis was determined on the basis of the differences of Ct. The differences were statistically significant in relation to the control of cells without treatment or infected by the virus, t-Student. *p<0.05, n=3.

(8) FIG. 8. It illustrates the distribution of daily mortality of the fishes from the group fed only with the diet without the composition of the present invention, the trojans and the treated, during the 60 days of study by SRS challenge.

(9) FIG. 9. It illustrates the percentage distribution accumulated of daily mortality of the fishes from the group fed with the diet only without the composition of the present invention, the trojans and the treated, during the 60 days of study by SRS challenge.

DETAILED DESCRIPTION OF THE INVENTION

(10) The present invention is related with a synergistic immunostimulant composition for fishes that comprise fucoidians and andrographolide, where the fucoidians are obtained from extracts prepared from Fucus vesiculosus, Fucus evanescens, Fucus distichus, Fucus serratus, Pelvetia wrightii, Ascophyllum nodosum, Himanthalia Lorea, Bifurcaría bifurcata, Sargassum stenophylum, Hizikia fusiforme, Durvillaea antártica, Lessonia nigrescens, Lessonia trabeculata, Lessonia vadosa, Macrocystis pyrifera, Undaria pinnatifida, Padina pavonia, Laminaría angustata, Laminaría japónica, Ecklonia kurome, Adenocytis utricularis, Dictyota menstrualis, Spatoglossum schroederio Chordaria flagelliformis. While the andrographolide are obtained from extracts prepared belonging from Andrographis affinis Nees, Andrographis beddomei, Andrographis echioides Nees, Andrographis elongata, Andrographis humifusa, Andrographis lineata Nees, Andrographis macrobotrys Nees, Andrographis nallamalayana, Andrographis neesiana, Andrographis ovata, Andrographis paniculata Nees, Andrographis, rothii, Andrographis serpyllifolia, Andrographis viscosula Nees Andrographis viscosula var. explicata y Andrographis wightiana. In the synergistic immunostimulating composition, the ratio fucoidian to andrographolide is in the range of 5:95 to 20:80. Preferably, the ratio fucoidian to andrographolide is 10:90.

(11) The present invention is related mainly to a synergistic immunostimulating composition for fishes comprising fucoidians and andrographolide, which allows an effective control and prevention of infections produced by intracellular microorganisms.

(12) The present invention is related more particularly to a synergistic composition comprising fucoidians and andrographolide, which allows an effective control and prevention of piscirickettsiosis, viral haemorrhagic septicemia, infectious pancreatic necrosis, infectious haematopoietic necrosis, pancreas disease and sleeping disease, infectious anemia of salmon, francicellosis and renibacteriosis.

(13) The present composition comprises synergistic comprising fucoidian and andrographolide, which allow effective control and prevention of piscirickettsiosis and infectious pancreatic necrosis (IPN) in fishes.

Example 1

Preparation of Aqueous Flour Extract Containing Fucoidian

(14) The dried brown algae were first pulverized by freezing them in liquid N.sub.2, and using a porcelain mortar, to obtain a 300 micron algae powder.

(15) Ten grams of the ground dried algae mixture were extracted with 200 ml of distilled water with continuous stirring for 4 hours at 25° C. The algal tissue was removed by simple filtration. The aqueous extract was centrifuged until a clarified solution. The solution is precipitated by the addition of 3 volumes of ethanol. The precipitate was recovered by centrifugation and dried in an electric oven at 50° C.

Example 2

Preparation of Andrographolide and Preparation of Extract

(16) For the preparation of the extract of andrographolide, dried leaves of Andrographis sp were used, the extraction was carried out using an 80% v/v water-ethanol mixture, the final extract is a composition containing 80% of the native extract and 20% of maltodextrin.

Example 3

Preparation of a Composition Andrographolide and Fucoidan

(17) A mechanical mixture of both dry extracts was performed in a ratio of 90/10 of algae extract (fucoidan) and extract of Andrographis sp., respectively. For this, a KitchenAid Heavy Duty mixer (Model KS5SS, USA) was used with stainless steel container, adjustable speed and capacity >1.5 L. The selected mixing speed was, according to the equipment, level 2 equivalent to ±70 rpm of the upper shaft. The mixing time was 10 minutes, the mixture was prepared according to the proportions of ingredients and the densities of these were determined through a gravimetric method with results of 0.77 grs/cm.sup.3.

Example 4

Results of Immune Effect in Fucoidan Cell Lines

(18) The SHK-1 cell line, derived from Salmo salar's kidney, was used. The assay was started when the cells shown 90% of confluence, and then they were stimulated with algae extract (5% of Fucoidian).

(19) The treatment was applied independently to SHK-1 cells, in L15 medium supplemented with 10% fetal bovine serum at a dose of 1 μg/ml, the cells were incubated at 20° C. during 24 hours of stimulation time.

(20) After the treatment, the cell supernatant was discarded and the cells were lysed with 200 μl of TRK lysis buffer and stored in tubes of 1.5 ml at −80° C. RNA extraction from the cells was performed using the RNA extraction kit (Omega-bio-tek), according to the manufacturer's protocol.

