PRODUCTS AND COMPOSITIONS
20220290143 · 2022-09-15
Inventors
- Judith Hauptmann (Berlin, DE)
- Dmitry SAMARSKY (Berlin, DE)
- Adrien Weingärtner (Berlin, DE)
- Lucas Bethge (Berlin, DE)
- Christian Frauendorf (Berlin, DE)
- Alison GALLAFENT (Berlin, DE)
Cpc classification
C12N2310/344
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N2310/317
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention relates to products and compositions and their uses. In particular the invention relates to nucleic acid products that interfere with target gene expression or inhibit target gene expression and therapeutic uses of such products.
Claims
1. A nucleic acid for inhibiting expression of a target gene in a cell, comprising at least one duplex region that comprises at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein said first strand is at least partially complementary to at least a portion of RNA transcribed from said target gene to be inhibited and wherein the terminal nucleotide at the 3′ end of at least one of the first strand and the second strand is an inverted nucleotide and is attached to the adjacent nucleotide via the 3′ carbon of the terminal nucleotide and the 3′ carbon of the adjacent nucleotide and/or the terminal nucleotide at the 5′ end of at least one of the first strand and the second strand is an inverted nucleotide and is attached to the adjacent nucleotide via the 5′ carbon of the terminal nucleotide and the 5′ carbon of the adjacent nucleotide.
2. The nucleic acid according to claim 1, wherein the nucleic acid is blunt ended at both ends.
3. The nucleic acid according to claim 1, wherein one or more nucleotides on the first and/or second strand are modified, to form modified nucleotides.
4. The nucleic acid according to claim 1, wherein the nucleic acid comprises at least one modification, wherein the at least one modification is a 2′-O-methyl or 2′-F modification.
5. The nucleic acid according to claim 1, wherein the inverted nucleotide at the 3′ end of at least one of the first strand and the second strand and/or the inverted nucleotide at the 5′ end of at least one of the first strand and the second strand is a purine.
6. The nucleic acid according to claim 1, further comprising a ligand.
7. A nucleic acid for inhibiting expression of a target gene in a cell, comprising at least one duplex region that comprises at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein said first strand is at least partially complementary to at least a portion of RNA transcribed from said target gene to be inhibited and wherein the terminal nucleotide at the 3′ end of at least one of the first strand and the second strand is an inverted nucleotide and is attached to the adjacent nucleotide via the 3′ carbon of the terminal nucleotide and the 3′ carbon of the adjacent nucleotide and/or the terminal nucleotide at the 5′ end of at least one of the first strand and the second strand is an inverted nucleotide and is attached to the adjacent nucleotide via the 5′ carbon of the terminal nucleotide and the 5′ carbon of the adjacent nucleotide, and wherein the nucleic acid molecule is directly or indirectly conjugated to a ligand via a linker.
8. A nucleic acid according to claim 7, wherein the ligand comprises one or more GalNac ligands or derivatives thereof.
9. The nucleic acid according to claim 8, wherein one or more nucleotides on the first and/or second strand are modified, to form modified nucleotides.
10. A composition comprising the nucleic acid of claim 1 and a physiologically acceptable excipient.
11-12. (canceled)
13. A method of treating a disease or disorder comprising administration of a composition comprising the nucleic acid according to claim 1 to an individual in need of treatment.
14. The nucleic acid according to claim 5, wherein the purine is an adenine.
15. The nucleic acid according to claim 5, wherein the purine is a guanine.
16. The nucleic acid according to claim 1, wherein the inverted nucleotide at the 3′ end of at least one of the first strand and the second strand and/or the inverted nucleotide at the 5′ end of at least one of the first strand and the second strand is a cytosine.
17. The nucleic acid according to claim 1, wherein the inverted nucleotide at the 3′ end of at least one of the first strand and the second strand and/or the inverted nucleotide at the 5′ end of at least one of the first strand and the second strand is a uracil.
18. The nucleic acid according to claim 1, wherein the nucleic acid has an overhang at one end and a blunt end at the other.
19. The nucleic acid according to claim 1, wherein the nucleic acid has an overhang at both ends.
20. The nucleic acid according to claim 1, wherein the nucleic acid has an overhang at the 3′ end of the first strand and a blunt end at the 3′ of the second strand.
21. The nucleic acid according to claim 1, wherein the nucleic acid has an inverted nucleotide at the 3′ end of the second strand, wherein the 3′ end of the second strand is a blunt end.
22. The nucleic acid according to claim 7, wherein the nucleic acid comprises a GalNAc moiety at the 5′ end of the second strand.
Description
[0330] The invention will now be described with reference to the following non-limiting figures and examples in which:
[0331]
[0332]
[0333]
[0334]
[0335]
[0336]
[0337]
[0338]
[0339]
[0340]
[0341]
[0342]
[0343]
[0344]
[0345]
[0346]
[0347]
[0348]
[0349]
[0350]
[0351]
[0352]
[0353]
[0354]
[0355]
[0356]
[0357]
EXAMPLES
Example 1
[0358] siRNA Modification: Using Inverted Nucleotides.
[0359] The terminal nucleotide at the 3′ end of an oligonucleotide strand can be attached to the adjacent nucleotide via the 3′ carbon of the terminal nucleotide and the 3′ carbon of the adjacent nucleotide to form a 3′-3′-inverted nucleotide (
Example 2
[0360] siRNA Modification: Synthesis of siRNA with Inverted Nucleotides.
[0361] All Oligonucleotides were either obtained from a commercial oligonucleotide manufacturer (Eurogentech, Belgium) or synthesized on an AKTA oligopilot synthesizer using standard phosphoramidite chemistry. Commercially available solid support and 2′O-Methyl RNA phosphoramidtes, 2′Fluoro DNA phosphoramidites (all standard protection) and commercially available long trebler phosphoramidite (Glen research) were used. Synthesis was performed using 0.1 M solutions of the phosphoramidite in dry acetonitrile and benzylthiotetrazole (BTT) was used as activator (0.3M in acetonitrile). All other reagents were commercially available standard reagents.
[0362] Conjugation of the GalNac synthon (ST23) or treblers ST41 and ST43 was achieved by coupling of the respective phosphoramidite to the 5′end of the oligochain under standard phosphoramidite coupling conditions. Phosphorothioates were introduced using standard commercially available thiolation reagents (EDITH, Link technologies).
[0363] ST23 is a GalNac C4 phosphoramidite (structure components as below)
##STR00025##
[0364] ltrb is as follows:
##STR00026##
[0365] Long trebler (Itt)
[0366] ST41 is as follows (and as described in WO2017/174657):
##STR00027##
[0367] ST43 is as follows (and as described in WO2017/174657):
##STR00028##
[0368] The single strands were cleaved off the CPG by using Methylamine. Where TBDMS protected RNA nucleosides were used, additional treatment with TEA*3HF was performed to remove the silyl protection, as known in the art. The resulting crude oligonucleotide was purified by Ionexchange chromatography (Resource Q, 6 mL, GE Healthcare) on a AKTA Pure HPLC System using a Sodium chloride gradient. Product containing fractions were pooled, desalted on a size exclusion column (Zetadex, EMP Biotech) and lyophilised.
[0369] For Duplexation, equimolar amounts of the respective single strands were dissolved in water and heated to 80° C. for 5 min. After cooling the resulting Duplex was lyophilised.
Example 3
[0370] siRNAs containing different inverted RNA bases in their 3′-terminal positions were tested for serum stability.
[0371] All siRNAs are modified by alternating 2′-OMe/2′-F in both strands, such that every 2′-OMe modified nucleotide on the first strand is paired with a 2′-F modified nucleotide on the second strand. TMP70 comprises two terminal phosphorothioates at 5′- and 3′-ends of both strands. TMP71-74 are modified by terminal phosphorothioates at 5′- and 3′-ends and one additional inverted nucleotide (A, U, C, G) at their 3′-ends. In contrast, TMP75-78 each have two phosphorothioate at the 5′-ends, no phosphorothioate at the 3′-ends and one additional inverted nucleotide (A, U, C, G) at the 3′-ends. Inverted RNA nucleotides are attached via a phosphodiester linkage.
[0372] Serum stability of ivR-modified siRNAs was tested. “w/o FBS” and “UT” indicates untreated samples. “FBS” indicates siRNA duplexes which were incubated at 5 μM final concentration with 50% FBS for 3 d, phenol/chloroform-extracted and precipitated with Ethanol. Samples were analyzed on 20% TBE polyacrylamide gels in native gel electrophoresis. TMP75 (which includes an inverted A) and TMP78 (which includes an inverted G) are more stable than TMP70.
[0373] Data are shown in
Example 4
[0374] The influence of inverted RNA nucleotides at terminal 3′ positions was analyzed using an siRNA against TMPRSS6. TMP70-TMP74 contain phosphorothioates at all termini, whereas TMP75-TMP78 do not contain terminal phosphorothioates at the 3′-ends of both strands. Inverted RNA nucleotides are present in addition to the terminal nucleotide as inverted A (TMP71, TMP75), inverted U (TMP72, TMP76), inverted C (TMP 73, TMP77) and inverted G (TMP74, TMP78). These siRNAs were tested for knockdown of the target gene in vitro. A non-related siRNA (PTEN) and a non-targeting siRNA (Luci) were included as controls. All tested variants show comparable activity under the tested conditions.
[0375] The experiment was conducted in Hep3B. Cells were seeded at a density of 150,000 cells per 6-well, transfected with 0.1 and 1 nM siRNA and 1 μg/ml Atufect after 24 h and lysed after 48 h. Total RNA was extracted and TMPRSS6 and Actin mRNA levels were determined by Taqman qRT-PCR. Each bar represents mean±SD of three technical replicates.
[0376] Knockdown activity of ivR-modified siRNAs in vitro was tested. A Hep3B cell line was seeded at a density of 150,000 cells per 6-well. Experimental conditions: 0.1 and 1 nM siRNA, 1 μg/ml Atufect, lysis 48 hpt. All variants were found to be equally active in vitro.
