TOLERANCE TO TOLCNDV IN CUCUMBER

20220279748 · 2022-09-08

Assignee

Inventors

Cpc classification

International classification

Abstract

A Cucumis sativus var. sativus plant tolerant to Tomato Leaf Curl New Delhi Virus (ToLCNDV) includes in its genome the combination of a first quantitative trait locus (QTL) QTL1 on chromosome 1 and a second QTL, QTL2 on chromosome 2, at least one of QTL1 and QTL2 being homozygous, wherein said combination confers to the plant tolerance to ToLCNDV and said QTLs on chromosomes 1 and 2 are present in the genome of the seeds of plant TOCUR6080, NCIMB accession number 43427. The QTL are preferably characterized by defined alleles of different SNPs on chromosomes 1 and 2. Parts of these plants have ToLCNDV tolerance phenotype, as well as progeny, and can be used for introgressing the tolerance in another genetic background, with different methods for obtaining cucumber plants or seeds with increased tolerance to ToLCNDV and different markers linked to the QTLs used to confer tolerance phenotype.

Claims

1. A Cucumis sativus var. sativus plant tolerant to Tomato leaf curl New Delhi virus (ToLCNDV), comprising in its genome the combination of a first quantitative trait locus (QTL) QTL1 on chromosome 1 and a second QTL, QTL2 on chromosome 2, at least one of QTL1 and QTL2 being homozygous, wherein said combination confers to the plant tolerance to ToLCNDV, wherein said QTL1 is located on chromosome 1, within the chromosomal region delimited by CU-0002005 (SEQ ID NO:1) and CU-0001983 (SEQ ID NO:12) and wherein said QTL2 is located on chromosome 2, within the chromosomal region delimited by CU-0000463 (SEQ ID NO:13) and CU-0006479 (SEQ ID NO:27), wherein said plant is a commercial gynoecious cucumber or a monoecious cucumber, with at least 50% of gynoecious flowers.

2. The plant according to claim 1, wherein said plant has less than 3 primary branches.

3. The plant according to claim 1, wherein said QTLs on chromosomes 1 and 2 are present in the genome of the seeds of plant designated TOCUR6080, deposited with NCIMB under accession number 43427.

4. The plant according to claim 1, wherein said plant is a progeny of the plant designated TOCUR6080, seeds thereof have been deposited at the NCIMB, under NCIMB accession number 43427.

5. The plant according to claim 1, comprising a further QTL on chromosome 4 imparting tolerance to ToLCNDV, wherein said QTL is characterized by allele A of SNP markers CU-0000290 (SEQ ID NO:28).

6. The plant according to claim 1 also containing in its genome sequences conferring resistance to Powdery Mildew, or to potyviruses.

7. A cell of the Cucumis sativus var. sativus plant according to claim 1, comprising in its genome said QTL1 on chromosome 1, and said QTL2 on chromosome 2, conferring tolerance to ToLCNDV in cucumber when combined, wherein at least one of the QTL is present homozygously.

8. The cell according to claim 7, wherein said cell is a regenerable cell, or a non regenerable cell.

9. A plant part of the Cucumis sativus var. sativus plant according claim 1, wherein said plant part comprises cells comprising in their genome said QTL1 on chromosome 1, and said QTL2 on chromosome 2, conferring tolerance to ToLCNDV in cucumber when combined, wherein at least one of the QTL is present homozygously.

10. Seed of a Cucumis sativus var. sativus plant, which develops into the plant according to claim 1,

11. A tissue culture of cells of the plant according to claim 1, wherein the cells are derived from embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, stems, petioles, roots, root tips, seeds, flowers, cotyledons, and/or hypocotyls, and contain in their genome said QTL1 on chromosome 1 and said QTL2 on chromosome 2 conferring tolerance to TolCNDV, wherein at least one of said QTLs is present homozygously.

12. (canceled)

13. A method for breeding Cucumis sativus plants having resistance to ToLCNDV, comprising the steps of crossing a plant grown from the deposited seeds NCIMB 43427 or progeny thereof bearing QTL1 and QTL2 conferring when combined ToLCNDV tolerance, with an initial Cucumis sativus plant devoid of said QTLs, wherein said QTL1 on chromosome 1 and QTL2 on chromosome 2 are present in the genome of the seeds of plant designated TOCUR6080, which have been deposited with NCIMB under accession number 43427.