(21) Once the total RNA was obtained, the mRNAs were transformed into cDNA by means of the reverse transcription reaction, which was performed in a total volume of 20 μl of solution, divided in two parts. The first reaction was performed in a mixture containing 1.6 μl of oligo-dT (1.25 μg/ml) for analysis of gene expression of the markers 1.0 μl of dNTPs (10 mM); 8.0 μl of total RNA (5 μg) and 0.1 μl of nuclease-free water and it was incubated for 10 min at 60° C. to elute secondary structures of the mRNAs. Subsequently, a second mixture comprised of 1 μl of M-MLV reverse transcriptase (200 U), 4 μl of 5× enzyme buffer and 0.5 μl of recombinant RNAseOUT ribonuclease inhibitor (40 U) was added to the solution, in a total volume of 5.5 μl and it will be incubated for 1 h at 37° C. Finally for the inactivation of reverse transcriptase, the reaction mixture was incubated at 72° C. during 10 min. The synthesized cDNA was stored at ˜20° C. for its subsequent amplification for PCR or its quantification by real-time (qPCR) for IFN-1 and IL-12 genes relative to EF-1α expression using the primers listed in Table 1 below:

(22) TABLE-US-00001 TABLE 1 Gen Primers Genbank IFN-I Fwd TGGGAGGAGATATCACAAAGC AY216594 (SEQ ID No: 1) Rev TCCCAGGTGACAGATTTCAT  (SEQ ID No: 2) IL-12 Fwd CTGAATGAGGTGGACTGGTATG BT049114 (SEQ ID No: 3) Rev ATCGTCCTGTTCCTCCG  (SEQ ID No: 4) ELF-1 Fwd TGCCCCTCCAGGATGTCTAC  AF321836 (SEQ ID No: 5) Rev CACGGCCCACAGGTACTG  (SEQ ID No: 6)

(23) Each amplification reaction was performed using 2 μl of cDNA as the annealing, 0.2 μM (Table 1) primers, 0.8 μl MgCl.sub.2 (25 mM), 1 μl Lightcycler® Fast Start DNA Master SYBR Green amplification mixture in a volume of 10 μl. The reaction was carried out in a LightCycler® 1.5 thermal cycler. The program consists of the following steps: initial denaturation at 95° C. for 10 min, followed by a PCR reaction of 35 cycles each composed of denaturation at 95° C. for 10 seconds, mating at 58° C. for 10 seconds and extension at 70° C. for 10 seconds. Subsequently a cycle to obtain the melting curve for 20 s at 95° C., and finally a cooling cycle at 40° C. for 30 s. For the relative quantification, it was performed with a standard curve, consisting of reactions containing dilutions of the purified PCR product of known concentration for the gene of interest. After obtaining and quantifying the PCR product corresponding to each gene, dilutions were made in a range of 10.sup.7 to 10.sup.2 numbers of copies/μl for each gene under study, for the subsequent calculation of the efficiency of the reaction, where the following relation, E=10(−1/slope)−1 will be used. For the calculation of relative expression by the qPCR technique amplification reactions of the ELF-1 gene cDNA were performed on each RNA sample from cells treated with the different stimuli in vitro. Then, the expression changes were calculated using the comparative CT method (Pfaffl, 2001).

(24) The results are illustrated in FIG. 3.

Example 5

Result of Immune Effect in Andrographolide Cell Lines

(25) The SHK-1 cell line, derived from Salmo's kidney, was used. The assay was started when the cells showed 90% confluency, where they were stimulated with an extract of Andrographis sp (10% total Andrographolide).

(26) The treatment was applied independently to SHK-1 cells in L15 medium supplemented with 10% fetal bovine serum at a dose of 5 nM of the Andrographis sp extract, the cells were incubated at 20° C. for 24 hours of stimulation time.

(27) After the treatment was finished, the cell supernatant was discarded and the cells were lysed with 200 μl of TRK lysis buffer and stored in 1.5 ml tubes at −80° C. RNA extraction from the cells was performed using the RNA extraction kit (Omega-bio-tek), in accordance to the manufacturer's protocol.

(28) Once the total RNA was obtained, the mRNAs were transformed into cDNA by means of the reverse transcription reaction, which was performed in a total volume of 20 μl of solution, divided into two parts. The first reaction was performed in a mixture containing 1.6 μl of oligo-dT (1.25 μg/ml) for analysis of gene expression of the 1.0 μl markers of dNTPs (10 mM); 8.0 μl of total RNA (5 μg) and 0.1 μl of water free of nucleases and incubated for 10 min at 60° C. to remove secondary structures from the mRNAs. After this a second mixture comprised of 1 μl of M-MLV reverse transcriptase (200 U), 4 μl of 5× enzyme buffer and 0.5 μl of RNAsaOUT 40 U recombinant ribonuclease inhibitor was added to this solution, in a total volume of 5.5 μl and it will be incubated for 1 h at 37° C. Finally for inactivation of reverse transcriptase, the reaction mixture was incubated at 72° C. for 10 min. The synthesized cDNA was stored at −20° C. for subsequent PCR amplification or quantification by real-time PCR (qPCR) for the IFN-1 and IL-12 genes relative to the expression of EF-1α using the primers indicated in Table 2 below:

(29) TABLE-US-00002 TABLE 2 Gen Primers Genbank IFN-I Fwd TGGGAGGAGATATCACAAAGC AY216594 (SEQ ID No: 1) Rev TCCCAGGTGACAGATTTCAT  (SEQ ID No: 2) IL-12 Fwd CTGAATGAGGTGGACTGGTATG BT049114 (SEQ ID No: 3) Rev ATCGTCCTGTTCCTCCG  (SEQ ID No: 4) ELF-1 Fwd TGCCCCTCCAGGATGTCTAC  AF321836 (SEQ ID No: 5) Rev CACGGCCCACAGGTACTG  (SEQ ID No: 6)

