STENOTROPHOMONAS MALTOPHILIA GYH AND APPLICATION THEREOF IN DEGRADATION OF CHLORINATED HYDROCARBON POLLUTANTS
20220275324 · 2022-09-01
Inventors
- Zhuowei CHENG (Hangzhou, Zhejiang, CN)
- Dongzhi CHEN (Hangzhou, Zhejiang, CN)
- Jiade WANG (Hangzhou, Zhejiang, CN)
- Jianming YU (Hangzhou, Zhejiang, CN)
- Jianmeng CHEN (Hangzhou, Zhejiang, CN)
- Yanhong GUAN (Hangzhou, Zhejiang, CN)
Cpc classification
C12R2001/01
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention discloses Stenotrophomonas maltophilia GYH and its application in degrading chlorinated hydrocarbon pollutants, and the application is carried out as follows: resting cells obtained by spreading cultivation of Stenotrophomonas maltophilia GYH are added to a pH=5-8 inorganic salt medium, and then a chlorinated hydrocarbon pollutant is added, and the cells are cultured at 20-35° C. and 140-180 rpm to degrade the pollutant. The concentration of chlorinated hydrocarbon pollutant which can be removed by Stenotrophomonas maltophilia GYH ranges from 2.9 mg/L to 8.93 mg/L. Therefore, the Stenotrophomonas maltophilia has a highly efficient degradation ability for similar industrial pollutants and is able to withstand high concentrations of these pollutants.
Claims
1. Stenotrophamonas maltophilia GYH, which is preserved in China Center for Type Culture Collection, the preservation number is CCTCC NO: M 20191025, the preservation date is Dec. 9, 2019, and the preservation address is Miuhan University, Wuhan, China, 430072.
2. An application of Stenotrophomonas maltophilia GYH as claimed in claim 1 in degrading a chlorinated hydrocarbon pollutant.
3. The application as claimed in claim 2, wherein the application is carried out as follows: resting cells obtained by spreading cultivation of Stenotrophomonas maltophilia GYH are added to a pH=5-8 inorganic salt medium, and then the chlorinated hydrocarbon pollutant is added, and the cells are cultured at 20-35° C. and 140-180 rpm to degrade the pollutant.
4. The application as claimed in claim 3, wherein the chlorinated hydrocarbon pollutant is at least one selected from the group consisting of chloroform, chlorobenzene, 1,2-dichloroethane, 1,1,1-trichloroethane and dichloromethane.
5. The application as claimed in claim 3, wherein in the inorganic salt medium, the amount of the resting cells calculated by the dry weight of the bacteria is 50-100 mg/L.
6. The application as claimed in claim 3, wherein the initial concentration of the chlorinated hydrocarbon pollutant in the inorganic salt medium is 1-10 mg/L.
7. The application as claimed in claim 3, wherein the composition of the inorganic salt medium is as follows: KH.sub.2PO.sub.42 g/L, (NH.sub.4).sub.2SO.sub.4 2 g/L, MgSO.sub.4 0.025 g/L and NaOH 0.18 g/L, the solvent is ultrapure water, pH 5-8.
8. The application as claimed in claim 2, wherein the resting cells of Stenotrophamonas maltophilia GYH are prepared as follows: (1) slant incubation: Stenotrophomonas maltophilia GYH is inoculated onto LB agar medium and cultivated at 30° C. in an incubator, thereby obtaining a bacterial slant; wherein the LB agar medium composition is as follows: 5 g/L yeast extract, 10 g/L NaNO.sub.3, 10 g/L peptone, 15-20 g/L agar, natural pH, deionized water as solvent; (2) spreading cultivation the slant cells in step (1) are inoculated. into LB liquid medium and incubated. at 30 160 rpm for 12 h, then the obtained spreading cultivation solution is centrifuged to collect wet cells, and the wet cells are washed with inorganic salt medium to obtain the resting cells of Stenotrophomonas maltophilia GYH; wherein the LB liquid medium composition is as follows: 5 g/L yeast extract, 10 g/L NaNO.sub.3, 10 g/L peptone, deionized water as solvent, natural pH.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
SPECIFIC EMBODIMENTS
[0029] The present invention is further illustrated below with specific examples, but the scope of the present invention is not limited thereto:
[0030] The materials and reagents used in the following examples can be obtained from commercial sources unless otherwise specified.
[0031] Example 1: isolation, purification and identification of Stenotrophomonas maltophilia GYH
[0032] 1, Isolation and purification of Stenotrophomonas maltophilia GYH
[0033] Stenotrophomonas maltophilia GYH is Gram-negative bacteria domesticated and isolated from activated sludge. The specific steps are as follows:
[0034] 50 mL of inorganic salt medium was added to a 300 mL shake flask, and 10 mL of activated sludge and 8.9 mg/L of chloroform were added for enrichment culture. When the concentration of chloroform reached 50% of the initial concentration, 5 mL of the enrichment solution was taken out and added to 50 ml of fresh inorganic salt medium and chloroform was added with a final concentration of 8.9 mg/L, after the above enrichment process had been repeated 5 times, the last enrichment solution was spread on LB agar medium after gradient dilution. A single colony was selected and inoculated to an isolation agar medium by streaking for purification (
[0035] The inorganic salt medium composition was as follows: KH.sub.2PO.sub.42 g/L, (NH.sub.4).sub.2SO.sub.4 2 g/L, MgSO.sub.4 0.025 g/L, NaOH 0.18 g/L, the solvent was ultrapure water, pH 5-8.
