IMPROVED ANTIBODY-OLIGONUCLEOTIDE CONJUGATE
20220313834 · 2022-10-06
Assignee
Inventors
Cpc classification
A61K47/6889
HUMAN NECESSITIES
A61K47/6415
HUMAN NECESSITIES
A61K47/6807
HUMAN NECESSITIES
A61K47/55
HUMAN NECESSITIES
A61K47/593
HUMAN NECESSITIES
A61K47/643
HUMAN NECESSITIES
A61K47/6857
HUMAN NECESSITIES
A61K47/6849
HUMAN NECESSITIES
C07J63/008
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
A61K47/642
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
A61K47/6851
HUMAN NECESSITIES
A61K47/6863
HUMAN NECESSITIES
A61K47/554
HUMAN NECESSITIES
A61K2039/507
HUMAN NECESSITIES
A61K47/6845
HUMAN NECESSITIES
A61K47/6885
HUMAN NECESSITIES
A61K47/549
HUMAN NECESSITIES
A61K47/6855
HUMAN NECESSITIES
A61K47/60
HUMAN NECESSITIES
A61K47/6825
HUMAN NECESSITIES
International classification
Abstract
The invention relates to a ligand-effector moiety provided with at least one saponin and antibody-effector moiety provided with at least one saponin. An aspect of the invention is a composition comprising the ligand-effector moiety provided with at least one saponin or the antibody-effector moiety provided with at least one saponin of the invention. The invention also relates to an antibody-drug conjugate comprising covalently linked saponin and to an antibody-oligonucleotide conjugate comprising covalently linked saponin. An aspect of the invention relates to a pharmaceutical composition comprising the ligand-effector moiety provided with at least one saponin or the antibody-effector moiety provided with at least one saponin of the invention, and optionally further comprising a pharmaceutically acceptable excipient. The invention also relates to the ligand-effector moiety provided with at least one saponin or the antibody-effector moiety provided with at least one saponin, for use as a medicament. The invention also relates to the ligand-effector moiety provided with at least one saponin or the antibody-effector moiety provided with at least one saponin of the invention for use in the treatment or prophylaxis of a cancer.
Claims
1. Conjugate comprising a cell-surface molecule targeting molecule and at least one effector moiety and further comprising at least one covalently bound saponin.
2. Conjugate of claim 1, wherein the at least one saponin is a triterpenoid saponin and/or a bisdesmosidic triterpene saponin belonging to the type of a 12,13-dehydrooleanane with an aldehyde function in position C-23 and optionally comprising a glucuronic acid function in a carbohydrate substituent at the C-3beta-OH group of the saponin, and/or a saponin isolated from any one or more of a Gypsophila species and/or a Saponaria species and/or an Agrostemma species and/or a Quillaja species such as Quillaja saponaria.
3.-4. (canceled)
5. Conjugate according to claim 1, wherein the at least one saponin is one or more of the saponins in Table A1 or Scheme I, SO1861, SA1657, GE1741, SA1641, QS-21, QS-21A, QS-21 A-api, QS-21 A-xyl, QS-21B, QS-21 B-api, QS-21 B-xyl, QS-7-xyl, QS-7-api, QS-17-api, QS-17-xyl, QS1861, QS1862, Quillaja saponin, Saponinum album, QS-18, Quil-A, Gyp1, gypsoside A, AG1, AG2, SO1542, SO1584, SO1658, SO1674, SO1832, or any of their stereomers and/or any combinations thereof, preferably the saponin is SO1861 and/or GE1741 and/or SA1641 and/or QS-21 and/or saponin with a quillaic acid aglycon core, a Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA carbohydrate substituent at the C-3beta-OH group and a Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)-4-OAc-Qui-(1.fwdarw.4)]-Fuc carbohydrate substituent at the C-28-OH group, and/or is 3-O-beta-D-galactopyranosyl-(1.fwdarw.2)-[beta-D-xylopyranosyl-(1.fwdarw.3)]-beta-D-glucuronopyranosyl quillaic acid 28-O-beta-D-glucopyranosyl-(1.fwdarw.3)-beta-D-xylopyranosyl-(1.fwdarw.4)-alpha-L-rhamnopyranosyl-(1.fwdarw.2)-[beta-D-xylopyranosyl-(1.fwdarw.3)-4-OAc-beta-D-quinovopyranosyl-(1.fwdarw.4)]-beta-D-fucopyranoside, more preferably the at least one saponin is SO1861 and/or QS-21, and/or wherein the at least one saponin is a bisdesmosidic saponin having a molecular mass of at least 1,500 Dalton and comprising an oleanan-type triterpene containing an aldehyde group at the C-23 position and optionally a hydroxyl group at the C-16 position, with a first branched carbohydrate side chain at the C-3 position which first branched carbohydrate side chain optionally contains glucuronic acid, wherein the saponin contains an ester group with a second branched carbohydrate side chain at the C-28 position which second branched carbohydrate chain preferably comprises at least four carbohydrate units, optionally containing at least on acetyl residue such as two acetyl residues and/or optionally comprising deoxy carbohydrates and/or optionally comprising quinovose and/or optionally comprising glucose and/or optionally comprising 4-methoxycinnamic acid and/or optionally comprising 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid and/or optionally comprising 5-O-[5-O-Rha-(1.fwdarw.2)-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid bound to a carbohydrate via an ester bond, or wherein the at least one saponin is QS-21 or any one or more of QS-21A, QS-21 A-api, QS-21 A-xyl, QS-21B, QS-21 B-api, QS-21 B-xyl, QS-7-xyl, QS-7-api, QS-17-api, QS-17-xyl, QS-18, QS1861, protonated QS1861 (QS1862), Quil-A.
6. (canceled)
7. Conjugate of claim 1, wherein the cell-surface molecule targeting molecule comprises or consists of a ligand or a proteinaceous ligand or a proteinaceous binding molecule for binding to the cell-surface molecule.
8. Conjugate of claim 1, wherein the cell-surface molecule targeting molecule comprises or consists of a non-proteinaceous ligand and/or a proteinaceous ligand for binding to a cell-surface molecule such as EGF or a cytokine, and/or comprises or consists of an immunoglobulin, at least one binding domain of an immunoglobulin and/or at least one binding fragment of an immunoglobulin, such as an antibody, an IgG, a molecule comprising or consisting of a Vhh domain or Vh domain, a Fab, an scFv, an Fv, a dAb, an F(ab).sub.2, Fcab fragment, which can bind to the cell-surface molecule.