[0377] Data are shown in
Example 5
[0378] The influence of inverted A and G RNA nucleotides at terminal 3′ positions was analyzed using an siRNA against TMPRSS6. TMP70 contains phosphorothioates at all termini, whereas TMP75 contains ivA and TMP78 contains ivG at the 3′-ends of both first and second strand. At these ends, ivA and ivG substitute for terminal phosphorothioates and are present in addition to the terminal nucleotide of the respective strands. The siRNA were tested for target knockdown in vitro. A non-related siRNA (PTEN) and a non-targeting siRNA (Luci) were included as controls. All tested variants show comparable activity under the tested conditions.
[0379] The experiment was conducted in Hep3B. Cells were seeded at a density of 150,000 cells per 6-well, transfected with 5 to 0.00016 nM siRNA and 1 μg/ml Atufect after 24 h and lysed after 48 h. Total RNA was extracted and TMPRSS6 and Actin mRNA levels were determined by Taqman qRT-PCR. Each bar represents mean±SD of three technical replicates.
[0380] Data are shown in
Example 6
[0381] The influence of inverted A and G RNA nucleotides at terminal 3′ positions was analysed using an siRNA against TMPRSS6. TMP70 contains each two phosphorothioate linkages at all termini, whereas TMP82 and TMP83 contain ivA (TMP82) and ivG (TMP83) at the T-end of the first strand and at the 3′-end of the second strand. Both inverted nucleotides are present in addition to the terminal nucleotide of the respective strands and are linked via a phosphorothioate bond. A non-related siRNA (PTEN) and a non-targeting siRNA (Luci) were included as controls. All tested variants show comparable activity under the tested conditions.
[0382] The experiment was conducted in Hep3B. Cells were seeded at a density of 150,000 cells per 6-well, transfected with 1 nM and 0.1 nM siRNA and 1 μg/ml Atufect after 24 h and lysed after 48 h. Total RNA was extracted and TMPRSS6 and Actin mRNA levels were determined by Taqman qRT-PCR. The results are shown in
[0383] Data are shown in
Example 7
[0384] Different siRNA duplexes containing inverted RNA nucleotides at both 3′-ends were tested for serum stability. TMP84-TMP87 contain inverted RNA in addition to the last nucleotide in the second strand and instead of the last nucleotide in the first strand. TMP88-TMP91 contain inverted RNA in addition to the last nucleotide in the first strand and instead of the last nucleotide in the second strand. All inverted RNA nucleotides substitute for terminally used phosphorothioates. In the design of TMP84-TMP87, ivA and ivG confer higher stability to the tested sequence than ivU and ivC (part A). In the design of TMP88-TMP91, there is no influence of base identity on duplex stability (part B).
[0385] “UT” indicates untreated samples. “FBS” indicates siRNA duplexes which were incubated at 5 μM final concentration with 50% FBS for 3 d, phenol/chloroform-extracted and precipitated with Ethanol. Samples were analysed on 20% TBE polyacrylamide gels in native gel electrophoresis and results are shown in
[0386] Sequences are set out in Table 1.
TABLE-US-00001 TABLE 1 Different siRNA duplexes containing inverted RNA nucleotides at both 3′-ends. Duplex sequence and chemistry ID top: first strand, bottom: second strand, both 5′-3′ TMP70 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU TMP84 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGivA fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfUivG TMP85 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGivU fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfUivG TMP86 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGivC fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfUivG TMP87 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGivG fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfivG TMP88 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmAivG fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUivA TMP89 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmAivG fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUivU TMP90 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmAivG fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUivC TMP91 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmAivG fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUivG mA, mU, mC, mG-2′-OMe RNA fA, fU, fC, fG-2′-F RNA ivA, ivU, ivC, ivG-inverted RNA (3′-3′) (ps)-phosphorothioate
Example 8
[0387] The influence of inverted RNA nucleotides at terminal 3′ positions was analysed using an siRNA against TMPRSS6. Sequences are set out in Table 1. TMP70 contains phosphorothioates at all termini, whereas TMP84-TMP87 contain ivG at the 3′-end of the second strand. The inverted RNA nucleotide is present in addition to the last nucleotide and substitutes for two terminal phosphorothioates. At the first strand 3′-end, ivA (TMP84), ivU (TMP85), ivC (TMP86) and ivG (TMP87) were tested. These inverted RNA nucleotides were added instead of the terminal nucleotide and substitute for phosphorothioates. A non-related siRNA (PTEN) and a non-targeting siRNA (Luci) were included as controls. All tested variants show comparable activity under the tested conditions.
[0388] The experiment was conducted in Hep3B. Cells were seeded at a density of 150,000 cells per 6-well, transfected with 1 nM and 0.1 nM siRNA and 1 μg/ml Atufect after 24 h and lysed after 48 h. Total RNA was extracted and TMPRSS6 and Actin mRNA levels were determined by Taqman qRT-PCR. Results are shown in
Example 9
[0389] The influence of inverted RNA nucleotides at terminal 3′ positions was analysed using an siRNA against TMPRSS6. The sequences are set out in Table 1. TMP70 contains phosphorothioates at all termini, whereas TMP88-TMP91 contain ivG at the 3′-end of the first strand. The inverted RNA nucleotide is present in addition to the last nucleotide and substitutes for two phosphorothioates. At the second strand 3′-end, ivA (TMP88), ivU (TMP89), ivC (TMP90) and ivG (TMP91) were tested. These inverted RNA nucleotides were added instead of the terminal nucleotide and substitute for phosphorothioates. A non-related siRNA (PTEN) and a non-targeting siRNA (Luci) were included as controls. All tested variants show comparable activity under the tested conditions.
[0390] The experiment was conducted in Hep3B. Cells were seeded at a density of 150,000 cells per 6-well, transfected with 1 nM and 0.1 nM siRNA and 1 μg/ml Atufect after 24 h and lysed after 48 h. Total RNA was extracted and TMPRSS6 and Actin mRNA levels were determined by Taqman qRT-PCR. Results are shown in
Example 10
[0391] The influence of inverted RNA nucleotides at terminal 3′ positions was analysed using a GalNAc-siRNA conjugate targeting TMPRSS6 in liposomal transfections. STS12009-L4 contains phosphorothioates at all non-conjugated termini, whereas the tested variants contain an inverted RNA nucleotide at the 3′-ends of both first and second strand. The inverted RNA is present in addition to the last nucleotide and substitutes for two terminal phosphorothioates (STS12009V10-L4 and —V11-L4) or is used in addition to two terminal phosphorothioates (STS12009V29-L4 and STS12009V30-L4). Inverted A (STS12009V10-L4 and -V29-L4) and inverted G (STS12009V11-L4 and —V30-L4) were used. All tested variants show comparable activity under the tested conditions.
[0392] The experiment was conducted in Hep3B. Cells were seeded at a density of 150,000 cells per 6-well, transfected with 5 nM to 0.0016 nM siRNA and 1 μg/ml Atufect after 24 h and lysed after 48 h. Total RNA was extracted and TMPRSS6 and Actin mRNA levels were determined by Taqman qRT-PCR. Each bar represents mean±SD of three technical replicates.
[0393] Sequences are listed in Table 2 and results are shown in
TABLE-US-00002 TABLE 2 GalNAc-siRNA conjugates targeting TMPRSS6 sequence were used to investigate the influence of inverted RNA nucleotides at terminal 3′ positions. Sequence chemistry Duplex ID Top: first strand, bottom: second strand, both 5′-3′ STS12009L4 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA [ST23(ps)]3 ST41(ps)fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU STS12009V10L4 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivA [ST23(ps)]3 ST41(ps)fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivA STS12009V11L4 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivG [ST23(ps)]3 ST41(ps)fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivG STS12009V29L4 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA ivA [ST23(ps)]3 ST41(ps)fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU ivA STS12009V30L4 mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA ivG [ST23(ps)]3 ST41(ps)fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fUivG mA, mU, mC, mG-2′OMe RNA fA, fU, fC, fG-2′F RNA ivA, ivG-inverted RNA (3′-3′) (ps)-phosphorothioate
Example 11
[0394] Different siRNA duplexes targeting ALDH2 and containing inverted RNA nucleotides at both 3′-ends were tested for serum stability. ALD02-ALD05 contain inverted RNA in addition to the last nucleotide in first and second strand. ALD06-ALD09 contain inverted RNA instead of the last nucleotide in first and second strand. All inverted RNA nucleotides substitute for terminally used phosphorothioates. In both designs, ivA and ivG confer higher stability to the tested sequence than ivU and ivC.
[0395] “UT” indicates untreated samples. “FBS” indicates siRNA duplexes which were incubated at 5 μM concentration with 50% FBS for 3 d, phenol/chloroform-extracted and precipitated with Ethanol. Samples were analysed on 20% TBE polyacrylamide gels in native gel electrophoresis and results are shown in
[0396] Sequences are shown in Table 3.
[0397] Table 3: Different siRNA duplexes containing inverted RNA nucleotides at both 3′-ends, where each sequence targets ALDH2.
TABLE-US-00003 Duplex sequence and chemistry ID top: first strand, bottom: second strand, both 5′-3′ ALD01 mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmC(ps)fG(ps)mG fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfA(ps)mU(ps)fU ALD02 mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfGmG IvA fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmUfU IvA ALD03 mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfGmG IvU fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmUfU IvU ALD04 mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfGmG IvC fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmUfU IvC ALD05 mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfGmG IvG fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmUfU IvG ALD06 mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfG IvA fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmU IvA ALD07 mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfG IvU fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmU IvU ALD08 mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfG IvC fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmU IvC ALD09 mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfG IvG fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmU IvG mA, mU, mC, mG-2′-OMe RNA fA fU fC fG-2′-F RNA ivA, ivU, ivC, ivG-irverted RNA (3′-3′) (ps)-phosphorothioate
Example 12
[0398] The influence of inverted A, U, C and G RNA nucleotides at 3′-overhang positions was analysed using an siRNA against ALDH2. Sequences are set out in Table 3. ALD01 contains phosphorothioates at all termini, whereas ALD02-ALD05 contain ivA (ALD01), ivU (ALD03), ivC (ALD04) and ivG (ALD05) at the 3′-end of the first strand and at the 3′-end of the second strand. Both inverted nucleotides are present in addition to the terminal nucleotide of the respective strands and substitute for terminal phosphorothioates. A non-related siRNA (PTEN) and a non-targeting siRNA (Luci) were included as controls. All tested variants show comparable activity under the tested conditions.