14. The method according to claim 13, comprising the steps of: a) Crossing a plant grown from the deposited seeds NCIMB 43427, or progeny thereof, bearing QTL1 on chromosome 1 and QTL2 on chromosome 2, conferring ToLCNDV resistance, and an initial Cucumis sativus plant preferably devoid of said QTL(s), b) Selecting a plant in the progeny thus obtained, bearing QTL1 and QTL2; c) Optionally self-pollinating one or several times the plant obtained at step b) and selecting in the progeny thus obtained a plant having tolerance to ToLCNDV, wherein said QTLs on chromosomes 1 and 2 are present in the genome of the seeds of plant designated TOCUR6080, which have been deposited with NCIMB under accession number 43427.

15. The method according to claim 13, comprising the steps of: a1) Crossing a plant grown from the deposited seeds NCIMB 43427, or progeny thereof, bearing QTL1 on chromosome 1 and QTL2 on chromosome 2, conferring ToLCNDV tolerance, and an initial Cucumis sativus plant, preferably devoid of said QTL(s), thus generating F1 hybrids, a2) Selfing the F1 hybrids to create F2 population, b) Selecting individuals in the progeny thus obtained having tolerance to ToLCNDV, wherein said QTLs on chromosomes 1 and 2 are present in the genome of the seeds of plant designated TOCUR6080, which have been deposited with NCIMB under accession number 43427.

16. (canceled)

17. A Cucumis sativus plant obtained by the method according to claim 13,

18. The method according to claim 19, said method comprising detection of the following alleles: allele A of CU-0002031 (SEQ ID NO:7), allele A of CU-0000366 (SEQ ID NO:8) or allele A of CU-0000744 (SEQ ID NO:10) on chromosome 1, in combination with allele A of CU-0002682 (SEQ ID NO:17) or allele A of CU-0005012 (SEQ ID NO:18) on chromosome 2, in a genetic material sample of the plant to be selected.

19. A method for selecting cucumber plants having two QTLs, conferring tolerance to ToLCNDV when combined, said method comprising: a) Assaying cucumber plants for the presence of at least two genetic markers, genetically linked to 2 QTLs conferring when combined tolerance to ToLCNDV in cucumber, b) Selecting a plant comprising the genetic markers and the QTLs conferring tolerance to ToLCNDV, wherein the QTLs and the genetic markers are to be found in the chromosomal region delimited on chromosome 1 by CU-0002005 (SEQ ID NO:1) and CU-0001983 (SEQ ID NO:12) and in the chromosomal region delimited on chromosome 2 by CU-0000463 (SEQ ID NO:13) and CU-0006479 (SEQ ID NO:27).

20. The method according to claim 19, wherein the QTL conferring resistance to ToLCNDV in cucumber is as found in the genome of the seeds of plant designated TOCUR6080 (NCIMB accession number 43427).

21.-22. (canceled)

23. A method for reducing the loss on cucumber production in condition of ToLCNDV infestation, comprising growing the cucumber plant according to claim 1.

24.-26. (canceled)

Description

LEGEND OF FIGURES

[0205] FIG. 1 illustrates the distribution of the level of ToLCNDV resistance/tolerance of F2 plants from the cross CUC29 x CUC01, at two different times (1Ev at 6 weeks DPI and 2Ev at 8 weeks DPI) as well as the evolution of the symptoms (AUDPC: area under the disease progress curve to quantify disease progress).

[0206] R stands for resistant or tolerant, S for susceptible. N is the number of plants.

[0207] FIG. 2 is the Manhattan plot showing mapping results of F2 population. Vertical axis (y-axis) shows the −log 10 of p-value and horizontal axis (x-axis) represents all SNPs by their positions by chromosomes along the genetic map and 7 chromosomes of cucumber.

[0208] FIG. 3 illustrates correlation between QTL and tolerance (each QTL separately), on the basis of the allele of one SNP for each QTL, namely CU-0000744 for QTL1 and CU-0005012 for QTL2.

