METHOD FOR INCREASING YIELD IN PLANTS
20220259611 · 2022-08-18
Inventors
- Bertrand HIREL (Versailles Cedex, FR)
- Hervé LASSAGNE (Chappes, FR)
- Sébastien PRAUD (Glaine Montaigut, FR)
- Marie-Héléne TIXIER (Chappes, FR)
- Thérèse TERCÉ-LAFORGUE (Saint- Germain-en-Laye, FR)
Cpc classification
C12N15/8261
CHEMISTRY; METALLURGY
A01H6/46
HUMAN NECESSITIES
Y02A40/146
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
The invention relates to a method for obtaining plants presenting a higher yield by inhibition of the GDH2 activity in the plants.
Claims
1.-15. (canceled)
16. A cereal comprising at least one cell which presents an inhibition of GDH2 activity.
17. The cereal of claim 16, wherein the inhibition of GDH2 activity is due to a mutation in the gdh2 gene.
18. The cereal of claim 16, wherein the mutation in the gdh2 gene is obtained by one of the following methods: a. a physical treatment, wherein the physical treatment comprises applying an electromagnetic radiation or a particle radiation to the cereal b. a chemical treatment, wherein the chemical treatment comprises exposing the seeds, gametes or plant parts of the cereal to a chemical, or c. an engineering biological system, wherein the engineering biological system comprises Gene editing, base editing or Genetic Modification.
19. The cereal of claim 17, wherein the sequence of the gdh2 gene encodes the GDH2 enzyme depicted by SEQ ID NO: 1.
20. The cereal of claim 16, which is maize.
21. The cereal of claim 20, wherein the inhibition of GDH2 activity is due to an insertion between nucleotides 814 and 815 of SEQ ID NO: 2.
22. The cereal of claim 20, wherein inhibition of GHD2 activity is due to introduction of a mutation in SEQ ID NO: 2 by gene editing.
23. The cereal of claim 16, wherein inhibition of GHD2 activity is due to the presence in the genome of said cereal of an antisense, or of an overexpression construct (leading to co-suppression), or of an RNAi construct.
24. A method for improving yield in a cereal, comprising inhibiting GDH2 activity in said cereal, wherein said cereal with inhibited GDH2 activity presents a higher yield than a cereal not having inhibited GDH2 activity.
25. The method of claim 24, wherein said cereal is maize.
26. The method of claim 24, wherein the inhibition of GDH2 activity is obtained by: a. an insertional mutagenesis or the introduction of at least one point mutation, b. the expression of an antisense or RNAi construct or the overexpression of a sense construct to cause co-suppression wherein the constructs are integrated in the cereal's genome, or c. the removal of part of the gdh2 gene or of the entire gene
27. A method for increasing cereal yield, comprising sowing cereal seeds, wherein said cereal seeds grow into plants that exhibit inhibited GDH2 activity, and wherein the yield of the cereals is increased as compared to the yield obtained from cereals not exhibiting inhibited GDH2 activity.
28. A method for identifying the cereal of claim 16 comprising: (a) screening a population of cereals, and (b) identifying the cereals presenting inhibition of GDH2 activity.
29. The cereal of claim 17, which is maize.
30. The cereal of claim 19, which is maize.
31. The cereal of claim 19, wherein inhibition of GHD2 activity is due to the presence in the genome of said cereal of an antisense, or of an overexpression construct (leading to co-suppression), or of an RNAi construct.
32. The cereal of claim 20, wherein inhibition of GHD2 activity is due to the presence in the genome of said cereal of an antisense, or of an overexpression construct (leading to co-suppression), or of an RNAi construct.
33. The cereal of claim 16, wherein all cells present an inhibition of the GDH2 activity.
34. The cereal of claim 33, which is maize.
Description
DESCRIPTION OF THE FIGURES
[0125]
[0126]
[0127]
[0128]
[0129]
EXAMPLES
Example 1
Identification of a Maize Having an Insert in the GDH2 Gene
[0130] A maize line having an insertion of a transposable element between position chr10:135303729-135303730 (RefGenV4) of the reference sequence in the GDH2 gene (Zm00001d025984) is isolated. The allele thus obtained is named D0425.