[0399] The experiment was conducted in Hep3B. Cells were seeded at a density of 150,000 cells per 6-well, transfected with 0.1 nM and 1 nM siRNA and 1 μg/ml Atufect after 24 h and lysed after 48 h. Total RNA was extracted and ALDH2 and Actin mRNA levels were determined by Taqman qRT-PCR. Results are shown in
Example 13
[0400] The influence of inverted A, U, C and G RNA nucleotides at terminal 3′ positions was analysed using an siRNA against ALDH2. Sequences are set out in Table 3. ALD01 contains phosphorothioates at all termini, whereas ALD06-ALD09 contain ivA (ALD06), ivU (ALD07), ivC (ALD08) and ivG (ALD09) at the 3′-end of the first strand and at the 3′-end of the second strand. Both inverted nucleotides are present instead of the terminal nucleotide of the respective strands and substitute for terminal phosphorothioates. A non-related siRNA (PTEN) and a non-targeting siRNA (Luci) were included as controls. All tested variants show comparable activity under the tested conditions.
[0401] The experiment was conducted in Hep3B. Cells were seeded at a density of 150,000 cells per 6-well, transfected with 0.1 nM and 1 nM siRNA and 1 μg/ml Atufect after 24 h and lysed after 48 h. Total RNA was extracted and ALDH2 and Actin mRNA levels were determined by Taqman qRT-PCR. Results are shown in
Example 14
[0402] Different GalNAc-siRNA conjugates containing inverted RNA nucleotides were tested for serum stability. STS22002L6 contains phosphorothioates at all non-conjugated ends, whereas STS22002V1 L6 and STS22002V2L6 contain inverted RNA nucleotides at the second strand 3′-end, where the nucleotide is present instead of the last nucleotide. STS22002V3L6 and —V4L6 contain inverted RNA nucleotides at the first strand 3′-end, where the nucleotide is present in addition to the last nucleotide. ivA was used in STS22002V1L6 and —V3L6, whereas ivG was used in STS22002V2L6 and —V4L6. All inverted RNA nucleotides substitute for terminally used phosphorothioates. STS22002V1 L6 and —V2L6 are slightly more stable than the other variants tested here.
[0403] “UT” indicates untreated samples. “FBS” indicates GalNAc-siRNA conjugates which were incubated at 5 μM concentration with 50% FBS for 3 d, phenol/chloroform-extracted and precipitated with Ethanol. Samples were analysed on 20% TBE polyacrylamide gels in native gel electrophoresis and results are shown in
[0404] Sequences are set out in Table 4.
TABLE-US-00004 TABLE 4 Different GalNAc-siRNA conjugates of a ALDH2 targeting sequence, containing inverted RNA nucleotides. Sequence chemistry Duplex ID Top: first strand, bottom: second strand, both 5′-3′ STS22002L6 mA(ps)fA(ps)mUfGmUfUmUfmCfCmUfGmCfUmGfAmC(ps)fG(ps)mG [ST23(ps)]3 ST43(ps)fCmCfGmUfCmAfGmCfAmGfGmAfAmAfAmCfA(ps)mU(ps)fU STS22002V1L6 mA(ps)fA(ps)mUfGmUfUmUfmCfCmUfGmCfUmGfAmC(ps)fG(ps)mG [ST23(ps)]3 ST43(ps)fCmCfGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmUfU ivA STS22002V2L6 mA(ps)fA(ps)mUfGmUfUmUfmCfCmUfGmCfUmGfAmC(ps)fG(ps)mG [ST23(ps)]3 ST43(ps)fCmCfGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmUfU ivG STS22002V3L6 mA(ps)fA(ps)mUfGmUfUmUfmCfCmUfGmCfUmGfAmCfGmG ivA [ST23(ps)]3 ST43(ps)fCmCfGmUfCmAfGmCfAmGfGmAfAmAfAmCfA(ps)mU(ps)fU STS22002V4L6 mA(ps)fA(ps)mUfGmUfUmUfmCfCmUfGmCfUmGfAmCfGmG ivG [ST23(ps)]3 ST43(ps)fCmCfGmUfCmAfGmCfAmGfGmAfAmAfAmCfA(ps)mU(ps)fU mA, mU, mC, mG-2′OMe RNA fA, fU, fC, fG -2′F RNA ivA, ivG-inverted RNA (3′-3′) (ps)-phosphorothioate
Example 14
[0405] The influence of inverted RNA nucleotides at terminal 3′ positions was analysed using a GalNAc-siRNA conjugate targeting ALDH2 by receptor-mediated uptake in mouse primary hepatocytes. The sequences are set out in Table 4. STS22002L6 contains phosphorothioates at all non-conjugated ends, whereas STS22002V1L6 and STS22002V2L6 contain inverted RNA nucleotides at the second strand 3′-end, where the nucleotide is present instead of the last nucleotide. STS22002V3L6 and —V4L6 contain inverted RNA nucleotides at the first strand 3′-end, where the nucleotide is present in addition to the last nucleotide. ivA was used in STS22002V1L6 and —V3L6, whereas ivG was used in STS22002V2L6 and —V4L6. All inverted RNA nucleotides substitute for terminally used phosphorothioates. All tested variants show comparable activity.
[0406] The experiment was conducted in primary mouse hepatocytes. Cells were seeded at a density of 20,000 cells per 96-well, treated with 125 nM to 0.04 nM siRNA conjugate directly after plating and lysed after 24 h. Total RNA was extracted and ALDH2 and Actin mRNA levels were determined by Taqman qRT-PCR. Results are shown in
Example 15
[0407] The influence of ivA at the first strand 3′-end was analysed in vivo in mice. Therefore, GalNAc-siRNA conjugates targeting ALDH2 were used. Sequences are set out in Table 4. STS22002L6 contains phosphorothioates at all non-conjugated termini, whereas STS22002V3L6 contains ivA at the first strand 3′-end in addition to the last nucleotide.
[0408] C57BL/6 male mice were subcutaneously treated with 10 mg/kg and 3 mg/kg GalNAc conjugate. Liver sections were prepared 7 days after treatment, RNA was extracted from the tissue and ALDH2 and ApoB mRNA levels were analysed by Taqman qRT-PCR. Results are shown in
Example 16
[0409] In vitro activity of GalNAc-conjugated siRNAs against ALDH2 (STS22006) containing inverted RNA nucleotides in addition to terminal nucleotides.
[0410] The influence of inverted RNA nucleotides at terminal positions was analyzed using GalNAc-siRNA conjugates targeting ALDH2 after receptor-mediated uptake in mouse primary hepatocytes. STS22006L6 contains phosphorothioates at all non-conjugated ends, whereas STS22006V7L6 contains one ivA at the first strand 3′-end and STS22006V8L6 contains one ivA at the second strand 3′-end. STS22006V9L6 contains each one ivA at the first strand and second strand 3′-ends. The named conjugates contain a GalNAc moiety at the second strand 5′-end. STS22006V10L35 contains a GalNAc moiety at the first strand 3′-end with each one ivA at the second strand 5′- and 3′-ends. All siRNA conjugates described here contain ivA instead of the terminal nucleotide and instead of terminal phosphorothioates.
[0411] The experiment was conducted in primary mouse hepatocytes. Cells were seeded at a density of 20,000 cells per 96-well, treated with 100, 10 and 1 nM siRNA conjugate directly after plating and lysed after 24 h. Total RNA was extracted and ALDH2 and PTEN mRNA levels were determined by Taqman qRT-PCR. Each bar represents mean±SD of three technical replicates
[0412] Data is shown in
Example 17
[0413] In vitro activity of GalNAc-conjugated siRNAs against ALDH2 (STS22009) containing inverted RNA nucleotides in addition to terminal nucleotides.
[0414] The influence of inverted RNA nucleotides at terminal positions was analyzed using GalNAc-siRNA conjugates targeting ALDH2 after receptor-mediated uptake in mouse primary hepatocytes. STS22009L6 contains phosphorothioates at all non-conjugated ends, whereas STS22009V3L6 contains one ivA at the first strand 3′-end and STS22009V4L6 contains one ivA at the second strand 3′-end. STS22009V5L6 contains each one ivA at the first strand and second strand 3′-ends. The named conjugates contain a GalNAc moiety at the second strand 5′-end. STS22009V6L35 contains a GalNAc moiety at the first strand 3′-end with each one ivA at the second strand 5′- and 3′-ends. All siRNA conjugates described here contain ivA instead of the terminal nucleotide and instead of terminal phosphorothioates.
[0415] The experiment was conducted in primary mouse hepatocytes. Cells were seeded at a density of 20,000 cells per 96-well, treated with 100, 10 and 1 nM siRNA conjugate directly after plating and lysed after 24 h. Total RNA was extracted and ALDH2 and PTEN mRNA levels were determined by Taqman qRT-PCR. Each bar represents mean±SD of three technical replicates
[0416] Data is shown in
Example 18
[0417] In vitro activity of GalNAc-conjugated siRNAs against TTR containing inverted RNA nucleotides in addition to terminal nucleotides.
[0418] The influence of inverted RNA nucleotides at terminal positions was analyzed using GalNAc-siRNA conjugates targeting TTR after receptor-mediated uptake in mouse primary hepatocytes. STS16001L1 contains phosphorothioates at all non-conjugated ends, whereas STS16001V11L1 contains one ivA at the first strand 3′-end and STS16001V12L1 contains one ivA at the second strand 3′-end. STS16001V13L1 contains each one ivA at the first strand and second strand 3′-ends. The named conjugates contain a GalNAc moiety at the second strand 5′-end. STS16001V14L35 contains a GalNAc moiety at the first strand 3′-end with each one ivA at the second strand 5′- and 3′-ends. All siRNA conjugates described here contain ivA instead of the terminal nucleotide and instead of terminal phosphorothioates.