9. Conjugate of claim 1, wherein the cell-surface molecule targeting molecule can bind to a tumor-cell surface molecule, preferably a tumor-cell receptor such as a tumor-cell specific receptor, more preferably a receptor selected from CD71, CA125, EpCAM(17-1A), CD52, CEA, CD44v6, FAP, EGF-IR, integrin, syndecan-1, vascular integrin alpha-V beta-3, HER2, EGFR, CD20, CD22, Folate receptor 1, CD146, CD56, CD19, CD138, CD27L receptor, PSMA, CanAg, integrin-alphaV, CA6, CD33, mesothelin, Cripto, CD3, CD30, CD239, CD70, CD123, CD352, DLL3, CD25, ephrinA4, MUC1, Trop2, CEACAM5, CEACAM6, HER3, CD74, PTK7, Notch3, FGF2, C4.4A, FLT3, CD38, FGFR3, CD7, PD-L1, CTLA4, CD52, PDGFRA, VEGFR1, VEGFR2, preferably selected from CD71, HER2 and EGFR.
10. (canceled)
11. Conjugate of claim 1, wherein the cell-surface molecule targeting molecule is or comprises a monoclonal antibody or at least one cell-surface molecule binding fragment or -domain thereof and preferably comprises or consists of any one of cetuximab, daratumumab, gemtuzumab, trastuzumab, panitumumab, brentuximab, inotuzumab, moxetumomab, polatuzumab, obinutuzumab, OKT-9 anti-CD71 monoclonal antibody of the IgG type, pertuzumab, rituximab, ofatumumab, Herceptin, alemtuzumab, pinatuzumab, OKT-10 anti-CD38 monoclonal antibody, an antibody of Table A2 or Table A3 or Table A4, preferably cetuximab or trastuzumab or OKT-9, or at least one cell-surface molecule binding fragment or -domain thereof.
12. Conjugate of claim 1, wherein the at least one effector moiety comprises or consists of any one or more of an oligonucleotide, a nucleic acid and a xeno nucleic acid, preferably selected from any one or more of a vector, a gene, a cell suicide inducing transgene, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), anti-sense oligonucleotide (ASO, AON), short interfering RNA (siRNA), microRNA (miRNA), DNA aptamer, RNA aptamer, mRNA, mini-circle DNA, peptide nucleic acid (PNA), phosphoramidate morpholino oligomer (PMO), locked nucleic acid (LNA), bridged nucleic acid (BNA), 2′-deoxy-2′-fluoroarabino nucleic acid (FANA), 2′-O-methoxyethyl-RNA (MOE), 2′-O,4′-aminoethylene bridged nucleic acid, 3′-fluoro hexitol nucleic acid (FHNA), a plasmid, glycol nucleic acid (GNA) and threose nucleic acid (TNA), or a derivative thereof, more preferably a BNA, for example a BNA for silencing HSP27 protein expression.
13. Conjugate of claim 1, wherein the at least one effector moiety comprises or consists of at least one proteinaceous molecule, preferably selected from any one or more of a peptide, a protein, an enzyme such as urease and Cre-recombinase, a ribosome-inactivating protein, a proteinaceous toxin selected from Table A5 and more preferably selected from any one or more of a viral toxin such as apoptin; a bacterial toxin such as Shiga toxin, Shiga-like toxin, Pseudomonas aeruginosa exotoxin (PE) or exotoxin A of PE, full-length or truncated diphtheria toxin (DT), cholera toxin; a fungal toxin such as alpha-sarcin; a plant toxin including ribosome-inactivating proteins and the A chain of type 2 ribosome-inactivating proteins such as dianthin e.g. dianthin-30 or dianthin-32, saporin e.g. saporin-S3 or saporin-S6, bouganin or de-immunized derivative debouganin of bouganin, shiga-like toxin A, pokeweed antiviral protein, ricin, ricin A chain, modeccin, modeccin A chain, abrin, abrin A chain, volkensin, volkensin A chain, viscumin, viscumin A chain; or an animal or human toxin such as frog RNase, or granzyme B or angiogenin from humans, or any fragment or derivative thereof; preferably the protein toxin is dianthin and/or saporin.
14.-16. (canceled)
17. Conjugate of claim 1, wherein the at least one saponin is covalently bound to the cell-surface molecule targeting molecule preferably an amino-acid residue of the cell-surface molecule targeting molecule, via an aldehyde function in the saponin, and/or to the at least one effector moiety preferably via an amino-acid residue in the at least one effector moiety, via an aldehyde function in the saponin, preferably an aldehyde function in position C-23 in a bisdesmosidic triterpene saponin belonging to the type of a 12,13-dehydrooleanane.
18. (canceled)
19. Conjugate of claim 1, wherein the at least one saponin is a bisdesmosidic triterpene saponin belonging to the type of a 12,13-dehydrooleanane, with an aldehyde function in position C-23 and comprising a glucuronic acid function in a carbohydrate substituent at the C-3beta-OH group of the saponin, wherein the saponin is covalently bound to an amino-acid residue of the cell-surface molecule targeting molecule and/or to the at least one effector moiety via said glucuronic acid function and preferably via an amino-acid residue in the at least one effector moiety.
20.-22. (canceled)
23. Conjugate of claim 1 wherein the at least one saponin is covalently bound to the cell-surface molecule targeting molecule and to the at least one effector moiety via at least one linker comprising a tri-functional linker to which tri-functional linker both the cell-surface molecule targeting molecule and the at least one effector moiety are bound, preferably the tri-functional linker is the trifunctional linker of Scheme II and Structure B.
24. Conjugate according to claim 1, wherein the at least one linker comprises at least one cleavable linker, wherein optionally said cleavable linker is subject to cleavage under acidic, reductive, enzymatic or light-induced conditions, and preferably the cleavable linker comprises a cleavable bond selected from a hydrazone bond or a hydrazide bond subject to cleavage under acidic conditions, and/or a bond susceptible to proteolysis, for example proteolysis by Cathepsin B, and/or a bond susceptible for cleavage under reductive conditions such as a disulphide bond, wherein said cleavable linker is subject to cleavage in vivo under acidic conditions as present in endosomes and/or in lysosomes of mammalian cells, preferably of human cells, preferably at pH 4.0-6.5, and more preferably at pH≤5.