(30) Each amplification reaction was performed using 2 μl CDNA as a template, primers of 0.2 μM (Table 2), 0.8 μl MgCl 2 (25 mM), 1 μl Lightcycler® Fast Start DNA Master SYBR Green amplification mixture in a volume of 10 μl. The reaction was carried out in a LightCycler® 1.5 thermal cycler. The program consisted on the following steps: initial denaturation at 95° C. during 10 min, followed by a PCR reaction of 35 cycles each one composed of denaturation at 95° C. during 10 s, mating at 58° C. during 10 s and an extension at 70° C. during 10 s. Subsequently a cycle to obtain the melting curve for 20 s at 95° C. And finally a cooling cycle at 40° C. during 30 s. The relative quantification was performed with a standard curve, consisting of reactions containing dilutions of the purified PCR product of a concentration known for the gene of interest. After obtaining and quantifying the PCR product corresponding to each gene, successive dilutions were performed in a range of 10.sup.7 to 10.sup.2 numbers of copies/μl for each gene under study, for the subsequent calculation of the efficiency of the reaction, where the following relation, E=10(−1/slope)−1 will be used. For the calculation of relative expression by the qPCR technique amplification reactions of the ELF-1 gene cDNA were performed on each RNA sample from cells treated with the different stimuli in vitro. Then, the expression changes were calculated using the comparative CT method (Pfaffl, 2001).

(31) The results are illustrated in FIGS. 4A and 4B.

Example 6

Result of Immune Effect on Cell Lines of the Mixture Fucoidian Plus Andrographolide

(32) The SHK-1 cell line, derived from Salmo salar's kidney, was used. The assay was started when the cells had 90% confluence, where they were stimulated with an extract of Andrographis sp and an extract of brown algae.

(33) The treatment was applied at the same time to SHK-1 cells, in a half of L15 supplemented with 10% fetal bovine serum at doses of 1 μg/ml of brown algae extract (5% total fucoidians) and 5 nM extract of Andrographis sp (10% total andrographolide) cells were incubated at 20° C. during 24 hours of stimulation time.

(34) After treatment, the cell supernatant was discarded and cells were lysed with 200 μl of TRK lysis buffer and stored in 1.5 ml tubes at −80° C. RNA extraction from the cells was performed using the RNA extraction kit (Omega-bio-tek), according to the manufacturer's protocol.

(35) Once the total RNA was obtained, the mRNAs were transformed into cDNA by means of the reverse transcription reaction, which was performed in a total volume of 20 μl of solution, divided in two parts. The first reaction was performed in a mixture containing 1.6 μl of oligo-dT (1.25 μg/ml) for analysis of gene expression of the 1.0 μl markers of dNTPs (10 mM); 8.0 μl of total RNA (5 μg) and 0.1 μl of water free of nucleases and it was incubated during 10 min at 60° C. to remove secondary structures from the mRNAs. Subsequently, to this solution was added a second mixture comprised of 1 μl of M-MLV reverse transcriptase (200 U), 4 μl of 5× enzyme buffer and 0.5 μl of recombinant RNAseOUT ribonuclease inhibitor (40 U), in a total volume of 5.5 μl and it will be incubated during 1 h at 37° C. Finally for inactivation of reverse transcriptase, the reaction mixture was incubated at 72° C. during 10 min. The synthesized cDNA was stored at −20° C. for further amplification by PCR or quantification by real-time PCR (qPCR) for the IFN-1 and IL-12 genes relative to EF-1α expression using the primers indicated in Table 3 below:

(36) TABLE-US-00003 TABLE 3 Gen Primers Genbank IFN-I Fwd TGGGAGGAGATATCACAAAGC AY216594 (SEQ ID No: 1) Rev TCCCAGGTGACAGATTTCAT  (SEQ ID No: 2) IL-12 Fwd CTGAATGAGGTGGACTGGTATG BT049114 (SEQ ID No: 3) Rev ATCGTCCTGTTCCTCCG  (SEQ ID No: 4) ELF-1 Fwd TGCCCCTCCAGGATGTCTAC  AF321836 (SEQ ID No: 5) Rev CACGGCCCACAGGTACTG  (SEQ ID No: 6)

(37) Each amplification reaction was performed using 2 μl of cDNA as a template, primers of 0.2 μM (Table 3), 0.8 μl MgCl (25 mM), 1 μl Lightcycler® Fast Start DNA Master SYBR Green amplification mixture in a volume of 10 μl. The reaction was carried out in a LightCycler® 1.5 thermal cycler. The program consisted of the following steps: initial denaturation at 95° C. during 10 min, followed by a PCR reaction of 35 cycles each composed of denaturation at 95° C. during 10 s, mating at 58° C. during 10 sec and extension at 70° C. during 10 sec. Subsequently a cycle to obtain the melting curve during 20 s at 95° C., and finally a cooling cycle at 40° C. during 30 s. The relative quantification was performed with a standard curve, consisting of reactions containing dilutions of the purified PCR product of known concentration for the gene of interest. After obtaining and quantifying the PCR product corresponding to each gene, successive dilutions were performed in a range of 10.sup.7 to 10.sup.2 number of copies/μl for each gene under study, for the subsequent calculation of the efficiency of the reaction, where the following relation, E=10(−1/slope)−1 will be used. For the calculation of the relative expression by the qPCR technique amplification reactions of the ELF-1 gene cDNA were performed in each RNA sample from cells treated with the different stimuli in vitro. Then, the expression changes were calculated using the comparative CT method (Pfaffl, 2001).

