Fluorogen-binding RNA aptamers
11434490 · 2022-09-06
Assignee
- Centre National De La Recherche (Paris, FR)
- Scientifique Université De Strasbourg (Strasbourg, FR)
- Simon Fraser University (Burnaby, British Columbia, CA)
- The United States Of America, As Represented By The Secretary, Department Of Health And Human Services (Rockville, MD)
Inventors
- Michael Ryckelynck (Strasbourg, FR)
- Alexis Autour (Strasbourg, FR)
- Peter Unrau (North Vancouver, CA)
- Elena Dolgosheina (Vancouver, CA)
- Sunny Chiu Yuk Jeng (Vancouver, CA)
- Shanker Shyam Sundhar Panchapakesan (North Madavilagam, IN)
- Amir Abdolahzadeh (Maple Ridge, CA)
- Razvan Cojocaru (Port Coquitlam, CA)
- Adrian Ferré D'Amaré (Rockville, MD, US)
- Robert Trachman (Rockville, MD, US)
Cpc classification
International classification
Abstract
RNA aptamers are disclosed with distinct fluorescent properties, fluorophore binding affinities, and salt dependence. Also disclosed are corresponding fluorophores, with selected fluorophores evidencing high cellular permeability. The aptamer's high fluorophore affinities, the high brightness of the bound complexes, and their thermal and salt stability, provide distinct aspects of the disclosed aptamers.
Claims
1. A RNA aptamer comprising an active core sequence as set forth in: TABLE-US-00026 (SEQ ID NO: 2) 5′- GG@(T.sub.1/WGW)GG(#.sub.1H/WG)WGGN@(#.sub.2/-)G(T.sub.2/H)GNH (AN@T.sub.3/G)-3′ with the proviso that the active core sequence is not the sequence as set forth in SEQ ID NO: 1: GAAGGGACGGUGCGGAGAGGAGA wherein, within the active core sequence: represents no nucleotide (gap); K represents U or G; S represents C or G; R represents A or G; W represents A or U; H represents A, C or U; N represents A, C, G or U; and @ represents N or a deletion; and wherein T.sub.1 represents any nucleotide, T.sub.2 and T.sub.3 being defined as follows: when T.sub.1 is A, T.sub.2 can be either A, G or U; and when T.sub.1 is A and T.sub.2 is A, then T.sub.3 is U; when T.sub.1 is A and T.sub.2 is G, then T.sub.3 is U; and when T.sub.1 is A and T.sub.2 is U, then T.sub.3 is A or U; or when T.sub.1 is C, T.sub.2 can be either G or U; and when T.sub.1 is C and T.sub.2 is G, then T.sub.3 is C or G; and when T.sub.1 is C and T.sub.2 is U, then T.sub.3 is G; or when T.sub.1 is G, T.sub.2 can be either G or C, and T.sub.3 is C; or when T.sub.1 is U, T.sub.2 can be either A or C; and when T.sub.1 is U and T.sub.2 is A, then T.sub.3 is A or U; and when T.sub.1 is U and T.sub.2 is C, then T.sub.3 is A; wherein #.sub.1 and #.sub.2 represents any nucleotide pair such that when #.sub.1 is A, then #.sub.2 represents A, C, G or U; or when #.sub.1 is C, then #.sub.2 is C; or when #.sub.1 is G, then #.sub.2 is G; or when #.sub.1 is U, then #.sub.2 represents A, G or U; wherein the aptamer adopts a determined tridimensional conformation which is a fluorophore binding conformation, said aptamer when it adopts the fluorophore binding conformation being liable interact with a fluorophore; wherein the aptamer further comprises, contiguous with the active core sequence, a 5′ leader sequence attached, or operably linked to (by covalent bound, i.e. phosphodiester bound), to the 5′ terminus of the active core and a 3′ tail sequence attached, or operably linked to (by covalent bridge mentioned below), to the 3′ terminus of the active core, and wherein the 5′ leader sequence and the 3′ tail sequence together mediate the juxtaposition of the 5′ terminus of the active core and the 3′ terminus of the active core when the aptamer is the fluorophore binding conformation.
2. The aptamer according to claim 1, wherein said aptamer can interact with a fluorophore, said fluorophore being selected from group consisting of the following compounds of the following Formula I and Formula II: ##STR00014## wherein: X represents O, S, Se, or C(CH.sub.3).sub.n; R.sub.1 represents an alkyl having from 1-6 carbons; R.sub.2 represents an alkyl having from 1-6 carbons; R.sub.3 is either a fused benzene, an alkyl having 1-6 carbons, a methoxy or H; R.sub.4 is an alkyl having 1-6 carbons, a methoxy or H; and n=zero or an integer from 1-6; ##STR00015## wherein: R.sub.1 represents any substituent; R.sub.2 through R.sub.5 represent H, F, Cl, Br, I, CH.sub.3, linear polymers, or extended heterocycles R.sub.6-R.sub.9 represent H, F, Cl, Br, I, CH.sub.3, linear polymers, or extended heterocycles R.sub.10 represents H, F, Cl, Br, I, CH.sub.3, linear polymers, or extended heterocycles, R.sub.11 through R.sub.12 represent H, F, Cl, Br, I, CH.sub.3, linear polymers, or extended heterocycles X represents the following atoms O, S and Se; and n is 1 or 3 or 5.
3. The aptamer according to claim 1, wherein the core active sequence comprises the following sequence: TABLE-US-00027 (SEQ ID NO: 5) 5′-$.sub.1GGNT.sub.1GG#.sub.1HUGGHA#.sub.2GT.sub.2GNHAN@T.sub.3$.sub.2-3′ wherein: H represents A, C or U N represents A, C, G or U @ represents any nucleotide or no nucleotide #.sub.1 and #.sub.2 represents any nucleotide pair such that when #.sub.1 is A, then #.sub.2 represents A, C, G or U; or when #.sub.1 is C, then #.sub.2 is C; or When #.sub.1 is G, then #.sub.2 is G; or when #.sub.1 is U, then #.sub.2 represents A, G or U, $.sub.1 and $.sub.2 represent any pair of nucleotides such that when $.sub.1 is A, then $.sub.2 is A, G or U; or when $.sub.1 is C, then $.sub.2 is A, G or U; or when $.sub.1 is G, then $.sub.2 is A, C, G or U; or when $.sub.1 is U, then $.sub.2 is A, G.
4. The RNA aptamer according to claim 1, wherein the core active sequence comprises the following sequence: TABLE-US-00028 (SEQ ID NO: 6) GG@WGWGGWGWGGN@GHGGHG wherein: W represents A or U; H represents A, C or U; N represents A, C, G or U; and @ represents N or a no nucleotide.
5. The RNA aptamer according to claim 1, wherein the core active sequence comprises the following sequence: TABLE-US-00029 (SEQ ID NO: 7) GAA(GG).sub.1AA(GG).sub.2NUU(GG).sub.3UAN′G.sub.4iUG.sub.4iiGUAUAUUC wherein: N is any nucleotide, N′ the anti-watson crick partner to N wherein (GG).sub.1, (GG).sub.2, (GG).sub.3 and G.sub.4i and G.sub.4ii form a quadruplex structure when the active core is in the fluorophore binding conformation, with the 5′ terminus of the active core being juxtaposed to the 3′ terminus of the active core.
6. The RNA aptamer according to claim 1, wherein the core active sequence comprises the following sequence: TABLE-US-00030 (SEQ ID NO: 8) [G/C]NR(GG).sub.1[R/D]AG[A/U](GG).sub.2NGN(GG).sub.3A*[A/U/D]GA* (GG).sub.4[A/C]R[A/D] wherein: A* is A or N, N is any nucleotide R is a purine, D denotes the absence of nucleotide, wherein (GG).sub.1, (GG).sub.2, (GG).sub.3 and (GG).sub.4 form a quadruplex structure when the active core is in the fluorophore binding conformation, with the 5′ terminus of the active core being juxtaposed to the 3′ terminus of the active core.
7. The RNA aptamer according to claim 1, wherein the core active sequences comprises one of the sequences as set forth in SEQ ID NO: 7 to SEQ ID NO: 6887.
8. The RNA aptamer comprising a core active sequence as defined in claim 1, with the proviso that said aptamer active core does not have the core sequence: GNR(GG).sub.1GNN(GG).sub.2NGN(GG).sub.3AGN(GG).sub.4AGA SEQ ID NO: 6888, wherein R is a purine, and N is any nucleotide.
9. The RNA aptamer according to claim 1, wherein the 5′ leader sequence and the 3′ tail sequence are complementary, so that binding of the 5′ leader sequence to the 3′ tail sequence mediates the juxtaposition of the 5′ terminus of the active core and the 3′ terminus of the active core when the aptamer is the fluorophore binding conformation.
10. The RNA aptamer according to claim 1, wherein the 5′ leader sequence and the 3′ tail sequence are complementary to a target sequence, the target sequence comprising: a leader bait sequence that is complementary to the 3′ tail sequence of the aptamer; and, a tail bait sequence that is complementary to the 5′ leader sequence of the aptamer; the leader and tail bait sequences being juxtaposed in the target sequence, so that binding of: the 5′ leader sequence to the tail bait sequence; combined with, binding of the 3′ tail sequence to the leader bait sequence; mediates the juxtaposition of the 5′ terminus of the active core and the 3′ terminus of the active core when the aptamer is the fluorophore binding conformation.
11. The RNA aptamer according to claim 1, wherein the leader and tail bait sequences being contiguous in the target sequence.
12. The RNA aptamer according to claim 1, wherein juxtaposition of the 5′ terminus of the active core and the 3′ terminus of the active core when the aptamer is the fluorophore binding conformation brings a phosphate group from the 5′ terminus to within 10 Å, or to within 9 Å or to within 8 Å, of a phosphate group from the 3′ terminus.
13. The RNA aptamer according to claim 1, wherein the aptamer has a fluorophore binding affinity of at least 400 nM, 300 nM, 200 nM, 100 nM, 50 nM, 40 nM, 30 nM, 20 nM, 10 nM, 5 nM, 1 nM or 0.5 nM when the core is in a fluorophore binding conformation.
14. The RNA aptamer according to claim 1, wherein the fluorophore-aptamer complex has a brightness of at least 7,000 M.sup.1 cm.sup.−1, 8,000 M.sup.−1cm.sup.−1, 9,000 M.sup.−1cm.sup.−1, 10,000 M.sup.−1 cm.sup.−1, 43,000 M.sup.−1cm.sup.−1.
15. The RNA aptamer according to claim 1, wherein the fluorophore-aptamer complex has a fluorescent lifetime of at least 1 ns, or at least 2 ns, or at least 3 ns, or at least 4 ns or at least 5 ns, or at least 6 ns, or in the range of 1-6 ns.
16. The RNA aptamer according to claim 1, wherein the fluorophore-aptamer complex is fluorescent in a formaldehyde solution.
17. The RNA aptamer according to claim 1, wherein the secondary aptamer sequence has affinity for a secondary target moiety.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11) TABLE-US-00013 TABLE 1 Hill coefficients of RNA Mango/TO1-Biotin complexes Hill Coefficients K.sub.D (mM) K.sup.+ Na.sup.+ K.sup.+ Na.sup.+ Mango-I 1.2 ± 0.1 N/A 48 ± 5 N/D Mango-II 1.4 ± 0.2 0.8 ± 0.1 39 ± 10 170 ± 110 Mango-III 1.0 ± 0.8* 0.5 ± 0.5 0.4 ± 0.1 0.8 ± 0.3 Mango-IV 1.5 ± 0.2* N/A 64 ± 24 N/D Errors are the standard deviation of three independent measurements. *Hill coefficients with an asterisk are estimated based on initial rise of fluorescence data.