[0036] The LB agar medium composition was as follows: 5 g/L yeast extract, 10 g/L NaNO.sub.3, 10 g/L peptone, 18 g/L agar, natural pH, and the solvent is deionized water.
[0037] The LB liquid medium composition was as follows: 5 g/L yeast extract, 10 g/L NaNO.sub.3, 10 g/L peptone, natural pH, and the solvent is deionized water.
[0038] The isolation agar medium was prepared as follows: agar was added to inorganic salt medium with the final concentration of 18 g/L, thereby obtaining the isolation agar medium, and when the isolation agar medium was used, chloroform was added as a carbon source with the final concentration of 8.9 mg/L.
[0039] 2. Identification of the strain GYH
[0040] (1) The characteristics of the strain GYH
[0041] The colonies were light yellow with neat edges, opaque, smooth, moist, and easy to pick. Under a transmission electron microscope, the bacteria were ellipsoidal, had flagella and a cell size of 655×2577 nm, and were Gram-negative. Through 16S rRNA sequence analysis and physiological and biochemical identification, the strain was determined to be Stenotrophomonas maltophilia. The specific steps were as follows:
[0042] (2) 16S rRNA sequencing
[0043] The DNA of the strain GYH was extracted and purified using Ezup Column Bacteria Genomic DNA Purification Kit, and stored at 4° C. The purified DNA was amplified by PCR with bacterial universal primers which were 27F (AGAGTTTGATCCTGGCTCAG) and 1492 R (GGTTACCTTGTTACGACTT). The PCR reaction program was set as follows:
pre-denaturation at 94° C. for 4 min, 30 cycles of denaturation at 94° C. for 45 s, annealing at 55° C. for 45 s and extension at 72° C. for 1 min, and finally extension at 72° C. for 10 min. The PCR product was purified and recovered for sequencing (Zhejiang Tianke High Technology Development Co. Ltd.). The sequence homology of the 165 rRNA sequencing result (the nucleotide sequence is shown in SEQ ID NO.1, it was uploaded to GenBank, thereby obtaining the NCBI gene accession No: MN860228) and the gene sequences uploaded to Genbank was compared, it was found that it belonged to the genus Stenotrophomonas and had the highest homology with Stenotrophomonas maltophilia, reaching 99%. From the results, 15 representative strains of Stenotrophomonas were selected and a phylogenetic tree shown in
[0044] (3)Utilization ability of the strain GYH on 63 carbon sources on Mérieux GN card.
[0045] BioMérieux automated microbial analyzer was used to investigate metabolism of 63 different carbon sources by the strain (entrusted to Zhejiang Tianke High Technology Development Co. Ltd. (formerly Zhejiang Institute of Microbiology)). The identification results were shown in Table 1. According to the biochemical reaction of BioMérieux automated microbial analyzer VITEK, the strain GYH can consume 11 kinds of carbon sources, but cannot consume the other 52 kinds of carbon sources.
TABLE-US-00001 TABLE 1 Biochemical reaction results of the strain GYH detected by BioMerieux automated microbial analyzer VITEK (GN card) Testing Number Abbreviation Chinese name results 2 APPA Ala-Phe-Pro-arylamidase + 3 ADO Adonitol − 4 PyrA L-Pyrrolydonyl-arylamidase − 5 IARL L-Arabitol − 7 dCEL D-cellobiose − 9 BGAL β-Galactosidase − 10 H2S H2S production − 11 BNAG β-N-Acetyl-glucosaminidase − 12 AGLTp Glutamyl arylamidase pNA − 13 dGLU D-Glucose − 14 GGT γ-Glutamyl-transferase + 15 OFF Fermentation/Glucose − 17 BGLU β-Glucosidase + 18 dMAL D-Maltose − 19 dMAN D-Mannitol − 20 dMNE D-Mannose − 21 BXYL β-Xylosidase − 22 BAIap β-Alanine Arylamidase pNA − 23 ProA L-Proline Arylamidase + 26 LIP Lipase + 27 PLE Palatinose − 29 TyrA Tyrosine Arylamidase − 31 URE Urease − 32 dSOR D-Sorbrtol − 33 SAC Sucrose − 34 dTAG D-Tagatose − 35 dTRE D-Trehalose − 36 CIT Citrate (sodium) + 37 MNT Malonate − 39 5KG 5-Keto-D-gluconate − 40 ILATk L-Lactate alkalinisation + 41 AGLU α-Glucosidase + 42 SUCT Succinate alkalinisation + 43 NAGA β-N-Acetyl-galactosaminidase − 44 AGAL α-Galactosidase − 45 PHOS Phosphatase + 46 GlyA Glycine Arylamidase − 47 ODC Ornithine decarboxylase − 48 LDC Lysine decarboxylase − 53 IHISa L-Histidine assimilation − 56 CMT Courmarate − 57 BGUR β-Glucoronidase − 58 O129R O/129 Resistance (comp. vibrio.) − 59 GGAA Glu-Gly-Arg-arylamidase + 61 IMLTa L-Malate assimilation − 62 ELLM ELLMAN − 64 ILATa L-lactate assimilation − Symbols: +, positive; −, negative
[0046] Through physiological and biochemical characteristics, genetic distance and comparison of 16S rRNA sequence, the strain GYH was identified as Stenotrophomonas maltaphilia, named Stenotrophamonas maltaphilia GYH, and stored in China Center for Type Collection, the preservation number is CCTCC NO: M20191025, and the preservation date is Dec. 9, 2019.
