Fusion protein for alpha-melanocyte stimulating hormone and preparation method and use thereof

Abstract

Disclosed is a fusion protein for α-Melanocyte stimulating hormone, the fusion protein containing a protein transduction domain (PTD), a human serum albumin (HSA) and an α-Melanocyte stimulating hormone (α-MSH). Also disclosed are a method for preparing the fusion protein and a use thereof for inhibiting or treating central nervous system inflammations.

Claims

1. An α-melanocyte stimulating hormone (α-MSH) fusion protein, wherein the α-MSH fusion protein comprises a protein transduction domain (PTD), a human serum albumin (HSA) and an α-MSH, wherein the PTD is located at the N-terminus of the fusion protein, the α-MSH is located at the C-terminus of the fusion protein, and the HSA is genetically fused with the α-MSH through a peptide linker peptide (L), and wherein the peptide linker comprises the amino acid sequence GGGGSGGGSG (SEQ ID NO: 11).

2. The α-MSH fusion protein according to claim 1, wherein the PTD comprises the amino acid sequence shown in SEQ ID NO: 2.

3. The α-MSH fusion protein according to claim 1, wherein the HSA comprises the amino acid sequence shown in SEQ ID NO: 4.

4. The α-MSH fusion protein according to claim 1, wherein the α-MSH comprises the amino acid sequence shown in SEQ ID NO: 6.

5. The α-MSH fusion protein according to claim 1, wherein the fusion protein comprises the amino acid sequence shown in SEQ ID NO: 8.

6. The α-MSH fusion protein according to claim 5, wherein the fusion protein is prepared by expression in cells of a yeast.

7. The α-MSH fusion protein according to claim 6, wherein the yeast is methylotrophic Pichia pastoris.

8. A method for preparation of the α-MSH fusion protein according to claim 1, wherein the method comprises steps of: 1) total gene synthesis of a sequence of α-MSH; 2) generating a sequence of PTD-HSA by polymerase chain reaction (PCR); 3) fusing the sequence of α-MSH from Step 1) and the sequence of PTD-HSA from step 2) by recombinant PCR, ligating a target fragment and a vector to obtain a recombinant yeast expression vector containing a DNA sequence of the α-MSH fusion protein; 4) transforming the recombinant yeast expression vector from Step 3) into Escherichia coli TOP 10 competent cells, extracting and sequencing recombinant expression vector plasmids, and then transforming plasmids whose sequences have been proved correct into a host expression system for expression, thus obtaining the fusion protein, wherein the host expression system is methylotrophic Pichia pastoris.

9. A recombinant expression vector comprising a DNA sequence which encodes the amino acid sequence of the α-MSH fusion protein according to claim 1.

10. A host expression system comprising the recombinant expression vector according to claim 9.

11. The recombinant expression vector according to claim 9, comprising the DNA sequence GGAGGTGGAGGTTCTGGAGGTGGATCTGGT (SEQ ID NO: 12), wherein SEQ ID NO: 12 encodes the peptide linker L.

12. The recombinant expression vector according to claim 9, comprising the DNA sequence shown in SEQ ID NO: 1, wherein SEQ ID NO: 1 encodes the PTD.

13. The recombinant expression vector according to claim 9, comprising the DNA sequence shown in SEQ ID NO: 3, wherein SEQ ID NO: 3 encodes the HSA.

14. The recombinant expression vector according to claim 9, comprising the DNA sequence shown in SEQ ID NO: 5, wherein SEQ ID NO: 1 encodes the α-MSH.

15. The recombinant expression vector according to claim 9, comprising the DNA sequence shown in SEQ ID NO: 7, wherein SEQ ID NO: 7 encodes the α-MSH fusion protein.

16. A method of inhibiting and treating inflammatory central nervous system (CNS) diseases and disorders comprising administering the α-MSH fusion protein according to claim 1.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 showed the map of pPinkα-HC vector.

(2) FIG. 2 showed the map of pPINKα-HC/PTD-HSA-L-α-MSH

DETAILED DESCRIPTION OF EMBODIMENTS

(3) Experimental Instruments

(4) Pipette, clean bench (An Tai), magnetic stirrer, microwave oven, high temperature steam sterilization pot, −80 low temperature refrigerator (Forma), ultra-pure water meter (Millipore), ice machine, centrifuge (Hitachi), HDB-PLUS constant temperature metal bath, HZQ-F16OA constant temperature oscillation incubator (Shanghai Yi Heng), PCR instrument (Applied Biosystems), centrifuge (Thermo), DYY-8B (Bo Le), Image electrophoresis Quant 300 gel imager (GE) etc.