(12)
(13)
(14)
(15)
(16) TABLE-US-00014 TABLE 2 Constructs used in in vivo experiments SEQ ID Construct Sequence NO: 5S-30- GTCTACGGCC ATACCACCCT GAACGCGCCC 6889 Control GATCTCGTCT GATCTCGGAA GCTAAGCAGG GTCGGGCCTG GTTAGTACTT GGATGGGAGA CCGCCTGGGA ATACCGGGTG CTGTAGGCGT CGACTTGCCA TGTGTATGTG GGGAAACCCA CATACTCTGA TGATCCTTCG GGATCATTCA TGGCAATCTA GA 5S-F30- GTCTACGGCC ATACCACCCT GAACGCGCCC 6890 Mango II GATCTCGTCT GATCTCGGAA GCTAAGCAGG mutant GTCGGGCCTG GTTAGTACTT GGATGGGAGA CCGCCTGGGA ATACCGGGTG CTGTAGGCGT CGACTTGCCA TGTGTATGTG GGTACGAATT AGATTAGATT AAGATTAGAG TACCCACATA CTCTGATGAT CCTTCGGGAT CATTCATGGC AATCTAGA 5S-F30- GTCTACGGCC ATACCACCCT GAACGCGCCC 6891 Mango I GATCTCGTCT GATCTCGGAA GCTAAGCAGG GTCGGGCCTG GTTAGTACTT GGATGGGAGA CCGCCTGGGA ATACCGGGTG CTGTAGGCGT CGACTTGCCA TGTGTATGTG GGTACGAAGG GACGGTGCGG AGAGGAGAGT ACCCACATAC TCTGATGATC CTTCGGGATC ATTCATGGCA ATCTAGA 5S-F30- GTCTACGGCC ATACCACCCT GAACGCGCCC 6892 Mango II GATCTCGTCT GATCTCGGAA GCTAAGCAGG GTCGGGCCTG GTTAGTACTT GGATGGGAGA CCGCCTGGGA ATACCGGGTG CTGTAGGCGT CGACTTGCCA TGTGTATGTG GGTACGAAGG AGAGGAGAGG AAGAGGAGAG TACCCACATA CTCTGATGAT CCTTCGGGAT CATTCATGGC AATCTAGA 5S-F30- GTCTACGGCC ATACCACCCT GAACGCGCCC 6893 Mango III GATCTCGTCT GATCTCGGAA GCTAAGCAGG GTCGGGCCTG GTTAGTACTT GGATGGGAGA CCGCCTGGGA ATACCGGGTG CTGTAGGCGT CGACTTGCCA TGTGTATGTG GGTACGAAGG AAGGATTGGT ATGTGGTATA TTCGTACCCA CATACTCTGA TGATCCTTCG GGATCATTCA TGGCAATCTA GA 5S-F30- GTCTACGGCC ATACCACCCT GAACGCGCCC 6894 Mango IV GATCTCGTCT GATCTCGGAA GCTAAGCAGG GTCGGGCCTG GTTAGTACTT GGATGGGAGA CCGCCTGGGA ATACCGGGTG CTGTAGGCGT CGACTTGCCA TGTGTATGTG GGTACCGAGG GAGTGGTGAG GATGAGGCGA GTACCCACAT ACTCTGATGA TCCTTCGGGA TCATTCATGG CAATCTAGA 5S Δ78-98- GTCTACGGCC ATACCACCCT GAACGCGCCC 6895 F30-Mango GATCTCGTCT GATCTCGGAA GCTAAGCAGG IV GTCGGGCCTG GTTAGTAGAA AGAATACCGG GTGCTGTAGG CGTCGACTTG CCATGTGTAT GTGGGTACCG AGGGAGTGGT GAGGATGAGG CGAGTACCCA CATACTCTGA TGATCCTTCG GGATCATTCA TGGCAA U6-Mango GTGCTCGCTT CGGCAGCACA TATACTAAAA 6896 IV TTGGAACGAT ACAGAGAAGA TTAGCATGGC CCCTACCGAG GGAGTGGTGA GGATGAGGCG AGTAGGATGA CACGCAAATT CGTGAAGCGT TCCATATTTT T 5′ SalI F30 GGCGTCGACT TGCCATGTGT ATGTGGGTAC 6899 primer 3′ XbaI F30 CGCTCTAGAT TGCCATGAAT GATCCCGAAG 6897 primer G 5′ T7 GCCGGATCCT AATACGACTC ACTATAGTCT 6898 promoter 5S ACGGCCATAC CACCC primer
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
DETAILED DESCRIPTION
(56) Microfluidic Isolation of Mango Aptamers
(57) As illustrated in
(58) TABLE-US-00015 TABLE 3 Metrics of the fluorescence profiling of Mango and R12 Fusion Number of Number of Temperature TO-1 λ efficiency analyzed analyzed Round (° C.) (nM) value (%) droplets variants R12-library 25 100 1.25 95 168,441 200,023 Mango 25 100 0.54 95 63,200 1
(59) The microfluidic-assisted in vitro compartmentalisation (pIVC,
(60) A potential limitation of μIVC is the requirement of high TO1-Biotin concentrations (˜100 nM), that would greatly exceed the Mango-I K.sub.D (˜3 nM), and that could prevent the selection of high affinity aptamers. To mitigate this, we supplemented the in vitro transcription (IVT) mixture with TO1 competitors NMM (N-methyl mesoporphyrin IX) and TO3-Biotin, which are both known to interact with G-quadruplexes. The NMM supplemented IVT mixture significantly reduces TO1-Biotin/Mango-I fluorescence (
(61) TABLE-US-00016 TABLE 4 Metrics of screenings in presence of NMM Fusion Number of Number of Number of Temperature NMM λ efficiency analyzed analyzed sorted Round (° C.) (μM) value (%) droplets variants droplets 1 45 3 1.25 90 2,716,500 3,056,062 25,834 2 45 4 0.2 85 1,011,000 171,870 21,754 3 45 6 0.22 87 1,511,250 289,253 3,719 4 45 8 0.14 75 986,875 103,621 5,309 5 45 0 0.15 90 491,625 66,369 1,689
(62) The last screening round shows that, in the absence of NMM, the fluorogenic properties of the enriched library remained unchanged (
(63) In a second set of screenings, we increased the selection stringency by using the Mango-I specific competitor TO3-Biotin, which differs from TO1-Biotin by only two carbons in the methine bridge. To further increase the selection pressure for TO1-Biotin binding, we also decreased the RNA concentration in the droplets to 0.3 μM (from 8 μM with NMM). TO3-Biotin competitor was introduced in the second round of screening to ensure that positive droplets were not missed in the first round (
(64) TABLE-US-00017 TABLE 5 Metrics of screenings in the presence of TO-3 Fusion Number of Number of Number of Temperature T0-3 T0-1 λ efficiency analyzed analyzed sorted Round (° C.) (nM) (nM) value (%) droplets variants droplets 1 45 0 100 1.25 95 2,328,630 2,765,248 4,607 2 45 50 100 0.2 80 1,106,750 177,080 8,328 3 45 75 100 0.15 94 1,019,990 143,818 6,446 4 45 100 100 0.2 95 1,002,500 190,475 11,478 5 45 200 100 0.17 90 1,044,500 159,808 12,205 6 45 400 100 0.25 85 1,015,880 215,874 8,779 7 25 800 100 0.2 79 1,087,500 195,750 8,463 8 45 1,600 100 0.26 88 768,250 175,775 4,729 9 25 3,200 100 0.28 75 547,250 114,922 5,868 10 45 0 25 0.15 70 499,500 52,447 4,004
(65) In round 1, the relative fluorescence of the population increased, but it decreased upon addition of competitor (Round 2,
(66) Aptamer Structure and Function
(67) Based on the parental sequence isolates R2-1, R5-NMM-20 and R5-NMM-5 (
(68) Mango-II has a distinct flurophore binding mode from that of Mango-I. Crystallography shows that Mango-I consists of a three-tiered G-quadruplex core that binds TO1-Biotin by sandwiching it between the T3 layer of the G-quadruplex and A25 and A30 (
(69) Mango-IV, while superficially similar to both Mango-I and Mango-II based on primary sequence (
(70) The folding of the presently disclosed constructs was characterized further by examining their salt dependence, thermal melting properties, and CD spectra. Both Mango-II and IV have Hill coefficients and affinities for potassium similar to Mango-I (
(71) Mango-III, the brightest of the three exemplified aptamers was considerably different from the other three Mangos. Unable to form a three tiered G-quadruplex even in principle due to the presence of only nine guanines in its core, these guanines where, nevertheless found to be well protected from DMS (
(72) Cellular Imaging of Mango Tagged RNAs
(73) To demonstrate the efficacy of the exemplified aptamers in cellular imaging, we tagged the well characterized human 5S ribosomal RNA with each Mango variant by incorporating them into an F30 folding scaffold (
(74) To image the tagged RNA, we transfected in vitro transcribed 5S-F30-Mango RNAs into HEK293T cells, fixed the cells on ice with formaldehyde and stained with TO1-Biotin. This protocol being based on the surprising finding that in vitro, Mango-I, II and IV fluorophore-aptamer complexes were substantially resistant to formaldehyde at room temperature (
(75) To illustrate the sub-cellular localization of the 5S-F30-Mango IV foci, we combined Mango imaging with immunostaining, which is made feasible by the ability of Mango-IV to withstand formaldehyde fixation. It has been shown that 5S rRNA is imported into mitochondria to facilitate the translation of mitochondrial proteins. Cytoplasmic 5S-Mango IV foci clearly overlap with immunostained mitochondria (
(76) To confirm that the observed foci are specific, we tagged and transfected an RNA that localizes to a different cellular compartment. The U6 snRNA (small nuclear RNA) is expected to associate with snRNP (Ribonuclear Protein) complexes in the nucleus. We tagged U6 snRNA by incorporating Mango-IV directly into an internal stem loop (
(77) Taken together, these fixed cell data show that Mango-IV, and other aptamers disclosed herein, can be used to label and image small cellular RNAs via direct transfection of in vitro transcribed RNAs, without affecting their expected sub-cellular localization. Finally, to illustrate that Mango-tagged RNA molecules can be imaged in live cells, we took advantage of the aptamer's high affinity for TO1-Biotin, and transfected in vitro transcribed 5S-F30-Mango-IV RNA pre-incubated with TO1-Biotin. After transfection the cells exhibit bright foci similar to those observed in
(78) To estimate the number of fluorescent 5S-F30-Mango IV molecules in each foci, we performed photobleaching-assisted microscopy on fixed cells. A maximum likelihood estimate analysis of the photobleaching trajectories.sup.27,28, revealed between 4 and 17 photobleaching steps per foci. In addition, the photobleaching step distribution reveals two peaks corresponding to either one or two molecules. The number of observed steps correlates linearly with the initial foci intensity below 2,000 intensity units. Altogether, these results indicate that each foci contains at least 4 to 17 fluorescent molecules, consistent with the observed range of experimental intensities, and raises the interesting possibility of imaging single molecules in live cells.
(79) Finally, to test whether the new Mangos have the ability to function as genetically encoded tags expressed in cells, we constructed plasmids that express the 5S rRNA under the control of a RNA pol III promoter in conjunction with a mCherry reporter gene to identify successfully transfected cells (
(80) To confirm that the observed 5S rRNA foci are specific, we expressed a Mango II tagged small Cajal-body specific RNA (mgU2-47) that mediates the 2′-O-methylation of the U2 snRNA.sup.29. Upon expression, the Mango tagged mgU2-47 RNA formed well defined nuclear foci that were absent in the mgU2-47 Control RNA (
(81) The photobleaching properties of Mango I and Mango IV were superior to RNA Spinach with bleaching half-lives 10 times longer on average under identical illumination conditions (
(82) Bipartite Aptamer Systems
(83) In the X-Ray crystal structure of Mango I, the ‘GAA{circumflex over ( )}A’ tetraloop motif, with ‘GAA’ on the 5′ end of the G quadruplex core (represented by {circumflex over ( )}) and the remaining ‘A’ on the 3′ end of the core, separates two phosphates juxtaposed at the end of the core by 8 Å. We recognized that this 8 Å separation is important for fluorescence enhancement with select embodiments of RNA Mangos, with the G quadruplex in configuration for ligand binding. We have recreated this conformation in what are designated herein as bipartite embodiments, involving the complementary base pairing of portions of the Mango aptamers to an RNA target. In embodiments of this kind, the Mango aptamer acts as a switch, with fluorescence being switched on by binding to the target, which may accordingly be called a ‘trigger’. This is schematically illustrated in
(84)
(85) To illustrate a functional bipartite system, we used β-actin mRNA from mouse embryo fibroblasts as a model. β-actin mRNA, because of its Zipcode region binds to Zipcode Binding Protein (ZBP) which then binds to cytoskeleton proteins for transport to the leading edges of lamellipodia in growing fibroblasts (
(86) To quantitatively compare bipartite constructs, we measured the difference in RFU between bound and unbound Mangos, providing a contrast ratio of bound to unbound fluorescence, reflecting the increase in fluorescence upon binding of the bipartite construct to the target in the presence of the fluorophore. Higher contrast reflects lower background, and thus higher signal to noise ratio. For instance, in the Mango I based bipartite construct targeting β-actin mRNA in the target region 1087-1121, the equilibrium RFU after the addition of TO1-Biotin to the Mango construct is 3 (point a in
(87) The Mango II core sequence was used to prepare alternative bipartite constructs that include an inhibitory stem, a sequence that is part of the aptamer that binds to a portion of the core sequence, thereby inhibiting core formation in the absence of binding to a target. Surprising, as illustrated in
(88) The length of the inhibitory stem may be adjusted in alternative embodiments. If the stem length is too short, it may not adequately destabilize the G-quadruplex, thus decreasing the contrast. If the stem length is too long, then the inhibited structure, with the stem bound to the core, may become so stable that it inhibits or delays folding of G-quadruplex upon trigger binding. In exemplary embodiments, we illustrate optimization of inhibitory stem length in Mango II constructs. Increasing the inhibitory arm length by increments of one nucleotide revealed that an inhibitory arm containing five nucleotides gave high contrast with minimal decrease in the rate of fluorescence increase (
(89) An alternative bipartite embodiment was prepared based on a Mango IV core sequence. A variety of constructs were tested (
(90) A variety of bipartite Mango constructs were exemplified in vivo via transfection into MCF7 cells. In these embodiments, the sequences shown in
(91) Unimolecular Mango III Rolling Circle Amplification
(92) Early transcription assays revealed that the mango constructs are capable of displaying fluorescence enhancement in T7 transcription buffer supplemented with potassium to a final of 140 mM (
(93) Fluorophores
(94) A variety of flurophores may be used in alternative aspects of the presently disclosed compositions and processes. For example, U.S. Pat. No. 4,883,867 describes fluorometric assays for ribonucleic acids that use dyes having Formula I:
(95) ##STR00008## Wherein: X=O, S, Se, or C(CH.sub.3).sub.n, =alkyl having from 1-6 carbons; R.sub.2=alkyl having from 1-6 carbons; R.sub.3=fused benzene, alkyl having 1-6 carbons, methoxy or H; R.sub.4=alkyl having 1-6 carbons, methoxy or H; and n=zero or an integer from 1-6.
