PRIMERS FOR ISOTHERMAL AMPLIFICATION

20220275431 · 2022-09-01

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to primers for isothermal amplification, in particular primers for loop-mediated isothermal amplification (LAMP). Also disclosed are methods for identifying a target nucleic acid, and methods for identifying a nucleic acid modification or substitution of a target nucleic acid. The invention finds utility in the diagnosis of diseases or disorders.

    Claims

    1-15. (canceled)

    16. A set of primers for loop-mediated isothermal amplification (LAMP) comprising a forward outer primer; a reverse outer primer; a forward inner primer; a reverse inner primer, a forward loop primer; and a reverse loop primer; wherein each primer is capable of binding to a target nucleic acid having complementary first and second nucleic acid strands, wherein the first nucleic acid strand has first, second, third, fourth, fifth and sixth regions; and wherein the second nucleic acid strand has first, second, third, fourth, fifth and sixth regions; wherein the fourth, fifth and sixth regions of the first nucleic acid strand are complimentary to the third, second, and first regions of the second nucleic acid strand; and wherein the fourth, fifth and sixth regions of the second nucleic acid strand are complimentary to the third, second, and first regions of the first nucleic acid strand; and wherein (a) the forward outer primer is complementary to the first region of the first nucleic acid strand; (b) the reverse outer primer is complementary to the first region of the second nucleic acid strand; (c) the forward inner primer has first and second parts, wherein: (i) the first part is complementary to the second region of the first nucleic acid strand; and (ii) the second part is complementary to the fourth region of the second nucleic acid strand; and (d) the reverse inner primer has first and second parts, wherein: (i) the first part is complementary to the second region of the second nucleic acid strand; and (ii) the second part is complementary to the fourth region of the first nucleic acid strand; (e) the forward loop primer is complementary to a region between the fourth and fifth regions of the second nucleic acid strand; (f) the reverse loop primer is complementary to a region between the fourth and fifth regions of the second nucleic acid strand; wherein at least one of the forward loop and reverse loop primers comprises a reporter.

    17. The set of primers of claim 16, wherein the forward loop primer comprises the reporter.

    18. The set of primers of claim 16, wherein the reverse loop primer comprises the reporter.

    19. The set of primers of claim 16, wherein one of the forward outer primer; reverse outer primer; forward inner primer; reverse inner primer, forward loop primer; and reverse loop primer further comprises an endonuclease cleavage site.

    20. The set of primers of claim 16, wherein the forward loop primer further comprises an endonuclease cleavage site.

    21. The set of primers of claim 16, wherein the reverse loop primer further comprises an endonuclease cleavage site.

    22. The set of primers of claim 19, wherein the cleavage site is an apurinic/apyrimidinic site (abasic site).

    23. The set of primers of claim 16, wherein the reporter comprises first and second dyes.

    24. The set of primers of claim 19, wherein the reporter comprises first and second dyes located at or adjacent opposing ends of the cleavage site.

    25. The set of primers of claim 16, wherein the reporter comprises a dye and a quencher.

    26. The set of primers of claim 25, wherein the dye is selected from the group consisting of 3′,6′-dihydroxy-1-oxospiro[2-benzofuran-3,9′-xanthene]-5-carboxylic acid (6-Carboxyfluorescein; 6-FAM); 6-Carboxy-2 ‘,7’-dichlorofluorescein diacetate N-succinimidyl ester (6-hexachlorofluorescein; 6-HEX); and 1-{6-[(2,5-Dioxo-1-pyrrolidinyl)oxy]-6-oxohexyl}-2-1(1E,3E,5E)-5-(1-{6-[(2,5-dioxo-1-pyrrolidinyl)oxy]-6-oxohexyl}-3,3-dimethyl-5-sulfo-1,3-dihydro-2H-indol-2-ylidene)-1,3-pentadien-1-yl]-3,3-dimethyl-3H-indolium-5-sulfonate (cyanine; Cy5).

    27. The set of primers of claim 23, wherein the quencher is a dark quencher.

    28. The set of primers of claim 16, wherein at least one of the forward inner and reverse inner primers further comprises a spacer attached at or adjacent the 3′ terminal end of at least one of the forward inner primer and reverse inner primer.

    29. The set of primers of claim 26, wherein the spacer comprises 3-(4,4′-Dimethoxytrityloxy)propyl-1-1[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.

    30. A method for identifying a target nucleic acid, the method comprising: (a) providing a sample; (b) providing the set of primers of claim 16; (c) performing isothermal amplification; and (d) identifying the nucleic acid target in the sample.

    31. A method for identifying a nucleic acid modification or substitution of a target nucleic acid, the method comprising: (a) providing a sample; (b) providing the set of primers of claim 16; (c) performing isothermal amplification; and (d) identifying the nucleic acid modification or substitution of the target nucleic acid in the sample.

    32. The method of claim 26, wherein the isothermal amplification is performed in the presence of a Bacillus stearothermophilus deoxyribonucleic acid polymerase enzyme and an Endonuclease IV enzyme.

    33. The method of claim 27, wherein the isothermal amplification is performed in the presence of a Bacillus stearothermophilus deoxyribonucleic acid polymerase enzyme and an Endonuclease IV enzyme.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0298] Embodiments of the invention will now be described with reference to the accompanying drawings in which:

    [0299] FIG. 1A is a schematic diagram of a set of primers of the invention comprising (a) a forward outer primer; (b) a reverse outer primer; (c) a forward inner primer; (d) a reverse inner primer, (e) a forward loop primer and (f) a reverse loop primer; wherein each primer is capable of binding to a target nucleic acid having complementary first (1.) and second (2.) nucleic acid strands, wherein the first (1.) nucleic acid strand has first (A), second (B), third (C), fourth (D), fifth (E) and sixth (F) regions; and wherein the second (2.) nucleic acid strand has first (F′), second (E′), third (D′), fourth (C′), fifth (B′) and sixth (A′) regions; wherein the fourth (D), fifth (E) and sixth (F) regions of the first (1.) nucleic acid strand are complimentary to the third (D′), second (E′), and first (F′) regions of the second (2.) nucleic acid strand; and wherein the fourth (C′), fifth (B′) and sixth (A′) regions of the second (2.) nucleic acid strand are complimentary to the third (C), second (B), and first (A) regions of the first (1.) nucleic acid strand; and wherein (a) the forward outer primer is complementary to the first region (A) of the first (1.) nucleic acid strand; (b) the reverse outer primer is complementary to the first (F′) region of the second (2.) nucleic acid strand; (c) the forward inner primer has first and second parts, wherein: (i) the first part is complementary to the second region (B) of the first (1.) nucleic acid strand; and (ii) the second part is complementary to the fourth (C′) region of the second (2.) nucleic acid strand; and (d) the reverse inner primer has first and second parts, wherein: (i) the first part is complementary to the second (E′) region of the second (2.) nucleic acid strand; and (ii) the second part is complementary to the fourth (D) region of the first (1.) nucleic acid strand; (e) the forward loop primer is complementary to a region between the fourth (C′) and fifth (B′) regions of the second (2.) nucleic acid strand; (f) the reverse loop primer is complementary to a region between the fourth (D) and fifth (E) regions of the first (1.) nucleic acid strand;

    [0300] FIG. 1B is a schematic diagram of an isothermal amplification using the primers of the invention; wherein (A) loop regions of the double-looped LAMP template, produced by strand-displacing polymerase extension from the outer and inner primers, are targeted by the inner primer and primer/probe; (B) after primer and probe target hybridisation, strand-displacement polymerase extension initiates, unwinding both loop structures, and primer/probe target hybridisation produces a dsDNA abasic site initiating Endonuclease IV cleavage in the wild-type reaction, and presence of the SNP in the mutant allele reaction inhibits abasic site dsDNA formation, preventing cleavage; and (C) combination of reaction temperature and strand-displacement polymerase extension causes fluorophore and quencher dissociation in the wild-type reaction, producing fluorescence, wherein the mutant allele reaction, the fluorophore and quencher remain associated, preventing fluorescence production and enabling wild-type and mutant allele differentiation;