(38) The results are illustrated in FIGS. 4A and 4B.

Example 7

Result of Immune Effect by Challenge P. salmonis

(39) The SHK-1 cell line, derived from Salmo salar's kidney, was used. The assay was started when the cells showed a 90% of confluence, where they were stimulated with a combination that will ensure a concentration of the brown algae extract of 1 μg/ml and 5 nM of the extract of Andrographis sp, as well as the individual stimulation with a concentration of 1 μg/ml extract of brown algae, and individual stimulation with a concentration of 5 nM of the extract of Andrographis sp. The treatments were applied independently to SHK-1 cells in L15 supplemented with 10% fetal bovine serum at the above-mentioned doses, cells were incubated at 20° C. during 24 hrs incubation.

(40) Infection with P. salmonis was carried out after the incubation period. For the challenge, a strain of Piscirickettsia salmonis PPT005 grown on a SHK-1 cell line, which was originally isolated from a dying population of Atlantic salmon (Salmo salar) from a farm salmond center near Puerto Montt, Chile, using CHSE-214 cells. The cells were infected and incubated at 18° C. in L-15 medium supplemented with 2% SFB. The bacteria were harvested from the infected cells when they had a 90% cytopathic effect (CPE). Finally, functional assays were performed by sowing 10.sup.4 bacteria per mL in SHK-1 cells at 90% of confluence.

(41) The length of the challenge test was 9 days, time required to obtain a 50% cytopathic effect in the control monolayers.

(42) After the treatment was complete, the supernatants were harvested and the surviving cells were lysed with 200 μl of TRK lysis buffer and stored in tubes of 1.5 ml at −80° C.

(43) 1 ml of each culture supernatant from SHK-1 cells was taken with 9 days of infection. These supernatants were centrifuged at 700×g during 10 min to remove the cell residue, and then at 16,000×g for 45 min to recover the bacteria in an Eppendorf 5402 centrifuge. All the sediments were processed by the Chelex method for obtaining the DNA to amplify. Briefly, they were suspended in 100 μl of 6% Instagene p/v (Chelex 100, Bio-Rad), they were shaken at maximum speed in a vortex and centrifuged at 11,600×g during 5 min in an Eppendorf centrifuge to collect the pearls of Chelex in the sediment and DNA in the supernatant. For the estimation of bacterial numbers, standard numbers were used like reference with known numbers of P. salmonis copies, obtained by cloning the ITS of this bacterium in the vector pCR® 2.1 TOPO TA (Invitrogen). The standards of 10.sup.4 to 10.sup.10 number of copies and the DNAs obtained by Chelex were amplified in parallel. Each reaction was performed in a volume of 30 μl with 1 μg of each DNA sample, and 0.5 mM of the ITS primers (Marshall et al 1998) labeled with FAM (495-535 nm). For amplification an initial denaturation of 10 minutes at 95° C. was performed, followed by 35 cycles with the following segments: denaturation at 95° C. during 15 seconds, alignment at 60° C. during 30 seconds and an extension at 72° C. during 45 seconds, and then a final extension of 6 min at 72° C. From the amplification curves obtained for each sample, the Ct (crossing threshold) values of the copy number standards were estimated, in accordance to the method described by Phaffi, 2001, the results are plotted in FIG. 5. In the case of the suriing cells a RNA extraction from the cells was performed using the RNA extraction kit (Omega-bio-tek), in accordance to the manufacturer's protocol.

(44) Once the total RNA was obtained, the mRNAs were transformed to cDNA by means of the reverse transcription reaction, which was performed in a total volume of 20 μl of solution, divided into two parts. The first reaction was carried out in a mixture containing 1.6 μl of oligo-<1T (1.25 μg/ml) for analysis of gene expression of the markers 1.0 μl of dNTPs (10 mM); 8.0 μl of total RNA (5 μg) and 0.1 μl of water free of nucleases and it was incubated during 10 min at 60° C. to remove secondary structures from the mRNAs. After, a second mixture comprised of 1 μl of M-MLV reverse transcriptase (200 U), 4 μl of 5× enzyme buffer and 0.5 μl of recombinant RNAseOUT ribonuclease inhibitor (40 U) was then added to this solution, in a total volume of 5.5 μl and it will be incubated during 1 h at 37° C. Finally for inactivation of the reverse transcriptase, the reaction mixture was incubated at 72° C. during 10 min. The synthesized cDNA was stored at −20° C. for subsequent PCR amplification or quantification by real-time PCR (qPCR) for the IFN-1 and IL-12 genes related to EF-1α expression using the primers indicated in table 4 below:

(45) TABLE-US-00004 TABLE 4 Gen Primers Genbank IFN-I Fwd TGGGAGGAGATATCACAAAGC AY216594 (SEQ ID No: 1) Rev TCCCAGGTGACAGATTTCAT  (SEQ ID No: 2) IL-12 Fwd CTGAATGAGGTGGACTGGTATG BT049114 (SEQ ID No: 3) Rev ATCGTCCTGTTCCTCCG  (SEQ ID No: 4) ELF-1 Fwd TGCCCCTCCAGGATGTCTAC  AF321836 (SEQ ID No: 5) Rev CACGGCCCACAGGTACTG  (SEQ ID No: 6)