[0047] Example 2 Obtaining the resting cells of Stenotrophomonas maltophilia
[0048] 1. Slant Cultivation:
[0049] Stenotrophomonas maltophilia CCTCC NO:M 20191025 was inoculated into LB liquid medium and incubated at 30° C., 160 rpm for 2 d, and then the activated bacteria were streaked on an LB agar plate and incubated at 30° C. in an incubator for 24 hours. The resulting single colonies were picked out, streaked on a plate to examine their purification, and stored on a slant of an LB test tube (4° C.).
[0050] 2. Spreading Cultivation
[0051] The slant cells of step 1 were inoculated into LB liquid medium and incubated at 30° C. 160 rpm for 12 h, then the obtained spreading cultivation solution was centrifuged to collect wet cells, and the wet cells were washed with inorganic salt medium, thereby obtaining the resting cells of Stenotrophomonas maltophilia GYH.
[0052] Example 3: Detection of degradation performance of Stenotrophomonas maltophilia GYH on chloroform with different concentrations
[0053] Each 50 mL of inorganic salt medium were put into a 330 mL shake flask, and sterilized at 110° C. for 40 min, After sterilization, the inorganic salt mediums were place at room temperature for 2 days to confirm no bacteria growth. Resting cells of Stenotrophomonas maltophilia GYH obtained by the method in Example 2 were added with the final concentration of 80 mg/L (calculated by dry cell weight), and then chloroform was added as the only carbon source with the final concentrations of 2.98 mg/L, 5.93 mg/L, 8.93 mg/L, 14.85 mg/L, 20.97 mg/L and 29.8 mg/L respectively, after sealing the shake flask, the resulting solutions were cultured on a shaker at 30° C., 160 rpm, and a blank control without bacteria was taken. The concentration of residual chloroform in the shake flask was determined regularly, and the generation of chloride ions in the solution was determined regularly. Bar graphs of time required for complete degradation of different substrate concentrations and degradation rate under different substrate concentrations within 84 h were drawn. The results were shown in
[0054] Example 4: Studies on broad spectrum of substrates of Stenotrophomonas maltophilia CCTCC NO: M 20191025.
[0055] The substrate in Example 3 was changed to that shown in Table 2, and the final concentration of the substrate was 10 mg/L. Other operations were the same as in Example 3. The results were shown in Table 2. It can be seen from Table 2 that Stenotrophomonas maltophilia CCTCC NO: M 20191025 has a degrading effect on all the chlorinated hydrocarbon organics. It can completely degrade 10 mg/L of chlorobenzene within 48 hours, can completely degrade 10 mg/L 1.2-dichloroethane within 72 hours, and also has a certain degradation effect on the other three chlorinated hydrocarbons.
TABLE-US-00002 TABLE 2 Degradation effects of different substrates Substrate (10 mg/L) Degradation time (h) Removal rate (%) Chlorobenzene 48 100 1.2-Dichloroethane 72 100 1.1.1-Trichloroethane 72 82.90 Dichloromethane 72 71.52 Trichloroethylene 72 41.35
[0056] Example 5: Degradation performance detection of Stenotrophomonas maltophilia CCTCC NO: M 20191025 on chloroform with different pH.
[0057] Each 50 mL of inorganic salt medium was put into a 330 mL shake flask, and sterilized at 110° C. for 40 min; wherein the pH value of the inorganic salt medium in each shake flask was 5, 6, 7 and 8 respectively. After sterilization, the inorganic salt mediums were placed at room temperature for 2 days to confirm no bacteria growth. The resting cells of Stenotrophomonas maltophilia GYH obtained by the method in Example 2 were added with the final concentration of 80 mg/L (calculated by dry cell weight), and then chloroform was added as the only carbon source with the final concentrations of 8.93 mg/L, after sealing the shake flask, the resulting solution was cultured on a shaker at 30° C., 160 rpm, and a blank control without bacteria was taken. The concentration of residual chloroform in the shake flask was determined regularly, and the generation of chloride ions in the solution was determined regularly, thereby obtaining time for complete degradation under different pH. The results were shown in
[0058] Although the present invention has disclosed the above examples, it is not intended to limit the scope of protection of the present invention, Changes and modifications made by any technical person familiar with the technology, without departing from the concept and scope of the present invention, should be involved in the scope of protection of the present invention.