[0419] The experiment was conducted in primary mouse hepatocytes. Cells were seeded at a density of 20,000 cells per 96-well, treated with 10, 1 and 0.1 nM siRNA conjugate directly after plating and lysed after 24 h. Total RNA was extracted and TTR and PTEN mRNA levels were determined by Taqman qRT-PCR. Each bar represents mean±SD of three technical replicates.
[0420] Data is shown in
Example 19
[0421] In vitro activity of GalNAc-conjugated siRNAs against ALDH2 containing inverted RNA nucleotides at 3′-ends instead of the last nucleotide.
[0422] The influence of inverted RNA nucleotides at terminal 3′ positions was analyzed using GalNAc-siRNA conjugates targeting ALDH2 after receptor-mediated uptake in mouse primary hepatocytes. STS22002L6 contains phosphorohioates at all non-conjugated ends, whereas STS22002V8L6 contains one ivA at the first strand 3′-end instead of the last nucleotide and instead of phosphorothioates. STS22002V9L6 contains each one ivA at the first and second strand 3′-ends instead of the respective last nucleotides and terminal phosphorothioates. STS22002V10L6 contains one ivA at the first strand 3′-end in addition to the last nucleotide and one ivA at the second strand 3′-end instead of the last nucleotide. Both ivA-containing ends are not stabilized by terminal phosphorothioates and the siRNA is conjugated to a GalNAc moiety which does not contain phosphorothioates.
[0423] The experiment was conducted in primary mouse hepatocytes. Cells were seeded at a density of 20,000 cells per 96-well, treated with 100, 10 and 1 nM siRNA conjugate directly after plating and lysed after 24 h. Total RNA was extracted and ALDH2 and PTEN mRNA levels were determined by Taqman qRT-PCR. Each bar represents mean±SD of three technical replicates.
[0424] Data is shown in
Example 20
[0425] Different modified variants of the GalNAc-siRNA conjugates STS22006 and STS22009 were analyzed for knockdown activity in vivo. “V1” variants contain a different 2′-OMe/2′-F modification pattern in the second strand and an ivA nucleotide at the 3′-end of the second strand, substituting for the last nucleotide and for terminal phosphorothioates at this end. “V2” additionally contains a different 2′-OMe/2′-F modification pattern in the first strand.
[0426] C57BU6 male mice were subcutaneously treated with 3 mg/kg and 1 mg/kg GalNAc conjugate. Liver sections were prepared 9 days after treatment, RNA was extracted from the tissue and ALDH2 and ApoB mRNA levels were analyzed by Taqman qRT-PCR. Each bar represents mean±SD of six animals. Statistical analysis is based on Kruskal-Wallis test with Dunn's multiple comparisons test against control group (PBS).
[0427] Data is shown in
Example 21
[0428] Serum stability of siRNA-conjugates (X0258-261) with non-cleavable GalNAc linker at the 5′-end of the second strand and 3′ phosphorylated ivR substituting the first nucleotide at the 5′-end of the first strand in comparison to stable X0139 and less stabilized positive (Juk) control for nuclease degradation.
[0429] The siRNA conjugates were incubated for 4 hours (4 h) or 3 days (3d) in 50% FBS at 37° C. or left untreated (0 h). After incubation, RNA was extracted by phenol/chloroform/isoamyl alcohol extraction. Degradation was visualized by TBE-Polyacrylamid gel electrophoresis and staining of RNA with SYBRGold.
[0430] Data are shown in
Example 22
[0431] Target gene expression in primary murine hepatocytes 24 h following treatment with TTR-siRNA conjugates with non-cleavable GalNAc-cluster at the 5′-end of the second strand and with one 3′-phosphorylated inverted ribonucleotide at the 5′-position of the first strand, without stabilizing phosphorothioate linkages between the three terminal nucleotides at that end (X0258-261), in comparison to a non-targeting GalNAc-siRNA (Luc), and a positive control (X0139) at indicated concentrations or cells left untreated (UT).
[0432] The experiment was conducted in murine primary hepatocytes. Cells were seeded at a density of 30,000 cells per 96-well and treated with siRNA-conjugates at concentrations ranging from 10 nM to 0.0001 nM. 24 h post treatment cells were lysed and RNA was extracted. Transcript levels of TTR and housekeeping mRNA (PTEN) were quantified by TaqMan analysis. Each bar represents mean±SD of three technical replicates.
[0433] Data are shown in
Example 23
[0434] Target gene expression in primary murine hepatocytes 24 h following treatment with TTR-siRNA with a GalNAc-cluster at the 3′-end of the first strand and one inverted ribonucleotide as an overhang at the 5′-position of the second strand replacing the two stabilizing phosphorothioate linkages between the first three nucleotides at this end (X0264-267), in comparison to a non-targeting GalNAc-siRNA (Luc), and a positive control (X0107) at indicated concentrations or left untreated (UT).
[0435] The experiment was conducted in murine primary hepatocytes. Cells were seeded at a density of 30,000 cells per 96-well and treated with siRNA-conjugates at concentrations ranging from 10 nM to 0.001 nM. 24 h post treatment cells were lysed and RNA was extracted. Transcripts levels of TTR and housekeeping mRNA (PTEN) were quantified by TaqMan analysis. Each bar represents mean±SD of three technical replicates.
[0436] Data are shown in
Example 24
[0437] Additional example compounds were synthesised by the methods described below and methods known to the person skilled in the art. Assembly of the oligonucleotide chain and linker building blocks was performed by solid phase synthesis applying phosphoramidte methodology. GalNAc conjugation was achieved by peptide bond formation of a GalNAc-carboxylic acid building block to the prior assembled and purified oligonucleotide having the necessary number of amino modified linker building blocks attached.
[0438] Oligonucleotide synthesis, deprotection and purification followed standard procedures that are known in the art.
[0439] Oligonucleotides were synthesized on an AKTA oligopilot synthesizer using standard phosphoramidite chemistry. Commercially available solid support and 2′O-Methyl RNA phosphoramidites, 2′Fluoro, 2′Deoxy RNA phosphoramidites, 2′TBDMS RNA phosphoramidites (all standard protection, ChemGenes, LinkTech) and commercially available long trebler phosphoramidite (Glen research) and 3′-Amino Modifier TFA Amino C-6 lcaa CPG 500 Å (CPG supported GlyC3Am(TFA)) was purchased from ChemGenes. Per-acetylated galactose amine 8 is commercially available. Phosphate generating agent Bis-cyanoethyl-N,N-diisopropyl phosphoramidite was purchased from ChemGenes.
[0440] Ancillary reagents were purchased from EMP Biotech. Synthesis was performed using a 0.1 M solution of the phosphoramidite in dry acetonitrile and benzylthiotetrazole (BTT) was used as activator (0.3M in acetonitrile). Coupling time was 15 min. A Cap/OX/Cap or Cap/Thio/Cap cycle was applied (Cap: Ac2O/NMI/Lutidine/Acetonitrile, Oxidizer: 0.1M 12 in pyridine/H2O). Phosphorothioates were introduced using standard commercially available thiolation reagent (EDITH, Link technologies). DMT cleavage was achieved by treatment with 3% dichloroacetic acid in toluene. Upon completion of the programmed synthesis cycles a diethylamine (DEA) wash was performed. All oligonucleotides were synthesized in DMT-off mode.
[0441] GlyC3Am(TFA)-solid support is:
##STR00029##
[0442] Synthesis of Compounds 2 to 10 and ST13
[0443] Compounds 2 to 5 and (S)-DMT-Serinol(TFA)-phosphoramidite 7 were synthesised according to literature published methods (Hoevelmann et al. Chem. Sci., 2016, 7, 128-135).
##STR00030##
[0444] i) ethyl trifluoroacetate, NEt3, MeOH, 0° C., 16 h, 5: 90%, ii) DMTCI, pyridine, 0° C., 16 h, 64% over two steps, iii) LiBH4, EtOH/THF (1/1, v/v), 0° C., 1 h, 76%, iv) 2-cyanoethyl-N,N-diisopropylchloro phosphoramidite, EtNiPr2, CH2Cl2, 56%, v) succinic anhydride, DMAP, pyridine, RT, 16 h, 38%, vi) HBTU, DIEA, amino-lcaa CPG (500A), RT, 18 h, 29% (26 μmol/g loading).
(S)-4-(3-(bis(4-methoxyphenyl)(phenyl)methoxy)-2-(2,2,2-trifluoroacetamido)propoxy)-4-oxobutanoic Acid (6)
[0445] To a solution of 5 in pyridine was added succinic anhydride, followed by DMAP. The resulting mixture was stirred at room temperature overnight. All starting material was consumed, as judged by TLC. The reaction was concentrated. The crude material was chromatographed in silica gel using a gradient 0% to 5% methanol in DCM (+1% triethylamine) to afford 1.33 g of 6 (yield=38%). m/z (ESI−): 588.2 (100%), (calcd. for C30H29F3NO8- [M-H]− 588.6). 1H-NMR: (400 MHz, CDCl.sub.3) δ [ppm]=7.94 (d, 1H, NH), 7.39-7.36 (m, 2H, CHaryl), 7.29-7.25 (m, 7H, CHaryl), 6.82-6.79 (m, 4H, CHaryl), 4.51-4.47 (m, 1H), 4.31-4.24 (m, 2H), 3.77 (s, 6H, 2×DMTr-OMe), 3.66-3.60 (m, 16H, HNEt3+), 3.26-3.25 (m, 2H), 2.97-2.81 (m, 20H, NEt3), 2.50-2.41 (4H, m), 1.48-1.45 (m, 26H, HNEt3+), 1.24-1.18 (m, 29H, NEt3).
