METHOD FOR IDENTIFYING WHETHER A DIPLOID POTATO IS SELF-COMPATIBLE

Abstract

The present application relates to the technical field of genetic breeding, and provides a method for identifying whether a diploid potato is self-compatible. The method relates to identifying whether a StSCI gene in the diploid potato is transcribed and expressed. Also disclosed is a method for identifying whether a StSCI gene is expressed by using molecular marker, and a method of screening for the molecular marker, which includes: obtaining the genome sequence information of parental materials, screening for difference sites of the parental materials, screening for the molecular marker, and identifying whether the screened molecular marker are usable. As for the identification of the self-compatibility of a diploid potato by using the screened molecular marker, the identification workload is small, a lot of time is saved, and the identification result is not affected by the environment, and it is accurate and reliable.

Claims

1. A method for identifying whether a diploid potato is self-compatible, comprising identifying whether the StSCI gene in the diploid potato is transcribed and expressed.

2. The method according to claim 1, wherein the nucleotide sequence of the StSCI gene comprises or consists of the following sequence: 1) the nucleotide sequence represented by SEQ ID NO: 1; or 2) the complementary sequence, degenerate sequence or homologous sequence of the nucleotide sequence represented by SEQ ID NO: 1; wherein the homologous sequence is a polynucleotide sequence having at least 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, 99.9% or more identity with the nucleotide sequence represented by SEQ ID NO: 1.

3. The method according to claim 1, wherein the presence of a molecular marker is used to predict whether the StSCI gene is expressed.

4. The method according to claim 3, wherein a method of screening for a molecular marker includes the following steps: (a) obtaining the genome sequence information of the parent materials: when the self-compatible diploid potato RH89-039-16 and the self-incompatible diploid potato are used as parent materials, re-sequencing the genome of RH89-039-16 and the self-incompatible diploid potato to obtain the genome sequence information; or developing corresponding primers according to the sequence information of the reference genome, performing PCR amplification on the target gene fragment of the parent materials, and sequencing the amplified products to obtain the sequence information of the specific fragment of the parent materials; (b) screening for a difference site of the parental materials: comparing the sequence information of the two parental materials RH89-039-16 and the self-incompatible diploid potato, and screening out the difference site of the nucleotide sequence of the StSCI gene and/or the nucleotide sequence of the StSCI gene linkage; the difference site of the nucleotide sequence comprise: single-base difference site and/or InDel marker; (c) screening for a molecular marker: designing primer sequences of a KASP marker for the single-base difference site selected in step (b); and/or designing primer sequences of a InDel marker for the InDel marker selected in step (b); (d) identifying whether the screened molecular marker is usable: identifying whether the genome sequencing results of the molecular marker screened in step (c) is identical to those of the RH89-039-16 and the self-incompatible diploid potato parent materials, as well as the hybrid offspring of the RH89-039-16 and the self-incompatible diploid potato.

5. The method according to claim 4, wherein in the step (b), the genetic distance of gene linkage is less than 20 cM.

6. The method according to claim 4, wherein in the step (b), through analyzing the nucleotide sequence of the StSCI gene and/or the nucleotide sequence of the StSCI gene linkage, screening out the RH89-039-16 in which the promoter region of the StSCI gene is inserted a nucleotide sequence fragment as compared with the self-incompatible diploid potato, wherein the nucleotide sequence fragment comprises or consists of the following sequence: 1) the nucleotide sequence represented by SEQ ID NO: 2; or 2) a functional homologous sequence having at least 90% sequence identity with the nucleotide sequence represented by SEQ ID NO: 2; or, 3) a polynucleotide hybridizing to the nucleotide sequence represented by SEQ ID NO: 2 under stringent conditions.

7. The molecular marker obtained by the method according to claim 4.

8. The molecular marker according to claim 7, wherein the molecular marker is one or a combination of more selected from the group consisting of: KASP marker, InDel marker, RFLP marker, RAPD marker, SSR marker, SSLP marker, AFLP marker, STS marker, or EST marker.