    [0301] FIG. 2 shows the results of a singleplex N. meningitidis assay single-target detection using the primers of the invention (modified LAMP) compared to detection using the primers of the state of the art (state-of-the-art LAMP), wherein the singleplex modified LAMP (grey) and state-of-the-art LAMP (red) N. meningitidis assays were challenged with N. meningitidis genomic DNA at 10.sup.3 copies, no template control (NTC) reactions (black) were performed in parallel, resulting LAMP fluorescence signal was recorded in the LightCycler® 480 FAM detection channel, with representative amplification curves for each reaction shown, successful modified LAMP and state-of-the-art LAMP detection of N. meningitidis is observed, however, modified LAMP produced earlier time-to-detection and increased fluorescence levels compared to state-of-the-art LAMP, and the NTC reactions performed successfully as no detection was observed;

    [0302] FIG. 3 shows the results of a singleplex modified LAMP N. meningitidis assay SNP identification with comparison to state-of-the-art LAMP, wherein the singleplex modified LAMP and state-of-the-art LAMP N. meningitidis assays were separately challenged with templates without SNPs, N. meningitidis genomic DNA (grey) and SNP0 (red), at 10.sup.5 copies, in parallel, the modified LAMP and state-of-the-art LAMP assays were also challenged with templates containing SNPs, SNP1-6 (A, dashed black) and SNPA (B, dashed black) respectively, at 10.sup.5 copies, no template control (NTC) reactions were performed in parallel (black), resulting amplification curves indicate modified LAMP single-base specificity as only templates without SNPs were detected, single-base specificity in the state-of-the-art LAMP assay was not observed as all templates, with or without SNPs, were detected, and the NTC reactions performed successfully as no detection was observed;

    [0303] FIG. 4 shows the allele-specific (AS) modified LAMP N. meningitidis assay single-tube detection of either wild-type or mutant allele templates, wherein the AS modified LAMP N. meningitidis assay was separately challenged with the wild-type template SNP0 (grey), and the mutant allele template SNP2 (red), at 10.sup.5 copies, a NTC reaction was performed in parallel (black), resulting LAMP fluorescence signal was recorded in the LightCycler® 480 FAM (wild-type) and HEX (mutant allele) detection channels, with representative amplification curves for each reaction shown, successful modified LAMP detection of both templates was observed in respective detection channels only, with no unspecific detection of either template in non-corresponding channels observed, and the NTC reaction performed successfully as no detection was observed;

    [0304] FIG. 5 shows multiplex modified LAMP N. meningitidis, S. pneumoniae and H. influenzae assay simultaneous multiple-target detection, wherein the multiplex modified LAMP assay was challenged with three bacterial templates, N. meningitidis (A, dashed black), S. pneumoniae (B, dashed black) and H. influenzae (C, dashed black), at 10.sup.2 genome copies in a single reaction, a NTC reaction was also performed in parallel (black), resulting LAMP fluorescence signal was recorded in the LightCycler® 480 FAM (N. meningitidis), HEX (S. pneumoniae) and Cy5 (H. influenzae) detection channels with representative amplification curves for each reaction shown, and successful simultaneous detection of all three bacterial templates, with no amplification in the NTC control reaction, was observed;

    [0305] FIG. 6 shows single-target detection of C. albicans bacterial template at 10-5 genome copies was successfully demonstrated using the singleplex C. albicans modified LAMP assay (FIG. 6, grey). The NTC reaction performed successfully as no amplification was observed (FIG. 6, black); and

    [0306] FIG. 7 shows singleplex N. meningitidis secondary modified LAMP assay single-target detection and SNP differentiation, wherein the singleplex N. meningitidis secondary modified LAMP assay was separately challenged with two synthetic templates, one without SNPs, SNP0 (grey), and one with SNPs, SNPB (grey dashed), both at 103 copies, wherein a no template control (NTC) reaction was also performed (black), and resulting amplification curves indicate successful single-target detection with single base specificity as only the template without SNPs (SNP0) was detected, whereby the NTC reaction performed successfully as no detection was observed.

    EXAMPLES

    [0307] Embodiments of the invention will now be described with reference to the following non-limiting examples:

    [0308] Materials and Methods

    [0309] Bacterial and Fungal DNA Template Preparation

    [0310] The singleplex modified LAMP N. meningitidis assay was evaluated using a range of N. meningitidis, Neisseria and closely related non-Neisseria reference strains (Table 1). The multiplex modified LAMP N. meningitidis, S. pneumoniae and H. influenzae assay was performed using type-strains N. meningitidis NCTC 10025, S. pneumoniae DSM 20566 and H. influenzae DSM 4690. The singleplex modified LAMP Candida alibicans assay was performed using Candida alibicans CBS 562 type strain. All bacterial and fungal strains, stored at −80° C., were cultured in brain heart infusion (BHI) media (Oxoid, Hampshire, UK) at 37° C. for 18 h under microaerophilic conditions, excluding Haemophilus strains which were cultured using Haemophilus test media (Oxoid). DNA extractions were performed using the DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany) followed by DNA quantification using the Qubit dsDNA broad range/high sensitivity assay kits and Qubit 2.0 fluorometer (Life Technologies, Warrington, UK). Genome size standards of 2.2 Mb, 2.1 Mb, 1.83 Mb, and 15.5 Mb for N. meningitidis, S. pneumoniae, H. influenzae, and Candida alibicans, respectively, were used to convert resulting DNA concentrations to genome copy values. Extracted DNA samples were stored at −80° C. prior to use.

    TABLE-US-00001 TABLE 1 Singleplex modified LAMP Neisseria meningitidis assay specificity panel. modified LAMP Organism Strain Result Inclusivity Panel N. meningitidis reference strains N. meningitidis (A, NCTC 10025 + type strain) N. meningitidis (A) DSM 10036 + N. meningitidis (A) NCTC 3372 + N. meningitidis (A) NCTC 3375 + N. meningitidis (B) ATCC 13090 + N. meningitidis (C) ATCC 13102 + N. meningitidis (C) DSM 15464 + N. meningitidis (W) NCTC 11203 + N. meningitidis (X) NCTC 10790 + N. meningitidis (Y) NCTC 10791 + Exclusivity Panel Neisseria reference strains and closely related non-Neisseria reference strains N. animalis DSM 23392 − N. animaloris DSM 21642 − N. bacilliformis DSM 23338 − N. canis DSM 18000 − N. caviae DSM 23336 − N. cuniculi DSM 21768 − N. dentiae DSM 19151 − N. elongata DSM 17712 − subsp. elongata N. elongata DSM 23337 − subsp. glycolytica N. elongata DSM 17632 − subsp. nitroreducens N. flavescens DSM 17633 − N. gonorrhoeae ATCC 19424 − N. gonorrhoeae DSM 9188 − N. gonorrhoeae DSM 9189 − N. lactamica ATCC 23970 − N. lactamica DSM 4691 − N. macacae DSM 19175 − N. mucosa DSM 17611 − N. ovis DSM 18075 − N. perflava DSM 18009 − N. polysaccharea DSM 22809 − N. shayeganii DSM 22246 − N. sicca DSM 17713 − N. subflava DSM 17610 − N. wadsworthii DSM 22247 − N. weaveri DSM 17688 − N. zoodegmatis DSM 21483 − N. zoodegmatis DSM 21643 − H. influenzae DSM 4690 − H. parainfluenzae DSM 8978 − H. haemolyticus CCUG 15312 − H. somnus CCUG 12839 − S. pneumoniae DSM 20566 − S. pseudopneumoniae DSM 18670 − S. agalactiae BCCM 15081 − S. mitis DSM 12643 − K. pneumoniae DSM 30104 − P. aeruginosa DSM 50071 − E. coli DSM 30083 − E. faecalis DSM 20371 − S. aureus DSM 346 − NCTC, National Collection of Type Cultures; DSM, Leibniz Institute DSMZ - German Collection of Microorganisms and Cell Cultures; ATCC, American Type Culture Collection; CCUG, Culture Collection, University of Goteborg, Sweden; BCCM, Belgian Coordinated Collections of Microorganisms; +, positive; −, negative.