(S)-DMT-Serinol(TFA)-succinate-lcaa-CPG (10)
[0446] The (S)-DMT-Serinol(TFA)-succinate (159 mg, 270 umol) and HBTU (113 mg, 299 umol) were dissolved in CH3CN (10 mL). Diisopropylethylamine (DIPEA, 94 μL, 540 umol) was added to the solution, and the mixture was swirled for 2 min followed by addition native amino-lcaa-CPG (500 A, 3 g, amine content: 136 umol/g). The suspension was gently shaken at room temperature on a wrist-action shaker for 16 h then filtered, and washed with DCM and EtOH. The solid support was dried under vacuum for 2 h. The unreacted amines on the support were capped by stirring with acetic anhydride/lutidine/N-methylimidazole at room temperature. The washing of the support was repeated as above. The solid was dried under vacuum to yield solid support 10 (3 g, 26 umol/g loading).
[0447] Synthesis of GalNAc synthon 9 was performed as described in Nair et al. J. Am. Chem. Soc., 2014,136 (49), pp 16958-16961.
##STR00031##
[0448] (vii) TMSOTf, DCM, hexenol, viii) RuCl3, NaIO4, DCM, CH3CN, H2O, 46% over two steps.
[0449] Synthesis of ST13(Ac)9 was achieved by following methods as described in Nair et al. J. Am. Chem. Soc., 2014,136 (49), pp 16958-16961. Final deacetylation to yield ST13 was achieved by treating ST13(Ac)9 with sodium methoxide in methanol.
##STR00032##
Trimeric GalNAc Synthon (ST13)
[0450] ST13(Ac)9 (3150 mg, 1.570 mmol) was dissolved in Methanol (100 ml) and sodium methoxide (5.4M, 227 mg, 1.512 mmol, 280 μL) was added (via syringe) at room temperature. The resulting mixture was stirred at for 1 h. Acetonitrile was added (75 ml) and the reaction mixture was concentrated under reduced pressure. m/z (ESI+): 814.5 (100%), (calcd. for C73H131N10O302+[M+2H]2+814.5). 1H NMR (400 MHz, DMSO-d6) δ[ppm] =7.91-7.72 (m, 9H, NH), 7.08 (s, 1H, NH), 4.90 (d, 3H), 4.77 (m, 3H), 4.20 (d; 3H), 3.70-3.64 (m, 9H), 3.57-3.40 (br, 30H, incl. res. H2O), 3.26 (m, 6H), 3.03-3.01 (m, 12H), 2.27-2.25 (m, 6H), 2.07-2.03 (m, 10H), 1.89-1.85 (t, 2H), 1.78 (s, 9H), 1.52-1.41 (m, 22H); 1.21 (m, 12H).
[0451] Synthesis of Oligonucleotides
[0452] Oligonucleotide synthesis of 3′trivalent tree-like GalNAc-cluster conjugated oligonucleotides commenced using commercially available GlyC3Am-solid support as in the example compound 168. Phosphoramidite synthesis coupling cycle consisting of 1) DMT-removal, 2) chain elongation using the required DMT-masked phosphoramidite, 3) capping of non-elongated oligonucleotide chains, followed by oxidation of the P(III) to P(V) either by Iodine or EDITH (if phosphorothioate linkage was desired) and again capping (Cap/Ox/Cap or Cap/Thio/Cap) was repeated until full length of the product was reached. Upon completion of chain elongation, the protective DMT group of the last coupled amidite building block was removed, as in step 1) of the phosphoramidite synthesis cycle.
[0453] Oligonucleotide synthesis of multiple 3′ mono-GalNAc conjugated oligonucleotides was commenced using (S)-DMT-Serinol(TFA)—succinate-lcaa-CPG (10) as in example compound 87. A second and third (S)-DMT-serinol(TFA) was coupled in the first and second cycle to the serinol(TFA)-CPG in order to make the precursor compound 11 for the example compound 87. Afterwards, phosphoramidite synthesis cycle was applied using 5′-DMT-2′OMe-RNA or 5′-DMT-2′F-DNA phosphoramidites until full length of the product was reached. Upon completion of chain elongation, the protective DMT group of the last coupled amidite building block was removed, as in step 1) of the phosphoramidite synthesis cycle.
##STR00033##
[0454] Finally, the respective oligonucleotides were off the CPG and set free from additional protective groups by by 40% aq. methylamine treatment. This treatment also liberated the amino function in the Serinol(TFA) and GlyC3Am(TFA) building block. The crude products were then purified each by ion exchange chromatography (Resource Q, 6 mL, GE Healthcare) on an AKTA Pure HPLC System using a sodium chloride gradient. Product containing fractions were pooled, desalted on a size exclusion column (Zetadex, EMP Biotech) and lyophilized to yield the precursor oligonucleotides 1 or 11 for further GalNAc conjugation.
[0455] All final single stranded products were analysed by AEX-HPLC to prove their purity. Identity of the respective single stranded products (non-modified, amino-modified precursors or GalNAc conjugated oligonucleotides) was proved by LC-MS analysis.
[0456] Conjugation to Single Stranded Oligonucleotides
[0457] Conjugated Singles Strands SEQ ID 168, 180, 182, 184 and 186
[0458] Conjugation of the GalNac synthon (ST13) was achieved by coupling to the 3′-amino function of the respective oligonucleotide strand (1) using a peptide coupling reagent. Therefore, the respective amino-modified precursor molecule was dissolved in H2O (500 OD/mL) and DMSO (DMSO/H2O, 2/1, v/v) was added, followed by DIPEA (2.5% of total volume). In a separate reaction vessel pre-activation of the trimeric-GalNAc-synthon (ST13) was performed by reacting 2 eq. of the carboxylic acid component with 2 eq. of HBTU in presence of 8 eq. DIPEA in DMSO. After 2 min the pre-activated compound ST13 was added to the solution of the respective amino-modified precursor molecule 1. After 30 min the reaction progress was monitored by LCMS or AEX-HPLC. Upon completion of the conjugation reaction the crude product was precipitated by addition of 10×iPrOH and 0.1×2M NaCl and harvested by centrifugation and decantation. The resulting pellet was dissolved in H.sub.2O and finally purified again by anion exchange and size exclusion chromatography and lyophilised.
##STR00034##
[0459] Conjugated Singles Strands 87, 107, 171, 173, 175, 177 and 179
[0460] Conjugation of the GalNac synthon (9) was achieved by coupling to the serinol-amino function of the respective oligonucleotide strand 11 using a peptide coupling reagent. Therefore, the respective amino-modified precursor molecule 11 was dissolved in H.sub.2O (500 OD/mL) and DMSO (DMSO/H2O, 2/1, v/v) was added, followed by DIPEA (2.5% of total volume). In a separate reaction vessel pre-activation of the GalN(Ac4)-C4-acid (9) was performed by reacting 2 eq. (per amino function in the amino-modified precursor oligonucleotide 11) of the carboxylic acid component with 2 eq. of HBTU in presence of 8 eq. DIPEA in DMSO. After 2 min the pre-activated compound 9 was added to the solution of the respective amino-modified precursor molecule. After 30 min the reaction progress was monitored by LCMS or AEX-HPLC. Upon completion of the conjugation reaction the crude product was precipitated by addition of 10× iPrOH and 0.1×2M NaCl and harvested by centrifugation and decantation. To set free the acetylated hydroxyl groups in the GalNAc moieties the resulting pellet was dissolved in 40% MeNH2 (1 mL per 500 OD) and after 15 min at RT diluted in H2O (1:10) and finally purified again by anion exchange and size exclusion chromatography and lyophilised to yield the final product 12.
##STR00035##
[0461] Ser(GN) Conjugated singles strands 87, 107, 171, 173, 175, 177 and 179 is a GalNAc-C4 building block attached to serinol derived linker moiety:
##STR00036##
[0462] wherein the O--- is the linkage between the oxygen atom and e.g. H, phosphoroate linkage or phosphorothioate linkage.
[0463] Serinol derived linker moieties may be based on serinol in any stereochemistry i.e. derived from L-serine isomer, D-serine isomer, a racemic serine or other combination of isomers. In a preferred aspect of the invention, the serinol-GalNAc moiety (SerGN) has the following stereochemistry:
##STR00037##
[0464] i.e. is based on an (S)-serinol-amidite or (S)-serinol succinate solid supported building block derived from L-serine isomer.
[0465] Double Strand Formation
[0466] Individual single strands were dissolved in a concentration of 60 OD/mL in H2O. Both individual oligonucleotide solutions were added together in a reaction vessel. For easier reaction monitoring a titration was performed. The first strand was added in 25% excess over the second strand as determined by UV-absorption at 260 nm. The reaction mixture was heated to 80° C. for 5 min and then slowly cooled to RT. Double strand formation was monitored by ion pairing reverse phase HPLC. From the UV-area of the residual single strand the needed amount of the second strand was calculated and added to the reaction mixture. The reaction was heated to 80° C. again and slowly cooled to RT. This procedure was repeated until less than 10% of residual single strand was detected.