9. The molecular marker according to claim 7, wherein the molecular marker is KASP molecular marker.

10. The molecular marker according to claim 7, wherein the molecular marker is InDel molecular marker.

11. A PCR primer for identifying the molecular marker according claim 7.

12. The PCR primer according to claim 11, wherein the primer is an upstream primer and/or a downstream primer, the upstream primer comprises the sequence of SEQ ID NO: 3, and the downstream primer comprises the sequence of SEQ ID NO: 4; and/or the upstream primer comprises the sequence of SEQ ID NO: 5, and the downstream primer comprises the sequence of SEQ ID NO: 6; and/or the upstream primer comprises the sequence of SEQ ID NO: 7, and the downstream primer comprises the sequence of SEQ ID NO: 8; and/or the upstream primer comprises the sequence of SEQ ID NO: 9, and the downstream primer comprises the sequence of SEQ ID NO: 10.

13. A reagent comprising the PCR primer for identifying the molecular marker according to claim 11.

14. A kit comprising PCR primer for identifying the molecular marker according to claim 11.

15. A kit comprising the reagent according to claim 13.

16. A method for identifying whether a diploid potato is self-compatible, comprising identifying whether the diploid potato is self-compatible by using the molecular marker according to claim 7.

17. The method according to claim 16, comprising the following steps: (i) performing hybridization by using the self-compatible diploid potato RH89-039-16 and the self-incompatible diploid potato as the parent materials to obtain the hybrid offspring of the diploid potatoes; (ii) extracting the leaf genome of the hybrid offspring of the diploid potatoes when they grow to the seedling stage; (iii) identifying the leaf genome by using the molecular marker, and determining whether the hybrid offspring of the diploid potatoes are self-compatible according to the identification results of the molecular marker.

18. The method according to claim 16, comprising the following steps: (i) performing hybridization by using the self-compatible diploid potato RH89-039-16 and the self-incompatible diploid potato as the parent materials to obtain the hybrid offspring of the diploid potatoes; (ii) extracting RNA from the plant cells of the hybrid offspring of the diploid potatoes, detecting the presence or absence of StSCI gene mRNA itself or its characteristic fragments in the plant cells of the hybrid offspring of the diploid potatoes by PCR method.

19. A method for identifying whether a diploid potato is self-compatible, comprising identifying whether the diploid potato is self-compatible by using the reagent according to claim 13.

20. A method for identifying whether a diploid potato is self-compatible, comprising identifying whether the diploid potato is self-compatible by using the kit according to claim 14.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0088] FIG. 1 is an agarose gel electrophoresis detection figure of the PCR reaction product in Example 1;

[0089] FIG. 2 shows the expressions of StSCI gene in individual plants A and B in Example 1;

[0090] FIG. 3 shows the identification of the self-compatibility phenotype of the hybrid offspring in Example 1.

DETAILED DESCRIPTION OF EMBODIMENTS

[0091] The technical solutions in the Examples of the present application will be clearly and completely described below, with reference to the drawings in the Examples of the present application. Obviously, the described examples are only a part of the examples of the present application, rather than all the examples. Based on the examples in this application, all other examples obtained by those of ordinary skill in the art without creative work shall fall within the protection scope of this application.

Definition

[0092] The term “self-compatibility” refers to the ability to produce seeds through self-pollination and self-fertilization, and the seeds may grow into fertile offspring and produce seeds.

[0093] As used herein, the term “diploid” refers to that each vegetative cell in a plant includes two sets of chromosomes (2x=2n, where n is the number of chromosomes). A set of chromosomes is provided by two parents.

[0094] As used herein, the term “gene” refers to a genetic unit (usually represented by a DNA sequence) occupying a specific location in a chromosome and including genetic instructions that contribute to the potential phenotypic characteristics or traits of a plant.

[0095] As used herein, the term “hybridization” refers to using male plants (or gametes) to fertilize female plants (or gametes). The term “gamete” refers to a haploid germ cell (egg or sperm) involved in sexual reproduction produced in a plant by gametophyte mitosis, wherein the two heterosexual gametes fuse to form a diploid zygote during sexual reproduction process. This term generally refers to pollen (including sperm cells) and ovules (including egg cells). Therefore, “hybridization” usually refers to fertilizing an individual's ovule with the pollen of another individual.