(96) Alternative embodiments disclosed therein include compounds wherein: R.sub.1=CH.sub.3, R.sub.2=CH.sub.3, R.sub.3=H, R.sub.4=H, X=S, and n=1; or, R.sub.1=CH.sub.3, R.sub.2=CH.sub.3, R.sub.3=fused benzene, R.sub.4=H, X=S, and n=0; or, R.sub.1=CH.sub.3, R.sub.2=CH.sub.3, R.sub.3=H, R.sub.4=H, X=O, and n=0; or, X=O, S, Se or C(CH.sub.3).sub.2, R.sub.1=alkyl having from 1-6 carbons, R.sub.2=alkyl having from 1-6 carbons, R.sub.3=fused benzene, alkyl having 1-6 carbons, methoxy or is hydrogen, R.sub.4=alkyl having 1-6 carbons, methoxy or H; and n=0 or an integer from 1-6; or, R.sub.1=CH.sub.3, R.sub.2=CH.sub.3, R.sub.3=H, R.sub.4=H, X=S, and n=1; or, R.sub.1=CH.sub.3, R.sub.2=CH.sub.3, R.sub.3=fused benzene, R.sub.4=H, X=S, and n=0; or, R.sub.1=CH.sub.3, R.sub.2=CH.sub.3, R.sub.3=H, R.sub.4=H, X=O, and n=0.
(97) In U.S. Pat. No. 4,883,867, Thiazole Orange (TO1) is identified as the compound of Formula I where R.sub.1=R.sub.2=CH.sub.3; R.sub.3=R.sub.4=H, X=S and n=0. As such, TO1 is an asymmetric cyanine fluorophore, which contains a benzothiazole ring covalently linked to a quinoline ring via a monomethine bridge. In aqueous solution the fluorophore exhibits very low fluorescence (λ.sub.ex=500 nm, λ.sub.em=525 nm, ϕ=2×10.sup.−4) due to rapid nonradiative decay through the torsional motion in the monomethine bridge joining the two heterocycles. Normally, TO1 becomes strongly fluorescent when the monomethine bridge connecting the two heterocycles is rigidified through nonspecific insertion into double-stranded helical nucleic acids giving a fluorescence quantum yield of 0.11. TO1 is characterized by: small size, lack of toxicity, plasma and nuclear membrane permeability, short intracellular half-life, and the accessibility of a broad wavelength range via simply synthesized TO1 analogues.
(98) In the examples disclosed herein, it has been shown that a very wide variety of substituents may be present at R.sub.1 in compounds of Formula I, for example comprising one or a combination of, substituted or unsubstituted: alkenyl, halogen (e.g., fluorine, chlorine, bromine, iodine, etc.), hydroxyl, alkoxy (e.g., methoxy, ethoxy, perchloromethoxy, perfluoromethoxy, etc.), alkylcarbonyloxy, alkyloxycarbonyl, arylcarbonyloxy, arylcarbonylamino, alkoxycarbonylamino, al koxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, alkylaminoacarbonyl, arylalkyl aminocarbonyl, alkenylaminocarbonyl, alkylcarbonyl, arylcarbonyl, aminoalkyl, arylalkylcarbonyl, alkenylcarbonyl, alkoxycarbonyl, silyl, aminocarbonyl, alkylthiocarbonyl, phosphate, aralkyl, phosphonato, phosphinato, cyano, amino, acylamino, amido, imino, sulfhydryl, alkylthio, sulfate, arylthio, thiocarboxylate, alkylsulfinyl, sulfonato, sulfamoyl, sulfonamido, nitro, cyano, azido, heterocyclyl, alkylaryl, aryl and heteroaryl substituents. The R.sub.1 group of Formula I may accordingly be substituted with any substituent which allows the fluorophore compound to perform its intended function.
(99) In alternative embodiments, fluorophores for use as disclosed herein may include compounds of Formula II:
(100) ##STR00009##
(101) Wherein:
(102) TABLE-US-00018 R Groups R.sub.1 Any substituent which allows the fluorophore compound to perform its intended function, eg: biotin, fluorescent dyes, NEB SNAP tags, with or without an amide bond in the linker. R.sub.2 through R.sub.5 H, F, Cl, Br, I, CH.sub.3, linear polymers, extended heterocycles (i.e. built of adjacent pairs of groups). R.sub.6-R.sub.9 H, F, Cl, Br, I, CH.sub.3, linear polymers, extended heterocycles (i.e. built of adjacent pairs of groups). R.sub.10 H, F, Cl, Br, I, CH.sub.3, linear polymers, extended heterocycles. R.sub.11 through R.sub.12 H, F, Cl, Br, I, CH.sub.3, linear polymers, extended heterocycles (i.e. built of adjacent pairs of groups). X atoms O (YO3), S (TO1 & TO3), Se. n (bridging groups) 1 (TO1) or 3 (TO3), or 5.
(103) In selected embodiments, R.sub.1 of compounds of Formula I or Formula II may be functionalized. For example, TO1-Acetate may be used as the basis for attaching a biotin tag for in vitro selection and subsequent complex purification. Embodiments have for example been tested and shown to work having biotinylated R.sub.1 substituents, with PEG linkers, for TO1 (n=1) and TO3 (n=3), including biotin (with variable length PEG linkers), desthiobiotin (with variable length PEG linkers), and CY5.sup.tm, wherein R.sub.1 is, respectively:
(104) ##STR00010##
(105) Advantageously, the following other specific compounds are encompassed by the invention:
(106) ##STR00011##
and in particular
(107) ##STR00012##
(108) ##STR00013##
(109) Unless explicitly stated otherwise, the terms “alkyl” and “heteroalkyl” each includes any reasonable combination of the following: (1) saturated alkyls as well as unsaturated alkyls (e.g. alkenyls and alkynyls); (2) linear or branched; (3) acyclic, cyclic (aromatic or nonaromatic) or multi-cyclic (fused rings, multiple non-fused rings or a combination thereof); and (4) unsubstituted or substituted. For example, an alkyl or heteroalkyl (i.e. “alkyl/heteroalkyl”) may be saturated, branched and cyclic, or unsaturated, branched and cyclic, or linear and unsaturated, or any other reasonable combination according to the skill of the person of skill in the art. Where the size of the alkyl/heteroalkyl is specified as X.sub.1-Xz, where z is any integer larger than 1 (e.g. 15, 18, 30, 100 or the like), it will be understood that the alkyl/heteroalkyl comprises at least 3 carbons and heteroatoms so as to form a ring. If unspecified, the size of the alkyl/heteroalkyl is what would be considered reasonable to the person of skill in the art. For example, but without limitation, if unspecified, the size of an alkyl may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more than 100 carbons in length, subject to the common general knowledge of the person of skill in the art. Further, but without limitation, if unspecified, the size of a heteroalkyl may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more than 100 carbons and heteroatoms in length, subject to the common general knowledge of the person of skill in the art.
(110) For convenience, unless otherwise specified the term “alkyl” shall without limitation include “alkylenyl” unless the context of its use clearly excludes alkylenyls, and vice versa. For example, but without limitation, where R.sup.1, R.sup.2 and R.sup.3 in R.sup.1-R.sup.2—R.sup.3 are identified as alkyl groups, it will be understood that R.sup.2 is an alkylenyl group and, similarly, R.sup.1 and R.sup.3 do not include alkylenyl groups.
(111) As used herein, in the context of an alkyl/heteroalkyl group of a compound, the term “linear” may be used as it is normally understood to a person of skill in the art and generally refers to a chemical entity that comprises a skeleton or main chain that does not split off into more than one contiguous chain. Non-limiting examples of linear alkyls include methyl, ethyl, n-propyl, and n-butyl.
(112) As used herein, the term “branched” may be used as it is normally understood to a person of skill in the art and generally refers to a chemical entity that comprises a skeleton or main chain that splits off into more than one contiguous chain. The portions of the skeleton or main chain that split off in more than one direction may be linear, cyclic or any combination thereof. Non-limiting examples of a branched alkyl group include tert-butyl and isopropyl.
(113) As used herein, the term “saturated” when referring to a chemical entity may be used as it is normally understood to a person of skill in the art and generally refers to a chemical entity that comprises only single bonds. Non-limiting examples of a saturated C.sub.1-C.sub.15 alkyl group may include methyl, ethyl, n-propyl, i-propyl, sec-propyl, n-butyl, i-butyl, sec-butyl, t-butyl, n-pentyl, i-pentyl, sec-pentyl, t-pentyl, n-hexyl, i-hexyl, 1,2-dimethylpropyl, 2-ethylpropyl, 1-methyl-2-ethylpropyl, l-ethyl-2-methylpropyl, 1,1,2-trimethylpropyl, 1,1,2-triethylpropyl, 1,1-dimethylbutyl, 2,2-dimethylbutyl, 2-ethylbutyl, 1,3-dimethylbutyl, 2-methylpentyl, 3-methylpentyl, sec-hexyl, t-hexyl, n-heptyl, i-heptyl, sec-heptyl, t-heptyl, n-octyl, i-octyl, sec-octyl, t-octyl, n-nonyl, i-nonyl, sec-nonyl, t-nonyl, n-decyl, i-decyl, sec-decyl and t-decyl. Non-limiting examples of C.sub.2-C.sub.15 alkenyl group may include vinyl, allyl, isopropenyl, l-propene-2-yl, 1-butene-l-yl, l-butene-2-yl, l-butene-3-yl, 2-butene-l-yl, 2-butene-2-yl, octenyl and decenyl. Non-limiting examples of C.sub.2-C.sub.15 alkynyl group may include ethynyl, propynyl, butynyl, pentynyl, hexynyl, heptynyl, octynyl, nonynyl and decynyl. Without limitation, the above-defined saturated C.sub.1-C.sub.15 alkyls, C.sub.2-C.sub.15 alkenyls and C.sub.2-C.sub.15 alkynyls are all encompassed within the term “X.sub.1-X.sub.15 alkyl”, as used herein. Without limitation, the term “X.sub.1-X.sub.15 heteroalkyl” would encompass each of the above-defined saturated C.sub.1-C.sub.15 alkyls, C.sub.2-C.sub.15 alkenyls and C.sub.2-C.sub.15 alkynyls, where one or more of the carbon atoms is independently replaced with a heteroatom. The person of skill in the art would understand that various combinations of different heteroatoms may be used.
(114) Unless explicitly stated otherwise, the terms “aryl” and “heteroaryl” each includes any reasonable combination of the following: (1) cyclic or multi-cyclic (fused rings, multiple non-fused rings or a combination thereof); and (2) aromatic (i.e. unsaturated rings) or nonaromatic (i.e. saturated rings); and (3) unsubstituted or substituted. Non-limiting examples of aryls or heteroaryls (i.e. “aryl/heteroaryl”) include: phenyl, naphthyl, thienyl, indolyl, pyridyl and the like. If unspecified, the size of the aryl/heteroaryl is what would be considered reasonable to the person of skill in the art. For example, but without limitation, if unspecified, the size of an aryl may be 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more than 100 carbons in length, subject to the common general knowledge of the person of skill in the art. Further, but without limitation, if unspecified, the size of a heteroaryl may be 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more than 100 carbons and heteroatoms in length, subject to the common general knowledge of the person of skill in the art. It is noted that an aryl or heteroaryl may have all or only a portion of its skeleton or main chain bonded in such a way so as to form a ‘loop’, circle or ring of atoms bonded together. That is, the aryl/heteroaryl may comprise linear or branched chains of carbons/heteroatoms that are not part of a ring or loop.
(115) As used herein, the term “substituted” is used as it would normally be understood to a person of skill in the art and generally refers to a compound or chemical entity that has one chemical group replaced with a different chemical group. Unless otherwise specified, a substituted alkyl may be an alkyl in which one or more hydrogen atom(s) may be/are replaced with one or more atom(s) that may be/are not hydrogen(s). For example, chloromethyl is a non-limiting example of a substituted alkyl, more particularly an example of a substituted methyl. Aminoethyl is another non-limiting example of a substituted alkyl, more particularly an example of a substituted ethyl. Unless otherwise specified, a substituted compound or group (e.g. alkyl, heteroalkyl, aryl, heteroaryl and the like) may be substituted with any chemical group reasonable to the person of skill in the art. For example, but without limitation, a hydrogen bonded to a carbon or heteroatom (e.g. N) may be substituted with halide (e.g. F, I, Br, Cl), amide, oxo, hydroxyl, thiol, phosphate, phosphonate, sulfate, SO.sub.2H, SO.sub.3H, alkyls, heteroalkyls, aryl, heteroaryl, ketones, carboxaldehyde, carboxylates, carboxamides, nitriles, monohalomethyl, dihalomethyl, trihalomethyl.