TABLE-US-00005 SEQ ID Name Sequence (5′-3′) 1 TMPJH01A mAfAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA 2 TMPJH01B fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU 3 TMPJH40A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA 4 TMPJH40B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU 5 TMPJH41A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA ivA 6 TMPJH41B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU ivA 7 TMPJH42A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA ivU 8 TMPJH42B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU ivU 9 TMPJH43A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA ivC 10 TMPJH43B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU ivC 11 TMPJH44A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA ivG 12 TMPJH44B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps)fU ivG 13 TMPJH45A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivA 14 TMPJH45B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivA 15 TMPJH46A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivU 16 TMPJH46B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivU 17 TMPJH47A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivC 18 TMPJH47B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivC 19 TMPJH48A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivG 20 TMPJH48B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivG 21 TMP82A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA(ps)ivA 22 TMP82B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU(ps)ivA 23 TMP83A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA(ps)ivG 24 TMP83B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU(ps)ivG 25 TMP84A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfG ivA 26 TMP84B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivG 27 TMP85A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfG ivU 28 TMP85B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivG 29 TMP86A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfG ivC 30 TMP86B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivG 31 TMP87A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfG ivG 32 TMP87B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivG 33 TMP88A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivG 34 TMP88B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmU ivA 35 TMP89A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivG 36 TMP89B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmU ivU 37 TMP90A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivG 38 TMP90B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmU ivC 39 TMP91A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivG 40 TMP91B fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmU ivG 41 STS12009L4A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA 42 STS12009L4B [ST23(ps)]3 ST41(ps)fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU (ps)fU 43 STS12009V10L4A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivA 44 STS12009V10L4B [ST23(ps)]3 ST41(ps)fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivA 45 STS12009V11L4A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmUfGmA ivG 46 STS12009V11L4B [ST23(ps)]3 ST41(ps)fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfGmUfU ivG 47 STS12009V29L4A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA ivA 48 STS12009V29L4B [ST23(ps)]3 ST41(ps)fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps) fU ivA 49 STS12009V30L4A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA ivG 50 STS12009V30L4B [ST23(ps)]3 ST41(ps)fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU(ps) fU ivG 51 ALD01A mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmC(ps)fG(ps)mG 52 ALD01B fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfA(ps)mU(ps)fU 53 ALD02A mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfGmG ivA 54 ALD02B fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmUfU ivA 55 ALD03A mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfGmG ivU 56 ALD03B fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmUfU ivU 57 ALD04A mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfGmG ivC 58 ALD04B fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmUfU ivC 59 ALD05A mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfGmG ivG 60 ALD05B fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmUfU ivG 61 ALD06A mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfG ivA 62 ALD06B fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmU ivA 63 ALD07A mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfG ivU 64 ALD07B fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmU ivU 65 ALD08A mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfG ivC 66 ALD08B fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmU ivC 67 ALD09A mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfG ivG 68 ALD09B fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmU ivG 69 STS22002L6A mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmC(ps)fG(ps)mG 70 STS22002L6B [ST23(ps)]3 ST43(ps)fCmCfGmUfCmAfGmCfAmGfGmAfAmAfAmCfA(ps)mU(ps) fU 71 STS22002V1L6A mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmC(ps)fG(ps)mG 72 STS22002V1L6B [ST23(ps)]3 ST43(ps)fCmCfGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmU ivA 73 STS22002V2L6A mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmC(ps)fG(ps)mG 74 STS22002V2L6B [ST23(ps)]3 ST43(ps)fCmCfGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmU ivG 75 STS22002V3L6A mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfGmG ivA 76 STS22002V3L6B [ST23(ps)]3 ST43(ps)fCmCfGmUfCmAfGmCfAmGfGmAfAmAfAmCfA(ps)mU(ps) fU 77 STS22002V4L6A mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfGmG ivG 78 STS22002V4L6B [ST23(ps)]3 ST43(ps)fCmCfGmUfCmAfGmCfAmGfGmAfAmAfAmCfA(ps)mU(ps) fU 79 STS22006L6A mU(ps)fC(ps)mUfUmCfUmUfAmAfAmCfUmGfAmGfUmU(ps)fU (ps) mC 80 STS22006L6B [ST23(ps)]3 ST43(ps)fGmAfAmAfCmUfCmAfGmUfUmUfAmAfGmAfA(ps)mG(ps) fA 81 STS22006V7L6A mU(ps)fC(ps)mUfUmCfUmUfAmAfAmCfUmGfAmGfUmU(ps)fU(ps)mC 82 STS22006V7L6B [ST23(ps)]3 ST43(ps)fGmAfAmAfCmUfCmAfGmUfUmUfAmAfGmAfAmGfA ivA 83 STS22006V8L6A mU(ps)fC(ps)mUfUmCfUmUfAmAfAmCfUmGfAmGfUmU(ps)fU(ps)mC ivA 84 STS22006V8L6B [ST23(ps)]3 ST43(ps)fGmAfAmAfCmUfCmAfGmUfUmUfAmAfGmAfA(ps)mG(ps) fA 85 STS22006V9L6A mU(ps)fC(ps)mUfUmCfUmUfAmAfAmCfUmGfAmGfUmUfUmC ivA 86 STS22006V9L6B [ST23(ps)]3 ST43(ps)fGmAfAmAfCmUfCmAfGmUfUmUfAmAfGmAfAmGfA ivA 87 STS22006V10L35A mU(ps)fC(ps)mUfUmCfUmUfAmAfAmCfUmGfAmGfUmU(ps)fU(ps)mC [(ps)Ser(GN)]3 88 STS22006V10L35B ivA fGmAfAmAfCmUfCmAfGmUfUmUfAmAfGmAfAmGfA ivA 89 STS22009L6A mA(ps)fU(ps)mGfUmAfGmCfCmGfAmGfGmAfUmCfUmU(ps)fC(ps) mU 90 STS22009L6B [ST23(ps)]3 ST43(ps)fAmGfAmAfGmAfUmCfCmUfCmGfGmCfUmAfC(ps)mA(ps) fU 91 STS22009V3L6A mA(ps)fU(ps)mGfUmAfGmCfCmGfAmGfGmAfUmCfUmU(ps)fC(ps)mU 92 STS22009V3L6B [ST23(ps)]3 ST43(ps)fAmGfAmAfGmAfUmCfCmUfCmGfGmCfUmAfCmAfU ivA 93 STS22009V4L6A mA(ps)fU(ps mGfUmAfGmCfCmGfAmGfGmAfUmCfUmUfCmU ivA 94 STS22009V4L6B [ST23(ps)]3 ST43(ps)fAmGfAmAfGmAfUmCfCmUfCmGfGmCfUmAfC(ps)mA(ps) fU 95 STS22009V5L6A mA(ps)fU(ps)mGfUmAfGmCfCmGfAmGfGmAfUmCfUmUfCmU ivA 96 STS22009V5L6B [ST23(ps)]3 ST43(ps)fAmGfAmAfGmAfUmCfCmUfCmGfGmCfUmAfCmAfU ivA 97 STS22009V6L6A mA(ps)fU(ps)mGfUmAfGmCfCmGfAmGfGmAfUmCfUmU(ps)fC(ps)mU [(ps)Ser(GN)]3 98 STS22009V6L6B ivA fAmGfAmAfGmAfUmCfCmUfCmGfGmCfUmAfCmAfU ivA 99 STS16001L1A mU(ps)fU(ps)mAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmG(ps)fU(ps)mU 100 STS16001L1B [ST23(ps)]3 ltrb(ps)fAmAfCmAfGmUfGmUfUmCfUmUfGmCfUmCfUmAfU(ps) mA(ps)fA 101 STS16001V11L1A mU(ps)fU(ps)mAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmG (ps)fU(ps)mU 102 STS16001V11L1B [ST23(ps)]3 ltrb(ps)fAmAfCmAfGmUfGmUfUmCfUmUfGmCfUmCfUmAfUmAfA ivA 103 STS16001V12L1A mU(ps)fU (ps)mAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmGfUmU ivA 104 STS16001V12L1B [ST23(ps)]3 ltrb(ps)fAmAfCmAfGmUfGmUfUmCfUmUfGmCfUmCfUmAfU(ps) mA(ps)fA 105 STS16001V13L1A mU(ps)fU (ps)mAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmGfUmU ivA 106 STS16001V13L1B [ST23(ps)]3 ltrb(ps)fAmAfCmAfGmUfGmUfUmCfUmUfGmCfUmCfUmAfUmAfA ivA 107 STS16001V14L35A mU(ps)fU(ps)mAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmG(ps)fU(ps)mU [(ps)Ser(GN)]3 108 STS16001V14L35B ivA fAmAfCmAfGmUfGmUfUmCfUmUfGmCfUmCfUmAfUmAfA ivA 109 STS22002L6A mA(ps)fA (ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmC(ps)fG (ps)mG 110 STS22002L6B [ST23(ps)]3 ST43(ps)fCmCfGmUfCmAfGmCfAmGfGmAfAmAfAmCfA(ps)mU(ps) fU 111 STS22002V8L6A mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfG ivA 112 STS22002V8L6B [ST23(ps)]3 ST43(ps)fCmCfGmUfCmAfGmCfAmGfGmAfAmAfAmCfA(ps)mU(ps) fU 