[0096] The term “recombination” refers to the exchange of information between two homologous chromosomes during meiosis. In a “recombinant” plant, DNA originally present at a specific location within the chromosome (for example, linked to a gene/site) is exchanged with DNA from another plant (i.e., exchanging between female parent and male parent or vice versa).

[0097] The term “single-abase difference site”, i.e., single nucleotide polymorphism (SNP), refers to the difference site of a single nucleotide (base) at the genomic level existing in two parents.

[0098] The term “KASP marker”, KASP is the abbreviation of Kompetitive Allele Specific PCR.

[0099] The term “KASP marker primer” is a primer designed and developed for a single-base difference site.

[0100] The term “insertion-deletion marker”, i.e. InDel (insertion-deletion), refers to the difference in the genome between the two parents. Compared with the other parent, a certain number of nucleotide insertions or deletions exist in the genome of one parent.

[0101] The term “InDel marker primer” refers to a PCR primer designed to amplify the InDel sites according to these InDel sites in the genome.

Example 1

[0102] A method for identifying whether a diploid potato is self-compatible, including the following steps:

[0103] (1) Re-Sequencing the Genomes of the Parental Materials RH89-039-16 and PI 225689:

[0104] RH89-039-16 is a self-compatible potato diploid material, and PI 225689 is a self-incompatible diploid potato material; after using these two materials as the parents for hybridization, the offspring have segregated traits of self-compatibility and self-incompatibility. In order to accurately identify the self-compatibility phenotype of the offspring, the parent materials RH89-039-16 and PI 225689 are re-sequenced to obtain the sequence information of the two materials.

[0105] (2) Developing Molecular Markers Co-Segregating with StSCI Gene in Parent Materials RH89-039-16 and PI 225689:

[0106] After comparing the sequence information of the chromosome fragments including the StSCI gene in the parent materials RH89-039-16 and PI 225689, it is found that a 538 bp (SEQ ID NO: 2) nucleotide sequence has been inserted into the promoter region of the StSCI gene in RH89-039-16. A pair of InDel molecular markers are designed according to this inserted sequence, and the primer sequences are as follows:

TABLE-US-00001 F: (SEQ ID NO: 9) 5′-CGTCGGATTCAGCAGCAGAGTT-3′; R: (SEQ ID NO: 10) 5′-AAGCGAATTACAAGCCTGTTTAGATTGAC-3′.

[0107] (3) Identifying the Phenotype of Hybrid Offspring Plants by Using InDel Molecular Markers:

[0108] When the hybrid offspring plants grow to the seedling stage, the leaf genome is extracted for PCR amplification reaction by using the primers in step (2), and the genomic DNA to be tested is used as a template.

[0109] A 20 μl amplification system is used in the PCR reaction: 1 μl of 10-20 ng/μl template DNA, 1 μl of 10 pmol/μl primers F and R respectively, 0.4 μl of 10 mmol/L dNTP mix, 0.3 μl of 0.5 U/μL Taq DNA polymerase, 2 μl of 10×PCR reaction buffer, and the rest is water.

[0110] PCR reaction conditions are: 94° C. for 5 min; 94° C. for 20 sec, 55° C. for 20 sec, 72° C. for 30 sec, 35 cycles; 72° C. for 10 min.

[0111] The PCR reaction product is detected by agarose gel electrophoresis, and the results are shown in FIG. 1. If the fragment of 428 bp may be amplified, then it indicates that the individual plant is self-compatible; if the fragment cannot be amplified, then it indicates that the individual plant is self-incompatible.

[0112] (4) Identifying the Expression of StSCI Gene in Individual Offspring Plant by Quantitative PCR:

[0113] In order to verify the expression of the StSCI gene in the self-compatible individual plant identified by molecular markers, as for the hybrid offspring when the individual hybrid plant A which is identified as self-incompatible and the individual hybrid plant B which is identified as self-incompatible by molecular markers grow to full flowering stage, the pollen of the plants is removed out by tweezers, and the total RNA in the pollen and leaves is extracted by using a total RNA extraction kit (Cat. No. DP419) from Tiangen Biotech Co. Ltd. according to the operation instructions, conducting reverse transcription by using TaKaRa Reverse Kit (Cat. No. RR047A) to obtain cDNA, then detecting the expression of StSCI gene by qRT-PCR with the TaKaRa Quantitative Kit (Cat. No. RR820A) according to the operation instructions. The results of the quantitative detection are shown in FIG. 2.