25. (canceled)
26. Conjugate of claim 1, wherein the at least one saponin is covalently bound to a lysine side chain, forming an amide bond, and/or to a cysteine side chain, forming a thio-ether linkage or a disulphide bond, wherein the lysine and/or cysteine is/are comprised by the cell-surface molecule targeting molecule and/or is/are comprised by the at least one effector moiety, and wherein the at least one saponin is either directly bound to the lysine and/or cysteine, or is bound via at least one linker optionally comprising a cleavable linker and/or a tri-functional linker such as the tri-functional linker of Scheme II and Structure B.
27. (canceled)
28. Conjugate of claim 1, wherein the at least one saponin is covalently bound to the cell-surface molecule targeting molecule and/or to the at least one effector moiety via at least one linker, wherein the linker is or comprises a scaffold comprising a polymeric or oligomeric structure and further comprising at least one fourth chemical group for covalently coupling of the scaffold to the cell-surface molecule targeting molecule and/or to the at least one effector moiety.
29. Conjugate according to claim 28, wherein the at least one saponin is covalently bound to the polymeric or oligomeric structure of the scaffold via a cleavable bond wherein the cleavable bond is subject to cleavage under any of acidic conditions, reductive conditions, enzymatic conditions and light-induced conditions, and preferably the cleavable bond comprises a hydrazone bond or a hydrazide bond subject to cleavage under acidic conditions, and/or a bond susceptible to proteolysis, for example proteolysis by Cathepsin B, and/or a bond susceptible for cleavage under reductive conditions such as a disulphide bond and/or wherein the cleavable bond is subject to cleavage in vivo under acidic conditions as present in endosomes and/or in lysosomes of mammalian cells, preferably of human cells, preferably at pH 4.0-6.5, and more preferably at pH≤5.5.
30.-38. (canceled)
39. Conjugate according to claim 28, wherein the polymeric or oligomeric structure of the scaffold comprises a linear, branched and/or cyclic polymer, oligomer, dendrimer, dendron, dendronized polymer, dendronized oligomer, a DNA, a polypeptide, poly-lysine, a poly-ethylene glycol, or an assembly of these polymeric or oligomeric structures which assembly is preferably built up by covalent cross-linking.
40. Conjugate according to claim 1, wherein the at least one saponin is a defined number of saponins or a defined range of saponins, preferably 1-128 saponins or at least 2, 3, 4, 5, 6, 8, 10, 16, 32, 64 or 128 saponins, or any number of saponins therein between, such as 7, 9, 12 saponins.
41. Conjugate according to claim 1, wherein the conjugate comprises more than one saponin, preferably 2, 3, 4, 5, 6, 8, 10, 16, 32, 64 or 1-100 saponins, or any number of saponins therein between, such as 7, 9, 12 saponins, covalently bound directly to an amino-acid residue of the cell-surface molecule targeting molecule and/or to the at least one effector moiety and preferably via an amino-acid residue in the at least one effector moiety, preferably to a cysteine and/or to a lysine, and/or covalently bound via at least one linker and/or via at least one cleavable linker and/or via at least one polymeric or oligomeric scaffold of any one of the claims 28-40, preferably 1-8 of such scaffolds or 2-4 of such scaffolds, wherein 1-32 saponins, preferably 2, 3, 4, 5, 6, 8, 10, 16 or 32 saponins, or any number of saponins therein between, such as 7, 9, 12 saponins, are covalently bound to the at least one scaffold.
42. Conjugate according to claim 1, wherein the at least one saponin is covalently bound to the cell-surface molecule targeting molecule and to the at least one effector moiety via a tri-functional linker, the tri-functional linker comprising a second chemical group with at least one saponin covalently bound thereto either directly or via a linker such as a cleavable linker and/or via the scaffold comprising a polymeric or oligomeric structure and a fourth chemical group for covalently coupling of the scaffold to the tri-functional linker, the tri-functional linker further comprising a third chemical group for covalent binding to the cell-surface molecule targeting molecule and comprising a first chemical group for covalent binding to the at least one effector moiety, wherein the cell-surface molecule targeting molecule is bound to the third chemical group and/or the at least one effector moiety is bound to the first chemical group, preferably the trifunctional linker is the trifunctional linker of Scheme II and Structure B.
43. Pharmaceutical composition comprising the conjugate of claim 1 and optionally a pharmaceutically acceptable excipient and/or a pharmaceutically acceptable diluent.
44.-45. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
[0157]
[0158]
[0159]
[0160]
[0161]
[0162]
[0163]
[0164]
[0165]
DETAILED DESCRIPTION
[0166] In order for a bioactive molecule to work, the molecule must be able to engage with its target, e.g. in the blood serum, on the outside of the cell surface or inside a cell or an organelle. The active moiety of almost all protein-based targeted toxins, e.g., must enter the cytosol of the target cell to mediate its target modulatory effect. In many constellations the toxin remains ineffective since (1) the targeting moiety is poorly internalized and remains bound to the outside of the cells, (2) is recycled back to the cell surface after internalization or (3) transported to the endolysosomes where it is degraded. Although these fundamental issues are known for decades and more than 500 targeted toxins have been investigated in the past decades, the problems have not been solved yet and only a couple of antibody-targeted protein toxin have been admitted to the market, albeit with warning labels for severe toxicity. Moxetumomab pasudotox-tdfk (LUMOXITI®, AstraZeneca Pharmaceuticals LP), has been approved for relapsed or refractory hairy cell leukemia by the FDA to date. Other of such approved ADCs are Elzonris, Ontak.
[0167] To overcome these problems, many strategies have been described including approaches to redirect the toxins to endogenous cellular membrane transport complexes of the biosynthetic pathway in the endoplasmic reticulum and techniques to disrupt or weaken the membrane integrity of endosomes, i.e. the compartments of the endocytic pathway in a cell, and thus facilitating the endosomal escape. This comprises the use of lysosomotropic amines, carboxylic ionophores, calcium channel antagonists, various cell-penetrating peptides of viral, bacterial, plant, animal, human and synthetic origin, other organic molecules and light-induced techniques. Although the efficacy of the targeted toxins was typically augmented in cell culture hundred- or thousand-fold, in exceptional cases more than million-fold, the requirement to co-administer endosomal escape enhancers with other substances harbors new problems including additional side effects, loss of target specificity, difficulties to determine the therapeutic window and cell type-dependent variations.