[0131] The insert of the transposable element is located in the end of the first exon (translated region) of the GDH2 gene (
[0132] In order to determine if the insertion is in homozygous or heterozygous form, three primers were defined according to the PCR-based KASP technology: one allele-specific forward primer of the GDH2 sequence (named D0425_EPF_F04_vic: ATCGAAGCTGCTCGGCCTC (SEQ ID NO: 22)) with a proprietary tail sequence corresponding with VIC dye, one allele-specific forward primer of the endogenous transposable element (named OMuA_G_fam: CTTCGTCCATAATGGCAATTATCTCG (SEQ ID NO: 23)) with a proprietary tail sequence corresponding with FAM dye and a third common allele-specific reverse primer of the GDH2 gene (named D0425_EPF_R04: AGACGCCACAAGCAACACG (SEQ ID NO: 24)).
[0133] These three primers may be used simultaneously in a PCR amplification experiment (Kaspar protocol LGC Genomics) starting with genomic DNA (hybridization temperature=57° C.). End point fluorescence read, and clusters analysis of the samples reveal: [0134] Vic fluorescence for homozygous WT plants [0135] Fam fluorescence for homozygous mutant plants; [0136] Both vic and fam fluorescence for the heterozygous plants.
[0137] The results, presented in
Example 2
Crossing to Obtain the Homozygous And Heterozygous Lines Tested in 2017 Trials
[0138] Introgression lines carrying or not the mutation were constructed so as to obtain mutants and a control differing only by the presence of the mutation. The introgression lines obtained were then crossed with each other in order to evaluate homozygous, heterozygous and wild type hybrids in a trial on summer 2017.
Example 3
In Gel Activity of the WT and GDH2 Homozygous and Heterozygous Lines
[0139] Protein extracts of the roots and leaves of the L1 wild type (WT) and L1 GDH2 homozygous and heterozygous mutants were subjected to native PAGE followed by NAD-GDH in-gel activity staining (Restivo et al. 2004) (
Example 4
Phenotype Analysis of the D0425 Mutant in a Hybrid Context for the Improvement of Yield in Optimal Condition on Summer 2017
[0140] Homozygous mutant hybrids, heterozygous mutant hybrids and wild type hybrids as a control were all evaluated in a trial on summer 2017. The experiment was carried out according to the following protocol:
[0141] 1 location (St PAUL Les Romans/Drome/France)
[0142] 6 replicates
[0143] optimal condition for water and nitrogen requirements (OPT)
[0144] The measured traits were:
[0145] Grain yield 15% (GY15%): shelled grain weight per plot adjusted to 15% grain moisture and converted to quintals per hectare.
[0146] Kernel numbers per square meters (K/m.sup.2): grain numbers per square meters calculated from grain yield estimation and thousand kernels weight
[0147] Thousand kernels weight (TKW): Weight of 1000 kernels randomly selected from the total kernels and adjusted to 15% moisture content.
[0148] Statistical analyses (ANOVA) were carried out to know if there was a difference between the different types of hybrids (homozygous for the mutation (mm), heterozygous for the mutation (m+) and wild-type control (wt)).
[0149] The results demonstrate that the insertion of a transposon into the GDH2 gene significantly (pvalue<5%) increases grain yield and kernel number per squares meters in optimal conditions (
[0150] For grain yield, the analysis of variance is
TABLE-US-00001 TABLE 1 Analysis of variance for grain yield with reference to FIG. 3A Sum of Mean Source DF squares square F Ration Prob > F Allele 2 178.45789 89.2289 7.6745 0.0051* Error 15 174.40032 11.6267 C. Total 17 352.85820
[0151] For kernel number per surface unit, the analysis of variance is
TABLE-US-00002 TABLE 2 Analysis of variance for grain yield with reference to FIG. 3B Sum of Mean Source DF squares square F Ration Prob > F Allele 2 461218.66 230609 8.4121 0.0035* Error 15 411208.41 27414 C. Total 17 872427.07
[0152] The analysis of variance for both parameters shows that the measured difference of yield and kernel number between the wild-type and mutant plants is significant.
Example 5
Gene Editing Experiments
[0153] In Example 1, the transposon is positioned between bases 814 et 815 in the GDH2 gene sequence (SEQ ID NO: 2). Such gene interruption within this region can be reproduced with gene editing technologies.
[0154] The GDH2 gene sequence of Zea mays (SEQ ID NO: 2) was analyzed in silico to detect possible PAM corresponding to SpCas9 and FnCpf1 in the region of the insertion in the mutant from Example 1.
[0155] Two targets were found for SpCas9 and one for FnCpf1 and so three guide RNAs were designed. (SEQ ID NO: 15-16-17), respectively guide SpCas9-Target-90, guide SpCas9-Target-96, and guide FnCpf1-Target-91.