[0114] The primer sequences of the quantitative detection are as follows:

TABLE-US-00002 F: (SEQ ID NO: 11) 5′-ATCAGCTAGAGAACTTGCTATTTCATGGG-3′; R: (SEQ ID NO: 12) 5′-CGTGCCTCGTATGTCTAGCCAACTTA-3′.

[0115] Reverse transcription reaction system and the conditions:

[0116] Reaction for removing the genomic DNA: 2 μl of 5×g DNA Eraser Buffer, 1 μl of gDNA Eraser, 1 μl of total RNA (1 μg/μl), 6 μl of RNase Free ddH2O, 42° C. for 2 min.

[0117] Reverse transcription reaction: 10 μl product of the reaction for removing genomic DNA, 1 μl of PrimeScript RT Enzyme Mix I, 1 μl of RT Prime Mix, 4 μl of 5× PrimeScript Buffer 2, 4 μl of RNase Free ddH2O, 37° C. for 15 min, 85° C. for 5 sec.

[0118] Quantitative reaction system and the conditions:

[0119] 20 μl of system for the quantitative PCR reaction: 10 μl of TB Green Premix Ex Taq II, 0.8 μl of PCR Forward Primer, 0.8 μl of PCR Reverse Primer, 0.4 μl of ROX Reference Dye, 2 μl of DNA template, and 6 μl of RNase Free ddH2O.

[0120] Reaction conditions: 95° C. for 30 sec; 95° C. for 5 sec, 60° C. for 30 sec, 40 cycles; 95° C. for 15 sec, 60° C. for 1 min, 95° C. for 15 sec.

[0121] It may be seen from the results in FIG. 2 that, in the pollen of the self-compatible individual plant A, the StSCI gene may be expressed; while in the self-incompatible individual plant B, the StSCI gene is not expressed.

[0122] (5) Identifying the Self-Compatibility Phenotype:

[0123] The self-compatible individual plant A and the self-incompatible individual plant B are routinely self-pollinated, and the fruit setting after pollination is observed. The results are shown in FIG. 3. After self-pollination, the fruits of the self-compatible individual plant A may develop normally, however the flowers of the self-incompatible individual plant B are withered with no fruit setting.

Example 2

[0124] A method of screening for molecular markers for identifying whether a diploid potato is self-compatible, including the following steps:

[0125] (1) Obtaining the Genome Sequence Information of the Parent Materials:

[0126] Self-compatible diploid potato RH89-039-16 and self-incompatible diploid potato PI 225689 are used as parent materials to perform hybridization to obtain hybrid offspring, re-sequencing the genome of RH89-039-16 and PI 225689 to obtain the genome sequence information.

[0127] (2) Screening for the Single-Base Difference Sites of the Parental Materials:

[0128] The nucleotide sequence of the StSCI gene and the nucleotide sequence of the StSCI gene linkage are analyzed and screened to find that, a T base is located at 58030614 bp on chromosome 12 of RH89-039-16, while a C base is located at the corresponding position on the PI 225689 material.

[0129] The StSCI gene has a nucleotide sequence represented by SEQ ID NO: 1; the genetic distance of gene linkage is less than 20 cM.

[0130] (3) Designing KASP Molecular Markers:

[0131] 50 bp of base sequence is retained respectively in the upstream and downstream of the different single base sequence, and a total of 101 bp of KASP primer sequence is designed including the different single base in the middle; the primer sequence is:

TABLE-US-00003 TTATGATCTTGATAAACTATATATTATCAATATGAATGTTGTAATTGATA [T:C]ATTATTTTGAACTTTGTCCAATCTATATTAGTTATTTAAGTCATC ATATT, (SEQ ID NO: 3) and (SEQ ID NO: 4); [T:C] position is the SNP site at position 58030614;

[0132] (4) Identifying Whether the Screened Molecular Markers are Usable:

[0133] The screened KASP molecular markers are identified whether they are identical to the genome sequencing results of RH89-039-16 and PI 225689 parent materials, and the test results show that they are identical. The KASP molecular markers may be used for subsequent identification.