(46) Each amplification reaction was performed using as a template 2 μl of cDNA, 0.2 μM primers (Table 1), 0.8 μl MgCl2 (25 mM), 1 μl of Lightcycler® Fast Start DNA Master SYBR Green amplification mixture in a volume of 10 μl. The reaction was carried out in a LightCycler® 1.5 thermal cycler. The program consisted of the following steps: initial denaturation at 95° C. during 10 min, followed by a PCR reaction of 35 cycles each one composed of denaturation at 95° C. during 10 s, mating at 58° C. during 10 s and extension at 70° C. during 10 s. Subsequently a cycle to obtain the melting curve during 20 s at 95° C., and finally a cooling cycle at 40° C. during 30 s. Relative quantification was performed with a curve standard, consisting of reactions containing dilutions of the purified PCR product of known concentration for the gene of interest. After obtaining and quantifying the PCR product corresponding to each gene, successive dilutions were performed in a range of 10.sup.7 to 10.sup.2 number of copies/μl for each gene under study, for the subsequent calculation of the efficiency of the reaction, where the following relationship, E=10 (−1/slope)−1. For the calculation of the relative expression by the qPCR technique amplification reactions of the ELF-1 gene cDNA were performed on each RNA sample of cells treated with the different stimuli in vitro. Then, the expression changes were calculated using the comparative CT method (Pfaffl, 2001).

Example 8

Immunostimulation Against Intracellular Microorganisms (IPNv) with the Composition of the Present Invention in Salmonid Fishes Cell Lines

(47) A study was performed on salmonid fishes cell lines, where the composition of the present invention was evaluated. Cell lines exposed to the combination of fucoidians+Andrographolide, cell lines exposed only to fucoidians, and subsequently, molecular markers relevant in Th0 to Th1 differentiation such as IL-12 and IFN-1 were evaluated. The separate fucoidians and the combination of these ones+Andrographolide are significantly different in surviving cells following a challenge with IPNV. At the same time, there is a decrease in the copy numbers of the pathogen agents significantly higher than the cells that received the composition of the present invention in relation to the use of only the fucoidians or the aqueous extract of brown algae.

(48) See FIGS. 6A, 6B and 7

(49) The studies in fishes were carried out in ponds, where the composition of the present invention was an aqueous extract of seaweed with a reference percentage of 5% fucoidians obtained from Macrocystes pyrifera in combination with an extract from the Andrographis sp plant with a 10% of total andrographolide in a proportion of 10% and 90%, respectively, the fish feed or diet was incorporated, in a dose in the range of 0.5 to 2.5 Kh per ton of food. Preferably, at a dose of 1 kg per ton of food.

(50) We used 450 specimens of rainbow trout (Oncorhynchus mykiss) with average weight of 100-120 g., however, additional fishes were available to achieve a coefficient of variation of less than or equal to 15%.

(51) Samples of 30 fishes were taken to be analyzed in the laboratory by real-time RT-PCR technique, to discard the presence of IPNv, BKD and SRS.

(52) An exploratory sampling was done to know the average weight of the population and to carry out the selection of the fishes chosen for the test. Only animals presenting the required weight, good condition of adaptation to the saline environment and sanitary condition approved by the veterinarian (free of IPNv, SRS and BKD) were included.

(53) With the selection data, all animals with weight outside the selection range, as well as those with peeling or those that their condition was not appropriate for the present study, were excluded when marking.

(54) The fishes were marked with pittags 10 days before the beginning of the test, proceeding as follows:

(55) a) The fishes were extracted from the pond and placed in a pan with an anesthetic solution, Tricaine methanesulfonate 80%.

(56) b) Once stage II (deep anesthesia) was reached, they were taken individually and arranged on the working table, in a lateral way, so that the head is left to the left side of the operator.

(57) c) A needle was inserted to make the incision in flank at the level of ventral fins, through which the chip was inserted. Then he performed a small massage to slide the chip into the ventral cavity.

(58) (d) The fishes were transferred to the basin of origin for their recovery and waiting for conformation of test ponds.

(59) Six ponds of 1 rn.sup.3 were formed from fishes previously marked with pittags. In each pond 50 fishes were deposited and of which the code of the chip was read, creating a database that associated, initial weight and length and pond number. The database allowed to follow the traceability of the tagged fishes, related to productive indexes and subsequent challenge with the pathogen. Simultaneously 2 ponds with 75 fishes each were formed, according to the same procedure, which were kept until the challenge stage, see FIG. 1.

(60) The fishes were kept in the ponds during 10 days as acclimatization period, under controlled conditions; average temperature of 14° C. (±1° C.), salinity in a range of 31-32 ppt, oxygen 80-100% saturation and pH of 7-8. The environmental parameters were monitored daily.

(61) During this stage, the ponds were fed with diet without the present composition, manually at 2-2.5% PC, with a 100% ration in the morning.

(62) Daily, the unconsumed food of each pond was recovered, to later estimate the actual feeding rate of each group.

(63) F existing mortality, it was extracted and recorded in the corresponding pond, and necropsy was carried out by trained personnel from the fish farming.

(64) The fishes were fed 2-2.5% pc/day, during acclimatization, treatment administration and challenge stage with pathogen. The food was administered manually, delivering 100% of the ration during the morning. It should be noted that during the acclimatization and challenge a commercial diet without additives was administered.

(65) The amount of food supplied was adjusted regularly according to the expected growth rate for the species and mortality. On a daily basis, unconsumed food was collected from the ponds, thus obtaining the actual feed intake for the estimation of subsequent productive indexes.

(66) During the development of the test, tissue samples were taken, considering the kidney, proximal intestine and blood samples for plasma collection. The number of samples and sample time are shown in Table 3 below.