[0168] All strategies, including physicochemical techniques, require enhancer molecules that interact more or less directly with membranes and comprise essentially small chemical molecules, secondary metabolites, peptides and proteins. A common feature of all these substances is that they are per se not target cell-specific and distribute with other kinetics than the targeted toxins. This is one major drawback of the current approaches.
[0169] The present invention will be described with respect to particular embodiments but the invention is not limited thereto but only by the claims. The embodiments of the invention described herein can operate in combination and cooperation, unless specified otherwise.
[0170] While the invention has been described in terms of several embodiments, it is contemplated that alternatives, modifications, permutations and equivalents thereof will become apparent to one having ordinary skill in the art upon reading the specification and upon study of the drawings and graphs. The invention is not limited in any way to the illustrated embodiments. Changes can be made without departing from the scope which is defined by the appended claims.
[0171] An aspect of the invention relates to a conjugate comprising a cell-surface molecule targeting molecule and at least one effector moiety and further comprising at least one covalently bound saponin.
[0172] The inventors established that the therapeutic window of a conjugate such as an antibody drug conjugate or an antibody-oligonucleotide conjugate, increases when administered to a tumor-bearing mammal (mouse) to whom the conjugate is administered, wherein said conjugate comprises at least one covalently bound saponin. The conjugate of the invention has at least one glycoside such as a saponin bound thereto, preferably covalently, more preferably via a cleavable linker. The saponin augments the therapeutic efficacy of the effector moiety bound to the cell-surface molecule targeting molecule, likely by enhancing the endosomal escape of the effector moiety into the cytosol where the activity of the effector moiety is desired. This way, already at a lower dose than the conventional dose of the ADC or the AOC, i.e. the conjugate of the invention, therapeutic effect is established under influence of the presence of the conjugate comprising the saponin(s) thereby bringing the saponin(s) near, at and/or inside the targeted cell. The targeted cell is for example a diseased cell such as a tumor cell or an auto-immune cell or a B-cell disease related B-cell, etc. The effector moiety is for example a toxin as part of an ADC or an oligonucleotide such as an antisense BNA as part of an AOC according to the invention.
[0173] An embodiment is the conjugate of the invention, wherein the at least one saponin is a triterpenoid saponin and/or a bisdesmosidic triterpene saponin belonging to the type of a 12,13-dehydrooleanane with an aldehyde function in position C-23 and optionally comprising a glucuronic acid function in a carbohydrate substituent at the C-3beta-OH group of the saponin, and/or a saponin isolated from any one or more of a Gypsophila species and/or a Saponaria species and/or an Agrostemma species and/or a Quillaja species such as Quillaja saponaria.
[0174] An embodiment is the conjugate of the invention, wherein the at least one saponin is a single specific saponin or is a mixture of two or more different saponins.
[0175] An embodiment is the conjugate of the invention, wherein the at least one saponin has a molecular mass of 3.000 Dalton or less, preferably 2.500 Dalton or less, more preferably 2.300 Dalton or less, most preferably, 2.000 Dalton or less, such as 1.500 Dalton-1.900 Dalton.
[0176] An embodiment is the conjugate of the invention, wherein the at least one saponin is one or more of the saponins in Table A1 or Scheme I, SO1861, SA1657, GE1741, SA1641, QS-21, QS-21A, QS-21 A-api, QS-21 A-xyl, QS-21B, QS-21 B-api, QS-21 B-xyl, QS-7-xyl, QS-7-api, QS-17-api, QS-17-xyl, QS1861, QS1862, Quillaja saponin, Saponinum album, QS-18, Quil-A, Gyp1, gypsoside A, AG1, AG2, SO1542, SO1584, SO1658, SO1674, SO1832, or any of their stereomers and/or any combinations thereof, preferably the saponin is SO1861 and/or GE1741 and/or SA1641 and/or QS-21 and/or saponin with a quillaic acid aglycon core, a Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA carbohydrate substituent at the C-3beta-OH group and a Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)-4-OAc-Qui-(1.fwdarw.4)]-Fuc carbohydrate substituent at the C-28-OH group, and/or is 3-O-beta-D-galactopyranosyl-(1.fwdarw.2)-[beta-D-xylopyranosyl-(1.fwdarw.3)]-beta-D-glucuronopyranosyl quillaic acid 28-O-beta-D-glucopyranosyl-(1.fwdarw.3)-beta-D-xylopyranosyl-(1.fwdarw.4)-alpha-L-rhamnopyranosyl-(1.fwdarw.2)-[beta-D-xylopyranosyl-(1.fwdarw.3)-4-OAc-beta-D-quinovopyranosyl-(1.fwdarw.4)]-beta-D-fucopyranoside, more preferably the at least one saponin is SO1861 and/or QS-21.
[0177] The inventors disclose here that covalently coupling saponins such as saponins in the water-soluble fraction of Quillaja saponaria, QS-21, SA1641, SO1861, Table A1, Scheme I, to the cell-surface molecule targeting molecule such as a proteinaceous molecule, such as via a tri-functional linker, e.g. the tri-functional linker of Scheme II, or via an oligomeric or polymeric structure of a scaffold comprising covalently bound saponins, results in improved cell toxicity exerted by the effector moiety such as a toxin, comprised by the conjugate, under influence of the covalently coupled saponin in the conjugate.
[0178] An embodiment is the conjugate of the invention comprising a saponin comprising one or several or all of the indicated structural features of the saponin of Structure A in Scheme I, the saponin of structure A referred to as a saponin with an ‘ideal’ structure when endosomal escape enhancing activity towards an effector moiety present in the endosome of a cell contacted with conjugate of the invention, and/or a saponin selected from any one or more of the further saponins in Scheme I:
##STR00001## ##STR00002## ##STR00003## ##STR00004##
[0179] According to the invention, a glycoside, such as a saponin according to the invention, bound to the cell-surface molecule targeting molecule comprised by the conjugate of the invention, which has the ‘ideal’ structure for the purpose of enhancing endosomal escape of an effector molecule comprised by the conjugate of the invention is a bisdesmosidic saponin according to Structure A of Scheme I, having a molecular mass of at least 1.500 Dalton and comprising an oleanan-type triterpene containing an aldehyde group at the C-23 position and optionally a hydroxyl group at the C-16 position, with a first branched carbohydrate side chain at the C-3 position which first branched carbohydrate side chain optionally contains glucuronic acid, wherein the saponin contains an ester group with a second branched carbohydrate side chain at the C-28 position which second branched carbohydrate chain preferably comprises at least four carbohydrate units, optionally containing at least one acetyl residue such as two acetyl residues and/or optionally comprising deoxy carbohydrates and/or optionally comprising quinovose and/or optionally comprising glucose and/or optionally comprising 4-methoxycinnamic acid and/or optionally comprising 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid and/or optionally comprising 5-O-[5-O-Rha-(1->2)-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid bound to a carbohydrate via an ester bond.