    [0311] Diagnostic targets and modified LAMP Oligonucleotides

    [0312] N. meningitidis, S. pneumoniae, H. influenzae, and C. albicans state-of-the-art LAMP oligonucleotides, designed with PrimerExplorer V4 (Eiken Chemical) using diagnostic targets NMO_1242, SPNA45 01710 and pstA, respectively (Higgins, 0.; Clancy, E.; Cormican, M.; Boo, T. W.; Cunney, R.; Smith, T. J., Evaluation of an Internally Controlled Multiplex Tth Endonuclease Cleavage Loop-Mediated Isothermal Amplification (state-of-the-art LAMP) Assay for the Detection of Bacterial Meningitis Pathogens. International journal of molecular sciences 2018, 19, (2), 524) were modified to create the modified LAMP and state-of-the-art LAMP oligonucleotides used in this study

    [0313] (Table 2). Oligonucleotide modifications included design of new reverse loop primers for the S. pneumoniae and H. influenzae assays, with addition of two 5′-end thymine residues to the forward loop primer of the N. meningitidis assay. Standard desalted oligonucleotides were synthesised by Integrated DNA Technologies. The modified LAMP primer/probes for N. meningitidis, S. pneumoniae, H. influenzae, and C. albicans labelled with FAM, HEX, Cy5 and FAM fluorophores, respectively, and the state-of-the-art LAMP primer/probe labelled with a FAM fluorophore, were HPLC purified and synthesised by Metabion International AG (Planegg, Germany). Each fluorophore corresponded to one of three detection channels of the LightCycler® 480 instrument II (Roche Diagnostics, Sussex, UK) used to perform the modified LAMP reactions.

    TABLE-US-00002 TABLE 2 modified LAMP and state-of-the-art LAMP oligonucleotides. Primer Type Sequence (5′-3′) N. meningitidis modified LAMP Forward Inner TGTCGGTGGCTTTGTTGGTGGTGTCGC- GTGCAAACAGATACGTCCG Reverse Inner CCGATGTACCAGCACCTTGTCC- GTTTGCGCTGATTACGCCTC Forward Outer CCCAATTCCACATCAATACGTG Reverse Outer GTGGTGTCGGTGGTGTTG modified LAMP (BHQ1)TTGA(dSpacer)A(FAM- Primer/Probe Wild-Type dT)TGTGTTGGGCGGTTTG modified LAMP (BHQ1)TTGA(dSpacer)C(HEX- Primer/Probe Mutant dT)TGTGTTGGGCGGTTTG (SNP2 template specific) Reverse Loop CACCACTTGGAAAAACAGAGGC S. pneumoniae modified LAMP Forward Inner TGGAAAATGCTCTGGCTTTTGAAGTGA- CCTACACCAATATCCTCGCT Reverse Inner TCTGTCTGGTAGACAGAATGACGGA- TCTTTGAGAATCAGATGCTGGA Forward Outer TCCGTCAACGAGGCACAA Reverse Outer AGCAAACTCACCAAGCGC Forward Loop TGATGAAACAGACAAGCTGATTCT modified LAMP (BHQ1)ACTC(dSpacer)CA(HEX- Primer/Probe dT)GCGCAATGATGGTATAATCC H. influenzae modified LAMP Forward Inner TGCCGCTGCTTCACGTAAATTATTTGG- TGCTTATTCCTATCGTGGTACG Reverse Inner CTTGGTTGCTCTCAATGGCAAG- GCACGCCAGTTAAAATCCCT Forward Outer GGCTGGAGCATTCGCATT Reverse Outer TTCTCCTGAAATTCGGGCAA Forward Loop AACATATTGTCCGTAGTGCG modified LAMP (BHQ2)TTGT(dSpacer)A(Cy5- Primer/Probe dT)CGAGCAGCTAAATCAGGGA C. albicans modified LAMP Forward Inner TGATGTGGTTGTGGTTGTGGTTGCGAT ATCAACTTTTATACACCCATGT Reverse Inner ACAGCATCAACCTGAATTACAAAACAC TACTGATGTTGTAGCATTTGCTG Forward Outer CACCAGAATTTAGGTGCCATG Reverse Outer GCGGAGTTGATTGTTTTGGTTG modified LAMP BHQ1-TTCA(dSpacer)C(FAM- Primer/Probe dT)TGTACTGGAAGCTCGT Reverse Loop CCAACAAATTAAACACATTCAACAGC N. meningitidis state-of-the-art LAMP state-of-the-art LAMP (FAM)TGTC(dSpacer)G(BHQ1- Primer/Probe dT)GGCTTTGTTGGTGGTGTCGC- GTGCAAACAGATACGTCCG Forward Inner TGTCGGTGGCTTTGTTGGTGGTGTCGC- GTGCAAACAGATACGTCCG Reverse Inner CCGATGTACCAGCACCTTGTCC- GTTTGCGCTGATTACGCCTC Forward Outer CCCAATTCCACATCAATACGTG Reverse Outer GTGGTGTCGGTGGTGTTG Forward Loop TTGAGATTGTGTTGGGCGGTTTG Reverse Loop CACCACTTGGAAAAACAGAGGC -, separation between 5′ antisense and 3′ sense inner primer sequences; BHQ1-dT, black hole quencher 1 linked to thymine; dSpacer, 1′,2′-dideoxyribose; FAM, 6-carboxyfluorescein fluorophore; HEX, 6-hexachlorofluorescein fluorophore; Cy5, cyanine fluorophore.

    [0314] Singleplex modified LAMP N. meningitidis assay single-target detection with comparison to state-of-the-art LAMP

    [0315] The singleplex modified LAMP N. meningitidis assay reaction contained 1×Isothermal Amplification Buffer (New England Biolabs, Hitchin, UK), 6 mM MgSO.sub.4 (Roche Diagnostics), 1.4 mM deoxynucleotide triphosphate set (New England Biolabs), N. meningitidis oligonucleotides [1.6 μM forward and reverse inner, 0.4 μM modified LAMP primer/probe wild-type and reverse loop, 0.2 μM forward and reverse outer], 8 U Bst 2.0 WarmStart DNA polymerase (New England Biolabs), 1 U Endonuclease IV (New England Biolabs), 1 μL DNA template or 1 μL molecular grade water for NTC reaction, and molecular grade water to give a final reaction volume of 25 μL. The singleplex state-of-the-art LAMP N. meningitidis assay was prepared as per the modified LAMP assay, with modifications: the Endonuclease IV enzyme was replaced with 15 U Tth Endonuclease IV (New England Biolabs); the modified LAMP primer/probe wild-type was replaced with unmodified forward loop primer; and 0.8 μM of the forward inner primer was replaced with state-of-the-art LAMP primer/probe (Table 2). Reactions were performed for 60×1 min cycles at 67° C. in a LightCycler® 480 instrument II (Roche Diagnostics). The fluorescence detection channel used was 495-520 nm (FAM) with fluorescent measurements recorded every min. Single-target detection using the singleplex modified LAMP and state-of-the-art LAMP N. meningitidis assays was demonstrated by challenging both assays with 10.sup.3 copies of type-strain N. meningitidis genomic DNA (FIG. 2). No template control (NTC) reactions using molecular grade water in place of bacterial template were carried out in parallel. Positive results in each reaction were recorded on the LightCycler® 480 as exponential signal acquisition exceeding background fluorescence and represented as fluorescence amplification curves. Cycle threshold (Ct) values denoted cycles at which fluorescent signal exceeded background levels. As reactions were performed for 60×1 min cycles, resulting Ct-values acted as approximate time-to-positivity values in minutes.

    [0316] Singleplex modified LAMP N. meningitidis assay analytical specificity, sensitivity and clinical sample testing All clinical samples were collected and processed by the IMSRL during routine diagnostic services in accordance with ethical review committee approved protocols. Samples were not analysed for human DNA in this study, and thus, the Ethics Committee of the National University of Ireland, Galway deemed that ethical approval for the evaluation of these samples was not required.