Example 3

[0134] A method of screening for molecular markers for identifying whether a diploid potato is self-compatible, including the following steps:

[0135] (1) Obtaining the Genome Sequence Information of the Parent Materials:

[0136] Self-compatible diploid potato RH89-039-16 and self-incompatible diploid potato PI 225689 are used as parent materials to perform hybridization to obtain hybrid offspring, re-sequencing the genome of RH89-039-16 and PI 225689 to obtain the genome sequence information.

[0137] (2) Screening for the InDel Markers of the Parental Materials:

[0138] The nucleotide sequence of the StSCI gene and the nucleotide sequence of the StSCI gene linkage are analyzed to screen out that an 11 bp nucleotide sequence is missing at position 58136285 in chromosome 12 of RH89-039-16 as compared with PI 225689.

[0139] The StSCI gene has a nucleotide sequence represented by SEQ ID NO: 1; and the genetic distance of gene linkage is less than 20 cM.

[0140] (3) Designing the InDel Molecular Markers:

[0141] An appropriate primer fragment is designed respectively upstream and downstream of the InDel site, and primers for amplifying a total of 108 bp fragment including the 11 bp missing sequence are designed. The primer sequences at both ends are as follows:

TABLE-US-00004 F: (SEQ ID NO: 5) 5′-GGTGTATCGAGTCGGAATAA-3′; R: (SEQ ID NO: 6) 5′-GATTCGGGAAATTGTACTCA-3′.

[0142] (4) Identifying Whether the Screened Molecular Markers are Usable:

[0143] The screened InDel molecular markers are identified whether they are identical to the genome sequencing results of RH89-039-16 and PI 225689 parent materials, and the test results show that they are identical. The InDel molecular markers may be used for subsequent identification.

Example 4

[0144] A method of screening for molecular markers for identifying whether a diploid potato is self-compatible, including the following steps:

[0145] (1) Sequencing the Genome of Parent Materials RH89-039-16 and C:

[0146] Self-compatible diploid potato RH89-039-16 and self-incompatible diploid potato PI 225689 are used as parent materials to perform hybridization to obtain hybrid offspring, re-sequencing the genome of RH89-039-16 and PI 225689 to obtain the genome sequence information.

[0147] (2) Screening for the InDel Markers of the Parental Materials:

[0148] The nucleotide sequence of the StSCI gene and the nucleotide sequence of the StSCI gene linkage are analyzed to screen out that a 538 bp nucleotide sequence is inserted in the promoter region of the StSCI gene.

[0149] The inserted nucleotide sequence has the nucleotide sequence represented by SEQ ID NO: 2; and the genetic distance of gene linkage is less than 10 cM.

[0150] (3) Designing the InDel Molecular Markers:

[0151] An appropriate first primer pair is designed upstream and downstream of the inserted sequence; an appropriate second primer pair is also designed upstream of the inserted sequence and in the inserted sequence. A first primer pair for amplifying a sequence including the inserted sequence in the promoter region and a second primer pair for amplifying part of the insertion sequence in the promoter region are designed; and the sequences of the two primer pairs are as follows:

TABLE-US-00005 the first upstream primer 1F: (SEQ ID NO: 7) 5′-CGTCGGATTCAGCAGCAGAGTT-3′; the first downstream primer 1R: (SEQ ID NO: 8) 5′-TCCACATGAGTTGTTTGTTTGGTGTAT-3′ the second upstream primer 2F: (SEQ ID NO: 9) 5′-CGTCGGATTCAGCAGCAGAGTT-3′; the second downstream primer 2R: (SEQ ID NO: 10) 5′-AAGCGAATTACAAGCCTGTTTAGATTGAC-3′.

[0152] (4) Identifying Whether the Screened Molecular Markers are Usable:

[0153] The screened two pairs of InDel molecular markers are identified whether they are identical to the genome sequencing results of RH89-039-16 and PI 225689 parent materials, and the test results show that they are identical. The InDel molecular markers may be used for subsequent identification.