[0180] SO1861 is different from the “ideal structure” displayed in Scheme I, Structure A, only in having only one acetyl residue at the quinovose and having an additional xylose. The “ideal structure” of a saponin for enhancing endosomal escape of an effector molecule or effector moiety, is a saponin which preferably has the Structure A of Scheme I, and saponins which display the endosomal escape enhancing activity have one or more of the structural features displayed in Structure A of Scheme I. Without wishing to be bound by any theory, the inventors belief that the Structure A of Scheme I represents an “ideal saponin” (and not a minimum requirement saponin) for endosomal escape enhancing activity, which means that not all of the structures (chemical groups) can or must be present in each saponin with at least sufficient endosomal escape enhancing activity to promote accumulation of the effector moiety in the cytosol, and which means that some saponins might have other structure elements such as acyl chains, and/or for yet other saponins that display endosomal escape enhancing activity, the sugars can be different than the sugars displayed in Scheme I. For example, the QS-21 saponin and some of the saponins in the water soluble fraction of Quillaja saponaria (Quillaja saponins; Quil-A) differ in the carbohydrate modification at C-28 when the ideal structure of Structure A in Scheme I is considered: presence of an acyl chain in QS-21 for example. In the water soluble fraction of Quillaja saponaria, saponins such as QS-7, QS1862, are similar to the ideal Structure A, and are similar to SO1861.
[0181] An embodiment is the conjugate of the invention, wherein the at least one saponin is a bisdesmosidic saponin having a molecular mass of at least 1.500 Dalton and comprising an oleanan-type triterpene containing an aldehyde group at the C-23 position and optionally a hydroxyl group at the C-16 position, with a first branched carbohydrate side chain at the C-3 position which first branched carbohydrate side chain optionally contains glucuronic acid, wherein the saponin contains an ester group with a second branched carbohydrate side chain at the C-28 position which second branched carbohydrate chain preferably comprises at least four carbohydrate units, optionally containing at least one acetyl residue such as two acetyl residues and/or optionally comprising deoxy carbohydrates and/or optionally comprising quinovose and/or optionally comprising glucose and/or optionally comprising 4-methoxycinnamic acid and/or optionally comprising 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid and/or optionally comprising 5-O-[5-O-Rha-(1->2)-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid bound to a carbohydrate via an ester bond, or wherein the at least one saponin is QS-21 or any one or more of QS-21A, QS-21 A-api, QS-21 A-xyl, QS-21B, QS-21 B-api, QS-21 B-xyl, QS-7-xyl, QS-7-api, QS-17-api, QS-17-xyl, QS-18, QS1861, protonated QS1861 (QS1862), Quil-A.
[0182] Table A1 and Scheme I and the above embodiments summarize a series of saponins that have been identified for their endosomal escape enhancing activity when contacted to mammalian cells, in particular human tumor cells, in free form together with a second molecule (e.g. an effector moiety or effector molecule, such as a toxin, an oligonucleotide). Reference is also made to the saponins with such endosomal escape enhancing activity listed in Table 9 and 10 of Boettger (2013) [Stefan Böttger, Untersuchungen zur synergistischen Zytotoxizität zwischen Saponinen und Ribosomen inakdivierenden Proteinen Typ I, Dissertaton zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften (Dr. rer. nat.), eingereicht im Fachbereich Biologie, Chemie, Pharmazie der Freien Universität Berlin, Tabelle 9, Tabelle 10, page 67-74]. Indeed, in cell-based bioassays using human tumor cells it was established for the saponins tabulated in Table A1 and those in Scheme I and in the various embodiments of the invention described herein, that under influence of these saponins, when part of the conjugate of the invention, the effector moiety such as a nucleic acid and/or a toxin such as a protein toxin (e.g. one or more of the protein toxins listed in Table A5), comprised by the conjugate, is delivered into the cytosol with increased efficiency and/or efficacy, presumably through intracellular release from the (late) endosomes and lysosomes. That is to say, endosomal and/or lysosomal escape of such effector moieties bound by the conjugate of the invention, e.g. nucleic acids and/or toxins, is less efficient in the absence of the saponin.
[0183] Surprisingly, the inventors now demonstrate that a water-soluble saponin fraction from Quillaja saponaria, comprising QS-21 and its family members QS-21A, QS-21 A-api, QS-21 A-xyl, QS-21B, QS-21 B-api, QS-21 B-xyl, QS-7-xyl, QS-7-api, QS-17-api, QS-17-xyl, QS1861, QS1862, QS-18 and Quil-A, also exhibits the ability to potentiate a biological effect in vitro of e.g. a nucleic acid bound to a monoclonal antibody or a protein toxin bound to a monoclonal antibody (examples of conjugates of the invention comprising covalently bound oligonucleotide or payload such as a (protein) toxin), when administered to tumor cells of a mammalian species (human) in the form of a covalent conjugate comprising a monoclonal antibody (cell-surface molecule targeting molecule of the invention), together with bound effector moiety and the at least one glycoside such as the QS-21 and its family member saponins encompassed by such QS-21 preparation (e.g. water soluble fraction of Quillaja saponaria), comprised by conjugate as a covalent conjugate, wherein the effector molecule and the glycoside, e.g. saponin fraction of Quillaja saponaria, QS-21, SO1861, SA1641, GE1741, are covalently bound to for example the cell-surface molecule targeting molecule directly or via a linker or via a polymeric or oligomeric scaffold, either directly or via at least one linker. Without wishing to be bound by any theory, the observed stimulation or potentiation of for example antisense BNA mediated reduction of tumor-cell HSP27 expression (HSP27 gene silencing) in the presence of saponins derived from Quillaja saponaria in vitro may (also) relate to activation of the inflammasome in the tumor cell by the saponins, for example resulting in tumor cell pyroptosis. The inventors established that cell-surface molecule targeting molecules of the invention conjugated to for example antisense BNA or dianthin or saporin, exerted any anti-tumor cell activity in vitro at all or improved anti-tumor cell activity when contacted with cells in bio-based cell assays, when the conjugate comprises a saponin such that the saponin(s) is/are targeted to the same (tumor) cells, whereas in the absence of the saponin(s), i.e. conventional ADC format without linked saponin(s), no such activity towards the tumor cell was observed. Presence of covalently coupled saponin in the conjugate of the invention proved to be essential for the efficient exertion of the activity of the effector moiety in the conjugate.