113 STS22002V9L6A mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfG ivA 114 STS22002V9L6B [ST23(ps)]3 ST43(ps)fCmCfGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmU ivA 115 STS22002V10L6A mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmCfGmG ivA 116 STS22002V10L6B [ST23(ps)]3 ST43fCmCfGmUfCmAfGmCfAmGfGmAfAmAfAmCfAmU ivA 117 STS22006V1L6A mU(ps)fC(ps)mUfUmCfUmUfAmAfAmCfUmGfAmGfUmU(ps)fU(ps)mC 118 STS22006V1L6B [ST23(ps)]3 ST43(ps)fGmAfAmAfCmUfCmAfGmUfUmUfAmAfGmAfAmG ivA 119 STS22009V1L6A mA(ps)fU(ps)mGfUmAfGmCfCmGfAmGfGmAfUmCfUmU(ps)fC (ps)mU 120 STS22009V1L6B [ST23(ps)]3 ST43(ps)mAmGmAmAmGmAfUfCfCmUmCmGmGmCmUmAmCmA ivA 121 STS22009V2L6A mA(ps)fU(ps)mGmUmAmGmCmCmGmAmGmGmAfUmCmUmU(ps)mC (ps)mU 122 STS22009V2L6B [ST23(ps)]3 ST43(ps)mAmGmAmAmGmAfUfCfCmUmCmGmGmCmUmAmCmA ivA 123 TMPJH01A AACCAGAAGAAGCAGGUGA 124 TMPJH01B UCACCUGCUUCUUCUGGUU 125 TMPJH41A AACCAGAAGAAGCAGGUGAA 126 TMPJH41B UCACCUGCUUCUUCUGGUUA 127 TMPJH42A AACCAGAAGAAGCAGGUGAU 128 TMPJH42B UCACCUGCUUCUUCUGGUUU 129 TMPJH43A AACCAGAAGAAGCAGGUGAC 130 TMPJH43B UCACCUGCUUCUUCUGGUUC 131 TMPJH44A AACCAGAAGAAGCAGGUGAG 132 TMPJH44B UCACCUGCUUCUUCUGGUUG 133 TMP85A AACCAGAAGAAGCAGGUGU 134 TMP86A AACCAGAAGAAGCAGGUGC 135 TMP87A AACCAGAAGAAGCAGGUGG 136 TMP88B UCACCUGCUUCUUCUGGUA 137 TMP90B UCACCUGCUUCUUCUGGUC 138 TMP91B UCACCUGCUUCUUCUGGUG 139 ALD01A AAUGUUUUCCUGCUGACGG 140 ALD01B CCGUCAGCAGGAAAACAUU 141 ALD02A AAUGUUUUCCUGCUGACGGA 142 ALD02B CCGUCAGCAGGAAAACAUUA 143 ALD03A AAUGUUUUCCUGCUGACGGU 144 ALD03B CCGUCAGCAGGAAAACAUUU 145 ALD04A AAUGUUUUCCUGCUGACGGC 146 ALD04B CCGUCAGCAGGAAAACAUUC 147 ALD05A AAUGUUUUCCUGCUGACGGG 148 ALD05B CCGUCAGCAGGAAAACAUUG 149 ALD06A AAUGUUUUCCUGCUGACGA 150 ALD06B CCGUCAGCAGGAAAACAUA 151 ALD07A AAUGUUUUCCUGCUGACGU 152 ALD08A AAUGUUUUCCUGCUGACGC 153 ALD08B CCGUCAGCAGGAAAACAUC 154 ALD09B CCGUCAGCAGGAAAACAUG 155 STS22006L6A UCUUCUUAAACUGAGUUUC 156 STS22006L6B GAAACUCAGUUUAAGAAGA 157 STS22009L6A AUGUAGCCGAGGAUCUUCU 158 STS22009L6B AGAAGAUCCUCGGCUACAU 159 STS16001L1A UUAUAGAGCAAGAACACUGUU 160 STS16001L1B AACAGUGUUCUUGCUCUAUAA 161 STS22002L6A AAUGUUUUCCUGCUGACGG 162 STS22002L6B CCGUCAGCAGGAAAACAUU 163 STS22002V8L6A AAUGUUUUCCUGCUGACGA 164 STS22002V9L6B CCGUCAGCAGGAAAACAUA 165 STS22009V1L6B AGAAGAUCCUCGGCUACAA 166 STS18001L4A mU(ps)fC(ps)mGfAmAfGmUfAmUfUmCfCmGfCmGfUmA(ps)fC(ps)mG 167 STS18001L4B [ST23(ps)]3 ST41(ps)fCmGfUmAfCmGfCmGfGmAfAmUfAmCfUmUfC(ps)mG(ps) fA 168 STS16001V4L11A mU(ps)fU(ps)mAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmG(ps)fU(ps)mU(ps) GlyC3Am(GalNAc) 169 STS16001V4L11B fA(ps)mA(ps)fCmAfGmUfGmUfUmCfUmUfGmCfUmCfUmAfU(ps)mA(ps)fA 170 STS16001L22A mU(ps)fU(ps)mAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmG(ps)fU(ps)mU 171 STS16001L22B Ser(GN)(ps)Ser(GN)(ps)Ser(GN)(ps)fAmAfCmAfGmUfGmUfUmCfUmUfGmCfUm CfUmAfU(ps)mA(ps)fA 172 STS16001V7L22A (po)ivAfUmAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmG(ps)fU(ps)mU 173 STS16001V7L22B Ser(GN)(ps)Ser(GN)(ps)Ser(GN)(ps)fAmAfCmAfGmUfGmUfUmCfUmUfGmCfUm CfUmAfU(ps)mA(ps)fA 174 STS16001V8L22A (po)ivGfUmAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmG(ps)fU(ps)mU 175 STS16001V8L22B Ser(GN)(ps)Ser(GN)(ps)Ser(GN)(ps)fAmAfCmAfGmUfGmUfUmCfUmUfGmCfUm CfUmAfU(ps)mA(ps)fA 176 STS16001V9L22A (po)iyUfUmAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmG(ps)fU(ps)mU 177 STS16001V9L22B Ser(GN)(ps)Ser(GN)(ps)Ser(GN)(ps)fAmAfCmAfGmUfGmUfUmCfUmUfGmCfUm CfUmAfU(ps)mA(ps)fA 178 STS16001V10L22A (po)ivCfUmAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmG(ps)fU(ps)mU 179 STS16001V10L22B Ser(GN)(ps)Ser(GN)(ps)Ser(GN)(ps)fAmAfCmAfGmUfGmUfUmCfUmUfGmCfUm CfUmAfU(ps)mA(ps)fA 180 STS16001V6L11A mU(ps)fU(ps)mAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmG(ps)fU(ps)mU(ps) GlyC3Am(GalNAc) 181 STS16001V6L11B ivAfAmAfCmAfGmUfGmUfUmCfUmUfGmCfUmCfUmAfU(ps)mA(ps)fA 182 STS16001V7L11A mU(ps)fU(ps)mAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmG(ps)fU(ps)mU(ps) GlyC3Am(GalNAc) 183 STS16001V7L11B ivGfAmAfCmAfGmUfGmUfUmCfUmUfGmCfUmCfUmAfU(ps)mA(ps)fA 184 STS16001V8L11A mU(ps)fU(ps)mAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmG(ps)fU(ps)mU(ps) GlyC3Am(GalNAc) 185 STS16001V8L11B ivUfAmAfCmAfGmUfGmUfUmCfUmUfGmCfUmCfUmAfU(ps)mA(ps)fA 186 STS16001V9L11A mU(ps)fU(ps)mAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmG(ps)fU(ps)mU(ps) GlyC3Am(GalNAc) 187 STS16001V9L11B ivCfAmAfCmAfGmUfGmUfUmCfUmUfGmCfUmCfUmAfU(ps)mA(ps)fA 188 STS18001L4A UCGAAGUAUUCCGCGUACG 189 STS18001L4B CGUACGCGGAAUACUUCGA 190 STS16001V4L11A UUAUAGAGCAAGAACACUGUU 191 STS16001V7L22A AUAUAGAGCAAGAACACUGUU 192 STS16001V8L22A GUAUAGAGCAAGAACACUGUU 193 STS16001V10L22A CUAUAGAGCAAGAACACUGUU 194 STS16001V4L11B AACAGUGUUCUUGCUCUAUAA 195 STS16001V6L11B AAACAGUGUUCUUGCUCUAUAA 196 STS16001V7L11B GAACAGUGUUCUUGCUCUAUAA 197 STS16001V8L11B UAACAGUGUUCUUGCUCUAUAA 198 STS16001V9L11B CAACAGUGUUCUUGCUCUAUAA Key mA, mU, mC, mG-2′-OMe RNA fA, fU, fC, fG-2′-F RNA ivA, ivU, ivC, ivG-inverted RNA (3-3 from SEQ ID NO 1-122; 5′-5′ from SEQ ID NO 166-187) (po)ivA, (po)ivU, (po)ivC, (po)ivG: 5′-5′-linked inverted ribonucleotide with 3′-phosphate (ps)-phosphorothioate
[0467] The sequences listed above may be disclosed with a linker or ligand, such as GalNAC or (ps) or (ps2) linkages for example. These form an optional, but preferred, part of the sequence of the sequence listing.
[0468] The following abbreviations may be used:
TABLE-US-00006 ivN Inverted nucleotide, either 3′-3′ or 5′-5′ (ps2) Phosphorodithioate vinylphosphonate Vinyl-(E)-phosphonate FAM 6-Carboxyfluorescein TAMRA 5-Carboxytetramethylrhodamine BHQ1 Black Hole Quencher 1 (ps) Phosphorothioate GN
STATEMENTS OF INVENTION
[0469] The statements reflect preferred features of the invention, and may each independently be combined with any aspect of the disclosure herein.
[0470] 1. A nucleic acid for inhibiting expression of a target gene in a cell, comprising at least one duplex region that comprises at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein said first strand is at least partially complementary to at least a portion of RNA transcribed from said target gene to be inhibited and wherein the terminal nucleotide at the 3′ end of at least one of the first strand and the second strand is an inverted nucleotide and is attached to the adjacent nucleotide via the 3′ carbon of the terminal nucleotide and the 3′ carbon of the adjacent nucleotide and/or the terminal nucleotide at the 5′ end of at least one of the first strand and the second strand is an inverted nucleotide and is attached to the adjacent nucleotide via the 5′ carbon of the terminal nucleotide and the 5′ carbon of the adjacent nucleotide.
[0471] 2. A nucleic acid according to statement 1, wherein the 3′ and/or 5′ inverted nucleotide of the first and/or second strand is attached to the adjacent nucleotide via a phosphate group by way of a phosphodiester linkage.
[0472] 3. A nucleic acid according to statement 1, wherein the 3′ and/or 5′ inverted nucleotide of the first and/or second strand is attached to the adjacent nucleotide via a phosphorothioate group.
[0473] 4. A nucleic acid according to statement 1, wherein 3′ and/or 5′ inverted nucleotide of the first and/or second strand is attached to the adjacent nucleotide via a phosphorodithioate group.
[0474] 5. A nucleic acid according to any of statements 1 to 6, wherein the 3′ and/or 5′ inverted nucleotide of the first and/or second strand forms an overhang.
[0475] 6. A nucleic acid according to any of statements 1 to 5, wherein the 3′ and/or 5′ inverted nucleotide of the first and/or second strand forms a blunt end.
[0476] 7. A nucleic acid according to any of statements 1 to 6, wherein the first strand and the second strand are separate strands.
[0477] 8. A nucleic acid according to any of statements 1 to 6, comprising a single strand that comprises the first strand and the second strand.
[0478] 9. A nucleic acid according to any of statements 1 to 8, wherein said first strand and/or said second strand are each from 17-35 nucleotides in length.
[0479] 10. A nucleic acid of any of statements 1 to 9, wherein the at least one duplex region consists of 19-25 nucleotide base pairs.
[0480] 11. A nucleic acid of any preceding statement, which [0481] a) is blunt ended at both ends; or [0482] b) has an overhang at one end and a blunt end at the other; or [0483] c) has an overhang at both ends
[0484] optionally a nucleic acid having an overhang at the 3′ end of the first strand and which has a blunt end at the 3′ of the second strand,
[0485] optionally wherein the nucleic acid has an inverted nucleotide such as ivA on the 3′ end of the second strand 3′-end at a blunt end.