(5) Experimental Materials

(6) Pipette, clean bench (An Tai), magnetic stirrer, microwave oven, high temperature steam sterilization pot, −80 low temperature refrigerator (Forma), ultra-pure water meter (Millipore), ice machine, centrifuge (Hitachi), HDB-PLUS constant temperature metal bath, HZQ-F16OA constant temperature oscillation incubator (Shanghai Yi Heng), PCR instrument (Applied Biosystems), centrifuge (Thermo), DYY-8B (Bo Le), Image electrophoresis Quant 300 gel imager (GE) etc.

(7) Experimental Materials

(8) 1. restriction endonucleases StuI, KpnI, Xho I, AflII (NEB products, USA);

(9) 2. Plasmid Mini Preparation Kit, DNA purification kit, DNA Gel Extraction Kit (Sangon Biotech, China);

(10) 3. T4 DNA ligase Kit (Takara, Dalian, China);

(11) 4. pPinkα-HC, pcDNA3.1-HSA, Pichia pastoris strain, Infusion Cloning Kit (Invitrogen, USA);

(12) 5. Escherichia coli TOP10 (Tian Yuan biotech (Beijing) Co., Ltd.)

(13) 6. yeast extract and peptone (Oxford products, USA)

(14) 7. LB medium: Yeast extract 5 g, peptone 10 g, NaCl 10 g, dissolved in 1000 mL deionized water, and adjusted the pH to 7 with 1 mol/L NaOH, autoclave sterilization.

(15) 8. YPD medium: Yeast extract 10 g, peptone 20 g, Agar 20 g, dissolved in 900 mL deionized water, and then high pressure sterilization, after cooling, add 100 mL 20% of the right sugar sterilized by the filter sterilization.

(16) 9. YPDS medium: Yeast extract 10 g, peptone 20 g, sorbitol 182.2 g, dissolved in 900 mL deionized water, and then high pressure sterilization, after cooling, add 100 mL 20% of the right sugar sterilized by the filter sterilization.

(17) 10. BMGY liquid medium: 10 g yeast extract, peptone 20 g, YNB 13.4 g, glycerol 10 g, potassium phosphate 26.631 g, dissolved in 1000 mL double distilled water, and then high pressure sterilization, after cooling to room temperature, adjusting the pH to 6.4 and preserved at −4° C. refrigerator.

(18) 11. Preparation of 1% agarose gel: add 1 g agarose to 100 mL TAE buffer and heating to boiling until the agarose is melted completely by using microwave, then cool the mixture to room temperature and drop a small amount of ethidium bromide (EB), pour it into a glue tank with comb after sufficient mixing, finally pull the comb until completely solidification when cooled to room temperature.

EMBODIMENT

Embodiment 1

(19) Generation of pPINKα-HC/PTD-HSA-L-α-MSH

(20) 1. primers used in generation of pPINKα-HC/PTD-HSA-L-α-MSH:

(21) TABLE-US-00001 NFT1: (SEQ ID NO: 13) TCTCTCGAGAAAAGGTACGGTAGAAAGAAACGTAGACAAAGACGTAGA NFT2: (SEQ ID NO: 14) GAAAGAAACGTAGACAAAGACGTAGA GATGCACACAAGAGTGAG R2: (SEQ ID NO: 15) GCTCCATAGAGTAAGAACCAGATCCACCTCCAGAACCTCCACCTCCTAA GCCTAAGGCAGCTTG R1: (SEQ ID NO: 16) TTAAATGGCCGGCCGGTACCttaAACTGGCTTACCCCATCTAAAGTGCTC CATAGAGTAAGAAC

(22) 2. First round PCR: pcDNA3.1-HSA vector was used as template with the forward primer NFT2 and the reverse primer R2. The reaction conditions are as follows: (1) degeneration at 94° C. for 5 min; (2) degeneration at 94° C. for 1 min; (3) renaturation at 55° C. for 30 s; (4) extension at 72° C. for 2 min; (5) return to step (2) and make 35 cycles; (6) extension at 72° C. for 5 min. The PCR products were analyzed by 1% agarose gel electrophoresis, and the results showed that the desired DNA bands were amplified about 1.8 kb in size.

(23) 3. Second round PCR: the first round PCR product was used as template with the forward primer NFT1 and the reverse primer R1. The reaction conditions are as follows: (1) degeneration at 94° C. for 5 min; (2) degeneration at 94° C. for 1 min; (3) renaturation at 55° C. for 30 s; (4) extension at 72° C. for 2 min; (5) return to step (2) and make 35 cycles; (6) extension at 72° C. for 5 min. The PCR products were analyzed by 1% agarose gel electrophoresis, and the results showed that the desired completely PTD-HSA-L-α-MSH DNA bands were amplified about 1.8 kb in size. The products was purified by DNA Gel Extraction Kit.