[0184] QS-21, and also the water-soluble saponins fraction comprising QS-21 from Quillaja saponaria is already for a long time known and previously intensively applied for its immune-potentiating abilities, e.g. as an adjuvant in e.g. sub-unit vaccines. For example, QS-21 is applied in two phase III clinical trials with human patients, who were vaccinated with a sub-unit vaccine mixed with an adjuvant comprising QS-21 (Glaxo-Smith-Kline, MAGRIT trial, DERMA study), wherein the sub-unit was MAGE-A3 protein, which is specifically expressed and presented by tumor cells. The anti-tumor vaccinations, potentiated with QS-21, aimed for extension of disease-free survival of the cancer patients (melanoma; non-small cell lung cancer). In addition, QS-21 has been tested as an adjuvant in clinical trials for developing anti-cancer vaccine treatment, for vaccines for HIV-1 infection, in development of a vaccine against hepatitis B, and for anti-malaria vaccine development using QS-21 comprising adjuvants AS01 and AS02 of Glaxo-Smith-Kline. Previous studies revealed an immune response elicited against MAGE-A3 peptides presented at the cancer cell surface, under influence of the QS-21 saponin comprising adjuvant (AS15; GSK). To the surprise of the inventors, the saponin fraction of Quillaja saponaria, and thus likely QS-21 (as part of the water soluble saponin fraction of Quillaja saponaria) potentiates the anti-tumor cell activity of e.g. a payload such as a protein toxin (dianthin), bound to the cell-surface molecule targeting molecule (e.g. the ligand EGF) in the conjugate of the invention (e.g. the ligand EGF).
[0185] By targeting a single cell-surface molecule with the conjugate of the invention, the delivery of the saponin and the effector moiety bound to the cell-surface molecule targeting molecule in the conjugate of the invention, at and inside the cytosol of the targeted cell, exposing the cell-surface molecule on the cell surface, is improved and more specific, compared to for example contacting the cell with only a regular ADC lacking the saponin of the invention, thus without the presence of the cell-targeted saponin (conjugate of the invention). An aberrant cell selected for targeting by the cell-surface molecule targeting molecule of the conjugate, ideally bears the epitope on the cell-surface molecule to which the cell-surface molecule targeting molecule can bind, to a high extent (i.e. relatively higher expression of the targeted cell-surface molecule on the targeted cell such as for example a tumor cell or an auto-immune cell, than the expression on a non-targeted cell such as for example a healthy cell) and/or expose the epitope in the targeted cell-surface molecule for binding of the cell-surface molecule targeting molecule of the conjugate, specifically, when (neighboring) healthy cells in a patient are considered. Preferably, the cell-surface molecule targeted by the cell-surface molecule targeting molecule of the conjugate of the invention is relatively highly and/or specifically expressed on the targeted (diseased, tumor) cell compared to healthy cells. An embodiment is the conjugate of the invention, wherein the target cell-surface molecule for the cell-surface molecule targeting molecule of the conjugate such as a tumor-cell receptor, is expressed specifically or to a relatively higher extent when compared to expression of the cell-surface molecule on the surface of a healthy (neighboring) cell. Thus, the epitope on the targeted cell-surface molecule is ideally unique to the targeted diseased cells, and is at least specifically present and exposed at the surface of the targeted cells. Binding of the conjugate of the invention to the epitope on the cell-surface molecule on a targeted cell is followed by endocytosis of the complex of the conjugate and the target cell-surface molecule. Since the conjugate only can enter the target cell through binding interaction with a cell-surface molecules specifically expressed to a sufficient extent or uniquely expressed on the targeted cell when compared to healthy cells that should not be targeted, accumulation of a therapeutically active amount of effector moiety and saponin comprised by the conjugate, inside the target cells is only possible and occurring if expression levels of the targeted cell-surface molecule is above a certain minimal expression threshold. At the same time, the fact that the effector moiety bound to the cell-surface molecule targeting molecule of the conjugate is only capable of exerting its intracellular (e.g. cytotoxic or gene silencing) activity in the presence of very same conjugate bearing the covalently bound saponin, also provides a safeguard against negative and undesired side effects of the effector moiety towards e.g. healthy cells and healthy tissue not meant to be targeted and affected by the effector moiety, when compared to exposure of cells to an ADC without the covalently bound saponin(s). That is to say, sufficiently low expression or even absence of exposed cell-surface molecule, to which a conjugate could bind, does ideally not allow entrance into (non-targeted) healthy cells of the conjugate to amounts that would result in endosomal escape of the effector moiety under influence of the saponin comprised by the conjugate. Since the ADC with coupled saponin or the AOC with covalently coupled saponin according to the invention can be used at lower dose compared to when the ADC or AOC without coupled saponin was applied in the therapeutic regimen, entrance of ADC with coupled saponin or entrance of AOC with coupled saponin in healthy cells to low extent already bears a lower risk for occurrence of unwanted side effects when for example the targeting and killing of target diseased cells such as tumor cells and auto-immune cells is considered.
[0186] An embodiment is the conjugate of the invention, wherein the cell-surface molecule targeting molecule comprises or consists of a ligand or a proteinaceous ligand or a proteinaceous binding molecule for binding to the cell-surface molecule.
[0187] An embodiment is the conjugate of the invention, wherein the cell-surface molecule targeting molecule comprises or consists of a non-proteinaceous ligand and/or a proteinaceous ligand for binding to a cell-surface molecule such as EGF or a cytokine, and/or comprises or consists of an immunoglobulin, at least one binding domain of an immunoglobulin and/or at least one binding fragment of an immunoglobulin, such as an antibody, an IgG, a molecule comprising or consisting of a Vhh domain or Vh domain, a Fab, an scFv, an Fv, a dAb, an F(ab).sub.2, Fcab fragment, which can bind to the cell-surface molecule.