[0209] FIG. 4 illustrates correlation of both QTLs combination to the ToLCNDV tolerance, on the basis of the alleles of one SNP for each QTL, namely CU-0000744 for QTL1 and CU-0005012 for QTL2.

[0210] FIG. 5 illustrates the proportion of androecious v. gynoecious sex expression in the F2 of CUC01 x CUC29.

[0211] FIG. 6 illustrates the proportion of androecious v. gynoecious sex expression in the BC1F3 of CUC01 x CUC29

EXAMPLES

Example 1

Adjusting Phenotyping Protocol and Screening for Resistant Plants

[0212] During Fall 2015, a trial was conducted, aiming to find ToLCNDV resistance leads in cucumber.

[0213] After screening for potential leads, 34 genotypes were selected (5 commercial varieties, 2 Long European Type breeding lines that were observed in recent years during the breeding program and 27 landraces). Additional 2 commercial hybrids were tested as susceptible controls (according to previous observation at the breeding program).

[0214] The trial was infected by whiteflies Bemisia tabaci (at least 50 females/leaf/plant), on September 6.sup.th-September 8.sup.th. All whiteflies acquired ToLCNDV from infected and symptomatic squash plants. The inoculation process was as follows:

[0215] Squash plants with whiteflies and ToLCNDV symptoms were used as a source of inoculum.

[0216] Presence of ToLCNDV and absence of CYSDV and CVYV were verified.

[0217] 20 plants of squash were grown and exposed to the infected plants as described before, for 6 weeks, inside an insect proof cage.

[0218] The plants of the cucumber genotype trial were then sown separately, and after 14 days were put together, in the cage with the infected squash plants.

[0219] Each plant of the trial has 20-50 adult whiteflies for 48-72 hours. The Bemisia tabaci were removed using pesticides.

[0220] The plants of the trial were then transplanted on September 9.sup.th in the greenhouse.

[0221] Evaluation was made 6 weeks post infection, on November 22.sup.nd.

[0222] The selected genotypes were:

TABLE-US-00001 Internal code Botanical species CUC01 C. sativus CUC02 C. sativus CUC03 C. sativus CUC04 C. sativus CUC05 C. sativus CUC06 C. sativus CUC07 C. sativus CUC09 C. sativus CUC10 C. sativus CUC11 C. sativus CUC12 C. sativus CUC13 C. sativus CUC14 C. sativus CUC15 C. sativus CUC16 C. sativus CUC17 C. sativus CUC18 C. sativus CUC19 C. sativus CUC20 C. sativus var. hardwickii CUC21 CUC22 C. sativus CUC23 C. sativus CUC24 C. sativus CUC25 C. sativus CUC26 C. sativus CUC27 C. sativus CUC28 C. sativus CUC29 C. sativus CUC30 C. sativus CUC31 C. sativus CUC32 C. sativus CUC34 C. sativus var. hardwickii SAT01 C. sativus SAT02 C. sativus

[0223] The plants corresponding to the genotype SAT01 did not germinate and genotype SAT02 had bad germination. For that reason, the infection quality is not certain for SAT02 at the time of infection.

[0224] The trial was designed as a complete block design (4 blocks) where each block contains 3-5 plants of each genotype (15-20 plants per accession).

[0225] The phenotypic evaluation was done according to four disease index:

[0226] 1—very susceptible

[0227] 2—susceptible

[0228] 3—Intermediate (minor disease symptoms)

[0229] 4—resistant (No disease symptoms)