(67) Kidney samples were taken in two 0.5 cm.sup.3 pieces, which were immersed in 2 ml eppendorf tubes (individually for each fish) containing 800 μL of later RNA (Ambion). These samples were labeled and refrigerated (4-6′C) during 24 h, then cooled to −80° C.

(68) The proximal intestine was destined to histological analysis, for which they were deposited in falcon tubes with buffered formalin. In this case, the number of samples per pond (3) was placed in the same tube, labeled with date, pond number and treatment.

(69) Blood samples were deposited immediately after collection in eppendorf tubes prepared with heparin (25 IU). They were then centrifuged to remove the plasma, which was placed in a new tube (previously labeled) and stored in the ultra-freezer (−80° C.) until taking off them.

(70) TABLE-US-00005 TABLE 5 Number and time of doing tissue sampling Blood/ Proximal Plasma Kidney intestine No of No of No of Sample Time TK sample TK sample TK sample TO- 1 3 1 3 1 3 acclimatization 2 3 2 3 2 3 begining 3 3 3 3 3 3 4 3 4 3 4 3 5 3 5 3 5 3 6 3 6 3 6 3 Total 18 18 18 TI-Treatment 1 3 1 3 1 3 Ending 2 3 2 3 2 3 (30 days) 3 3 3 3 3 3 4 3 4 3 4 3 5 3 5 3 s 3 6 3 6 3 6 3 Total 18 18 18 T2-ending 1 10 It is considered the testing of 5 challenge 2 10 samples per pond of the treated survivors 3 10 group and S control Total 30

(71) The food with the composition of the present invention was distributed to three ponds (triplicate), as indicated in Table 6, during 30 consecutive days. The remaining ponds (controls) continued their feeding with a standard diet throughout the evaluation period. Administration of treatment was as described above.

(72) During this time, temperature, pH, salinity and oxygen were monitored daily. If there was mortality at this stage, it was taken out and recorded in the corresponding pond, performing an anatomopathological test.

(73) TABLE-US-00006 TABLE 6 Detail administration treatment Time No of administration No Pond fishes Group Diet Type (days) 1 47 Treatment immunostimulant 30 2 47 Control Commercial 30 3 47 Treatment immunostimulant 30 4 47 Control Commercial 30 5 47 Treatment immunostimulant 30 6 47 Control Commercial 30

(74) Control corresponds to the commercial diet.

(75) The immuno-modulating agent corresponds to the composition of the present invention.

(76) Then, a challenge was performed with P. salmonis. Table 7 details the specifications of the P. salmonis isolate that was used in the inoculation of Trojan fishes.

(77) TABLE-US-00007 TABLE 7 P. salmonis isolate specifications Laboratory of origin ADL Diagnostic Chile Ltda. Agent Piscirickett sia salmonis Laboratory code PM-34152 species of original isolate Rainbow Trout species where it was realized Atlantic Salmon- Rainbow Trout date original isolation May 11, 2012 Organ of isolation Kidney No of animalizations 1 Isolation condition Reanimated cryopreserved Inoculum production type Bacterial culture

(78) The inoculum was administered with TCID50/ml determined by the Karber Spearman method by the laboratory ADL Diagnostic Chile Ltda. In addition, the purity of the inoculum was evaluated, considering ISAv, IPNv, BKD, F. psycrophilum RT-PCR analysis and bacteriological cultures in medium TSA and TSA/s at 18 and 35° of incubation.

(79) At the end of the administration of the diet with the composition of the present invention, the fishes were redistributed to perform the challenge. Three ponds of 1 m.sup.3 were formed, considering the mixture of treated and untreated fishes at random in the new ponds, as indicated in table 6. At the time of the new distribution the pittag was read, assigning to each chip the group and pond, see FIG. 2.

(80) TABLE-US-00008 TABLE 8 Redistribution of fishes for challenge No Origin chal- TK-1 TK-2 TK-3 TK-4 TK-5 TK-6 lenge n = 40 n:40 n = 40 n = 40 n = 40 n = 40 pond Treated Control Treated Control Treated Control Total 7 13 14 13 13 14 13 80 8 13 13 14 13 13 14 80 9 14 13 13 14 13 13 80

(81) Observation: The number of fishes is estimated considering mortality and sampling in the treatment administration stage, if not, the number will be adjusted to the real n.

(82) Treated means that a diet comprising the composition of the present invention has been provided. Control means that only a commercial diet has been provided.

(83) The challenge was achieved by cohabitation, which involved introducing fishes infected with P. salmonis, trojans, into healthy fishes ponds (treated and controlled), as indicated in Table 9, considering an infection pressure of 33%. The inoculum was administered intraperitoneally to the trojan group at a rate of 0.2 m/fish. The inoculation was performed according to the following procedure:

(84) a) The fishes were extracted from the pond and placed in a container with anesthetic solution (Tricaina 80% ASL).

(85) b) Once the anesthetic stage III was reached, they were taken individually and held with the ventral face upwards.

(86) c) The needle was inserted at an angle of approximately 45° in the ventral midline, between the pectoral and pelvic fins, injecting 0.2 ml per fish.

(87) d) At this stage the pittag was read by assigning to the chip code the group ‘trojans’, pond number and inoculation date.

(88) e) Post application the fishes were transferred to the assigned pond, constantly monitoring the state of recovery.

(89) TABLE-US-00009 TABLE 9 Distribution of challenge groups by cohabitation Group TK-7 TK-8 TK-9 N n N Treated 40 40 40 Control 40 40 40 Trojans 40 40 40 Total 120 120 120

(90) Treated means that it has received the diet with the composition of the present invention.