(116) As used herein, the term “unsubstituted” is used as it would normally be understood to a person of skill in the art. Non-limiting examples of unsubstituted alkyls include methyl, ethyl, tert-butyl, and pentyl. The expression “optionally substituted” is used interchangeably with the expression “unsubstituted or substituted”.
(117) Although various embodiments of the invention are disclosed herein, many adaptations and modifications may be made within the scope of the invention in accordance with the common general knowledge of those skilled in this art. Such modifications include the substitution of known equivalents for any aspect of the invention in order to achieve the same result in substantially the same way. Numeric ranges are inclusive of the numbers defining the range, and inclusive of all numbers and fractions subsumed within the respective ranges. The word “comprising” is used herein as an open-ended term, substantially equivalent to the phrase “including, but not limited to”, and the word “comprises” has a corresponding meaning. Terms such as “consisting essentially of” and “consists essentially of” allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention. As used herein, the singular forms “a”, “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a thing” includes more than one such thing. Citation of references herein is not an admission that such references are prior art to the present invention. Any priority document(s) and all publications, including but not limited to patents and patent applications, cited in this specification are incorporated herein by reference as if each individual publication were specifically and individually indicated to be incorporated by reference herein and as though fully set forth herein. The invention includes all embodiments and variations substantially as hereinbefore described and with reference to the examples and drawings. Nothing herein is intended as a promise of any specific utility for all embodiments.
(118) The term “about” or “approximately” as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, is meant to encompass variations of +/−20% or less, preferably +/−10% or less, more preferably +/−5% or less, and still more preferably +/−1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier “about” or “approximately” refers is itself also specifically, and preferably, disclosed.
(119) All references cited in the present specification are hereby incorporated by reference in their entirety. In particular, the teachings of all references herein specifically referred to are incorporated by reference, along with all documents cited in documents that are cited herein.
(120) Standard reference works setting forth the general principles of recombinant DNA technology include Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989; Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New York, 1992 (with periodic updates) (“Ausubel et al. 1992”); the series Methods in Enzymology (Academic Press, Inc.); Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press: San Diego, 1990; PCR 2: A Practical Approach (M. J. MacPherson, B. D. Hames and G. R. Taylor eds. (1995); Harlow and Lane, eds. (1988) Antibodies, a Laboratory Manual; and Animal Cell Culture (R. I. Freshney, ed. (1987). General principles of microbiology are set forth, for example, in Davis, B. D. et al., Microbiology, 3rd edition, Harper & Row, publishers, Philadelphia, Pa. (1980).
(121) Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases “in one embodiment” or “in an embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention, and form different embodiments, as would be understood by those in the art. For example, in the appended claims, any of the claimed embodiments can be used in any combination.
(122) In this description of the invention, reference is made to the accompanying drawings that form a part hereof, and in which are shown by way of illustration only of specific embodiments in which the invention may be practiced. It is to be understood that other embodiments may be utilized and structural or logical changes may be made without departing from the scope of the present invention. The description, therefore, is not to be taken in a limiting sense, and the scope of the present invention is defined by the appended claims.
(123) It is an object of the invention to not encompass within the invention any previously known product, process of making the product, or method of using the product such that Applicants reserve the right and hereby disclose a disclaimer of any previously known product, process, or method. It is further noted that the invention does not encompass any product, process, or making of the product or method of using the product, which does not meet the written description and enablement requirements of the USPTO (35 U.S.C. § 112, first paragraph) or the EPO (Article 83 of the EPC), such that Applicants reserve the right and hereby disclose a disclaimer of any previously described product, process of making the product, or method of using the product.
(124) Preferred statements (features) and embodiments may be combined with any other features or embodiments unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features or statements indicated as being preferred or advantageous.
PROTOCOL EXAMPLES
(125) High Throughput Screening
(126) Digital droplet PCR: DNA libraries were diluted in 200 μg/mL yeast total RNA solution (Ambion) down to ˜8 template DNA molecules per picoliter to have λ=0.2, or ˜40 templates DNA molecules per picoliter. 1 μL of this dilution was then introduced in 100 μL of a PCR mixture containing 0.2 μM of Forward primer (5′-CTT TAA TAC GAC TCA CTA TAG GAA CCC GCA AGC CAT C (SEQ ID NO: 6900), 0.2 μM of Reverse primer (5′-CAG AAT CTC ACA CAG CC(SEQ ID NO: 6901)), 0.2 mM of each dNTP, 0.67 mg/mL Dextran-Texas Red 70 kDa (Molecular Probes), 0.1% Pluronic F68, Phire II DNA polymerase (Thermo-Scientific) and the corresponding buffer according to recommended concentrations. The mixture was loaded in a length of PTFE tubing and infused into a droplet generator microfluidic device where it was dispersed into 2.5 pL droplets (production rate of ˜12,000 droplets/second) carried by HFE 7500 fluorinated oil (3M) supplemented with 3% of a fluorosurfactant. Droplet production frequency was monitored and used to determine droplet volume by adjusting pumps flow rates (MFCS, Fluigent). Emulsions were collected in 0.2 μL tubes, and subjected to an initial denaturation step of 2 min at 95° C. followed by 30 PCR cycles of: 30 sec at 95° C., 30 sec at 55° C., 1 min 30 at 72° C.
(127) Droplet fusion: PCR droplets were then injected into a fusion device at a rate of ˜1,500 droplets/second, spaced by a stream of HFE 7500 fluorinated oil supplemented with 2% fluorosurfactant. Each PCR droplet was synchronized with a 16 μL in vitro transcription (IVT) droplet containing 2.2 mM of each NTP (Larova), 24 mM MgCl.sub.2, 44 mM Tris-HCl pH 8.0, 50 mM KCl, 5 mM DTT, 1 mM Spermidine, 35 μg/mL of Dextran-Texas Red 70 kDa (Molecular Probes), 0.1% Pluronic F68, 20 μg/mL T7 RNA polymerase (purified in the laboratory), 100 nM TO1-Biotin (Dolgosheina et al., 2014), 1 μg inorganic pyrophosphatase (Roche) supplemented with the desired concentration of NMM. For the screenings performed in the presence of TO3-Biotin (Dolgosheina et al., 2014), the T7 RNA polymerase (New England Biolabs) concentration was reduced to 70 U per reaction. The IVT mixture was loaded in a length of PTFE tubing that was kept on ice during all the experiment. IVT droplets were produced using a stream of HFE 7500 fluorinated oil supplemented with 2% (w/w) of fluorinated surfactant. Flow-rates (MFCS, Fluigent) were adjusted to generate 16 pL IVT droplets and maximize the synchronization of one PCR droplet with one IVT droplet. Pairs of droplets were then fused with an AC field (350 V at 30 kHz) and the resulting emulsion collected off-chip and incubated for 120 min (high concentration of T7 RNA polymerase, NMM screenings) or 30 min (low concentration of T7 RNA polymerase, TO3-Biotin screenings) at 37° C. Droplet analysis and sorting:_The emulsion was finally re-injected into an analysis and sorting microfluidic device mounted on a Thermo plate (Tokai Hit) holding the temperature at 45° C. as previously described.sup.3. Droplets were re-injected at a frequency of −200 droplets/second, spaced with a stream of surfactant-free HFE 7500 fluorinated oil. The green fluorescence (TO1-Biotin in complex with the aptamer) of each droplet was analysed and the droplets having the highest green fluorescence were sorted. The gated droplets were deflected into collecting channel by applying a 1 ms AC field (1200 V, 30 kHz) and collected into a 1.5 mL tube. Collected droplets were recovered by flushing 200 μL of HFE 7500 fluorinated oil (3M) through the tubing. 100 μL of 1H, 1H, 2H, 2H-perfluoro-1-octanol (Sigma-Aldrich) and 200 μL of 200 μg/mL yeast total RNA solution (Ambion) were then added, the droplets were broken by vortexing the mixture and DNA-containing aqueous phase was recovered.
(128) Quantification of RNA Produced in Droplets
(129) A PCR mixture supplemented with DNA coding for RNA Mango (λ=10, ensuring that all the droplets were occupied) was emulsified in 2.5 pL droplets and the DNA amplified as above. The droplets were paired and fused with droplets of in vitro transcription mixture containing either a low (70 U of enzyme from New England Biolabs) or a high (20 μg/mL of enzyme purified in the lab) concentration of T7 RNA polymerase and the resulting emulsions were incubated for respectively 30 min or 120 min at 37° C. After incubation, the RNA-containing phase was recovered using 1H, 1H, 2H, 2H-perfluoro-1-octanol (Sigma-Aldrich) and the transcription was stopped by a phenol extraction followed by an ethanol precipitation in the presence of 300 mM sodium acetate pH 5.5 (Sigma-Aldrich). After centrifugation and a wash in 70% ethanol, the pellets were re-suspended in water. 10 U of Baseline-Zero™ DNase (Epicentre) and the corresponding buffer were added and a second incubation of 60 min at 37° C. was performed. The DNase was removed by phenol extraction and RNA recovered by ethanol precipitation.
(130) Recovered RNAs, were reverse transcribed for 60 min at 55° C., followed by 5 min at 95° C., in a mixture containing 10 pmol of Reverse primer, 0.5 mM of each dNTPs RT Maxima (Thermo-Scientific) and the corresponding buffer according to recommended concentrations. The cDNA was amplified using SsoFast™ Evagreen supermix (Bio-Rad) supplemented with 0.2 μM of each primer (Forward and Reverse) using a CFX96 Touch™ Real TimePCR Detection System (Bio-Rad). Finally the cDNA was quantified using the calibration curve obtained with reactions performed with purified RNAs.
(131) Enrichment Measurement
(132) The pool molecules contained in 2 μL recovered from the sorted fractions were introduced into 100 μL of PCR mixture containing 0.1 μM of each primer (Fwd and Rev), 0.2 mM of each dNTP, 0.05 U/μL of DreamTaq™ and its corresponding buffer (Fermentas). The mixture was then subjected to an initial denaturation step of 30 sec at 95° C., followed by 20 cycles of: 5 sec at 95° C. and 30 sec at 60° C. 20 μL of PCR products were then in vitro transcribed in 250 μL of mixture containing 2 mM of each NTP, 25 mM MgCl.sub.2, 40 mM Tris-HCl pH 8.0, 5 mM DTT, 1 mM Spermidine and 70 μg/mL T7 RNA polymerase. After 4 hours of incubation at 37° C., 10 U of Baseline-Zero™ DNase (Epicentre) and the corresponding buffer were added and the mixture was incubated for 60 min at 37° C. RNAs were recovered by phenol extraction followed by an ethanol precipitation in the presence of 300 mM sodium acetate pH 5.5 (Sigma-Aldrich). After centrifugation and a wash in 70% ethanol, the pellets were dissolved in denaturing loading buffer (0.05% bromophenol blue, 0.05% xylene cyanol, 20% glycerol, 1× TBE, 8 M urea) and the solution loaded onto a 12% denaturing 8 M urea acrylamide/bisacrylamide gel. The piece of gel containing RNA was identified by UV shadowing, sliced from the gel and transferred into a dialyze tube (MWCO=3 500, Spectrum Lab) filled with TBE. RNA was electro-eluted by placing the montage in TBE for 60 min at 100 V. Eluted RNA were filtered in centrifuge tube (porosity 0.45 μm, VWR) and ethanol precipitated in the presence of 300 mM sodium acetate pH 5.5. After centrifugation and a wash in 70% ethanol, the pellets were dissolved in DEPC-Treated water and quantified with Nanodrop (Thermo Scientific).
(133) In the case of NMM screenings, 2 μM of RNA were incubated with 100 nM of TO1-Biotin in 40 mM Tris-HCl pH 8.0, 50 mM KCl, and 22 mM MgCl.sub.2. Eventually, NMM (3 μM) was added and TO1-Biotin fluorescence (ex. 492 nm/em. 516 nm) measured. In the case of TO3-Biotin screenings, 300 nM of RNA and 100 nM of TO1-Biotin were used with or without 1.6 μM of TO3-Biotin. Both green (ex. 492 nm/em. 516 nm) and red (ex. 635 nm/em. 665 nm) fluorescence were measured.
(134) TA-Cloning, Sequencing and Colony Screening
(135) Genes contained in the libraries were diluted in a PCR mixture as a immediately above and thermocycled 25 times using a final extension step of 10 min at 72° C. PCR products were inserted in pTZ57R/T vector following manufacturer's instruction (InsTAclone PCR cloning Kit, Thermo-Scientific). Ligation products were recovered by phenol/chloroform extraction and ˜100 ng of DNA used to transform Electro-10 blue bacteria (Agilent) placed in a 2 mm electroporation (MicroPulser, Bio-Rad). After an hour of recovery at 37° C. under agitation, bacteria were plated on Luria broth (LB)-Ampicillin agar plate and incubated overnight at 37° C. The colonies were picked, used to inoculate liquid LB and grown at 37° C. until saturation. Plasmids DNA were extracted using “GeneJet Plasmid Miniprep kit” (Thermo-Scientific), and sequences determined by Sanger approach (GATC Biotech).