[0188] The inventors established that such immunoglobulins, domains thereof, ligands, etc., are particularly suitable for application as the cell-surface molecule targeting molecule of the conjugate comprising the binding site for binding to the target cell surface molecule. For example, antibodies and binding domains of antibodies are suitable for targeting an epitope in a selected cell-surface molecule exposed on the cell surface, resulting in targeting the conjugate and thus the effector moiety and the saponin together to target cells expressing the cell-surface molecule targeted by the cell-surface molecule targeting molecule of the conjugate. Similarly, ligands such as EGF, targeting the EGFR on target cells, are suitable for application as the cell-surface molecule targeting molecule in the conjugate. Preferred are cell-surface molecule targeting molecules for binding an epitope in a target cell surface molecule, which are specific for the binding of the conjugate to the cell-surface molecule. Cell-surface molecule targeting molecules of the invention based on antibodies or domains or binding fragments thereof for example provide for such desired specificity for a selected epitope on a selected cell-surface molecule of a selected cell for targeting such as a diseased cell, a tumor cell, an auto-immune cell, etc. Therefore, cell-surface molecule targeting molecules based on antibodies or binding molecules (fragments, domains), such as (human, humanized, chimeric) monoclonal antibodies, are preferred for the conjugates of the invention.
[0189] An embodiment is the conjugate of the invention, wherein the cell-surface molecule targeting molecule can bind to a tumor-cell surface molecule, preferably a tumor-cell receptor such as a tumor-cell specific receptor, more preferably a receptor selected from CD71, CA125, EpCAM(17-1A), CD52, CEA, CD44v6, FAP, EGF-IR, integrin, syndecan-1, vascular integrin alpha-V beta-3, HER2, EGFR, CD20, CD22, Folate receptor 1, CD146, CD56, CD19, CD138, CD27L receptor, PSMA, CanAg, integrin-alphaV, CA6, CD33, mesothelin, Cripto, CD3, CD30, CD239, CD70, CD123, CD352, DLL3, CD25, ephrinA4, MUC1, Trop2, CEACAM5, CEACAM6, HER3, CD74, PTK7, Notch3, FGF2, C4.4A, FLT3, CD38, FGFR3, CD7, PD-L1, CTLA4, CD52, PDGFRA, VEGFR1, VEGFR2, preferably selected from CD71, HER2 and EGFR. These receptors are preferred examples of molecules bearing epitopes to which the cell-surface molecule targeting molecule of the conjugate of the invention can bind, which molecules are sufficiently specific or even uniquely expressed at the surface of selected target cells for binding of the conjugate, such that the conjugate binds uniquely, and/or specifically, or at least preferentially and at least to a larger extent to said target cells compared to binding of the conjugate to cells which express and expose the receptor to a lower extent or does not expose the receptor at the cell surface. The target cells are for example aberrant cells, tumor cells, malignant cells, diseased cells, B-cells involved in malignancy, auto-immune cells, etc.
[0190] An embodiment is the conjugate of the invention, wherein the tumor-cell receptor is internalized by the tumor cell after binding to the cell-surface molecule targeting molecule of the invention or wherein the tumor-cell receptor is internalized by the tumor cell after binding to the conjugate of the invention, and wherein preferably binding of the cell-surface molecule targeting molecule and binding of the conjugate to the tumor-cell receptor is followed by tumor-cell receptor-mediated internalization, e.g. via endocytosis, of a complex of the conjugate and the tumor-cell receptor.
[0191] An embodiment is the conjugate of the invention, wherein the tumor-cell receptor is internalized by the tumor cell upon binding and/or internalization is induced by the binding to the cell-surface molecule targeting molecule of the invention, or wherein the tumor-cell receptor is internalized by the tumor cell after binding to the conjugate of the invention, or internalized upon and/or due to the binding of the conjugate to the tumor cell receptor, and wherein preferably binding of the cell-surface molecule targeting molecule and binding of the conjugate to the tumor-cell receptor induces and/or results in tumor-cell receptor-mediated internalization, e.g. via endocytosis, of a complex of the conjugate and the tumor-cell receptor.
[0192] Synchronization is the missing link between a successful delivery strategy for mice and its application in humans. Indeed, the inventors established in a series of in vivo mouse tumor models that separately administering to the mice a dose of free saponin and a dose of e.g. ADC without coupled saponin, did not result in any desired anti-tumor activity such as delayed tumor growth, tumor regression, diminished and slower tumor growth, compared to control animals not treated with the ADC in the presence of free saponin. The free saponin was administered using various routes of administration and using various time points of administering the free saponin compared to the moment of administering the ADC (administering free saponin before, during and after administering the ADC). The ADC tested in in vivo tumor models was cetuximab-dianthin (with free SO1861), or trastuzumab-saporin (with free SO1861). Varying the dose of free saponin did not provide for an efficacious anti-tumor activity. The ADCs referred to were administered at a dose that in itself did not inflict any beneficial anti-tumor effect on the tumor-bearing animals. Surprisingly, the inventors now established that beneficial anti-tumor activity in various in vitro mammalian cell-based bioassays using human tumor cells and/or in various in vivo animal tumor models can be achieved by treating the cells or animals with conjugates according to the invention. The conjugates optionally comprising a scaffold according to the invention (see below). The scaffold for example being a tri-functional linker with a covalently bound saponin (e.g. SO1861, QS-21) via a cleavable or non-cleavable linkage, and/or with a covalently bound effector moiety (e.g. dianthin, gene-silencing antisense BNA(HSP27) via a non-cleavable bond or a cleavable bond, the scaffold linked with a covalently bond to the cell-surface molecule targeting molecule of the conjugate such as a monoclonal antibody such as cetuximab, trastuzumab, OKT-9, or the scaffold being a dendron, such as a dendron, for example G4-dendron, to which for example four moieties can bind such as four saponin molecules, or a dendron for binding for example two saponins and two effector molecules, the dendron comprising a chemical group for (covalent) coupling to the cell-surface molecule targeting molecule of the conjugate such as a ligand or an antibody or fragment or domain thereof. Reference is made to the further embodiments and the Examples section, exemplifying various of these scaffolds according to the invention, showing in vivo and/or in vitro anti-tumor cell activity when cell toxicity exerted by e.g. a proteinaceous toxin is considered or when gene silencing in the tumor cell is considered.