    [0317] Analytical specificity of the singleplex modified LAMP N. meningitidis assay was evaluated using genomic DNA from a panel of bacterial reference strains (Table 1) at 10.sup.5 genome copy concentrations. The limit of detection (LOD) of the singleplex modified LAMP N. meningitidis assay was determined by testing 6 replicates of 32, 16, 8, 4, 2 and 1 genome copy concentrations of type-strain N. meningitidis NCTC 10025 genomic DNA. Probit regression analysis was performed on the resulting data using Minitab 17 (Table 3) to establish assay LOD with 95% probability. The clinical application of the singleplex modified LAMP N. meningitidis assay was assessed using archived genomic DNA extracted from blood and cerebrospinal fluid (CSF) samples of confirmed bacterial meningitis cases. The Irish Meningitis and Sepsis Reference Laboratory (IMSRL) supplied 72 anonymised samples which were previously collected and processed as part of routine diagnostic service. IMSRL DNA extractions were carried out using a QIAsymphony SP/AS instrument with QIAamp DSP DNA Blood Mini Kits (Qiagen), as per manufacturer instructions, followed by real-time PCR analysis for N. meningitidis, S. pneumoniae and H. influenzae. We reconfirmed the presence of N. meningitidis, S. pneumoniae and H. influenzae in each respective sample using singleplex real-time PCR assays targeting the N. meningitidis NMO 1242, S. pneumoniae lepA and H. influenzae pstA genes (Table 4). PCR reactions were performed on a LightCycler® 480 II instrument, using the LightCycler® 480 Probes Master kit (Roche Diagnostics) as per manufactures instructions, testing 2.5 μL of each sample (Table 5). For comparative purposes, the diagnostic sensitivity and specificity of the singleplex modified LAMP N. meningitidis assay was also determined by testing 2.5 μL of each sample (Table 5). Samples from cases of meningococcal infection were used to determine modified LAMP diagnostic sensitivity, and samples from cases of pneumococcal and Haemophilus infection were used to determine modified LAMP diagnostic specificity. Positive control reactions incorporating respective type-strain genomic DNA at 10.sup.3 genome copies, and negative control reactions substituting molecular grade water for bacterial template, were carried out in parallel to the above reactions.

    TABLE-US-00003 TABLE 3 Singleplex modified LAMP N. meningitidis assay limit-of-detection (LOD) Probit analysis. Genome copy Replicates tested/ concentration tested Replicates detected 32 6/6 16 6/6 8 6/6 4 6/6 2 6/4 1 6/1 Genome copy LOD per reaction 3.1 (95% probability)

    TABLE-US-00004 TABLE 4 PCR oligonucleotides. Type Sequence (5′-3′) N. meningitidis Forward CGACATGTTCGAACGTAATCTCC Probe (FAM)TATCGGGCAAAGCCAAATGCGAAG(BHQ1) Reverse ATTTCGGTGGCGCGTTT S. pneumoniae Forward CTCGTAAGCGTAAACTCCTTG Probe (FAM)ACGCATGAAATCCATCGGATCAGTT(BHQ1) Reverse CATACTCAAGACGCTGAGGA H. influenzae Forward GGTACGCACYACGGACAATATG Probe (FAM)AGCTCTTGGTTGCTCTCAATGGCA(BHQ1) Reverse CCTGATTTAGCYGCTCGATAACA FAM, 6-carboxyfluorescein fluorophore; BHQ1, black hole quencher

    TABLE-US-00005 TABLE 5 Singleplex modified LAMP N. meningitidis assay clinical sample testing using N. meningitidis, S. pneumoniae and H. influenzae PCR-positive DNA extracts from blood and CSF specimens of confirmed bacterial meningitis cases. N. meningitidis Clinical Samples N. meningitidis N. meningitidis modified Sample Clinical PCR LAMP No. Specimen (Ct Value) (Ct Value) 1 BLD 36.97 24.30 2 BLD 30.82 15.06 3 BLD 31.46 14.49 4 BLD 30.02 15.47 5 BLD 30.05 15.05 6 BLD 34.17 16.26 7 CSF 33.55 17.23 8 BLD 36.11 37.13 9 CSF 30.21 13.28 10 BLD 33.06 16.82 11 CSF 30.32 15.27 12 BLD 33.17 17.62 13 BLD 36.37 21.37 14 BLD 33.47 17.73 15 BLD 23.82 12.01 16 BLD 36.72 17.86 17 BLD 33.91 16.00 18 CSF 36.46 23.05 19 BLD 29.88 14.62 20 BLD 34.83 18.28 21 BLD 33.89 17.37 22 BLD 36.06 12.23 23 CSF 34.02 16.84 24 CSF 23.98 13.29 25 CSF 32.79 18.20 26 CSF 23.04 13.53 27 CSF 33.31 18.49 28 CSF 22.39 13.27 29 CSF 27.29 13.65 30 CSF 26.53 12.60 31 CSF 22.98 13.75 32 CSF 30.30 14.52 33 CSF 26.93 12.11 S. pneumoniae Clinical Samples N. meningitidis S. pneumoniae modified Sample Clinical PCR LAMP No. Specimen (Ct Value) (Ct Value) 34 BLD 31.61 − 35 CSF 24.13 − 36 BLD 28.01 − 37 CSF 34.64 − 38 CSF 26.33 − 39 BLD 28.59 − 40 CSF 30.47 − 41 CSF 33.22 − 42 CSF 31.99 − 43 CSF 25.32 − 44 BLD 31.84 − 45 BLD 26.87 − 46 CSF 29.31 − 47 BLD 27.05 − 48 BLD 32.61 − 49 CSF 25.60 − 50 CSF 23.18 − 51 CSF 28.83 − 52 CSF 23.61 − 53 CSF 26.34 − 54 CSF 31.06 − 55 CSF 28.81 − H. influenzae Clinical Samples N. meningitidis H. influenzae modified Sample Clinical PCR LAMP No. Specimen (Ct Value) (Ct Value) 56 BLD 38.50 − 57 CSF 37.26 − 58 BLD 37.48 − 59 CSF 36.54 − 60 CSF 32.24 − 61 CSF 28.65 − 62 CSF 27.95 − 63 BLD 35.50 − 64 BLD 38.40 − 65 BLD 37.73 − 66 BLD 34.44 − 67 BLD 38.61 − 68 BLD 31.18 − 69 BLD 38.45 − 70 BLD 37.13 − 71 CSF 35.73 − 72 CSF 30.99 − BLD, blood; CSF, cerebrospinal fluid; −, negative.

    [0318] Singleplex modified LAMP N. meningitidis assay SNP identification with comparison to state-of-the-art LAMP

    [0319] Templates used to demonstrate modified LAMP single-base specificity were synthetic 500 bp DNA gBlocks® Gene Fragments (Table 7 and Table 6) purchased from Integrated DNA Technologies (Leuven, Belgium). Each template was based on a 500 bp sequence of the N. meningitidis NMO_1242 diagnostic target. SNP0 was an exact copy of this sequence and acted as a wild-type template for positive control reactions. SNP1-6 were incomplete copies of this sequence containing single-base mismatches in close proximity to the modified LAMP primer/probe wild-type abasic site, and acted as mutant allele test templates for the modified LAMP assay. SNPA contained a single-base mismatch in close proximity to the state-of-the-art LAMP primer/probe abasic site and acted as a mutant allele test template for the state-of-the-art LAMP assay. The single-base mismatches between the gBlocks® Gene Fragment templates and their respective probes were designed to create either guanine to adenine, or cytosine to thymine, interactions (Table 7). Single-base specificity of the singleplex modified LAMP N. meningitidis assay was demonstrated by challenging the assay with SNP1-6 templates at 10.sup.5 copies (FIG. 3). For comparison, the state-of-the-art LAMP assay was challenged with the SNPA template at 10.sup.5 copies. Positive control reactions for both assays contained N. meningitidis genomic DNA and the SNP0 template at 10.sup.5 copies, with no template controls reactions performed in parallel.