(136) Single colonies were introduced in 10 μL of a PCR mixture identical to that used for TA-cloning and the DNA amplified as above. 2 μL of PCR product added to 18 μL of in vitro transcription mixture containing 2 mM of each NTP, 25 mM MgCl.sub.2, 40 mM Tris-HCl pH 8.0, 50 mM KCl, 5 mM DTT, 1 mM Spermidine, 70 μg/mL T7 RNA polymerase and 100 nM TO1-Biotin. The mix was then split in two and one aliquot was supplemented with 3 μM of NMM. The reaction was incubated in a real-time thermocycler (Mx 3005P, Agilent) for 2 hours at 37° C. and the green fluorescence (ex. 492 nm/em. 516 nm) measured every minute.
(137) DMS Probing of Mangos
(138) DMS (Denaturing): Protocol is adapted from Lorsch and Szostak, 1994.sup.13. 50 nM RNA was 3′ end labelled with .sup.32pCp and gel purified. The resulting RNA was incubated in 50 mM HEPES pH 7.5 (volume 50 μL) at room temperature for 30 min. After incubation, 10 μg carrier RNA was added. The sample was then heated to 90° C. for 3 min before the addition of 0.5 μL of 25% DMS (diluted in ethanol) and heated to 80° C. for 1 min. 150 μL ice cold ethanol+5 μL 3 M NaCl was then immediately added and moved to −20° C. for 30 min. DMS modified RNA was pelleted by centrifuge at 16,300 RCF at 4° C. for 20 min.
(139) DMS (Native): 50 nM 3′ end labeled RNA was incubated in 50 mM HEPES pH 7.5, 1 mM MgCl.sub.2, 140 mM either KCl or NaCl, with or without 500 nM TO1-Biotin (final volume 50 μL) at room temperature for 30 min. After incubation, 10 μg carrier RNA was added. The sample was then incubated at room temperature for 15 min after the addition of 0.5 μL of 100% DMS. 150 μL ice cold ethanol+5 μL 3 M NaCl was then immediately added and pelleted as for the denaturing DMS protocol.
(140) Reduction: Pellets were resuspended in 10 μL 1 M Tris buffer pH 8 and 10 μL of freshly prepared 0.2 M sodium borohydride was added. Reaction was carried out on ice and in the dark for 30 min. Reactions were stopped by ethanol precipitation as above.
(141) Aniline Cleavage: To the resulting pellet, 20 μL (1 part Aniline, 7 parts ddH.sub.2O, 3 parts glacial acetic acid) were added and incubated at 60° C. for 15 min in the dark. Samples were flash frozen by placing tubes in liquid nitrogen and lyophilized by speed vacuum centrifuge. Once dry, 20 μL ddH.sub.2O was added, the sample refrozen and lyophilized once again. The pellet was resuspended in a 50% formamide denaturing solution before being loading on a 15% polyacrylamide gel (19:1 acrylamide:bis).
(142) T1 RNase Ladder and Alkaline Hydrolysis Ladder: 200 pmol 3′ end labeled RNA was incubated in 20 mM sodium citrate, 6.3 M urea, and 1 U/μL T1 RNase (Thermo Scientific) at 50° C. for 10 min. Samples was flash frozen in liquid nitrogen for 5 min, heat denatured in denaturing solution at 95° C. for 5 min prior to gel loading. Hydrolysis ladders were generated by incubating in 50 mM NaHCO.sub.3 at 90° C. for 20 min and neutralizing using 0.17 M Tris-HCl.
(143) Screening for Minimal Functional Mango Motifs
(144) To identify the minimal functional motif of each Mango, truncated constructs were designed as shown in
(145) Affinity Measurements of Mango Variants
(146) Fluorescence data was gathered using a Varian Cary Eclipse Spectrophotometer unless otherwise stated. Fluorescent titrations in the in vivo mimicking buffer (WB: 140 mM KCl, 1 mM MgCl.sub.2, 10 mM NaH.sub.2PO.sub.4 pH 7.2, 0.05% Tween-20) were performed to determine binding affinities. Fluorescence was measured at the maximum excitation and emission wavelengths of each complex (
F([RNA])=F.sub.max[(K.sub.D+[RNA]+[Fluorophore])/2−√(([RNA]−[Fluorophore])2+K.sub.D(K.sub.D+2[RNA]+2[Fluorophore]))]/2+F.sub.unbound (Eq. 1)
(147) Where F([RNA]) is the fluorescence as a function of RNA concentration [RNA], F.sub.max is the maximal fluorescence of the bound complex and F.sub.unbound the fluorescence of the unbound fluorophore. When the fluorescence of F.sub.unbound was undetectable, it was set to zero.
(148) Or to the following equation for TO3-Biotin and NMM experiments:
F([RNA])=F.sub.max[RNA]/(K.sub.D+[RNA])+F.sub.unbound (Eq. 2)
F.sub.max was determined using Eq. 1 or Eq. 2 as appropriate.
Temperature Dependent Fluorescence and UV Melting Curves
(149) Temperature dependence measurements were started at 90° C. decreasing at a rate of 1° C./min until 20° C., then returned at 1° C./min until 90° C. was reached. Fluorescence measurements were obtained at the maximum excitation/emission of the fluorescent complex used and were measured in WB buffer using 1 μM RNA either with or without 5 μM TO1-Biotin. Temperature dependence of fluorescence and absorbance were measured using a Varian Cary Eclipse Fluorescence Spectrophotometer at excitation and emission peaks and a Varian Cary 100 Bio UV-visible spectrophotometer monitoring at 260 nm.
(150) Circular Dichroism
(151) Circular dichroism spectra were obtained on an Applied Photophysics Chirascan Circular Dichroism Spectrometer using 5 μM RNA, 140 mM monovalent salts and 7 μM TO1-Biotin. Spectra were scanned in 1 nm steps with a bandwidth of 1 nm. Data shown is the average of three repeats. Samples were measured using a 1 mm pathlength quartz cuvette (Starna Cells Inc.).
(152) Formaldehyde Resistance Assay
(153) RNA Mango aptamers were incubated with TO1-Biotin in WB buffer for at least one hour until equilibrium fluorescence was reached. Formaldehyde was then added such that final concentrations after dilution were 50 nM RNA, 100 nM TO1-Biotin and 0, 2, 4, or 8% formaldehyde. Fluorescence was measured as a kinetic run at a rate of 2 readings per minute using a Varian Cary Eclipse Fluorescence Spectrophotometer, ex/em=510±2.5/535±5 nm.
(154) Cell Culture and Maintenance
(155) HEK293T cells were grown in Dulbecco Modified Eagle's Medium containing 10% Fetal Bovine Serum, 2 mM D-Glucose, 2 mM L-Glutamine, 1 mM Sodium Pyruvate and 100 U/ml Penicillin/Streptomycin (Thermo Fisher) and maintained at 37° C. with 5% CO.sub.2 in a humidified incubator. Cells used for imaging were cultured in Ibidi glass bottomed 8-well chamber slides (Ibidi GmbH).
(156) 5S-Mango RNA Synthesis and Purification
(157) DNA encoding the F30 folding scaffold was modified to incorporate the Mango RNA sequences and ordered from (Intergrated DNA Technologies). The DNA was amplified by PCR to incorporate 5′ SalI and 3′ Xbal restriction sites. PCR products were digested using Fast Digest enzymes (Thermo Fisher) and ligated into SalI/Xbal linearized and Shrimp Alkaline Phosphotase (NEB) treated pAV5S-F30-2xdBroccoli (Addgene plasmid 66845, a gift from Dr S. Jaffrey). DNA encoding the full 5S-F30-Mango sequence was PCR amplified and a 5′ T7 RNA polymerase promoter introduced. DNA was transcribed in vitro with T7 RNA polymerase (NEB) at 37° C. for 16 h in 40 mM Tris-HCl, 30 mM MgCl.sub.2, 2 mM spermidine, 1 mM dithiothreitol, 5 mM rNTPs, 1 U/μl E. coli inorganic pyrophosphotase, 4 U/μl T7 RNA polymerase (pH 7.9). RNA was purified from an 8 M urea denaturing polyacrylamide and bis to acrylamide ratios here XX gel followed by elution in RNA elution buffer (40 mM Tris-HCl pH 8.0, 0.5 M sodium acetate, 0.1 mM EDTA) and ethanol precipitation. Fluorescence measurements were taken for each of the RNA constructs using a Varian Cary Eclipse Fluorescence Spectrophotometer (Agilent) containing 40 nM TO1-Biotin, 200 nM RNA, 10 mM Sodium Phosphate, 100 mM KCl and 1 mM MgCl.sub.2 at pH 7.2. Similar measurements were also taken with a limiting amount of RNA (40 nM) in an excess of TO1-Biotin (200 nM) and the results showed a similar trend.
(158) 5S-Mango RNA Synthesis and Transfection
(159) RNA was transfected directly into 8-well chamber slides using the Lipofectamine-based CRISPRMAX reagent following the manufacturers guidelines (Invitrogen). Initially 125 nM RNA containing 10 mM Sodium Phosphate buffer (pH 7.2), 100 mM KCl and 1 mM MgCl.sub.2 was incubated at room temperature followed by a 1:1 dilution in OptiMEM prior to transfection. The RNA transfected was incubated at 37° C. for 1 hour in complete growth medium.
(160) Cell Fixation and Immunostaining
(161) Cells were fixed in PBS containing 4% paraformaldehyde for 10 min on ice (Thermo Fisher) followed by permeabilization in 0.2% Triton X-100 for 10 min at room temperature. Cells were first blocked (2% BSA in PBS) for 30 min followed by primary antibody (1:50-1:500 dilutions) incubation for 120 min in blocking solution.
(162) Primary antibodies used here were: Anti-Ribosomal Protein S6 (MAB5436, R&D Systems), Anti-ATP5B (ab14730, Abcam), Anti-GW182 (ab7052, Abcam), Anti-EEA-1 (ab70521, Abcam), Anti-LSm3 (NBP2-14206, Novus Biologicals), Anti-TIAR (sc-398372, Santa Cruz). Secondary antibodies used were Donkey Anti-mouse and Donkey Anti-Rabbit Alexa Fluor 680 (Molecular Probes). Primary antibodies were washed three times for 20 min each in blocking solution followed by incubation with secondary antibody at 1:500 dilution for 60 min, which was subsequently washed as above. After immunostaining the cells were washed three times for 5 min each with PKM buffer (10 mM Sodium Phosphate, 100 mM KCl and 1 mM MgCl.sub.2) followed by a 10 min incubation in 200 nM TO1-Biotin diluted in PKM buffer before replacing with imaging media (10 mM Sodium Phosphate, 100 mM KCl and 1 mM MgCl.sub.2 1 μg/ml Hoechst 33258).
(163) Live-Cell Imaging and Fluorescence Microscopy
(164) To visualize the nuclear boundary in live cells, a plasmid expressing a fluorescently tagged histone protein (EBFP2-H2B-6, Addgene plasmid 55243) was transfected using FuGene 6 (Promega) 24 h prior to RNA transfection. RNA was transfected directly into 8-well chamber slides (Ibidi GmbH) as described above, with an additional pre-incubation step with 250 nM of TO1-Biotin prior to the addition of the CRISPRMAX transfection reagent. Following incubation of the RNA transfection, the cells were washed once with PBS and replaced with live-cell imaging media (Fluorobrite DMEM supplemented with 20 mM HEPES, Invitrogen). Live and fixed cell images were taken using a Zeiss Elyra wide-field microscope by exciting at 405 nm (Blue), 488 nm (Green) and 642 nm (Far-Red) and detecting at 420-480 nm, 495-550 nm and >650 nm, respectively. Live cells were maintained at 37° C. with 5% CO.sub.2 in a stage top incubator (Tokai Hit). Images were processed using FIJI and spot detection analysis was performed on each maximum projection by the spot detector plugin in the ICY image analysis software, which detects significant foci with a pixel area 3×3 pixels.
REFERENCES
(165) 1. Nicoludis, J. M. et al. Optimized End-Stacking Provides Specificity of N-Methyl Mesoporphyrin IX for Human Telomeric G-Quadruplex DNA. J. Am. Chem. Soc. 134, 20446-20456 (2012). 2. Dolgosheina, E. V. et al. RNA Mango Aptamer-Fluorophore: A Bright, High-Affinity Complex for RNA Labeling and Tracking. ACS Chem. Biol. 9, 2412-2420 (2014). 3. Autour, A., Westhof, E. & Ryckelynck, M. iSpinach: a fluorogenic RNA aptamer optimized for in vitro applications. Nucleic Acids Res. 44, 2491-2500 (2016). 4. Warner, K. D. et al. Structural basis for activity of highly efficient RNA mimics of green fluorescent protein. Nat. Struct. Mol. Biol. 21, 658-663 (2014). 5. Huang, H. et al. A G-quadruplex—containing RNA activates fluorescence in a GFP-like fluorophore. Nat. Chem. Biol. 10, 686-691 (2014). 6. Shaner, N. C., Steinbach, P. A. & Tsien, R. Y. A guide to choosing fluorescent proteins. Nat. Methods 2, 905-909 (2005). 7. Jeng, S. C. Y., Chan, H. H. Y., Booy, E. P., McKenna, S. A. & Unrau, P. J. Fluorophore ligand binding and complex stabilization of the RNA Mango and RNA Spinach aptamers. RNA (2016). doi:10.1261/rna.056226.116 8. Paige, J. S., Wu, K. Y. & Jaffrey, S. R. RNA Mimics of Green Fluorescent Protein. Science 333, 642-646 (2011). 9. Filonov, G. S., Kam, C. W., Song, W. & Jaffrey, S. R. In-Gel Imaging of RNA Processing Using Broccoli Reveals Optimal Aptamer Expression Strategies. Chem. Biol. 22, 649-660 (2015). 10. Karunatilaka, K. S. & Rueda, D. Post-transcriptional modifications modulate conformational dynamics in human U2-U6 snRNA complex. RNA 20, 16-23 (2014). 11. Smirnov, A., Entelis, N., Martin, R. P. & Tarassov, I. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18. Genes Dev. 25, 1289-1305 (2011). 12. Ryckelynck, M. et al. Using droplet-based microfluidics to improve the catalytic properties of RNA under multiple-turnover conditions. RNA 21, 458-469 (2015). 13. Lorsch, J. R. & Szostak, J. W. In vitro selection of RNA aptamers specific for cyanocobalamin. Biochemistry (Mosc.) 33, 973-982 (1994).