Example 5

[0154] A method for identifying whether a diploid potato is self-compatible, including the following steps:

[0155] (1) performing hybridization by using the self-compatible diploid potato RH89-039-16 and the self-incompatible diploid potato PI 225689 as the parent materials to obtain the hybrid offspring;

[0156] (2) extracting the leaf genome of the hybrid offspring plants when they grow to the seedling stage;

[0157] (3) identifying the leaf genome by using the KASP molecular markers obtained by the method of Example 2, if the [T:T] or [T:C] exists at position 58030614 bp in chromosome 12 of the hybrid offspring, then it is self-compatible; otherwise, if [C:C] exists at such a position, then it is self-incompatible. Since the hybrid offspring plant has the same base at the same position in the chromosome of RH89-039-16, it indicates that this offspring plant has obtained the chromosome including the StSCI gene.

Example 6

[0158] A method for identifying whether a diploid potato is self-compatible, including the following steps:

[0159] (1) performing hybridization by using the self-compatible diploid potato RH89-039-16 and the self-incompatible diploid potato PI 225689 as the parent materials to obtain the hybrid offspring;

[0160] (2) extracting the leaf genome of the hybrid offspring plants when they grow to the seedling stage;

[0161] (3) identifying the leaf genome by using the InDel molecular markers obtained by the method of Example 3; since the StSCI gene included in RH89-039-16 is heterozygous, and the 11 bp is missing in chromosome 12, two bands of the 97 bp and 108 bp fragments are amplified in RH89-039-16 by the InDel molecular marker primers, while there is only a band of the 108 bp fragment amplified in PI 225689.

[0162] Therefore, when the PCR products amplified by InDel molecular marker primers from the diploid potato hybrid offspring are subjected to PAGE electrophoresis, if the resulting band type is consistent with that of RH89-039-16, the hybrid offspring plant is self-compatible; otherwise, if the resulting band type is consistent with that of PI 225689, the hybrid offspring plant is self-incompatible.

Example 7

[0163] A method for identifying whether a diploid potato is self-compatible, including the following steps:

[0164] (1) performing hybridization by using the self-compatible diploid potato RH89-039-16 and the self-incompatible diploid potato PI 225689 as the parent materials to obtain the hybrid offspring;

[0165] (2) extracting the leaf genome of the hybrid offspring plants when they grow to the seedling stage;

[0166] (3) identifying the leaf genome by using the two pairs of InDel molecular markers obtained by the method of Example 4; wherein the genomic DNA to be tested is used as a template, the first primer pair (1F and 1R) in Example 4 is used as a group, and the second primer pair (2F and 2R) in Example 4 is used a group, performing PCR amplification reaction separately.

[0167] A 20 μl amplification system is used in the PCR reaction: 1 μl of 10-20 ng/μl template DNA, 1 μl of 10 pmol/μl primers F and R respectively, 0.4 μl of 10 mmol/L dNTP mix, 0.3 μl of 0.5 U/μL Taq DNA polymerase, 2 μl of 10×PCR reaction buffer, and the rest is water.

[0168] PCR reaction conditions are: 94° C. for 5 min; 94° C. for 20 sec, 55° C. for 20 sec, 72° C. for 30 sec, 35 cycles; 72° C. for 10 min.

[0169] (4) Detecting the PCR amplification products, i.e., detecting the PCR reaction products by agarose gel electrophoresis. If the size of the fragment amplified by the first primer pair is 500 bp, and there is no any band amplified by the second primer pair, it indicates that the hybrid offspring material is self-incompatible; otherwise, if the size of the fragment amplified by the first primer pair is 500 bp, and a band of 400 bp fragment is amplified by the second primer, it indicates that the hybrid offspring material is heterozygous and self-compatible, since the plant is self-compatible, after self-crossing the offspring of this plant will have a separation of self-compatibility phenotype.

[0170] The above descriptions are only preferred examples of this application, and are not intended to limit this application. Any modification, equivalent replacement, etc. made within the spirit and principle of this application shall be covered in the protection scope of this application.