    TABLE-US-00006 TABLE 6 N. meningitidis 500 bp DNA gBlocks ® Gene Fragments with and without SNPs. SNP0 (without SNP) AGCTGTAATACCACATCACCGCCAGAAAGATAAACGAAAACGCCAAATCCAACACCGAAGTCAGCGCCTGACCGGTC AAGAAATTGCGAATCTG CTCCAATTCCCGCACCCGAGCCACCGTATCACCCACTCGTCTGTGCTCGAAATAGGATAAAGGCAGGGAAAGCAGAT GCCGGAACAAACGCGCG CCCAATTCCACATCAATACGTGAAGTCGTATGTGCAAACAGATACGTCCGCAAACCGCCCAACACAATCTCAAACAGC GACACCACCAACAAAG CCACCGACACCACATCCAAAGTAGAGAATCCCCGATGTACCAGCACCTTGTCCATCACCACTTGGAAAAACAGAGGC GTAATCAGCGCAAACAG CTGCAACACCACCGACACCACCAATACTTCAAAAAACAACCGGCGGTATTTGATTACCGCCGGAATAAACCAGGTAAA GTCAAACTTTGCCAAA CTGCCCAATACCGAAGCGCGGGAAGCAACC SNP1 (with SNP) AGCTGTAATACCACATCACCGCCAGAAAGATAAACGAAAACGCCAAATCCAACACCGAAGTCAGCGCCTGACCGGTC AAGAAATTGCGAATCTG CTCCAATTCCCGCACCCGAGCCACCGTATCACCCACTCGTCTGTGCTCGAAATAGGATAAAGGCAGGGAAAGCAGAT GCCGGAACAAACGCGCG CCCAATTCCACATCAATACGTGAAGTCGTATGTGCAAACAGATACGTCCGCAAACCGCCCAACACAATCcustom-character CAAACAGC GACACCACCAACAAAG CCACCGACACCACATCCAAAGTAGAGAATCCCCGATGTACCAGCACCTTGTCCATCACCACTTGGAAAAACAGAGGC GTAATCAGCGCAAACAG CTGCAACACCACCGACACCACCAATACTTCAAAAAACAACCGGCGGTATTTGATTACCGCCGGAATAAACCAGGTAAA GTCAAACTTTGCCAAA CTGCCCAATACCGAAGCGCGGGAAGCAACC SNP2 (with SNP) AGCTGTAATACCACATCACCGCCAGAAAGATAAACGAAAACGCCAAATCCAACACCGAAGTCAGCGCCTGACCGGTC AAGAAATTGCGAATCTG CTCCAATTCCCGCACCCGAGCCACCGTATCACCCACTCGTCTGTGCTCGAAATAGGATAAAGGCAGGGAAAGCAGAT GCCGGAACAAACGCGCG CCCAATTCCACATCAATACGTGAAGTCGTATGTGCAAACAGATACGTCCGCAAACCGCCCAACACAAcustom-character CTCAAACAGC GACACCACCAACAAAG CCACCGACACCACATCCAAAGTAGAGAATCCCCGATGTACCAGCACCTTGTCCATCACCACTTGGAAAAACAGAGGC GTAATCAGCGCAAACAG CTGCAACACCACCGACACCACCAATACTTCAAAAAACAACCGGCGGTATTTGATTACCGCCGGAATAAACCAGGTAAA GTCAAACTTTGCCAAA CTGCCCAATACCGAAGCGCGGGAAGCAACC SNP3 (with SNP) AGCTGTAATACCACATCACCGCCAGAAAGATAAACGAAAACGCCAAATCCAACACCGAAGTCAGCGCCTGACCGGTC AAGAAATTGCGAATCTG CTCCAATTCCCGCACCCGAGCCACCGTATCACCCACTCGTCTGTGCTCGAAATAGGATAAAGGCAGGGAAAGCAGAT GCCGGAACAAACGCGCG CCCAATTCCACATCAATACGTGAAGTCGTATGTGCAAACAGATACGTCCGCAAACCGCCCAACACAcustom-character TCTCAAACAGC GACACCACCAACAAAG CCACCGACACCACATCCAAAGTAGAGAATCCCCGATGTACCAGCACCTTGTCCATCACCACTTGGAAAAACAGAGGC GTAATCAGCGCAAACAG CTGCAACACCACCGACACCACCAATACTTCAAAAAACAACCGGCGGTATTTGATTACCGCCGGAATAAACCAGGTAAA GTCAAACTTTGCCAAA CTGCCCAATACCGAAGCGCGGGAAGCAACC SNP4 (with SNP) AGCTGTAATACCACATCACCGCCAGAAAGATAAACGAAAACGCCAAATCCAACACCGAAGTCAGCGCCTGACCGGTC AAGAAATTGCGAATCTG CTCCAATTCCCGCACCCGAGCCACCGTATCACCCACTCGTCTGTGCTCGAAATAGGATAAAGGCAGGGAAAGCAGAT GCCGGAACAAACGCGCG CCCAATTCCACATCAATACGTGAAGTCGTATGTGCAAACAGATACGTCCGCAAACCGCCCAACACcustom-character ATCTCAAACAGC GACACCACCAACAAAG CCACCGACACCACATCCAAAGTAGAGAATCCCCGATGTACCAGCACCTTGTCCATCACCACTTGGAAAAACAGAGGC GTAATCAGCGCAAACAG CTGCAACACCACCGACACCACCAATACTTCAAAAAACAACCGGCGGTATTTGATTACCGCCGGAATAAACCAGGTAAA GTCAAACTTTGCCAAA CTGCCCAATACCGAAGCGCGGGAAGCAACC SNP5 (with SNP) AGCTGTAATACCACATCACCGCCAGAAAGATAAACGAAAACGCCAAATCCAACACCGAAGTCAGCGCCTGACCGGTC AAGAAATTGCGAATCTG CTCCAATTCCCGCACCCGAGCCACCGTATCACCCACTCGTCTGTGCTCGAAATAGGATAAAGGCAGGGAAAGCAGAT GCCGGAACAAACGCGCG CCCAATTCCACATCAATACGTGAAGTCGTATGTGCAAACAGATACGTCCGCAAACCGCCCAACAAAATCTCAAACAGC GACACCACCAACAAAG CCACCGACACCACATCCAAAGTAGAGAATCCCCGATGTACCAGCACCTTGTCCATCACCACTTGGAcustom-character AAACAGAGGC GTAATCAGCGCAAACAG CTGCAACACCACCGACACCACCAATACTTCAAAAAACAACCGGCGGTATTTGATTACCGCCGGAATAAACCAGGTAAA GTCAAACTTTGCCAAA CTGCCCAATACCGAAGCGCGGGAAGCAACC SNP6 (with SNP) AGCTGTAATACCACATCACCGCCAGAAAGATAAACGAAAACGCCAAATCCAACACCGAAGTCAGCGCCTGACCGGTC AAGAAATTGCGAATCTG CTCCAATTCCCGCACCCGAGCCACCGTATCACCCACTCGTCTGTGCTCGAAATAGGATAAAGGCAGGGAAAGCAGAT GCCGGAACAAACGCGCG CCCAATTCCACATCAATACGTGAAGTCGTATGTGCAAACAGATACGTCCGCAAACCGCCCAACcustom-character CAATCTCAAACAGC GACACCACCAACAAAG CCACCGACACCACATCCAAAGTAGAGAATCCCCGATGTACCAGCACCTTGTCCATCACCACTTGGAAAAACAGAGGC GTAATCAGCGCAAACAG CTGCAACACCACCGACACCACCAATACTTCAAAAAACAACCGGCGGTATTTGATTACCGCCGGAATAAACCAGGTAAA GTCAAACTTTGCCAAA CTGCCCAATACCGAAGCGCGGGAAGCAACC SNPA (with SNP) AGCTGTAATACCACATCACCGCCAGAAAGATAAACGAAAACGCCAAATCCAACACCGAAGTCAGCGCCTGACCGGTC AAGAAATTGCGAATCTG CTCCAATTCCCGCACCCGAGCCACCGTATCACCCACTCGTCTGTGCTCGAAATAGGATAAAGGCAGGGAAAGCAGAT GCCGGAACAAACGCGCG CCCAATTCCACATCAATACGTGAAGTCGTATGTGCAAACAGATACGTCCGCAAACCGCCCAACACAATCTCAAACAGC GACACCACCAACAAAG CCACCcustom-character ACACCACATCCAAAGTAGAGAATCCCCGATGTACCAGCACCTTGTCCATCACCACTTGGAAAAACAGAGGC GTAATCAGCGCAAACAG CTGCAACACCACCGACACCACCAATACTTCAAAAAACAACCGGCGGTATTTGATTACCGCCGGAATAAACCAGGTAAA GTCAAACTTTGCCAAA CTGCCCAATACCGAAGCGCGGGAAGCAACC Highlight, SNP mismatch.

    TABLE-US-00007 TABLE 7 N. meningitidis modified LAMP and state-of-the-art LAMP primer/probes with complementary region of each gBlocks ® Gene Fragment template (SNPs highlighted). modified LAMP Primer/Probe Wild-Type: TTGA-ATTGTGTTGGGCGGTTTG                         ||||||||||||||||||||||| SNP0:                   AACTCTAACACAACCCGCCAAAC SNP1:                   AACcustom-character CTAACACAACCCGCCAAAC SNP2:                   AACTCcustom-character AACACAACCCGCCAAAC SNP3:                   AACTCTcustom-character ACACAACCCGCCAAAC SNP4:                   AACTCTAcustom-character CACAACCCGCCAAAC SNP5:                   AACTCTAAcustom-character ACAACCCGCCAAAC SNP6:                   AACTCTAACcustom-character CAACCCGCCAAAC modified LAMP Primer/Probe Mutant:    TTGA-CTTGTGTTGGGCGGTTTG                         ||||||||||||||||||||||| SNP0:                   AACTCcustom-character AACACAACCCGCCAAAC SNP2:                   AACTCGAACACAACCCGCCAAAC state-of-the-art LAMP Primer/Probe:           TGTC-GTGGCTTTGTTGGTGGTGTCGCGTGCAAACAGATACGTCCG                         |||||||||||||||||||||||||||||||||||||||||||||| SNP:                    ACAGCCACCGAAACAACCACCACAGCGCACGTTTGTCTATGCAGGC SNPA:                   ACAcustom-character CCACCGAAACAACCACCACAGCGCACGTTTGTCTATGCAGGC Underline, dye labels, -, abasic site, bold, single base difference between modified LAMP Primer/Probe Wild-Type and modified LAMP Primer/Probe Mutant.