EXAMPLES
Example 1: Crystal Structures of the Mango-II RNA Aptamer Reveal Heterogeneous Fluorophore Binding and Guide Engineering of Variants with Improved Selectivity and Brightness
(166) Several aptamers that induce fluorescence of their cognate small molecules by >1000-fold, and that can be used in vivo as RNA analogues of fluorescent proteins have been described.1-3 Among these, RNA Mango is noteworthy because of its small size (<30 nucleotides) and its high affinity for the thiazole orange-derived fluorophore, TO1-Biotin (Kd=3.1 nM). Moreover, its complex with the related fluorophore TO3-Biotin (Kd=8 nM) is one of the most red-shifted fluorogenic tags described to date, having an emission maximum of longer wavelength than the fluorescent protein mPlum.4 The Co-crystal structure of RNA Mango revealed a three-tiered G-quadruplex. TO1-Biotin binds on one of its flat faces, with each of its three heterocycles, benzothiazole (BzT), mehtylquinoline (MQ) and biotin sequestered under an unpaired nucleotide.5,6 Mango-II was recently obtained by subjecting the final pool of the RNA Mango selection to compartmentalization coupled to fluorescence sorting.7 Compared to the original aptamer (hereafter Mango-I), the new RNA is brighter (11,000 M-1 cm-1 vs. 17,000 M-1 cm-1 for Mango-I and Mango-II, respectively), and binds to both TO1-Biotin and TO3-Biotin (
(167) TABLE-US-00019 TABLE 6 Summary of crystallographic statistics Mango-II-TO1 Mango-II-TO3 Data collection Space group C222.sub.1 C222.sub.1 Cell dimensions a, b, c (Å) 36.83, 182.41, 107.49 37.10, 181.76, 108.290 α, β, γ (°) 90, 90, 90 90, 90, 90 Resolution (Å) 107.49-2.57 (2.68-2.57).sup.a 46.52-2.99 (3.2-2.99).sup.a R.sub.merge 0.058 (>1) 0.098 (0.93) <I>/<σ(I)> 18.6 (0.9) 16.4 (0.5) Completeness (%) 98.8 (90.0) 99.8 (99.6) Redundancy 8.8 (7.9) 10.5 (4.1) Refinement Resolution (Å) 91.21-2.90 (2.99-2.90) 46.52-3.00 (3.19-3.00) No. reflections 15464 (1257) 7735 (1268) R.sub.work/R.sub.free 18.58/23.06 18.99/25.51 No. atoms 2453 2339 RNA 2283 2283 TO1-Biotin 162 48 Ions 8 8 Water 0 0 B-factors (Å.sup.2) 75.32 57.38 RNA 75.29 57.53 TO1-Biotin 75.95 51.52 Ions 62.0 42.42 Water N.A. N.A. R.m.s deviations Bond lengths (Å) 0.007 0.006 Bond angles (°) 1.437 1.200 .sup.aValues in parentheses are for highest-resolution shell. One crystal was used for each data set.
(168) The two complexes crystallized in similar unit cells with three crystallographically independent RNAs (chains A, B, C) in the asymmetric unit (A.U.). Overall, the three RNAs in each structure are very similar (rmsd ˜0.7 Å for all non-hydrogen RNA atoms), and so are the RNAs in complex with the two different fluorophores (rmsd ˜0.2 Å between the best-ordered chains in each structure; the coordinate precisions of the two structures are 0.42 Å and 0.40 Å, respectively). The folds of Mango-I and Mango-II are overall similar, and this similarity extends to crystal packing, in which adjacent aptamers stack pairwise through their fluorophore-distal quadruplex faces. Nonetheless, and as in the case of Mango-II, analytical ultracentrifugation indicates the aptamer RNA is monomeric in solution (
(169) Mango-II has an almost identical melting profile in both the presence and absence of TO1-Biotin and is more thermostable than Mango-I.7 In addition, Mango-II is remarkably formaldehyde resistant; Mango-II reacted with formaldehyde, can still bind and induce fluorescence of TO1-Biotin. Together, these data suggest that the Mango-II aptamer has a pre-organized binding pocket.
(170) Three structural differences between Mango-I and Mango-II are consistent with a higher stability of the latter RNA and its improved fluorophore affinity. First, each guanine in the T3 G-quartet is isolated from the T2 G-quartet by one of four adenine containing propeller loops (
(171) The five adenines in the four propeller loops and the planar T3 quadruplex they create together define the fluorophore binding pocket of Mango-II. In this complex, the MQ and BzT of TO1-Biotin are coplanar and, in chains A and B, stack on G13 and G29 of T3, respectively (
(172) In the structure of Mango-II bound to TO3-Biotin, electron density corresponding to the fluorophore was only observed for the headgroup (BzT, MQ, and the trimethine linker), and only in RNA chains A and B (
(173) Highly selective fluorogenic RNAs would facilitate development of orthogonal fluorescent tags. The structural heterogeneity revealed by our Mango-II TO1-Biotin and TO3-Biotin co-crystal structures, as well as the comparable affinity of the aptamer for the two fluorophores, suggests that the fluorophore binding pocket of this aptamer is not highly stereoselective. To increase selectivity of Mango-II, we constructed mutants focusing on residue A22, which in our structures is conformationally plastic and appeared to have the most potential to influence TO3-Biotin discrimination. Mutants were analyzed for affinity and fluorescence enhancement of TO1-Biotin and TO3-Biotin (Table 8 & 9). Mutation to guanine reduced the binding affinity and fluorescence enhancement of both TO1-Biotin and TO3-Biotin (Table 8 & 9). Such an outcome is not unexpected, as G-quadruplex nucleic acids can undergo alternative folding when additional guanine bases are present.8 However, mutation to uridine or cytosine maintained the binding affinity for TO1-Biotin (0.9 nM) while decreasing the affinity of TO3-Biotin from ˜1.4 nM to ˜5.0 nM (Table 8 & 9). Unexpectedly, these mutations also increased the fluorescence enhancement of TO1-Biotin by 18% while decreasing the fluorescence enhancement of TO3-Biotin by 25% (Table 8 & 9).
(174) TABLE-US-00020 TABLE 7 Summary of crystallographic statistics Mango-II-A22U-TO1 Data collection Space group C222.sub.1 Cell dimensions a, b, c (Å) 36.86, 181.03, 109.06 α β, γ (°) 90, 90, 90 Resolution (Å) 46.38-2.80 (2.95-2.80).sup.a R.sub.merge 0.102 (0.956) <I>/<σ(I)> 18.6 (1.1) Completeness (%) 99.8 (99.6) Redundancy 11.3 (8.7) Refinement Resolution (Å) 46.38-2.80 (2.95-2.80) No. reflections 9216 (1254) R.sub.work/R.sub.free 18.59/23.69 No. atoms 2511 RNA 2349 TO1-Biotin 162 Ions 8 Water 0 B-factors (Å.sup.2) 59.34 RNA 59.37 TO1-Biotin 58.74 Ions 54.6 Water N.A. R.m.s deviations Bond lengths (Å) 0.008 Bond angles (°) 1.55 .sup.aValues in parentheses are for highest-resolution shell. One crystal was used for each data
(175) TABLE-US-00021 TABLE 8 Binding and fluorescence of Mango-II and mutants to TO1-B and its derivatives. RNA Ligand K.sub.D (nM) FI.sub.E Mango II - WT TO1-B 1.1 ± 0.3 1303 ± 20 Mango II - A22U TO1-B 0.9 ± 0.4 1543 ± 24 Mango II - A22C TO1-B 0.9 ± 0.2 1407 † Mango II - A22G TO1-B 6.4 ± 1.5 1224 † Mango II - WT TO3-B 1.4 ± 0.3 61 ± 2 Mango II - A22U TO3-B 5.0 ± 2.8 46 ± 3 Mango II - A22C TO3-B 5.1 ± 1.4 37 † Mango II - A22G TO3-B 7.6 ± 3.7 52 † Mango II - A12U TO1-B 0.40 ± 0.07 1342 † Mango II - A17U TO1-B 1.00 ± 0.16 1237 † Mango II - A15U TO1-B 1.92 ± 0.39 1133 † A20U A25U A26U A31U Mango II - A15U TO1-B 0.76 ± 0.24 1329 † A20U A25U Mango II - WT TO1-OAc 56 ± 2 258 ± 10 Mango II - A22U TO1-OAc 43 ± 3 315 ± 4 Mango II - WT TO1-ME 2.41 ± 0.54 401 ± 6 Mango II - A22U TO1-ME 4.81 ± 1.02 302 ± 6 Mango II - WT TO1-PA 1.04 ± 0.57 493 ± 5 Mango II - A22U TO1-PA 2.21 ± 1.09 275 ± 3 Mango II - WT TO1-PE 0.37 ± 0.06 783 ± 13 Mango II - A22U TO1-PE 1.00 ± 0.13 825 ± 14 † Indicates the fluorescence enhancement was calculated relative to wt from the binding titration.
(176) To understand how the Mango-II A22U mutation results in increased TO1-Biotin fluorescence enhancement, we determined the co-crystal structure of this complex at 2.8 Å resolution (Table 7). The RNA structure is generally unchanged from that of the wild-type. The nucleobase of U22 is ordered but projects into solvent rather than interacting with T3. TO1-Biotin adopts the same orientation in all three chains in the A.U. with Bzt and MQ stacking on G29 and G13, respectively (
(177) TABLE-US-00022 TABLE 9 RNA sequence table. SEQ RNA Sequence ID # Name NO 1 Mango GCGUACGAAG GAGAGGAGAG GAAGAGGAGA 6902 II-wt GUACGC 2 Mango GCGUACGAAGGAGAGGAGAGGUAGAGGAGAGU 6903 II- ACGC A22U 3 wt* GGCACGUACGAAGGAGAGGAGAGGAAGAGGAG 6904 (8 bp) AGUACGUGC 4 A22U* GGCACGUACGAAGGAGAGGAGAGGUAGAGGAG 6905 AGUACGUGC 5 A22C* GGCACGUACGAAGGAGAGGAGAGGCAGAGGAG 6906 AGUACGUGC 6 A22G* GGCACGUACGAAGGAGAGGAGAGGGAGAGGAG 6907 AGUACGUGC 7 A12U* GGCACGUACGAAGGUGAGGAGAGGAAGAGGAG 6908 AGUACGUGC 8 A17U* GGCACGUACGAAGGAGAGGUGAGGAAGAGGAG 6909 AGUACGUGC 9 A15U GGCACGUACGAAGGUGAGGUGAGGUUGAGGU 6910 A20U GAGUACGUGC A25U A26U A31U* 10 A15U GGCACGUACGAAGGUGAGGUGAGGUAGAGGAG 6911 A20U AGUACGUGC A25U*
(178) TABLE-US-00023 TABLE 10 Mean CC values for binding pocket residues in respective complexes and chains. Mango-II-TO1 Mango-II-TO3 Mango-II-A22U-TO1 Chain A 0.9282 0.9433 0.9605 Chain B 0.9181 0.9201 0.9431 Chain C 0.8606 0.8790 0.9248 Binding pocket residues are defined as G13, G18, G24, G29, A12, A17, A22, A23 and A28
(179) To extend our crystallographic observations into solution conditions, we examined the fluorescence lifetimes of the wildtype and A22U mutant Mango-II RNAs in complex with TO1-Biotin. The A22U mutation increases the average lifetime of the emission from 1.51 (±0.06) ns to 1.92 (±0.03) ns. The lifetime of the Mango-II-TO1-Biotin complex has two components, and both are increased in the mutant compared to the wild-type: the first from 0.52 (±0.02) ns to 0.72 (±0.01) ns, and the second from 2.33 (±0.12) ns to 2.904 (±0.001) ns (
(180) TABLE-US-00024 TABLE 11 Parameters from the analysis of fluorescence lifetime data. Parameter TO1-Biotin Mango II wt Mango II A22U τ.sub.1 (ns) 0.11 0.52 (±0.02) 0.72 (±0.01) α.sub.1 (%) 63 45 (±3) 45 (±2) τ.sub.2 (ns) 0.50 2.33 (±0.12) 2.904 (±0.001) α.sub.2 (%) 25 55 (±3) 55 (±2) t.sub.3 (ns) 2.63 \ \ α3 (%) 12 \ \ τ.sub.i (ns) * 1.77 2.05 (±0.09) 2.53 (±0.02) τ.sub.a (ns) * 0.51 1.51 (±0.06) 1.92 (±0.03) * τ.sub.i is the intensity-weighted average lifetime, and τ.sub.α is the amplitude-weighted average lifetime calculated from the data presented above. The latter is used in the text when discussing and comparing the TCSPC data for the different structures.