[0486] 12. A nucleic acid according to any preceding statement, wherein one or more nucleotides on the first and/or second strand are modified, to form modified nucleotides.
[0487] 13. A nucleic acid of statement 12, wherein one or more of the odd numbered nucleotides of the first strand are modified.
[0488] 14. A nucleic acid according to statement 13, wherein one or more of the even numbered nucleotides of the first strand are modified by at least a second modification, wherein the at least second modification is different from the modification of statement 9.
[0489] 15. A nucleic acid of statement 14, wherein at least one of the one or more modified even numbered nucleotides is adjacent to at least one of the one or more modified odd numbered nucleotides.
[0490] 16. A nucleic acid of any one of statements 13 to 15, wherein a plurality of odd numbered nucleotides are modified.
[0491] 17. A nucleic acid of any one of statements 14 to 16, wherein a plurality of even numbered nucleotides are modified by a second modification.
[0492] 18. A nucleic acid of any of statements 12 to 17, wherein the first strand comprises adjacent nucleotides that are modified by a common modification.
[0493] 19. A nucleic acid of any of statements 13 to 18, wherein the first strand comprises adjacent nucleotides that are modified by a second modification that is different to the modification of statement 9.
[0494] 20. A nucleic acid of any of statements 13 to 19, wherein one or more of the odd numbered nucleotides of the second strand are modified by a modification that is different to the modification of statement 9.
[0495] 21. A nucleic acid according to any of statements 13 to 19, wherein one or more of the even numbered nucleotides of the second strand are modified by the modification of statement 9.
[0496] 22. A nucleic acid of statement 20 or 21, wherein at least one of the one or more modified even numbered nucleotides of the second strand is adjacent to the one or more modified odd numbered nucleotides.
[0497] 23. A nucleic acid of any of statements 20 to 22, wherein a plurality of odd numbered nucleotides of the second strand are modified by a common modification.
[0498] 24. A nucleic acid of any of statements 20 to 23, wherein a plurality of even numbered nucleotides are modified by a modification according to statement 9.
[0499] 25. A nucleic acid of any of statements 20 to 24, wherein a plurality of odd numbered nucleotides are modified by a second modification, wherein the second modification is different from the modification of statement 9.
[0500] 26. A nucleic acid of any of statements 20 to 25, wherein the second strand comprises adjacent nucleotides that are modified by a common modification.
[0501] 27. A nucleic acid of any of statements 20 to 26, wherein the second strand comprises adjacent nucleotides that are modified by a second modification that is different from the modification of statement 9.
[0502] 28. A nucleic acid according to any one of statements 12 to 27, wherein each of the odd numbered nucleotides in the first strand and each of the even numbered nucleotides in the second strand are modified with a common modification.
[0503] 29. A nucleic acid of any one of statements 13 to 28, wherein each of the even numbered nucleotides are modified in the first strand with a second modification and each of the odd numbered nucleotides are modified in the second strand with a second modification.
[0504] 30. A nucleic acid according to any one of statements 20 to 29, wherein the modified nucleotides of the first strand are shifted by at least one nucleotide relative to the unmodified or differently modified nucleotides of the second strand.
[0505] 31. A nucleic acid of any one of statements 1 to 30, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NO:s 1, 3, 5 and 7.
[0506] 32. A nucleic acid of any one of statements 1 to 30, wherein the second strand comprises a sequence selected from the group consisting to SEQ ID NO:s 2, 4, 6 and 8.
[0507] 33. A nucleic acid according to any one of statements 8 to 32, wherein the modification and/or modifications are each and individually selected from the group consisting of 3′-terminal deoxy-thymine, 2′-O-methyl, a 2′-deoxy-modification, a 2′-amino-modification, a 2′-alkyl-modification, a morpholino modification, a phosphoramidate modification, 5′-phosphorothioate group modification, a 5′ phosphate or 5′ phosphate mimic modification and a cholesteryl derivative or a dodecanoic acid bisdecylamide group modification.
[0508] 34. A nucleic acid according to any one of statements 8 to 33, wherein the modification is any one of a locked nucleotide, an abasic nucleotide or a non-natural base comprising nucleotide.
[0509] 35. A nucleic acid according to any one of statements 8 to 34, wherein at least one modification is 2′-O-methyl.
[0510] 36. A nucleic acid according to any one of statements 8 to 35, wherein at least one modification is 2′-F.
[0511] 37. A nucleic acid according to any one of statements 1 to 36, wherein the inverted nucleotide at the 3′ end of at least one of the first strand and the second strand and/or the inverted nucleotide at the 5′ end of at least one of the first strand and the second strand is a purine, such as an adenine
[0512] 38. A nucleic acid according to any one of statements 1 to 37, further comprising a ligand.
[0513] 39. A nucleic acid according to any one of statements 1 to 38, comprising a phosphorothioate linkage between the terminal one, two or three 3′ nucleotides and/or 5′ nucleotides of the first and/or the second strand.
[0514] 40. A nucleic acid according to any one of statements 1 to 39, comprising two phosphorothioate linkage between each of the three terminal 3′ and between each of the three terminal 5′ nucleotides on the first strand, and two phosphorothioate linkages between the three terminal nucleotides of the 3′ end of the second strand.
[0515] 41. A nucleic acid for inhibiting expression of a target gene in a cell, comprising at least one duplex region that comprises at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein said first strand is at least partially complementary to at least a portion of RNA transcribed from said target gene to be inhibited and wherein the terminal nucleotide at the 3′ end of at least one of the first strand and the second strand is an inverted nucleotide and is attached to the adjacent nucleotide via the 3′ carbon of the terminal nucleotide and the 3′ carbon of the adjacent nucleotide and/or the terminal nucleotide at the 5′ end of at least one of the first strand and the second strand is an inverted nucleotide and is attached to the adjacent nucleotide via the 5′ carbon of the terminal nucleotide and the 5′ carbon of the adjacent nucleotide, and wherein the nucleic acid molecule is directly or indirectly conjugated to a ligand via a linker.
[0516] 42. A nucleic acid according to any of statements 38 to 41, wherein the ligand comprises one or more GalNac ligands and derivatives thereof, such as comprising a GalNAc moiety at the second strand 5′-end.
[0517] 43. A nucleic acid according to any of statements 38 to 42, wherein the ligand is directly or indirectly conjugated to a nucleic acid as defined in any preceding statements by a bivalent or trivalent branched linker.
[0518] 44. A nucleic acid of statement 41, wherein the nucleotides are modified as defined in any preceding statements.
[0519] 45. A nucleic acid of any preceding statement, wherein the ligand comprises the formula I:
[S—X.sup.1—P—X.sup.2].sub.3-A-X.sup.3— (I)
[0520] wherein: [0521] S represents a saccharide, wherein the saccharide is N-acetyl galactosamine; [0522] X.sup.1 represents C.sub.3-C.sub.6 alkylene or (—CH.sub.2—CH.sub.2—O).sub.m(—CH.sub.2).sub.2— wherein m is 1, 2, or 3; [0523] P is a phosphate or modified phosphate (preferably a thiophosphate); [0524] X.sup.2 is alkylene or an alkylene ether of the formula (—CH.sub.2).sub.n—O—CH.sub.2— where n=1-6; [0525] A is a branching unit; [0526] X.sup.3 represents a bridging unit; [0527] wherein a nucleic acid according to the present invention is conjugated to X.sup.3 via a phosphate or modified phosphate (preferably a thiophosphate).
[0528] 46. A conjugated nucleic acid having one of the following structures:
[0529] wherein Z is a nucleic acid according to any of statements 1 to 40.
[0530] 47. A nucleic acid of any preceding statement, wherein the ligand comprises:
##STR00047##
[0531] 48. A composition comprising a nucleic acid or conjugated nucleic acid as defined in any preceding statement and a formulation comprising: [0532] i) a cationic lipid, or a pharmaceutically acceptable salt thereof; [0533] ii) a steroid; [0534] iii) a phosphatidylethanolamine phospholipid; [0535] iv) a PEGylated lipid.
[0536] 49. A composition according to statement 48, wherein in the formulation the content of the cationic lipid component is from about 55 mol % to about 65 mol % of the overall lipid content of the lipid formulation, preferably about 59 mol % of the overall lipid content of the lipid formulation.
[0537] 50. A composition as disclosed in statement 48, wherein the formulation comprises;
[0538] A cationic lipid having the structure;
##STR00048##
[0539] the steroid has the structure;
##STR00049##
[0540] the phosphatidylethanolamine phospholipid has the structure;
##STR00050##
[0541] and the PEGylated lipid has the structure;
##STR00051##
[0542] 51. A composition comprising a nucleic acid or conjugated nucleic acid of any of statements 1 to 47 and a physiologically acceptable excipient.
[0543] 52. A nucleic acid or conjugated nucleic acid according to any of statements 1 to 47 for use in the treatment of a disease or disorder.
[0544] 53. Use of a nucleic acid or conjugated nucleic acid according to any of statements 1 to 47 in the manufacture of a medicament for treating a disease or disorder.
[0545] 54. A method of treating a disease or disorder comprising administration of a composition comprising a nucleic acid or conjugated nucleic acid according to any of statements 1 to 47 to an individual in need of treatment.
[0546] 55. The method of statement 54, wherein the nucleic acid or conjugated nucleic acid is administered to the subject subcutaneously or intravenously.
[0547] 56. A process of making a nucleic acid or conjugated nucleic acid of any of statements 1 to 47.
[0548] 57 A nucleic acid, method, use or composition according to any preceding statement, or any disclosure herein, wherein there is no terminal phosphorothioate in the nucleic acid.
[0549] 58 A nucleic acid, method, use or composition according to any preceding statement, or any disclosure herein, wherein the terminal nucleotide is located at the 3′ end of at least one of the first strand and the second strand, or both.
[0550] 59 A nucleic acid, method, use or composition according to any preceding statement, or any disclosure herein, wherein the ligand does not contain a phosphorothioate, such as a nucleic acid according conjugated to a Galnac moiety which does not contain phosphorothioates.