    [0320] AS modified LAMP N. meningitidis assay single-tube detection of either wild-type or mutant allele templates

    [0321] The singleplex modified LAMP N. meningitidis assay was modified to incorporate the modified LAMP primer/probe mutant (Table 2), a SNP2 specific mutant allele HEX fluorophore labelled modified LAMP primer/probe, also at 0.4 μM concentration, creating the AS modified LAMP N. meningitidis assay. This assay was separately challenged with the wild-type SNP0 template and the mutant allele SNP2 template, each at 10.sup.5 copies (FIG. 4). Reactions were performed as per the standard singleplex modified LAMP N. meningitidis assay with the addition of using two fluorescence detection channels, 495-520 nm (FAM, wild-type) and 535-565 nm (HEX, mutant allele). A colour compensation file, generated as per LightCycler® 480 operator manual, was applied for correction of any channel-to-channel fluorescence crosstalk. A NTC reaction as previously described was carried out in parallel.

    [0322] Multiplex modified LAMP N. meningitidis, S. pneumoniae and H. influenzae assay simultaneous multiple-target detection

    [0323] The multiplex modified LAMP N. meningitidis, S. pneumoniae and H. influenzae assay was prepared as per the singleplex modified LAMP N. meningitidis assay, with the further addition of S. pneumoniae and H. influenzae modified LAMP oligonucleotides (Table 2) at the same concentration as the N. meningitidis oligonucleotides. The addition of molecular grade water was altered to maintain a final reaction volume of 25 μL. Simultaneous multiple-target detection using the multiplex modified LAMP N. meningitidis, S. pneumoniae and H. influenzae assay was demonstrated by challenging the assay with N. meningitidis NCTC 10025, S. pneumoniae DSM 20566 and H. influenzae DSM 4690 purified genomic DNA at 10.sup.2 genome copies, in a single reaction (FIG. 5). This reaction was performed at 65° C. using fluorescence detection channels 495-520 nm (FAM), 535-565 nm (HEX) and 646-662 nm (Cy5). A colour compensation file was generated as previously described and applied for correction of any channel-to-channel fluorescence crosstalk. A NTC reaction was carried out in parallel as previously described.

    Example 1

    [0324] Singleplex modified LAMP N. meningitidis assay single-target detection with comparison to state-of-the-art LAMP

    [0325] Both the singleplex modified LAMP and state-of-the-art LAMP N. meningitidis assays successfully demonstrated single-target detection of N. meningitidis at 10.sup.3 genome copies (FIG. 2, grey and dashed grey, respectively). However, the resulting amplification curves data highlighted significantly improved assay performance in the modified LAMP assay compared to the state-of-the-art LAMP assay. The modified LAMP assay produced time-to-positivity values of approximately 10 min compared to 20 min in the state-of-the-art LAMP assay. Additionally, the modified LAMP assay produced higher fluorescence levels compared to the state-of-the-art LAMP assay. The NTC reactions performed successfully as no amplification was observed (FIG. 2, black).

    Example 2

    [0326] Singleplex modified LAMP N. meningitidis assay analytical specificity, sensitivity and clinical sample testing

    [0327] Complete analytical specificity was observed for the singleplex modified LAMP N. meningitidis assay as all N. meningitidis inclusivity panel reference strains were successfully detected, with no detection observed for the exclusivity panel reference strains (Table 1). The limit-of-detection (LOD) for the singleplex modified LAMP N. meningitidis assay was confirmed with 95% probability using Probit analysis to be 3.1 genome copies per reaction (Table 3). All IMSRL clinical samples provided, were successfully reconfirmed to be positive for the presence of respective pathogens N. meningitidis, S. pneumoniae or H. influenzae, using real-time PCR (Table 5). Compared to these PCR results, the singleplex modified LAMP N. meningitidis assay demonstrated 100% diagnostic sensitivity and specificity by successfully detecting all N. meningitidis positive clinical samples and none of the S. 10 pneumoniae or H. influenzae positive clinical samples (Table 5). The positive controls reactions carried out in parallel were successfully detected with no detection observed in the NTC reactions.

    Example 3

    [0328] Singleplex modified LAMP N. meningitidis assay SNP identification with comparison to state-of-the-art LAMP

    [0329] Single-base specificity was successfully demonstrated in the singleplex modified LAMP N. meningitidis assay as only templates without SNPs, N. meningitidis genomic DNA (FIG. 3A, grey) and the SNP0 template (FIG. 3A, grey), were successfully detected. All templates incorporating

    [0330] SNPs, SNP1-6, were not detected with the modified LAMP assay (FIG. 3A, dashed black). The singleplex state-of-the-art LAMP N. meningitidis assay successfully detected templates without SNPs, N. meningitidis genomic DNA (FIG. 3B, grey) and the SNP0 template (FIG. 3B, grey). However, the state-of-the-art LAMP assay did not demonstrate single-base specificity as it also detected the SNP incorporating template, SNPA (FIG. 3B, dashed grey). The no template control reactions performed successfully in both assays as no signal was observed (FIG. 3, black).

    Example 4

    [0331] Allele-specific (AS) modified LAMP N. meningitidis assay single-tube detection of either wild-type or mutant allele templates

    [0332] The AS modified LAMP N. meningitidis assay, incorporating FAM labelled wild-type modified LAMP primer/probe and HEX labelled mutant SNP2 specific modified LAMP primer/probe, successfully demonstrated differential detection of wild-type or mutant allele templates at 10.sup.5 copies, in single-tube reactions (FIG. 4). The SNP0 template, acting as the wild-type template, was successfully detected by the wild-type specific FAM labelled modified LAMP primer/probe in the FAM detection channel (FIG. 4A, grey), with no detection of this template observed in the HEX detection channel (FIG. 4B, grey). The SNP2 template, acting as the mutant allele template, was successfully detected by the mutant allele SNP2 specific HEX labelled modified LAMP primer/probe in the HEX detection channel (FIG. 4B, dashed grey), with no detection of this template observed in the FAM detection channel (FIG. 4A, dashed grey). The NTC reaction performed successfully as no signal was observed (FIG. 4, black)

    Example 5

    [0333] Multiplex modified LAMP N. meningitidis, S. pneumoniae and H. influenzae assay simultaneous multiple-target detection

    [0334] Simultaneous multiple-target detection of all three bacterial templates at 10.sup.2 genome copies, in a single reaction, was successfully demonstrated using the multiplex modified LAMP N. meningitidis, S. pneumoniae and H. influenzae assay (FIG. 5, dashed black). Each target was detected in the appropriate respective fluorescence detection channel of the LightCycler® 480, N. meningitidis FAM (FIG. 5A), S. pneumoniae HEX (FIG. 5B) and H. influenzae Cy5 (FIG. 5C). The NTC reaction performed successfully as no amplification was observed (FIG. 5, black).

    Example 6

    [0335] Singleplex modified LAMP C. albicans assay single-target detection

    [0336] Single-target detection of C. albicans bacterial template at 10-5 genome copies was successfully demonstrated using the singleplex C. albicans modified LAMP assay (FIG. 6, grey). The NTC reaction performed successfully as no amplification was observed (FIG. 6, black).

    Example 7

    [0337] Secondary Modified LAMP Technology

    [0338] Similar to the modified LAMP technology, secondary modified LAMP technology also alters the state-of-the-art LAMP method through oligonucleotide modifications and use of an endonuclease IV cleavage enzyme. Secondary modified LAMP technology utilises blocked inner primers with 3′-end

    [0339] C3-Spacer extension blocks and internal abasic sites (Table 8).