(181) The Inventor's mutant co-crystal structure shows no direct contacts between U22 and TO1-Biotin. To gain further insight into how the U22 mutation improves Mango-II properties, we examined the effect of varying the length of the linker between the thiazole orange and biotin moieties of TO1-Biotin. We determined the affinity and fluorescence enhancement of four compounds: TO1-OAc (TO1-acetate), TO1-ME (TO1-methylester), TO1-PA (TO1-propanylamide), TO1-PE (TO1-pentenoylester) (
(182) The inventors demonstrate that Mango-II is a versatile platform for fluorescence enhancement of thiazole-orange derived fluorophores, and have shown that variants of this RNA tag, designed with the aid of crystal structures, have improved properties. Analysis of the fluorophore-RNA shape complementarity of each of our structures reveals that fluorescence enhancement correlates directly with the SC statistic. The Mango-II-TO3-Biotin and Mango-II(A22U)-TO1-Biotin complexes both yield similarly high SC statistics, possibly indicating an upper limit to the shape complementarity attainable for this type of complex. The high SC statistic observed for the A22U mutant-TO1-Biotin complex also correlates with improved binding affinity, fluorescence enhancement and fluorescence lifetime. Fluorescence binding studies on TO1-Biotin variants independently suggest that these improvements are due to removal of steric constraints on the ligand by the transversion mutation to a pyrimidine, consistent with our crystallographic analysis. By achieving enhanced fluorescence properties through improved ligand-RNA packing and structural homogeneity, this work demonstrates that even functionally selected fluorogenic RNAs can potentially be improved through detailed structural and mechanistic analysis.
REFERENCES
(183) 1. Paige, J. S.; Wu, K. Y.; Jaffrey, S. R., RNA mimics of green fluorescent protein. Science 2011, 333 (6042), 642-646. 2. Dolgosheina, E. V.; Jeng, S. C. Y.; Panchapakesan, S. S. S.; Cojocaru, R.; Chen, P. S. K.; Wilson, P. D.; Hawkins, N.; Wiggins, P. A.; Unrau, P. J., RNA Mango aptamer-fluorophore: A bright, high-affinity complex for RNA labeling and tracking. ACS Chem. Biol. 2014, 9 (10), 2412-2420. 3. Tan, X. H.; Constantin, T. P.; Sloane, K. L.; Waggoner, A. S.; Bruchez, M. P.; Armitage, B. A., Fluoromodules consisting of a Promiscuous RNA aptamer and red or blue fluorogenic cyanine dyes: selection, characterization, and bioimaging. J. Am. Chem. Soc. 2017, 139 (26), 9001-9009. 4. Rodriguez, E. A.; Campbell, R. E.; Lin, J. Y.; Lin, M. Z.; Miyawaki, A.; Palmer, A. E.; Shu, X. K.; Zhang, J.; Tsien, R. Y., The growing and glowing toolbox of fluorescent and photoactive proteins. Trends Biochem. Sci. 2017, 42 (2), 111-129. 5. Trachman, R. J.; Demeshkina, N. A.; Lau, M. W. L.; Panchapakesan, S. S. S.; Jeng, S. C. Y.; Unrau, P. J.; Ferré-D'Amaré, A. R., Structural basis for high-affinity fluorophore binding and activation by RNA Mango. Nat Chem Biol 2017, 13 (7), 807-813. 6. Trachman, R. J.; Truong, L.; Ferre-D'Amare, A. R., Structural principles of fluorescent RNA aptamers. Trends Pharmacol. Sci. 2017, 38 (10), 928-939. 7. Autour A et al., Fluorogenic RNA Mango aptamers for imaging small non-coding RNAs in mammalian cells Nat. Comm. 2018 (In Press), DOI: 10.1038/s41467-018-02993-8. 8. Phan, A. T.; Kuryavyi, V.; Gaw, H. Y.; Patel, D. J., Small-molecule interaction with a five-guanine-tract G-quadruplex structure from the human MYC promoter. Nat. Chem. Biol. 2005, 1 (3), 167-173. 9. Lawrence, M. C.; Colman, P. M. Shape complementarity at protein/protein interfaces. JMB 1993, 234, 946-950. 10. Jarikote, D. V.; Krebs, N.; Tannert, S.; Roder, B.; Seitz, O., Exploring base-pair-specific optical properties of the DNA stain thiazole orange. Chem. Eur. J. 2007, 13, 300-310. 11. Leontis, N. B.; Westhof, E., Geometric nomenclature and classification of RNA base pairs. RNA 2001, 7 (4), 499-512.
Example 2—an RNA Aptamer of Unusual Structural Complexity Induces Bright Fluorescence of a Thiazole Orange Derivative
(184) In order to elucidate the molecular basis for the unusually bright fluorescence of the Mango-III-TO1-Biotin complex, and as a starting point for structure-guided optimization of this tool for live-cell imaging of RNAs, we have now determined its co-crystal structure at 2.35 Å resolution, revealing a compact aptamer RNA of unusual structural complexity. The thiazole orange (TO) headgroup of the fluorophore is constrained between a long-range Watson-Crick base pair and a G-quadruplex to a planar conformation that would maximize its fluorescence, thereby explaining the high quantum yield of Mango-III.
(185) Results
(186) Overall Structure of Mango-III Bound to TO1-Biotin
(187) A 38-nt construct comprising the conserved 28-nt Mango-III core flanked by nucleotides presumed to form a 5-base pair Watson-Crick duplex was co-crystalized with TO1-Biotin. The structure was solved by the single-wavelength anomalous dispersion (SAD) method using data from an iridium derivative (Table 12, Methods).
(188) TABLE-US-00025 TABLE 12 Summary of crystallographic statistics Mango-III-TO1 Mango-III-A15U-TO1 SuperMango-III-TO1 Data collection Space group P2.sub.12.sub.12.sub.1 H3 I4.sub.122 Cell dimensions a, b, c (Å) 63.03, 67.59, 76.67 91.95, 91.95, 161.69 53.27, 53.27, 188.04 α β, γ (°) 90, 90, 90 90, 90, 120 90, 90, 90 Resolution (Å) 46.10-2.35 (2.39-2.35).sup.a 45.97-2.90 (2.98-2.90).sup.a 40.59-1.51 (1.55-1.51) R.sub.merge 0.06 (>1) 0.038 (0.91) 0.05 (>1) <I>/<σ(I)> 50.6 (1.2) 10.3 (1.0) 20.9 (1.5) Completeness (%) 99.9 (100) 98.5 (99.0) 99.9 (98.6) Redundancy 7.2 (7.1) 2.3 (2.2) 10.2 (10.6) Refinement Resolution (Å) 38.3-2.35 (2.43-2.35) 45.98-2.90 (3.03-2.90) 40.59-1.55 (1.61-1.55) No. reflections 12717 (1237) 11055 (1224) 20013 (1951) R.sub.work/R.sub.free 19.28/20.92 19.29/23.07 16.8/19.12 No. atoms 1806 3171 996 RNA 1632 2283 787 TO1-Biotin 107 93 52 Ions 9 5 8 Water 25 4 143 B-factors (Å.sup.2) 76.8 79.75 33.90 RNA 76.91 80.17 32.07 TO1-Biotin 74.29 67.45 34.09 Ions 79.7 65.02 33.35 Water 79.1 58.93 41.81 R.m.s deviations Bond lengths Å 0.006 0.007 0.005 Bond angles 1.265 1.541 1.06 .sup.aValues in parentheses are for highest-resolution shell. One crystal was used for each data set.
(189) The crystallographic asymmetric unit (ASU) contains two similar RNA-fluorophore complexes (RMSD=0.15 Å for all non-hydrogen atoms). The two RNAs in the ASU each make three crystal contacts involving duplex stacking (
(190) The structure of Mango-III (
(191) A coaxial duplex-triplex-quadruplex stack Mango-I is comprised of a three-tiered G-quadruplex flexibly connected to its adjacent A-form duplex P1 through a GAA″A-tetraloop-like junction (A denotes the site of insertion of the quadruplex). The corresponding residues of Mango-III adopt a completely different structure. Instead of folding like the first three nucleotides of a GNRA tetraloop, G1, A2 and A3 of Mango-III continue the duplex structure of P1 by Watson-Crick base-pairing with complementary nucleotides at the 3′ end of the aptamer (
(192) The expanded A7⋅U19⋅A25 triple links the P1 duplex with the quadruplex of Mango-III through three sets of interactions. First, the base triple stacks below the T1 of the quadruplex and above the closing A3⋅U26 base pair of P1. Second, the 2′-OH of U26 donates a hydrogen bond to the N1 of A7 of the triple, in effect expanding it to a pseudo-tetrad. Third, a hydrated cation (MB, Sr2+ in this crystal structure, but likely Mg2+ under physiological conditions) and a network of ordered water molecules connects the phosphate of A7 to the minor grooves of both, A3 and G4, thereby spanning the duplex-quadruplex junction. Overall, these interactions likely produce a rigid connection between P1 and the G-quadruplex moieties of Mango-III, which is consistent with the identical (within coordinate precision) relative arrangements of the two elements in the two crystallographically independent aptamer RNAs in the A.U.
(193) A Partially Parallel Non-Canonical Duplex
(194) The P2 duplex of Mango-III is unique because of the chain direction of its two strands, and because each of its three base pairs is non-canonical. The backbones of the trans Watson-Crick U15⋅U22 and trans Hoogsteen A16⋅A23 base pairs are parallel. The third base pair is formed between U24 and G21, whose backbones are locally anti-parallel, being on opposite ends of the same loop connecting G20 of T1 (the last guanine of the G-quadruplex) to A25 of the base triple. The G21⋅U24 pair is formed in cis, and comprises a single hydrogen bond. The unusual structure of the P2 duplex is reflected in variable C1′-C1′ distances (8.5 Å, 11.4 Å and 12.6 Å for the three pairs) that differ from that typical for canonical antiparallel A-form RNA duplexes (10.7 Å), and appears to be stabilized by a cross-strand stacking of A16 on G21. This latter interaction gives rise to two reciprocal hydrogen bonds between the N1 of A16 and the 2′-OH of G21, and the O6 of G21 and the 2′-OH of A16.
(195) Formation of a duplex such as P2 between nucleotides in a propeller loop of a G-quadruplex and residues 3′ to it is unusual. P2 contributes to the overall structure of Mango-III and formation of its fluorophore binding pocket in three important ways. First, because P2 is followed immediately by A25, formation of the duplex anchors the 2-tiered G-quadruplex onto the base triple. Second, G18 and G20 form the only non-contiguous and anti-parallel guanine stack in the Mango-III G-quadruplex, and P2 anchors the backbones of these two nucleotides next to each other. This may be further facilitated by a hydrogen bond between the pro-Rp non-bridiging phosphate oxygen (NBPO) of U10 and the 2′-OH of G14 from the adjacent guanine stack (
(196) The TO1-Biotin-Binding Site of Mango-III
(197) Unbiased residual electron density corresponding to the BzT and MQ heterocycles as well as the four proximal atoms of the PEG linker of TO1-Biotin unambiguosly located the TO headgroup between T2 of the G-quadruplex and the tertiary A10⋅U17 trans Watson-Crick base pair (
(198) To test the functional significance of the tertiary A10⋅U17 base pair of Mango-III, we generated all sixteen combinations of nucleotides at these two positions, and examined their effect on TO1-Biotin binding and fluorescence enhancement (
(199) Structure of the Enhanced Mango-III(A10U) Mutant
(200) To determine the structural basis of the improvement in fluorescence resulting from the A12U mutation of Mango-III, we determined the crystal structure of this variant in complex with TO1-Biotin at 2.9 Å resolution (Table 1, Methods, and
(201) In both structures, N3 of U17 donates a hydrogen to bond with either N3 of the wild type A15 or 02 of U15. The distance of this hydrogen bond decreases from ˜2.95 Å in the wild type structure to ˜2.7 Å in the A15U mutant. This further reduces the overlap of the nucleotide in position 15 with the methylquinoline. As a result, TO1-Biotin is observed in two distinct conformations in the ASU of the A15U mutant, with two copies found in the E conformation and two copies in the Z conformation (
(202) The mutant base pair results in reduced overlap with the ligand. This is consistent with fluorescence binding data showing that the more extended TO3-Biotin fluorophore is disrupted by pyrimidine substitutions in the cap and favored by purine substitutions (
(203) Structure Guided Reselection of Mango-III
(204) Given the improved fluorescence enhancement observed in the A22U mutant and the detrimental effects of mutagenesis to T1′ and T1, as well as the structurally implied instability of these two regions, we hypothesized that structure guided reselection would improve the fluorescence enhancement and or stability of the Mango-III aptamer. A starting pool of 4.1×106 sequences was generated by mixing two RNA pools in equal proportion, with the first pool (pool 1) randomized at ten positions in the conserved Mango-III core (8, 12, 15, 17, 22, 24, 26, 29, 30, 31) and the second pool (pool 2) randomized at the same positions as pool 1 with an additional random insertion 3′ to position 31 to potentially allow for a canonical G-tetrad to form. An engineering work flow was implemented consisting of one round of SELEX*, to enrich high affinity aptamers, followed by seven rounds of IVC to select for bright aptamers. The selection converged on five sequences with frequencies of 58%, 12%, 8.5%, 1.2% and 0.4% (
(205) The inter-tier interactions of A21 and G26 appear to be the most stable in P2. This interaction network is observed in all six protamers of our two structures, whereas two protamers in the ASU of Mango-III-A15U show U20, A28, and U29 in an unfolded state. However, even the unfolded conformations in the Mango-III (A15U)-TO1-Biotin complex resolve the pro-RP oxygen of U20 hydrogen bonding to the 02′ of G19, suggesting that the nucleotide in the 20 position can promote a stable binding-pocket regardless of base composition. Indeed, mutagenesis of the bases in P2 show that T3′ is the most tolerant to nucleotide changes, with TO1-Biotin Kds ranging from 1.6 nM to 9.7 nM. while mutagenesis of P2′ and P1′ exhibit Kds ranging from 140 nM to 250 nM. Seeing as the A21 residue is adjacent to the cap nucleotide U22, the binding of fluorophore may couple folding of both U22 and A21. These binding data support the importance of A21 and G26 in stabilizing the fluorophore binding pocket and the precarious nature of U29, given its location adjacent to the mixed tetrad, T1.