TABLE-US-00002 Phenotype Total plant Accession 1 (S) 2 (I-S) 3 (I-R) 4 (R) number CUC01 20 0 0 0 20 CUC02 1 0 16 1 18 CUC03 7 9 2 0 18 CUC04 12 6 0 0 18 CUC05 6 11 0 0 17 CUC06 11 7 0 0 18 CUC07 5 5 0 0 10 CUC09 14 4 0 0 18 CUC10 9 10 0 0 19 CUC11 11 6 2 0 19 CUC12 19 0 0 0 19 CUC13 9 5 0 0 14 CUC14 19 0 0 0 19 CUC15 14 4 0 0 18 CUC16 9 6 0 0 15 CUC17 0 0 0 0 0 CUC18 0 4 1 0 5 CUC19 10 10 0 0 20 CUC20 11 8 0 0 19 CUC21 0 1 1 15 17 CUC22 1 0 0 4 5 CUC23 15 3 0 0 18 CUC24 7 6 1 2 16 CUC25 1 1 3 12 17 CUC26 6 4 3 6 19 CUC27 1 2 3 9 15 CUC28 0 8 6 3 17 CUC29 0 0 1 17 18 CUC30 4 8 0 0 12 CUC31 10 2 0 0 12 CUC32 13 4 0 0 17 CUC34 4 6 0 2 12 SAT01 0 0 0 0 0 SAT02 0 0 0 18 18

[0230] Further to this trial, seven leads were found, namely CUC21, CUC25, CUC26, CUC27, CUC28, CUC29 and SAT02. No tested commercial varieties were observed as really resistant.

[0231] CUC21: 15/17 plants were observed resistant. This line has however many necrotic effects that makes it difficult to be used in breeding program.

[0232] SAT02: 18/18 plants were observed resistant; this line had however bad germination, which may have biased the resistance results.

[0233] Out of the 5 remaining leads, CUC29, with 17/18 resistant plants, was chosen for further work. Moreover, all the other leads (except CUC29) are segregating and need to be selected and fixed before any further work. CUC29 seems to be fixed for resistance and was thus also chosen for this further reason.

[0234] When plants were evaluated 10 weeks post infection (i.e. 4 weeks after the first evaluation), the general findings were: [0235] The susceptible lines continue to express symptoms, [0236] the plants expressing intermediate symptoms (level 3) turned to be symptomless (level 4).

[0237] CUC29 (Landrace) was thus confirmed as the more resistant lines; in order to confirm that the tolerance found in CUC02 and in CUC29 was different in nature, a comparison of both genotypes was carried out (see example 3).

Example 2

Creation of a F2 Mapping Population Derived from CUC29 x CUC01

[0238] An F2 mapping population with CUC01 as susceptible parent were created, namely CUC29 (R parent) * CUC01 (S Parent).

[0239] In order to have a more accurate phenotyping data, the mapping population was phenotyped using 5 levels (1=very susceptible, 3=susceptible, 5=intermediate resistant (IR), 7=more resistant than IR but not resistant, 9=resistant).

[0240] The phenotypic results on the F2 CUC29 x CUC01 are illustrated on FIG. 1. Two different evaluations of the phenotype were carried out, 6 weeks after infection (1.sup.st evaluation), and 8 weeks after infection (2.sup.nd evaluation). The disease progress is then evaluated on the basis of these two evaluations. For comparison, for the susceptible parent, the mean of the 1.sup.st evaluation was 5.1; the mean for the 2.sup.nd evaluation was 4.8 and the mean of the AUDPC was 54.4 (Standard deviation of 13.8), which means that, naturally, more than 40% of the CUC01 susceptible parent show Intermediate resistance/tolerance, under these conditions.

[0241] Finally, with a view to comparing CUC02 and CUC29, an equivalent F2 mapping population was also created with CUC02 x CUC01 (see example 3).

Example 3

QTL Analysis on the F2 Mapping Population Derived from CUC29 x CUC01

[0242] A complete QTL analysis was carried out with available SNPs.

[0243] A first selection was carried out among the potential SNPs on the basis of their allelic variations between CUC29 and CUC01. The F2 mapping population was finally screened with a set of 27 SNPs, covering all the chromosomes, having the better −log.sub.10(p-value) or the better R.sup.2 value.

[0244] The SNP markers detection is performed using the KASPar™ technology. KASPar™ primers were designed using PrimerPicker™ tool in KLIMS™ (KBioscience Laboratory Management System) by providing DNA sequences with SNPs. Three primers, A1 (Allele specific primer 1), A2 (Allele specific primer 2), and C (common reverse primer) were designed for each SNP sequence based on KASPar™ chemistry. DNA strand and allele designation and orientation is done according to the TOP/BOT method developed by Illumina: https://www. illumina.com/documents/products/technotes/technote_topbot.pdf.