(24) 4. The pPinkα-HC vector was digested with Stu I and Kpn I, then product was purified by DNA purification kit. The PTD-HSA-L-α-MSH DNA was cloned into pPinkα-HC by In-Fusion technology. The recombinant DNA was transformed into competent cells of E. coli. The transformants were applied to the ampicillin resistance LB plate 37° C. with overnight incubation for screening positive clones. Finally, the recombinant DNA was confirmed by sequencing in Invitrogen and the correctly identified vector was named as pPINKα-HC/PTD-HSA-L-α-MSH.

(25) Generation of pPINKα-HC/HSA-L-α-MSH

(26) 1. primers used in generation of pPINKα-HC/HSA-L-α-MSH:

(27) TABLE-US-00002 NF: (SEQ ID NO: 17) TCTCTCGAGAAAAGGGATGCACACAAGAGTGAG R2: (SEQ ID NO: 15) GCTCCATAGAGTAAGAACCAGATCCACCTCCAGAACCTCCACCTCCTAA GCCTAAGGCAGCTTG R1: (SEQ ID NO: 16) TTAAATGGCCGGCCGGTACCttaAACTGGCTTACCCCATCTAAAGTGCTCC ATAGAGTAAGAAC

(28) 2. First round PCR: pcDNA3.1-HSA vector was used as template with the forward primer NF2 and the reverse primer R2. The reaction conditions are as follows: (1) degeneration at 94° C. for 5 min; (2) degeneration at 94° C. for 1 min; (3) renaturation at 55° C. for 30 s; (4) extension at 72° C. for 2 min; (5) return to step (2) and make 35 cycles; (6) extension at 72° C. for 5 min. The PCR products were analyzed by 1% agarose gel electrophoresis, and the results showed that the desired DNA bands were amplified about 1.8 kb in size.

(29) 3. Second round PCR: the first round PCR product was used as template with the forward primer NF and the reverse primer R1. The reaction conditions are as follows: (1) degeneration at 94° C. for 5 min; (2) degeneration at 94° C. for 1 min; (3) renaturation at 55° C. for 30 s; (4) extension at 72° C. for 2 min; (5) return to step (2) and make 35 cycles; (6) extension at 72° C. for 5 min. The PCR products were analyzed by 1% agarose gel electrophoresis, and the results showed that the desired completely HSA-L-α-MSH DNA bands were amplified about 1.8 kb in size. The products was purified by DNA Gel Extraction Kit.

(30) 4. The pPinkα-HC vector was digested with Stu I and Kpn I, then product was purified by DNA purification kit. The HSA-L-α-MSH DNA was cloned into pPinkα-HC by In-Fusion technology. The recombinant DNA was transformed into competent cells of E. coli. The transformants were applied to the ampicillin resistance LB plate 37° C. with overnight incubation for screening positive clones. Finally, the recombinant DNA was confirmed by sequencing in Invitrogen and the correctly identified vector was named as pPINKα-HC/HSA-L-α-MSH

(31) Expression of PTD-HSA-L-α-MSH and HSA-L-α-MSH in Host Cells

(32) pPINKα-HC/PTD-HSA-L-α-MSH vector and pPINKα-HC/HSA-L-α-MSH vector were linearized and transformed into host cells respectively. The transformants were applied to PAD plate 30° C. with 48 h incubation for screening positive clones. Then the selected positive clone was inoculated into BMGY medium, following by transferring to BMMY medium to induce expression of fusion protein for 96 h. Finally the supernatant was harvested by centrifugation at 1500×g for 5 min at 4° C., and the expression level of fusion protein was analyzed by SDS-PAGE. The strain with the highest expression level was selected as the engineering strain and stored at −80° C. PTD-HSA-L-α-MSH has the nucleotide sequence of SEQ ID NO:7, encoding the amino acid sequence shown in SEQ ID NO:8, and the molecular weight of it is about 70 KDa. HSA-L-α-MSH has the nucleotide sequence of SEQ ID NO:9, encoding the amino acid sequence shown in SEQ ID NO:10, and the molecular weight of it is about 69 KDa.

Embodiment 2

(33) Validation of the Ability to Across BBB of PTD-HSA-L-α-MSH

(34) Experimental Materials

(35) 1. Experimental Instruments

(36) Syringes, pipette, centrifuge (Hitachi), ultra-pure water meter (Millipore), ultrasound, constant temperature Incubator (Shanghai YiHeng), Microplate reader (Thermo) etc.

(37) HSA Elisa Kit (cygnustechnologies).

(38) 2. Experimental Animals

(39) 10 mice (18-22 g) were used in the experiment, and were purchased from Laboratory Animal Center of Lanzhou University.