[0156] The proTaU6::SpCas9-Target-90::polyT cassette sequence and proZmUBI_intZmUBI::SpCAS9::terAtNOS cassette sequence were cloned via restriction enzyme reaction into a destination binary plasmid. The binary destination vector which contains a HMWG promoter driving a reporter gene to product a green fluorescent protein and an actin promoter (proOsActin) driving a bar gene which confers herbicide basta resistance is a derivative of the binary vector pMRT (WO2001018192A3). Maize cells are transformed by Agrobacterium tumefaciens according to Komari et al (1996). Maize cultivar A188 is transformed with these agrobacterial strains essentially as described by Ishida et al (1996).
[0157] proTaU6: SEQ ID NO: 18
[0158] proZmUBI_intZmUBI: SEQ ID NO: 19
[0159] terAtNos: SEQ ID NO: 20
[0160] polyT: SEQ ID NO: 21
[0161] In the same way, proTaU6::SpCas9-Target-96::polyT cassette sequence and proZmUBI_intZmUBI::SpCAS9::terAtNOS cassette sequence were cloned via restriction enzyme reaction and transformed into maize cells.
[0162] In the same way, proTaU6::FnCpf1-Target-91::polyT cassette sequence and proZmUBI_intZmUBI::FnCpft:terAtNOS cassette sequence were cloned via restriction enzyme reaction and transformed into maize cells.
Example 6
Root Amino-Acid Content in the GDH2 Mutants
[0163] The roots and shoots of homozygous mutant hybrids (mm), heterozygous mutant hybrids (m+) and wild type hybrids (WT) were sampled using plants having 6 fully developed leaves. Plants were grown on coarse sand in a controlled environment growth chamber (16 h light, 350-400 mmol photons.m-2.Math.s-1, 26° C.; 8 h dark, 18° C.) and watered with a C solution containing 10 mM NO3- and 2 mM NH4+ (Cöic and Lesaint 1971). Amino acid extraction and quantification by GC-MS analysis were conducted as described by Cukier et al. (2018).
[0164] At 50-80% increase in the glutamate content and of all the amino acids derived from glutamate (Alanine, GABA, Asparagine, Glutamine, Serine, Glycine) was observed in the roots of maize hybrids carrying a homozygous mutation (mm) for the gene encoding Gdh2 (
[0165] Such an increase was less marked in the heterozygous hybrid mutants (m+) suggesting a dose-dependent effect of the mutation. Such an increase was not observed in shoots likely because the enzyme activity is at least five times higher in roots compared to the shoots (
REFERENCES
[0166] Coïc Y, Lesaint C (1971) Comment assurer une bonne nutrition en eau et en ions minéraux en horticulture. Hortic Française 8: 11-14
[0167] Cukier, C., Lea, P. J., Cañas, R., Marmagne, A., Limami, A. M., Hirel, B. 2018 Labeling maize (Zea mays L.) leaves with 15NH.sub.4.sup.+ and monitoring nitrogen incorporation into amino acids by GC/MS analysis. Curr. Prot. Plant Biol. doi.org/10.1002/cppb.20073.
[0168] Dubois F, Tercé-Laforgue T, Gonzalez-Moro M B, Estavillo M B, Sangwan R,
[0169] Gallais A, Hirel B (2003) Glutamate dehydrogenase in plants: is there a new story for an old enzyme? Plant Physiol Biochem. 41: 565-576.
[0170] Fontaine J X, Saladino F, Agrimonti C, Bedu M, Tercé-Laforgue T, Tétu T, Hirel B, Restivo F M, Dubois F (2006) Control of the Synthesis and of the Subcellular Targeting of the Two GDH Genes Products in Leaves and Stems of Nicotiana plumbaginifolia and Arabidopsis thaliana. Plant Cell Physiol. 47: 410-418.
[0171] Fontaine J X, Tercé-Laforgue T, Armengaud P, Clément G, Renou J P, Pelletier S, Catterou M, Azzopardi M, Gibon Y, Lea P J, Hirel B, Dubois F (2012) Characterization of a NADH-dependent glutamate dehydrogenase mutant of Arabidopsis demonstrates the key role of this enzyme in root carbon and nitrogen metabolism. Plant Cell 24: 4044-4065.
[0172] Fontaine J X, Tercé-Laforgue T, Bouton S, Pageau K, Lea P J, Dubois F, Hirel B (2013) Further insights into the isoenzyme composition and activity of glutamate dehydrogenase in Arabidopsis Thaliana. Plant Signal. Behay. 8: 3, e233291-5.