[0245] The results of the QTL analysis are illustrated on FIG. 2.

[0246] The genotypic analysis revealed 2 QTLs linked to the tolerance:

[0247] The QTL interval on chromosome 1 is between CU-0002005 (pos. 20,879,343) to CU-0006168 (pos. 22,663,842), LOD 3.51

[0248] The QTL interval on chromosome 2 is between CU-0000463 (pos. 15,987,817) to CU-0002276 (pos. 16,649,407), LOD 3.02

[0249] A third QTL with minor effect was also detected on chromosome 4, at the locus of SNP CU-0000290, positioned on chromosome 4: 11,511,634, sequence:

TABLE-US-00003 (SEQ ID NO: 28) TTGGGAATGCAAAACACATCATCGATAACATGTAAGTTTGAAAGTATGAA ATGTAACCTTCCCCCTACAGATTGCTGCTTAGCTCCATGCATATAGAGTC [custom-character /G]TCAGTAAACTATATTATACACTCTTTAAGAGTTGCTGCTTCTAGG CAAACCTTTTGATTGTCTCTATACCCAYCTCTTTTGTCAACAAGGGAACA CTTAT.

[0250] The allele linked to the tolerance is underlined (allele A).

[0251] The sequences of the SNPs on chromosomes 1 and 2, including the surrounding sequences, and the position in the cucumber genome (genome v2.0, Chinese Long IL 9930, available at http://cucurbitgenomics.org/organism/2, based on Huang et al, 2009, and Li et al, 2011) are given in tables 3 and 4 for chromosomes 1 and 2 respectively. Table 5 gives the results of the QTL analysis, namely the value of −Log 10(Prob>F) and R.sup.2 values. The −log.sub.10(p-value) parameter is indeed an indication of the correlation to the tolerance phenotype (highest values are indicative of a highest correlation) and the R.sup.2 value is an indication of the effect of the marker on the phenotype of tolerance to the disease.

[0252] A comparison of the F2 mapping population CUC29 x CUC01 and CUC02 x CUC01 reveals that CUC02 does not comprise the QTL on chromosomes 1 and 2 as described above, especially there is no position on chromosome 2 which is associated with tolerance in F2 mapping population of CUC02.

Example 4

QTL Validation

[0253] A new F1 population was made using CUC01 x CUC29, Marker-assisted selection (MAS) was done to choose the F1s with the QTL intervals. The relevant F1 were crossed with CUC01 to get BC1F1, MAS was done on the BC1F1 to choose the ones with the QTL intervals. The BC1F1 were selfed to obtain BC1F2, MAS was done on the BC1F2 to choose the ones with the QTL intervals to get BC1F3. Table 5 gives the results of the QTL analysis, namely the value of −Log 10(Prob>F) and R.sup.2 values for the thus obtained BC1F3.

[0254] Given the marker-assisted selection made at the BC1 F1 level, and the high number of plants in the BC1F3 population, the p-values and R.sup.2 data obtained with this F3 population allow a better definition of the QTLs. The analysis based on this BC1F3 population indeed revealed 2 QTLs linked to the tolerance:

[0255] The QTL interval on chromosome 1 is between CU-0002005 (pos. 20,879,343) to CU-0001983 (pos. 23,366,713).

[0256] The QTL interval on chromosome 2 is between CU-0000463 (pos. 15,987,817) to CU-0006479 (pos. 17,291,444).

[0257] The results with the BC1 F3 also confirm the QTL on chromosome 4, around the SNP CU-0000290 at position 11,511,634.

[0258] The correlation between the QTL and the phenotype of tolerance or resistance is illustrated in FIG. 3, for each QTL independently, and in FIG. 4 for both QTLs in combination.

[0259] Seeds corresponding to the BC1 F3 were selected on the basis of the homozygous presence of both QTLs and of the QTL on chromosome 4, for seed deposit at the NCIMB under accession number 43427 on Jun. 24, 2019.

Example 5

Androecious/Gynoecious Sex Expression

[0260] CUC29 shows androecious sex expression. By doing 2 backcrosses, it is however possible to change the sex expression of a resistant material from androecious to gynoecious. The inventors have illustrated this change through backcrosses with the line CUC01, not having an androecious sex expression.