(40) 3. Methods

(41) Mice were housed in groups of at most five animals per cage with clean water and food available ad libitum. PTD-HSA-L-α-MSH or HSA-L-α-MSH were given at a dosage of 1 μm/kg through a single intravenous injection in 150 μL volume. Mice were anesthetized 6 h after drug administration. The hippocampal tissue was harvest and homogenized immediately. Finally the level of PTD-HSA-L-α-MSH or HSA-L-α-MSH in hippocampal tissue homogenate was tested by ELISA.

(42) TABLE-US-00003 TABLE 1 Results of ELISA test groups PTD-HSA-L-α-MSH(ng/mL) HSA-L-α-MSH 0.06 ± 0.02 PTD-HSA-L-α-MSH 0.65 ± 0.01

(43) The results listed in table one showed that the described PTD-HSA-L-α-MSH in the present invention possess the ability of across the BBB.

Embodiment 3

(44) Neuroprotection of TAT-HSA-α-MSH on Experimental Brain Inflammation in Mice

(45) Experimental Materials

(46) 1. Experimental Instruments

(47) Syringes, pipette, centrifuge (Hitachi), ultra-pure water meter (Millipore), ultrasound, constant temperature Incubator (Shanghai YiHeng), Microplate reader (Thermo) etc.

(48) TNF-a Elisa Kit (Dakewei, China).

(49) 2. Experimental Animals

(50) 20 mice (18-22 g) were used in the experiment, and were purchased from Laboratory Animal Center of Lanzhou University.

(51) 3. Methods

(52) Mice were housed in groups of at most five animals per cage with clean water and food available ad libitum. PTD-HSA-L-α-MSH or HSA-L-α-MSH were given at a dosage of 1 μm/kg through a single intravenous injection in volume of 150 pt. Mice were anesthetized 6 h after drug administration. The hippocampal tissue was harvest and homogenized immediately. Finally the level of PTD-HSA-L-α-MSH or HSA-L-α-MSH in hippocampal tissue homogenate was tested by ELISA.

(53) Lipopolysaccharide (LPS), a gram negative bacterial endotoxin, is the cell wall component of gram negative bacteria. Within the CNS, LPS challenge triggers central inflammatory responses, which results in releasing of proinflammatory mediators such as TNF-α. Therefore, to determine whether the described PTD-HSA-L-α-MSH can inhibit the production of pro-inflammatory factors in vivo, experimental brain inflammation of mouse induced by LPS was established, in which TNF-α was analyzed to detect the efficacy of PTD-HSA-L-α-MSH.

(54) Mice were housed in groups of at most five animals per cage with clean water and food available ad libitum. The mice in control group were injected with 150 μL saline two times. The mice in LPS group were injected with 150 μL LPS at the dose of 5 mg/kg, and then injected with 150 μL saline. The mice in PTD-HSA-L-α-MSH+LPS group were injected with 150 μL LPS at the dose of 5 mg/kg, and then injected with 150 μL PTD-HSA-L-α-MSH at the dose of 1 μm/kg. The mice in α-MSH+LPS group were injected with 150 μL LPS at the dose of 5 mg/kg, and then injected with 150 μL α-MSH at the dose of 1 μm/kg. Mice were anesthetized 2 h after drug administration. The hippocampal tissue was harvest and homogenized immediately. Finally the level of TNF-α in hippocampal tissue homogenate was tested by ELISA.

(55) TABLE-US-00004 TABLE 2 TNF-α levels in hippocampal tissues tested by ELISA groups TNF-α (pg/mg protein) control 14.8 ± 4.2 LPS 191.9 ± 9.1  LPS + PTD-HSA-L-α-MSH  38.3 ± 18.3 LPS + α-MSH 155.8 ± 10.3

(56) Compared with the control group treated with saline, the level of TNF-α in LPS group was increased at 191.9 pg in per protein of homogenate, which indicated that the inflammation model was successfully established. Compared with LPS group, TNF-α increase was significantly inhibited in experimental brain inflammation mice after given PTD-HSA-L-α-MSH intraperitoneally at a single dose of 1 μm/kg in LPS+PTD-HSA-L-α-MSH group. In contrast, TNF-α could not be suppressed by α-MSH intraperitoneally injection in LPS+α-MSH group. The results indicated that PTD-HSA-L-α-MSH can potentially inhibit the CNS inflammation after i.p. administration. Taken together, the ability to cross the BBB, inhibition of CNS inflammation, make PTD-HSA-L-α-MSH a promising candidate therapeutic agent for treatment of neuro-inflammatory diseases.

(57) The above is a detailed description of the present invention with a specific preferred embodiment, and it cannot be determined that the specific implementation of the present invention is confined to these embodiments. For the general technical personnel in the technical field of the invention, some simple deduction or replacement made with the concept of the invention should be regarded as the protection scope of the invention.