[0173] Grabowska A, Zdunek-Zastocka E, Kutryn E, Kwinta J (2017) Molecular cloning and functional analysis of the second gene encoding glutamate dehydrogenase in triticale. Acta Physiol. Plant. 39:24
[0174] Hirel B, Martin A, Tercé-Laforgue T, Gonzalez-Moro M B, Estavillo J M (2005) Physiology of maize I: A comprehensive and integrated view of nitrogen metabolism in a C4 plant. Physiol. Plant. 124: 167-177.
[0175] Hirel B, Le Gouis J, Ney B, Gallais A (2007) The challenge of improving nitrogen use efficiency in crop plants: towards a more central role for genetic variability and quantitative genetics within integrated approaches. J. Exp. Bot. 58: 2369-2387.
[0176] Labboun S, Tercé-Laforgue T, Roscher A, Bedu M, Restivo F M, Velanis C N, Skopelitis D S, Moshou P N, Roubelakis-Angelakis K A, Suzuki A. Hirel B (2009) Resolving the role of plant glutamate dehydrogenase: I. In vivo real time nuclear magnetic resonance spectroscopy experiments. Plant Cell Physiol 50: 1761-1773.
[0177] Lightfoot D A, Mungur R, Ameziane R, Nolte S, Long L, Bernhard K, Colter A, Jones K, Iqbal M J, Varsa E, Young B (2007) Improved drought tolerance of transgenic Zea mays plants that express the glutamate dehydrogenase gene (gdhA) of E. coli. Euphytica 156: 103-116.
[0178] Loulakakis K A, Roubelakis-Angelakis K A (1992) Ammonium-induced increase in NADH-glutamate dehydrogenase activity is caused by de novo synthesis of the α-subunit. Planta 187: 322-327.
[0179] Loulakakis K A, and Roubelakis-Angelakis K A (1996) The seven NAD(H)-glutamate dehydrogenase isoenzymes exhibit similar anabolic activities. Physiol. Plant. 96: 29-35.
[0180] Melo-Oliveira R, Oliveira I C, Coruzzi G M (1996) Arabidopsis mutant analysis and gene regulation define a non-redundant role for glutamate dehydrogenase in nitrogen assimilation. Proc. Natl. Acad, Sci. USA 96: 4718-4723.
[0181] Pavesi A, Ficarelli A, Tassi F, Restivo F M (2000) Cloning of two glutamate dehydrogenase cDNAs from Asparagus officinalis: sequence analysis and evolutionary implications. Genome 4: 306-316.
[0182] Purnell M P, Skopelitis D S, Roubelakis-Angelakis K A, Botella J R (2005) Modulation of higher-plant NADH-dependent glutamate dehydrogenase activity in transgenic tobacco via alteration of beta subunit levels. Planta 222: 167-180.
[0183] Restivo F M (2004) Molecular cloning of glutamate dehydrogenase genes of Nicotiana plumbaginifolia: structure and regulation of their expression by physiological and stress conditions. Plant Sci. 166: 971-982.
[0184] Skopelitis D S, Paranychiankis N V, Paschalidis K A, Plianokis E D, Delis I D, Yakoumakis D I, Kouvarakis A, Papadakis E D, Stephanou E G, Roubelakis-Angelakis K A (2006) Abiotic stress generates ROS that signal expression of anionic glutamate dehydrogenase to form glutamate for proline synthesis in tobacco and grapevine. Plant Cell 18: 2767-2781.
[0185] Tercé-Laforgue T, Bedu M, Dargel-Graffin C, Dubois F, Gibon Y, Restivo F M, Hirel B, (2013) Resolving the role of plant glutamate dehydrogenase: II. Physiological Characterization of plants overexpressing individually or simultaneously the two enzyme subunits. Plant. Cell. Physiol. 54: 1634-1647.
[0186] Tercé-Laforgue T, Clément G, Marchi L, Restivo F M, Lea P J, Hirel B (2015). Resolving the role of plant NAD-glutamate dehydrogenase: Ill. Overexpressing individually or simultaneously the two enzyme subunits under salt stress induces changes in the leaf metabolic profile and increases plant biomass production. Plant Cell Physiol. 56: 1918-1929.
[0187] Turano F J, Dashner R, Upadhyaya A, Caldwell C R (1996) Purification of mitochondrial glutamate dehydrogenase from dark-grown soybean seedlings. Plant Physiol. 112: 1357-1364.
[0188] Zhou X, Lin J, Zhou Y, yang Y, Liu H, Zhang C, Tang D, Zhao X, Zhu Y, Liu X (2015) Overexpressing a fungal CeGDH gene improves nitrogen utilization and growth in rice. Crop Sci 55: 811-820.