[0261] FIG. 5 illustrates the androecious/gynoecious sex expression in the F2 of CUC01 x CUC29. The androecious/gynoecious sex expression is measured by the respective number of female and male flowers.

[0262] The same analysis has been carried out on the BC1F3 of CUC01 x CUC29; comprising one additional backcross with respect to the F2 of CUC01 x CUC29, and the results are illustrated on FIG. 6. As can be observed, the androecious sex expression of the CUC29 parent has been totally changed to a gynoecious sex expression through the two backcrosses.

Example 6

Genetic Modification of Cucumber Seeds by Ethyl Methane Sulfonate (EMS)

[0263] Seeds of a cucumber varieties are to be treated with EMS by submergence of approximately 2000 seeds per variety into an aerated solution of either 0.5% (w/v) or 0.7% EMS for 24 hours at room temperature.

[0264] Approximately 1500 treated seeds per variety per EMS dose are germinated and the resulting plants are grown, preferably in a greenhouse, to produce seeds.

[0265] Following maturation, M2 seeds are harvested and bulked in one pool per variety per treatment. The resulting pools of M2 seeds are used as starting material to identify the individual M2 seeds and the plants with a tolerance to Tomato Leaf curl New Delhi virus.

TABLE-US-00004 TABLE 3 SNPs present in the QTL on chromosome 1. The polymorphism is indicated within brackets. The allele representative of the presence of the QTL is underlined in the bracket and reported in the last column (Tolerance T allele). The position is with respect to the cucumber genome as published: genome v2.0, Chinese Long IL 9930, available at http://cucurbitgenomics.orgiorganism/2 (based on Huang et al, 2009 and Li et al, 2011). SEQ T SNP_id Position SEQ (TOP) ID allele CU- 20879343 CATGTCTGTCCAAACAACAAAACAGAGAAGCTCAC[custom-character /G]AAGTATAGATAATTAAACAAAGTTTGTTCTCTAAG 1 A 0002005 CU- 20885446 TTACTTTTTGGCTTCAAATTGGTTTGGGGTTGAGA[A/custom-character ]CTTTGAATTTCTGTGGCAGTGGGGTGTTAGTGTGT 2 G 0000824 CU- 20926977 CTGATGAAGCATAAAGAATGAGTTACACTTCAGCG[custom-character /C]IITATTACACTAAGAAAATAGTTAAACTTCAAGTCC 3 A 0001679 CU- 20933874 TAGTTATCAATTGGAAGGAACTTGGCGTATCGCTC[A/custom-character ]GCCTTCGCTCCTGATTTGTGTTCATAATATTCAAC 4 G 0000195 CU- 21060207 TGGATCATCGTCTTTGGTTGTTGCTGGAGGTGGTC[custom-character /G]FATTGGTGTGATGGTTGCATTGTTAGGGATGTTTG 5 A 0000697 CU- 21068285 TTGTTCATAGTCTTTACAACACATTAGAAGAAGAA[A/custom-character ]ITAAGGCAAGCTTCTAAGAAAGACAAAAGGAAGCT 6 G 0000649 CU- 21144782 TCTATAATTCCATACACACCAGGTGATGCTAAACC[custom-character /G]GTTGCCGCGCTCATTAATAGGTTTCTAGGCTTTCC 7 A 0002031 CU- 22019793 CTAAATGTGTAACATGTTGAAACCTAGGACAAACT[custom-character /G]GGCTTGTAGGTAGACACGGAATTAGGTTTTTTCTT 8 A 0000366 Cu- 22180220 ATTCCCAGCATCATACACGTAGAACTGACTCGCTA[custom-character /C]ATAAGAACACATTCTCAAGATGTGCTTTCAATAGG 9 A 0000554 Cu- 22190343 CTACCATTTATAGAGTTTATAGTCGTAGAATGAAT[custom-character /G]TGATCCATTGTCGCACCTTCAAATTGAATGCTCTT 10 A 0000744 Cu- 22663842 GTAGCTGTGGAGAAGGAGCAATGGTCAAGGAAAGT[A/custom-character ]AAGGCGATGGGAACCTGAGACGGTGGTGAATGCGA 11 G 0006168 Cu- 23366713 TCATTATAAGCTATGTTCGACTCGCAGGAGGCTTC[A/custom-character ]CATGCATACACAACAATTGTGGCCCAATCGAGCGA 12 G 0001983