    TABLE-US-00008 TABLE 8 N. meningitidis secondary modified LAMP oligonucleotides Primer Type Sequence (5′-3′) Blocked Forward TGTCGGTGGCTTTGTTGGTGGTGTCGC- Inner GTGCAAACAGATACGTCCG(dSpacer)AAAC- C3Spacer Blocked Reverse CCGATGTACCAGCACCTTGTCC- Inner GCTGTTTGCGCTGATTAC(dSpacer)CCTC- C3spacer Forward Outer CCCAATTCCACATCAATACGTGAAGT Reverse Outer TTGGTGGTGTCGGTGGTGTTG Forward Loop TTGAGATTGTGTTGGGCGGTTTG Reverse Loop CACCACTTGGAAAAACAGAGGC dSpacer, 1′,2′-dideoxyribose; C3Spacer, C3 Spacer phosphoramidite

    [0340] The singleplex N. meningitidis secondary modified LAMP assay reaction contained 1X Isothermal Amplification Buffer (New England Biolabs, Hitchin, UK), 6 mM MgSO.sub.4 (Roche Diagnostics), 1.4 mM deoxynucleotide triphosphate set (New England Biolabs), N. meningitidis secondary modified LAMP oligonucleotides (Table 1) [1.6 μM blocked forward and blocked reverse inner, 0.4 μM forward and reverse loop, 0.2 μM forward and reverse outer], 8 U Bst 2.0 WarmStart DNA polymerase (New England Biolabs), 8 U endonuclease IV (New England Biolabs), 0.5X SYBR Green 1, 1 μL DNA template or 1 μL molecular grade water for NTC reactions, and molecular grade water to give a final reaction volume of 25 μL. The reaction was performed for 40×1 min cycles at 67° C. in a LightCycler® 480 instrument II (Roche Diagnostics). The fluorescence detection channel used was 495-520 nm (FAM) with fluorescent measurements recorded every min. A no template control (NTC) reaction using molecular grade water in place of a DNA template was carried out in parallel. Positive results in each reaction were recorded on the LightCycler® 480 as exponential signal acquisition exceeding background fluorescence and were represented as fluorescence amplification curves.

    [0341] During a LAMP reaction, the blocked inner primers hybridise to their targets leading to cleavage of the internal abasic sites, unblocking the inner primers and enabling LAMP amplification to proceed. However, if a SNP is present in the blocked inner primer target region adjacent to the abasic site, cleavage will not occur. This property of secondary modified LAMP technology enables differentiation between target templates with and without SNPs. The secondary modified LAMP technology can be monitored using basic intercalating dyes, such as SYBR Green 1, and thermostatic fluorometers. Additionally, this method can be monitored using lateral flow dipstick technology via 5′-end modifications of the inner and loop primers with appropriate labels, such as Biotin and/or FITC.

    [0342] Single-target detection using the singleplex N. meningitidis secondary modified LAMP assay was demonstrated by challenging the assay with the synthetic SNP0 template (Tables 9 and 10) at a concentration of 10.sup.3 copies (FIG. 7). The singleplex N. meningitidis secondary modified LAMP assay successfully demonstrated single-target detection of the synthetic template SNP0 at 10.sup.3 copies (FIG. 7, grey). The singleplex N. meningitidis secondary modified LAMP assay also successfully demonstrated single-base specificity as the SNP containing synthetic template, SNPB, was not detected (FIG. 7, grey dashed). The NTC reaction carried out in parallel performed successfully as no amplification was observed (FIG. 7, black).

    TABLE-US-00009 TABLE 9 N. meningitidis 500 bp DNA gBlocks ® Gene Fragments with and without SNPs SNP0 (without SNP) AGCTGTAATACCACATCACCGCCAGAAAGATAAACGAAAACGCCAAATCCAACACCGAAGTCAG CGCCTGACCGGTCAAGAAATTGCGAATCTG CTCCAATTCCCGCACCCGAGCCACCGTATCACCCACTCGTCTGTGCTCGAAATAGGATAAAGGC AGGGAAAGCAGATGCCGGAACAAACGCGCG CCCAATTCCACATCAATACGTGAAGTCGTATGTGCAAACAGATACGTCCGCAAACCGCCCAACAC AATCTCAAACAGCGACACCACCAACAAAG CCACCGACACCACATCCAAAGTAGAGAATCCCCGATGTACCAGCACCTTGTCCATCACCACTTG GAAAAACAGAGGCGTAATCAGCGCAAACAG CTGCAACACCACCGACACCACCAATACTTCAAAAAACAACCGGCGGTATTTGATTACCGCCGGAA TAAACCAGGTAAAGTCAAACTTTGCCAAA CTGCCCAATACCGAAGCGCGGGAAGCAACC SNPB (with SNP) AGCTGTAATACCACATCACCGCCAGAAAGATAAACGAAAACGCCAAATCCAACACCGAAGTCAG CGCCTGACCGGTCAAGAAATTGCGAATCTGCTCCAATTCCCGCACCCGAGCCACCGTATCACCC ACTCGTCTGTGCTCGAAATAGGATAAAGGCAGGGAAAGCAGATGCCGGAACAAACGCGCGCCC AATTCCACATCAATACGTGAAGTCGTATGTGCAAACAGATACGTCCGCAAACCGCCCAACACAAT CTCAAACAGCGACACCACCAACAAAGCCACCGACACCACATCCAAAGTAGAGAATCCCCGATGT ACCAGCACCTTGTCCATCACCACTTGGAAAAACAGAGTCGTAATCAGCGCAAACAGCTGCAACA CCACCGACACCACCAATACTTCAAAAAACAACCGGCGGTATTTGATTACCGCCGGAATAAACCAG GTAAAGTCAAACTTTGCCAAACTGCCCAATACCGAAGCGCGGGAAGCAACC

    TABLE-US-00010 TABLE 10 N. meningitidis secondary modified LAMP blocked reverse inner primer (5′-3′) with complementary regions of the synthetic template SNP0 (without SNP) and SNPB (with SNP) Blocked Reverse Inner: CCGATGTACCAGCACCTTGTCCGCTGTTTGCGCTGATTAC-CCTC                        ||||||||||||||||||||||||||||||||||||||||||||| SNP0:                  GGCTACATGGTCGTGGAACAGGCGACAAACGCGACTAATGCGGAG SNPB:                  GGCTACATGGTCGTGGAACAGGCGACAAACGCGACTAATGCTGAG Underline, SNP mismatch; -, abasic site

    DISCUSSION

    [0343] Loop-mediated isothermal amplification (LAMP) provides rapid, robust, sensitive and specific, user-friendly, nucleic acid amplification technology for POC infectious disease diagnostics in low-resourced disease burdened areas. However, multiplex pathogen detection and SNP identification using LAMP is difficult to achieve. Nucleic acid diagnostics requires multiplex detection capabilities to facilitate simultaneous multiple-pathogen detection, reduced analysis time, sample conservation and incorporation of internal control validation. SNP identification capabilities in nucleic acid diagnostics enables effective differentiation of closely related pathogens, identification of point-mutations associated with antimicrobial resistance and more effective disease epidemiological surveillance/control. The present invention provides technology for singleplex or multiplex pathogen detection with SNP identification. The invention demonstrates single-target detection and SNP identification using a singleplex modified LAMP assay, with comparison to the previously reported state-of-the-art LAMP technology and evaluation in terms of analytical specificity, sensitivity and clinical application. Modified versions of this assay were subsequently used to demonstrate single-tube wild-type and mutant allele differentiation, and simultaneous multiple-pathogen detection.

    [0344] The singleplex modified LAMP N. meningitidis assay demonstrated earlier detection and increased fluorescence production compared to state-of-the-art LAMP (FIG. 2), highlighting improved assay performance. This result is possibly due to enhanced reaction kinetics resulting from reduced cleavage enzyme present in modified LAMP compared to state-of-the-art LAMP, and increased cleavage activity of Endonuclease IV in modified LAMP, compared to Tth Endonuclease IV in state-of-the-art LAMP. Also, perhaps the 5′-end inner primer state-of-the-art LAMP modifications effect loop structure formation compared to the unmodified inner primers in modified LAMP. The singleplex modified LAMP N. meningitidis assay was 100% analytically specific, as only the inclusivity panel reference strains were detected during specificity testing (Table 1). The LOD of the singleplex modified LAMP N. meningitidis assay was established to be 3.1 genome copies per reaction using Probit analysis (Table 3). Typical LODs for previously reported N. meningitidis LAMP assays range from 6-10 genome copies per reaction. Small scale clinical sample testing of the singleplex modified LAMP N. meningitidis assay, using DNA from N. meningitidis, S. pneumoniae and H. influenzae positive blood and CSF samples, demonstrated 100% diagnostic sensitivity and specificity as only the N. meningitidis samples were detected (Table 5).