(91) Control means you have only received a commercial diet.

(92) Subsequently, the fishes were left in the ponds waiting for the appearance of mortality. During this stage, the feeding was carried out in accordance to the point 6.8 and daily environmental parameters such as temperature, salinity, oxygen and pH were registered. Mortality was identified according to the number of pittag from the database, registering daily.

(93) The challenge lasted for 60 days, period of time that, the accumulated mortality of the control group was expected to reach 40-60%, thus ending the test.

(94) The mortality recorded during the days of challenge was sent to the diagnostic laboratory to be analyzed by anatomopathological observations. In parallel, molecular analyzes were performed by real-time RT-PCR, for IPN and SRS viruses, to 20% of the total, considering 15 trojans, 30 of the treated group and 30 of the control group, to confirm the presence of the pathogen.

(95) Weight and length were measured at day 0 (Beginning Acclimatization), at 30 days of treatment administration and at the end of the challenge with P. salmonis, on the 100% of the fish in each group. From the data, condition factor (K), feed rate (SFR), specific growth rate (SGR), % growth, thermal growth rate (GF3) and food conversion rate (FCRb).

(96) Below are summarized in tables some of the productive variables such as average body weight, condition factor K, coefficient of variation and weight gain at the end of treatment administration. As can be seen, the final weight increased in all ponds.

(97) TABLE-US-00010 TABLE 10 Body weight, condition factor, coefficient of variation and weight gain at the end of the treatment administration stage. Test pond N-10 N-11 N-12 N-13 N-21 N-22 variable Treated Treated Treated Treated Control Treated No of fishes at 47 47 47 47 47 47 the begining No of fishes at 47 47 46 47 47 46 the ending % accumulated 0 0 2.1 0 0 2.1 mortality Begining 99.1 101.8 100.2 100.2 96.1 103.1 Weight (g) Final Weight 250.2 254.1 247.4 249.0 252.0 243 (g) Initial 1.50 1.55 1.53 1.57 1.54 1.55 condition factor (k) Final condition 1.42 1.42 1.43 1.42 1.45 1.40 factor (k) Increases 151.1 152.3 147.2 148.8 155.9 139.9 weight (g) Coef. 10.6 12 9.7 10.1 10.9 11 Inicial weight variation (%) Coef. 24.1 21.4 20.7 19.4 19.8 20.8 Final weight variation (%)

(98) Treated means that the diet has been supplied with the composition of the invention

(99) TABLE-US-00011 TABLE 11 Food supplied, % SFR and feed conversion factor. Test pound N-10 N-11 N-12 N-13 N-21 N-22 Variable Treated Treated Treated Treated Control Treated Food supplie 6.1 6.8 6.4 6.1 6.3 5.8 (kg) % SFR 2.0 2.0 2.0 2.0 2.0 2.0 Theorical % SFR real 1.44 1.57 1.51 1.44 1.50 1.37 Conversion 0.81 0.89 0.87 0.82 0.81 0.83 Factor (FCR,)

(100) Control means that only a commercial diet has been supplied.

(101) Treated means that the diet has been supplied with the composition of the invention.

(102) Control means that only a commercial diet has been supplied.

(103) Table 12 summarizes the production parameters obtained during the treatment administration period (Diet with the present composition of the present invention). From the table can be seen that the growth indicators (% growth, SGR and SFR) were similar between the treated group and the control group. The data from each group did not present significant differences in weight, obtained at the end of the administration (p>0.05), in the SGR specific growth rate (p>0.05) and in the thermal growth rate GF3 (p>0.05).

(104) TABLE-US-00012 TABLE 12 Summary of productive variables by treatment group Initial Final % % Group Days Weight Weight mortality SGR % SFR % FCR GF3 Increase Control 30 98.83 249.5 0.7 1.78 1.48 0.83 2.33 152.5 Treatment/ 30 101.17 249.15 0.7 1.73 1.46 0.84 2.227 145.9 Additive

(105) Control means that only commercial diet has been provided.

(106) Treatment means that a commercial diet has been provided with the composition of the present invention.

(107) Table 13 shows the biomass increase and cumulative growth (%) post-administration of the commercial diet with the composition of the present invention. The increase in biomass fluctuated from 6.35 to 7.28 kg and the accumulated growth of 135.7 to 162.2% between the different test ponds.

(108) The specific growth rate (SGR) ranged varied from 1.65 to 1.85 among different replicates, however, no differences were observed between the group to which a commercial diet was supplied with the composition of the present invention and the group to which only the commercial diet has been supplied. The same happened for the growth rate term (GF3), with a range of 2.16 to 2.42 behaving similarly in both groups.

(109) TABLE-US-00013 TABLE 13 Biomass, percentage of relative growth, rate of thermal growth and specific rate of growth at the end of the treatment administration stage Test pound N-10 N-11 N-12 N-13 N-21 N-22 Variable Treated treated control Control control Treated Initial 4.66 4.78 4.71 4.71 4.52 4.85 Biomass (kg) Final 11.8 11.9 11.4 11.7 11.8 11.2 Biomass (kg) Biomass 7.14 7.12 6.69 6.99 7.28 6.35 increases (kg) ′′′% 152.5 149.6 146.9 148.5 162.2 135.7 Accumulate Increase Specific 1.78 1.76 1.74 1.75 1.85 1.65 Growth rate (SGR) Thermal 2.33 2.32 2.28 2.29 2.42 2.16 Growth rate (GF3)

(110) Accumulated growth is calculated from the beginning of acclimatization and at the end of treatment administration.