(206) Methods
(207) Crystallography
(208) RNAs were chemically synthesized (Dharmacon); deprotected according the manufacturers protocol and gel purified. RNAs were exchanged into 20 mM MOPS-KOH pH 7.0, 150 mM KCl and 10 μM EDTA through centrifugal ultrafiltration (3,000-Da cutoff, Millipore); filtered (0.1 μm cutoff, Amicon Ultrafree-MC, Millipore); and stored at 4° C. Some RNAs were in vitro transcribed and purified by electrophoresis on 14% polyacrylamide (19:1 acrylamide/bisacrylamide), 1×TBE, 8M Urea gels; electroeluted from gel slices; washed once with 1M KCl; desalted by ultrafiltration and a partial list appears in
(209) Crystallization of Mango-III-TO1-Biotin was performed by heating RNA 1 (20 mM MOPS-KOH pH 7.0, 150 mM KCl, 10 μM EDTA) to 95° C. for 3 minutes, placed at 21° C. for 10 minutes, mixed with equimolar concentration of TO1-Bitoin then kept at 21° C. for 30 minutes. For crystallization, 0.2μ of RNA solution (300 μM) and 0.2 μl reservoir solution were mixed and equilibrated against 0.04 M Na Cacodylate pH 6.5, 0.08 M NaCl, 0.012 M KCl, 0.02 M MgCl.sub.2, 0.012 M Spermine.Math.4 Cl, 5.5% Sucrose, 31% MPD. Strongly fluorescent (500 nm illumination), tretraganol pyramidal crystals grew in 1-3 days to maximum dimensions of 300×100×100 μm.sup.3. Additional cryoprotection was not necessary prior to mounting the crystal in a nylon loop and vitrifying by plunging into liquid nitrogen. Data collection was performed under a cryo-cooled nitrogen stream at APS 22-BM with a beam wavelength of 0.977 Å as well as APS 24-ID-C at 1.495 Å resulting in data sets with a maximum resolution of 2.35 Å. Data were reduced in HKL2000 with 10% of reflections flagged for R.sub.Free calculation. Phases were obtained by soaking crystals in drop conditions above supplemented with 10 mM Iridium hexamine for 90 minutes and then vitrifying by plunging into liquid nitrogen. Data sets of iridium soaked crystals were collected at APS 22-ID at a wavelength of 0.957 Å. SHELXC reported a significant anomalous signal extending to 3.5 Å from a single crystal diffracting to 3.2 Å. Two heavy atom sites were located by SHELXD with density modification performed in SHELXE resulting in an uninterpretable map. Sites from SHELXD were loaded into AutoSol resulting in phase solution with a figure of merit of 0.22. The resulting density modified map showed decent density contrast for a helical region allowing for 16 bases to be modeled directly into the SAD map. This model was then refined using Pehnix.refine and molecular replaced into the native data set (2.35 Å resolution) collected at APS 22-BM using the program Phaser, resulting in a TFZ score of 12.1. Manuel building and refinement was performed in Coot and Phenix.refine, respectively, using the HL coefficients generated from the Iridium dataset as a target.
(210) Mango-III-A15U-TO1-Biotin was crystallized by adding 0.2 μl of RNA 2 solution (300 μM, prepared similarly to above with addition of TO1-Biotin) and 0.2 μl reservoir solution were mixed and equilibrated against 1.6 M Ammonium Citrate, 3.0% glycerol and 4% Acetone. Strongly fluorescent, equilateral triangular rod like crystals, grew in 1-2 days with dimensions of 80×(20×20×20) μm. Supplementation of the growth conditions was not necessary for cryoprotection. Crystals were mounted in a nylon loop and vitrifying by plunging into liquid nitrogen. Data were collected at ALS beamline 502 at a wavelength of 1.105 Å. Data were reduced in DIALS with 5% of reflections being flagged for R.sub.Free calculation. Phasing was performed by molecular replacement using the program Phaser with coordinates from the Mango-III-TO1 structure from above with residues 1, 2, 15, 22, 37 and 38 deleted along with the TO1 ligand. A replacement solution was found with a TFZ score of 15.2. Multiple rounds of building and refinement were performed in Coot and Phenix.refine respectively. Simulated annealing was performed every 6 refinement cycles at 5000 K until an R.sub.Free of 0.25 was reached. A new set of R.sub.Free flags composing 10% of reflections was selected and building and refinement continued with 4 rounds of simulated annealing.
(211) Analytical Ultracentrifugation
(212) Analytical Ultracentrifugation was performed on RNA 1 in the presence and absence of TO1-Biotin. Cells contained RNA Mango at 5 μM concentration in addition to 20 mM MOPS-KOH, pH 7.0, 150 mM KCl, 10 μM EDTA. Samples were prepared as noted above. 500 scans were collected and averaged on a Beckman XLI analytical ultracentrifuge. Absorbance was measured at 295 nm, under constant velocity with a run speed of 60,000 r.p.m. at 20° C. The viscosity and density of the buffer were calculated to be 0.01015 P and 1.0068 g m1.sup.−1, respectively, with the Sednterp server (http://rasmb.org/sednterp).
(213) Fluorescence Binding Experiments
(214) RNA Preparation
(215) RNAs 3-10 were in vitro transcribed via run off transcription with oligonucleotides purchased from IDT and purified by electrophoresis on 10% polyacrylamide (19:1 acrylamide/bisacrylamide), 1×TBE, 8M Urea gels; electroeluted from gel slices; washed once with 1M KCl; desalted by ultrafiltration. RNA concentrations were determined by reading the Absorbance at 260 nm on a NanoDrop Spectrophotometer (ThermoFisher Scientific), and using the extinction coefficients determined with the nearest neighbor method using the IDT OligoAnalyzer online tool.
(216) Binding Affinity Measurements
(217) Fluorescence readings were recorded using a Varian Cary Eclipse Spectrophotometer set to measure at the maximum excitation and emission wavelengths of the Mango II aptamer dye complex. Fluorescence titrations were performed in Mango selection buffer (WB: 140 mM KCl, 1 mM MgCl.sub.2, 10 mM NaH.sub.2PO.sub.4 pH 7.2, 0.05% Tween-20). To determine binding affinity and Fmax, curves were fitted using least squares (Kaleidagraph 4.5) using the following equation for TO1-Biotin:
(218)
Or to the following equation for TO3-Biotin:
(219)
Fluorescence Enhancement Measurements
(220) Fluorescence enhancement experiments were performed on a Photon Technologies International/820 Photomultiplier Detection System with an excitation and emission wavelength centered at 510 nm and 535 nm, respectively, for TO1-Biotin and TO1 derivatives while TO3-Biotin excitation and emission were 635 nm and 660 nm, respectively. The bandwidth for all measurements was 1.5 nm for all experiments. Measurements were performed in a 0.2 cm path length cuvette in a background of 20 mM MOPS pH 7.0, 150 mM KCl, 10 μM EDTA. Fluorescence readings were taken in the absence of RNA at a ligand concentration of 0.82 μM. A concentrated, annealed stock of RNA was then added to the cuvette resulting in a final concentration of 2 μM RNA and allowed to equilibrate for 1 minute prior to taking an emission reading. Fluorescence enhancement was determined by dividing the fluorescence signal of ligand in the presence of RNA by the fluorescence signal in the absence of RNA corrected for the background of the instrument.
(221) Fluorescence Lifetime Measurements
(222) Fluorophore lifetime measurements were performed by using an in-house modified 2-photon fluorescence microscope based on a Zeiss LSM 510 unit capable of Time-Correlated Single-Photon Counting (TCSPC) measurements. A diode-pumped solid state laser (Millenia Prime, Spectra Physics, Newport, Calif.) was used to pump a Ti:Sapphire Tsunami oscillator (Model 3960C, Spectra Physics, Newport, Calif.), operating in femtosecond mode, at a repetition rate of 80 MHz, and tunable in the near infrared region. The output beam of the Ti:Sapphire laser was directed into an acousto-opto modulator (MT110/B50/A1.5 IR/S, AA Optoelectronic, France), controlled through the Zeiss LSM electronics and software, to attenuate the power before steering it into the LSM unit. The beam was reflected onto a 700/488 dichroic mirror and directed into the back aperture of a Plan Apochromat 63×, NA 1.4, oil immersion objective, and expanded to fill the back pupil. The fluorescence from the sample was collected from the same objective, intercepted by a 733LP dichroic mirror, sent toward the back port of the microscope, filtered through an ET700SP-2P filter (Chroma Technologies, Bellows Falls, Vt.) to remove residual scattering from the laser, and further passed through a 540/50 nm bandpass filter (Semrock, Rochester, N.Y.). The fluorescence is finally focused onto the photocathode of a H7422P-40 GaAsP photomultiplier detector (Hamamatsu, Japan). The large NA of the objective contributes to a certain degree of depolarization of the incoming excitation beam, as well as of the detected fluorescence. According to Fisz (J. Chem. Phys. A, 2007 and 2009), this would allow one to omit an analyzer (polarizer) in front of our detector, because magic angle conditions are achieved by using a 45° angle detection (i.e. unpolarized) configuration. The signal from the detector and the synchronization signal from the laser are directed into an SPC150 photon counting card (Becker & Hickl, Germany), controlled by the SPCM64 proprietary software from the manufacturer (Becker & Hickl, Germany). The data were collected with a 12.5 ns time window in TCSPC histogramming mode with 1024 channels, with a width of 12.2 ps each.
(223) For the experiments the laser was tuned at 780 nm, and the power adjusted to 18 mW before the objective lens. RNA samples were diluted to a concentration of ˜3-5 μM in buffer. TO-1B was measured at a concentration of 50 μM due to low fluorescence signal of the compound, compared to the RNA-bound version. An 80 μl droplet was deposited onto a #1.5 coverslip, previously treated with BSA to avoid nonspecific binding of RNA to the glass, and covered to avoid evaporation. The excitation was focused ˜5 μm above the upper surface of the coverslip to reduce scatter and to avoid collecting signal from molecules immobilized on the glass surface. The beam was kept stationary by using the LSM controller to simply open the excitation shutter, and data were collected until the maximum count in the peak channel of the TCSPC histogram reached 10.sup.4 photons. Experiments were repeated in triplicate. An instrument response function (IRF) was collected on every day of measurement by recording the second harmonic generation (SHG) signal from crushed urea crystals deposited onto a glass coverslip, in this case the bandpass filter before the detector was substituted with a 440 nm short pass filter to collect the 390 nm SHG. The data collected with the SPCM64 software were stored as *.sdt files for subsequent analysis.
(224) Fluorescence Lifetime Data Analysis
(225) Data were analyzed using the SPCImage software (Becker & Hickl, Germany). The fluorescence decay curves were fit using exponential functions of the form:
(226)
(227) Where n is at most equal to 3 in our software. The data fitting routine uses a least-square algorithm where the exponential function is first reconvoluted with the measured IRF and then fit to the data. The shift of the IRF for each dataset, as well as a scatter contribution were included as free parameters during fitting. The number of exponentials used to fit the data was adapted in order to minimize the χ.sup.2 value, which together with the randomness of the residuals was used to evaluate the goodness of the fit.
REFERENCES
(228) 1. Otwinski, Z. & Minor, W. Processing of X-ray diffraction data collected in oscillation mode. Methods Enzymol. 276, 307-326 2. Kabsch, W. XDS. Acta Cryst. D Biol Crystallogr 66, 125-132 (2010) 3. McCoy, A. J. et al. Phaser crystallographic software. J. Appl. Cryst. 40, 658-674 (2007) 4. Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. Features and development of Coot. Acta Crystallogr. D Biol. Crystallogr. 66, 486-501 5. Adams, P. D. et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr. D Biol Crystallogr. 66, 213-221 (2010)