    [0345] The invention demonstrates that the previously reported state-of-the-art LAMP technology does not enable single-base specificity as it amplified templates with and without SNPs located in the state-of-the-art LAMP primer/probe target region (FIG. 3B). Presence of a 5′-end SNP in the state-of-the-art LAMP primer/probe target region may inhibit binding during loop formation, preventing abasic site dsDNA formation and inhibiting cleavage, which should subsequently enable SNP identification. Without being bound by theory, it is hypothesised that during Bst polymerisation dissociating the loop structure, extension over the state-of-the-art LAMP primer/probe abasic site occurs, producing dsDNA which enables cleavage and fluorescence production regardless of the presence of a SNP. The present invention successfully demonstrates single-base specificity as none of the SNP containing templates tested, SNP1-6 (Table 6), were detected (FIG. 3A). Without being bound by theory, this single-base specificity in modified LAMP may be due to a combination of reaction temperature with the presence of a SNP inhibiting efficient modified LAMP primer/probe target hybridisation, which prevents cleavage of the abasic site. The demonstration of SNP identification in this study (FIG. 3A) further indicates that nucleotide mismatches located within a specific 6 base region of the modified LAMP primer/probe (Table 7) prevents detection. SNPs located directly outside this 6 base range on the modified LAMP primer/probe were also tested but identified as positive with the LightCycler® 480. However, the resulting amplification curves for these templates indicated low level detection which was easily differentiable from the positive control reactions used.

    [0346] Based on these results, the present invention demonstrates flexible assay design for obtaining SNP identification as targeted nucleotide mismatches can be located anywhere within this 6 base region (Table 7). There is currently no other real-time multiplex isothermal nucleic acid amplification method that offers this type of flexible SNP identification. Further to this, utilising the loop primer for SNP identification enables even greater design flexibility, as once the core inner and outer primer sequences are confirmed, different loop primers can be designed to target various sequences, and SNPs, located in the loop section. SNP identification was demonstrated using synthetic 500 bp DNA gBlocks® Gene Fragments instead of genomic DNA. However, the resulting modified LAMP and state-of-the-art LAMP amplification curves produced with these templates were very similar to resulting N. meningitidis genomic DNA amplification curves (FIG. 3).

    [0347] Modifications were made to the singleplex modified LAMP assay, including addition of a mutant modified LAMP primer/probe (Table 2) to create the allele-specific (AS) modified LAMP assay, and addition of S. pneumoniae and H. influenzae oligonucleotides (Table 2) to create the multiplex modified LAMP assay. The AS modified LAMP assay successfully demonstrated a single-tube reaction that can detect either wild-type or mutant allele templates (FIG. 4). Other LAMP technologies reporting SNP genotyping capabilities require separate reactions to independently detect wild-type or mutant allele templates, increasing reagent and sample specimen costs. The multiplex modified LAMP assay successfully demonstrated the simultaneous detection of N. meningitidis, S. pneumoniae and H. influenzae (FIG. 5) in a single reaction. This result highlights the robustness of modified LAMP in terms of tolerance to co-amplification inhibition which is necessary for multiplex nucleic acid diagnostics in the occurrence of pathogen co-infection. The demonstration of multiplex modified LAMP detection also highlights the potential of this technology for incorporation of internal amplification controls, as with state-of-the-art LAMP. Multiplex modified LAMP was performed at the lower temperature of 65° C., compared to 67° C. in singleplex modified

    [0348] LAMP, as this produced optimal detection of all three bacterial targets while maintaining efficient SNP identification capabilities. The combination of AS modified LAMP and multiplex modified LAMP capabilities highlights the potential for multiplex detection of closely positioned SNPs using a single core LAMP primer set. Previous PCR-based SNP genotyping technologies have been reported for the detection of SNPs clustered together in close proximity. Based on the multiplex capabilities of modified LAMP, the addition of further modified LAMP primer/probes to the AS modified LAMP assay, each targeting different SNPs and labelled with alternative fluorophores, could enable simultaneous detection of multiple closely located SNPs.

    [0349] Various LAMP technologies with SNP and point-mutation genotyping capabilities have been reported. However, these methodologies have limitations compared to the present invention. Most reported methods employ allele-specific forward and reverse inner primers with overlapping 5′-end mismatches to a specific SNP, preventing hybridisation and amplification, and thus enabling differentiation between templates with and without this SNP. This strategy, however, has restrictive assay design as the entire LAMP primer set is based around a single nucleotide location. Also, this approach cannot guarantee complete SNP template amplification suppression, often leading to delayed SNP template detection and the occurrence of false positives or non-specific amplification. Monitoring this method is generally performed using intercalating dyes, which can inhibit LAMP reactions, or real-time turbidimetry. Both monitoring approaches, however, do not facilitate multiplex detection and require extensive optimisation to avoid non-specific amplification. It has been reported that SNP LAMP techniques using allele-specific oligonucleotide hybridisation (LAMP-ASO) and annealing selectivity of allele-specific inner primers with 3′-end or 5′-end mismatches (3′AS-LAMP and 5′AS-LAMP). However, LAMP-ASO is not a single-tube system requiring contamination prone post-amplification processing, and the AS-LAMP methods are prone to false-positive results. Also reported is the use of gold nanoparticles to achieve SNP LAMP. This method, however, is non-isothermal as template denaturing at 95° C. is required, with laborious contamination prone post-amplification processing. Also reported is use of gold nanoparticles to achieve SNP LAMP, however, this method again requires post-amplification analysis.

    [0350] The present invention demonstrates that the inner primers are not suitable for achieving LAMP SNP identification with the state-of-the-art LAMP primer/probe modifications (FIG. 3B). Also, considering the outer primers do not target the unique double-looped LAMP template structure, the loop primers were chosen for development of modified LAMP technology. A small number of LAMP technologies have reported real-time detection and SNP identification capabilities through utilisation of the loop primers. FLOS-LAMP demonstrates real-time LAMP detection using self-quenching and de-quenching fluorogenic loop probes. However, this technology has not demonstrated multiplex target detection, does not enable SNP identification, has a relatively poor LOD of 500 genome copies, and possesses restrictive design limitations requiring guanine or cytosine flanked thymine residues for probe design. PNA-LNA mediated LAMP has demonstrated SNP detection capabilities via an amplification blocking peptide nucleic acid (PNA) clamping probe that targets the loop regions in LAMP. However, this method does not enable multiplex detection and requires post-amplification

    [0351] PCR or gel electrophoresis analysis. LAMP-FLP incorporates a fluorescently labelled loop primer (FLP), and quencher probe (QP), enabling SNP detection by measuring resulting peak temperatures of fluorescence resonance energy transfer (FRET). This method, however, requires increased oligonucleotide primer compared to standard LAMP, and is not fully isothermal as generation of a post-amplification annealing curve from 95° C. to 35° C. is required. It is also reported that a SNP LAMP technique using a similar principle to the SNP overlap allele-specific inner primer methods. This method, however, utilises overlap between the loop and inner primer, and is subject to the same previously mentioned limitations of restrictive assay design and monitoring using intercalating dyes or turbidity.

    [0352] The present invention incorporates all of the previously reported properties of state-of-the-art LAMP technology, in terms of assay specificity, sensitivity and improved multiplex target detection over competing methods. However, the present invention further improves on state-of-the-art LAMP in terms of reaction time-to-positivity and fluorescence production, as well as now incorporating flexible SNP identification capabilities. Additionally, the present invention requires one fifteenth of the cleavage enzyme concentration, and half of the oligonucleotide probe concentration, required by state-of-the-art LAMP. The modified LAMP primer/probe also uses alternate fluorophore and quencher positioning to state-of-the-art LAMP, this has no impact on assay performance but further reduces assay cost in terms of oligonucleotide synthesis. Further reduced assay costs can be achieved by lowering the modified LAMP primer and probe concentrations by half, maintaining comparable detection times and fluorescence production with single-digit genome copy LOD. the present invention is the first report of a single-tube, real-time, multiplex LAMP method with SNP identification capabilities, providing state-of-the-art transferable isothermal nucleic acid amplification technology for POC infectious disease diagnostics.