(111) Control means that only a commercial diet has been provided.

(112) Treaty means that it has been supplied a commercial diet with the composition of the present invention.

(113) From the results obtained, T test was performed for independent samples, not observing significant differences (p>0.05) for the growth variable, between the control group and the group treated with experimental additive.

(114) For the specific rate of thermal growth and specific rate, the same analysis was applied, not registering significant differences (p<0.05) between the treated group and the control group.

(115) In the challenge stage with P. salmonis, post challenge mortality was analyzed. To do this, during the period of cohabitation the rainbow trout groups presented a similar percentage of cumulative mortality among replicates in the group of trojans.

(116) In the control group and the one administered with food of the composition of the present invention, it was higher in one of the replicates (TK C9), whereas replicate 2 and 3 (TK C10 and C11) had similar mortality, however, the trend was similar between the replicates, where the control group had higher mortality than the treated groups. FIGS. 8 and 9 show the evolution of daily and accumulated mortality per pond.

(117) In order to confirm the reason of mortality of the challenged groups, dead fishes were analyzed by molecular techniques (RT-PCR real time) with a total of 63 samples, obtaining 100% of positive cases with presence of P. salmonis, and 0 positive samples for IPNV, in the different groups evaluated (see Table 14). The average Ct for the control group was 21.71 and for the experimental group 23.1.

(118) TABLE-US-00014 TABLE 14 Results of the P. salmonis PCR analysis in rainbow trout during the cohabitation challenge Ct No. IPNV P. average of % Pond Group Analyzed (+) salmonis P. salmonis Prevalence C9 Trojan 5 0 5 17.3 100 C10 Trojan 5 0 5 23.9 100 C11 Trojan 5 0 5 23.8 100 C9 Control 10 0 10 23.03 100 C10 Control 10 0 10 19.23 100 C11 Control 10 0 10 22.87 100 C9 Treated 9 0 9 23.48 100 C10 Treated 4 0 4 21.38 100 C11 Treated 5 0 5 24.66 100

(119) Control means that only a commercial diet has been added.

(120) Treated means that a commercial diet plus the composition of the present invention has been supplied.

(121) In addition to molecular analysis, necropsy of the mortality was performed, external and internal lesions associated with SRS were seen. In general, the most recurrent injuries were ulcerative injuries on the skin, fin-hemorrhages, congestive intestinal serous, congestive brain, renomegaly, congestive adipose tissue, splenomegaly, and congestive pyloric blinds.

(122) Table 15 shows the average weight, condition factor (K) and percentage of growth obtained at the end of the challenge for the control group and the treated group. As noted, the group treated with the composition of the present invention obtained higher average weight, condition factor and cumulative % growth at the end of the challenge.

(123) TABLE-US-00015 TABLE 15 Average weight at the end of the challenge with P. salmonis Variable Treated Control Initial Weight (g) 249.6 252.8 Final Weight (g) 567.0 483.8 Initial condition 1.40 1.45 factor (K) Final condition 1.38 1.28 factor (K) Coef. Initial 19.4 22.3 weight variation (%) Coef. Final 36.9 43.14 weight variation (%) % accumulated growth 127.2 91.3

(124) Control means that only a commercial diet has been supplied.

(125) Treated means that the commercial diet plus the composition of the present invention has been supplied.

(126) For the interpretation of the efficacy results of the treatment, the relative percentage of survival (RPS) was calculated, based on the mortality recorded during the challenge. The RPS is the ratio between the cumulative mortality of treated fishes at the time the cumulative mortality of control (untreated) fishes reach 40-60%. The RPS is expressed according to the following formula:
RPS=1−(% mortality of fishes treated/% mortality of untreated fishes (control).Math.100

(127) Also, the cumulative mortality of the control group was calculated at day 60 post challenge and at the end of the study (day 80). The RPS for the group treated by pond and as a group is presented below in Tables 16 and 17.

(128) TABLE-US-00016 TABLE 16 Relative Survival Rate (RPS) in rainbow trout at 60 days post challenge Control Group Treated % accumulated % accumulated Group Pond mortality mortality RPS(%) C9 30 15 50.0 C10 32.5 7.5 76.9 C11 25 10 60.0 RPS experimental product 62.3

(129) Control means that only a commercial diet has been supplied.

(130) Treated means that the commercial diet plus the composition of the present invention has been supplied.

(131) TABLE-US-00017 TABLE 17 Relative Survival Rate (RPS) at end-time rainbow trout Control Group Treated group % accumulated % accumulated Pound mortality Mortality RPS (%) C9 40 22.5 43.8 C10 32.5 10 69.2 C11 32.5 12.5 61.5 RPS experimental product 57.14

(132) Control means that only a commercial diet has been added.

(133) Treated means that a commercial diet plus the composition of the present invention has been supplied.

(134) As seen in the tables, the RPS at day 60 was 62.3% and then decreasing to day 80 post challenge with 57.14%.

(135) The study concluded after 133 days, having 23 days of acclimatization period, a 30 days of treatment administration period, and a 80 days cohabitation challenge. The results showed that the incorporation of the composition in the diet substantially improved the survival of the fishes when they were exposed to Piscirickettsia salmonis via natural infestation (cohabitation), obtaining significant differences with in relation to the group that was not treated. On the other hand, at the productive level, no differences were observed significant at the food consumption, conversion, increasing weight and specific growth rate, behaving in a similar way to a normal diet without additive.