TABLE-US-00005 TABLE 4 SNPs present in the QTL on chromosome 2. The polymorphism is indicated within brackets. The allele representative of the presence of the QTL is underlined in the bracket and reported in the last column (tolerance T allele).The position is with respect to the cucumber genome as published: genome v2.0, Chinese Long IL 9930, available at http://cucurbitgenomics.orgiorganism/2 (based on Huang et al, 2009 and Li et al, 2011). SEQ T SNP_id Position SEQ (TOP) ID allele CU- 15987817 GGAACAAAATATGTGGGGGCAAAAGTAATTCCAAG[custom-character /G]CAAAAACAGCCAATACACCCAAACCAAAAATTATC 13 A 0000463 CU- 16084617 GTGAGGGTATAGATCTTTCTGAGGCATAGAACAAC[custom-character /G]TTTTTCTGGCAGTACATATTGCTTGTTAATGAAAT 14 A 0001997 CU- 16163059 TTGATTTATTTATTTCTTTTTGAAGTTGTGTTAGA[custom-character /G]GGAAAAGGTAAGAGGGTAGGGATAATGGTTTTCAG 15 A 0001204 Cu- 16214529 TGTGTATTGAGTAGCGAATAAGGGAAGGAGGATTT[custom-character /G]GGGGAAGAGAGAAAGGTGAGAGAATAAGGGAAGAA 16 A 0003652 Cu- 16222398 GAAAAGCCAGTTGGACGGCGGGGTGGAGGTTGGTC[custom-character /G]TCGTACTTGCGCTTGTTGGAAGGAGTATCAGTAGC 17 A 0002682 Cu- 16456658 CTCTTCTTCAATGCTAAATACTTCTGGGAAAACCA[custom-character /G]GTGTGAATCAACTGGTGAAGGGTCCGATTCGGTGT 18 A 0005012 Cu- 16463342 CTTACAGTGCTGCTGTTAAACTTCGGACTTGTGAG[custom-character /G]TATAAGATTAACGCGTGAACGCTTGGGTCAAACTC 19 A 0001371 Cu- 16649407 TCTGTTACATGATTTGTACATGGCCAGAAGAGGAG[custom-character /G]GTCTTTGATAGCTGTGAGAGAAAAATACAAGCTAC 20 A 0002276 Cu- 16903104 AAAACTTCTAAACATGAGAGTATAATATTTAAAGT[A/custom-character ]GTGCATGTAAACTGAAAGTGTTAATGACATTATGA 21 C 0001479 Cu- 16917180 TCTAGATCGACTGCACCATCTCCATCTTTGTCAGC[custom-character /G]AAGCAACACCATAGTGAGCTTTCTGAAACGACATC 22 A 0006476 Cu- 17000884 TAAGGTTACACACAAATACACATATAGTTTTGCTT[C/custom-character ]GAAAAGCTTTTGGTCATCCTTAGGAAGTTCCTAAA 23 G 0003181 Cu- 17004020 GCTTGTCTAATAACAAACTGATCAACAATTTTAAC[custom-character /G]GTGTGCACCGGATCTTGATGTGGTGCAGCCGCCTT 24 A 0001663 Cu- 17050659 TTCACAAACATGGTGGCTTATTATCTGATTCAGGG[custom-character /C]GTGCTCTTGGGCGATTTCATTTTGATAAGATGAGA 25 A 0001531 Cu- 17203182 CAAAATCTTGAACAATCGAAAGCTTCTTCATCAAC[custom-character /C]TCTTCGCACGCAACTTCTTCATCTTCTCTTCTTCT 26 C 0001495 Cu- 17291444 ATCCCGAAACCAAAACGATGCGTAGAACAAAAGCA[custom-character /A]CGCTAGAAGGATCGAGCCACCCGTATCAATGCATG 27 G 0006479

TABLE-US-00006 TABLE 5 Results of the QTL analysis on the F2 population and the BC1F3. The T allele is the allele representative of the presence of the tolerance QTL and S allele is the allele representative of susceptible sequences. T S SNP_id Chromosome F2{−Log.sub.10(Prob > F)} F2(R.sup.2) BC1F3{−Log.sub.10(Prob > F)} BC1F3(R.sup.2) allele allele CU-0002005 1 1.56 0.15 6.56 0.38 A G CU-0000824 1 1.56 0.15 6.56 0.38 G A CU-0001679 1 0.12 0.01 A C CU-0000195 1 1.62 0.15 6.95 0.40 G A CU-0000697 1 1.67 0.09 A G CU-0000649 1 1.67 0.09 7.39 0.42 G A CU-0002031 1 1.12 0.13 A G CU-0000366 1 1.54 0.08 A G CU-0000554 1 1.18 0.12 A G CU-0000744 1 1.67 0.12 7.94 0.44 A G CU-0006168 1 3.02 0.12 6.27 0.37 G A CU-0001983 1 2.26 0.11 5.67 0.34 G A CU-0000463 2 1.44 0.06 A G CU-0001997 2 0.62 0.06 6.14 0.36 A G CU-0001204 2 0.60 0.07 6.14 0.36 A G CU-0003652 2 0.67 0.07 6.14 0.36 A G CU-0002682 2 0.67 0.07 6.14 0.36 A G CU-0005012 2 2.12 0.07 6.00 0.35 A G CU-0001371 2 1.96 0.07 6.00 0.35 A G CU-0002276 2 2.76 0.08 6.00 0.35 A G CU-0001479 2 1.79 0.08 5.37 0.32 C A CU-0006476 2 2.67 0.05 A G CU-0003181 2 2.28 0.05 G C CU-0001663 2 2.28 0.05 A G CU-0001531 2 1.23 0.08 4.93 0.30 A C CU-0001495 2 1.64 0.07 C A CU-0006479 2 1.65 0.07 G A

REFERENCES

[0266] Huang et al. 2009. The genome of the cucumber, Cucumis sativus L. Nat Genet. 2009 December; 41(12):1275-81. [0267] Chang et al, 2010. Identification and characterization of a mechanical transmissible begomovirus causing leaf curl on oriental melon. European Journal of Plant Pathology 127(2):219-228. [0268] Tiwari et al, 2012. Molecular detection and identification of Tomato leaf curl New Delhi virus isolate causing yellow mosaic disease in Bitter gourd (Momordica charantia), a medicinally important plant in India. Medicinal Plants, 2(2). 117-123. [0269] Gao et al. 2016. DNA-guided genome editing using the Natronobacterium gregoryi Argonaute. Nature Biotechnology volume 34, pages 768-773. [0270] Islam, S. et al. 2011. Screening of Luffa cylindrica Roem against tomato leaf curl New Delhi virus, inheritance of resistance and identification of SRAP markers linked to resistance gene. Journal of Horticulture Science and Biotechnology 86(6):661-667. [0271] Kirkbride, J. H., Jr. 1993. Biosystematic monograph of the genus Cucumis (Cucurbitaceae). 84. [0272] Li, Z. et al. 2011. RNA-Seq improves annotation of protein-coding genes in the cucumber genome. BMC Genomics 12:540. [0273] Lopez, C. et al. 2015. Mechanical transmission of Tomato leaf curl New Delhi virus to cucurbit germplasm: selection of tolerance sources in Cucumis melo. Eupphytica 204:679-691. [0274] Ranjan et al 2015. Evaluation of cucumber (Cucumis sativus) germplasm for agronomic traits and disease resistance and estimation of genetic variability. Indian Journal of Agricultural Sciences 85(2):234-9. [0275] Ruiz et al 2015. First Report of Tomato leaf curl New Delhi virus Infecting Tomato in Spain. The American Phytopathological Society. Vol. 99, No. 6, p.894. [0276] Saeed M. et al. 2007. A monopartite begomovirus-associated DNA beta satellite substitutes for the DNA B of a bipartite begomovirus to permit systemic infection. J Gen Virol. 88(Pt 10):2881-9.