[0193] Without wishing to be bound by any theory, in view of the failures observed when treatment of tumor-bearing animals with an ADC together with free saponin is considered, it is preferred to synchronize the presence of both, the at least one saponin, and the effector moiety, preferably a toxin or an oligonucleotide, in compartments or vesicles of the endocytic pathway of the target cell, e.g. a tumor cell or an auto-immune cell. With ADC and free saponin, synchronizing the presence of the molecules in the late endosomes, in order to obtain the synergistic effects in vivo was not beneficially obtainable according to attempts of the inventors. In one aspect, the invention preferably solves at least the following problem with respect to combining the effector moiety and the saponin(s) in a single conjugate molecule: without wishing to be bound by any theory the only reasonable chemical group within, e.g., the saponins that can be used for (covalent), in particular single and cleavable, retainable coupling is required for the endosomal escape activity. Known restrictions are most likely the reason why saponins have not been used in combination with pharmaceutically active substances in clinical investigations other than the application of saponins in vaccination regimes wherein the use of an immune-potentiating adjuvant substance was implied, although the striking endosomal escape enhancer effect of, e.g., saponins listed in Table A1 and Scheme I is known for more than 10 years. For example providing a conjugate of the invention with a covalently bound saponin, for example in the context of a scaffold carrying several saponins, solves these difficulties, at least in part. Surprisingly, the saponins previously applied for their immune-potentiating activity in the vaccination context involving saponins as adjuvant component, are now also suitably for (covalent) coupling to the cell-surface molecule targeting molecule comprised by the conjugate of the invention, for anti-tumor activity in vitro and in vivo.
[0194] An embodiment is the conjugate of the invention, wherein the cell-surface molecule targeting molecule is or comprises a monoclonal antibody or at least one cell-surface molecule binding fragment or -domain thereof, and preferably comprises or consists of any one of cetuximab, daratumumab, gemtuzumab, trastuzumab, panitumumab, brentuximab, inotuzumab, moxetumomab, polatuzumab, obinutuzumab, OKT-9 anti-CD71 monoclonal antibody of the IgG type, pertuzumab, rituximab, ofatumumab, Herceptin, alemtuzumab, pinatuzumab, OKT-10 anti-CD38 monoclonal antibody, an antibody of Table A2 or Table A3 or Table A4, preferably cetuximab or trastuzumab or OKT-9, or at least one cell-surface molecule binding fragment or -domain thereof.
[0195] As said, by targeting the cell-surface molecule with the cell-surface molecule targeting molecule of the conjugate of the invention, the delivery of the saponin and the effector moiety at and inside the cytosol of the very same targeted cell is improved and more specific. An aberrant cell selected for targeting by the cell-surface molecule targeting molecule of the conjugate ideally bears the cell-surface molecule to a high extent and/or specifically, when (neighboring) healthy cells in a patient are considered. Thus, the epitope on the targeted cell-surface molecule is ideally unique to the targeted diseases cells, and is at least specifically present and exposed at the surface of the targeted cells. Binding of the conjugate is followed by endocytosis of the complexes of the conjugate and the target cell-surface molecule.
[0196] Tables A2, A3 and A4 list preferred examples of the cell-surface molecule comprising the epitope for the cell-surface molecule targeting molecule of the conjugate of the invention. When the cell-surface molecule is specifically expressed on the target cell, preferably binding of the conjugate to the cell-surface molecule results in the specific targeting of the conjugate to the desired target cell such as a tumor cell exposing the tumor-cell surface molecule, whereas other cells such as healthy cells, which do not express the cell-surface molecule or do express cell-surface molecule to a lower extent, compared to expression of the cell-surface molecule(s) on the targeted (aberrant) cell, are not targeted by the conjugate or are only targeted to a lower extent.
[0197] A pharmaceutically active substance in this invention is an effector moiety that is used to achieve a beneficial outcome in an organism, preferably a vertebrate, more preferably a human being such as a cancer patient or an auto-immune patient. Benefit includes diagnosis, prognosis, treatment, cure and/or prevention of diseases and/or symptoms. The pharmaceutically active substance may also lead to undesired harmful side effects. In this case, pros and cons must be weighed to decide whether the pharmaceutically active substance is suitable in the particular case. If the effect of the pharmaceutically active substance inside a cell is predominantly beneficial for the whole organism, the cell is called a target cell. If the effect inside a cell is predominantly harmful for the whole organism, the cell is called an off-target cell. In artificial systems such as cell cultures and bioreactors, target cells and off-target cells depend on the purpose and are defined by the user.
[0198] An effector moiety that is a polypeptide may be, e.g., a polypeptide that recover a lost function, such as for instance enzyme replacement, gene regulating functions, or a toxin.
[0199] An embodiment is the conjugate of the invention, wherein the at least one effector moiety comprises or consists of any one or more of an oligonucleotide, a nucleic acid and a xeno nucleic acid, preferably selected from any one or more of a vector, a gene, a cell suicide inducing transgene, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), anti-sense oligonucleotide (ASO, AON), short interfering RNA (siRNA), microRNA (miRNA), DNA aptamer, RNA aptamer, mRNA, mini-circle DNA, peptide nucleic acid (PNA), phosphoramidate morpholino oligomer (PMO), locked nucleic acid (LNA), bridged nucleic acid (BNA), 2′-deoxy-2′-fluoroarabino nucleic acid (FANA), 2′-O-methoxyethyl-RNA (MOE), 2-O,4′-aminoethylene bridged nucleic acid, 3′-fluoro hexitol nucleic acid (FHNA), a plasmid, glycol nucleic acid (GNA) and threose nucleic acid (TNA), or a derivative thereof, more preferably a BNA, for example a BNA for silencing HSP27 protein expression.
[0200] The inventors show that a tumor-cell targeting monoclonal antibody provided with covalently coupled antisense BNA such as BNA(HSP27) and provided with covalently coupled saponin of the invention, that is contacted with tumor cells, both the BNA and the saponin coupled to the antibody (e.g. cetuximab) via a cleavable bond, is capable of silencing HSP27 in vivo in tumors, compared to control and compared to the AOC bearing the BNA only and not the saponin (SO1861, Quil-A). Administering an ADC-saponin conjugate of the invention or an antibody-oligonucleotide conjugate-saponin conjugate of the invention (AOC-saponin), such as an antibody-BNA-saponin conjugate, thus endows the ADC-saponin or AOC-saponin with anti-tumor cell activity not seen with only the ADC or only the AOC, which do not have the covalently saponins bound to the monoclonal antibody, at the same dose. Noteworthy, the AOC and the separate monoclonal antibody with covalently coupled saponin as a combination of two separate conjugates, increase HSP27 expression in tumor cells, when administered to tumor-bearing mice separately in separate groups of mice, compared to a control group (vehicle administered, only). Only administration of the AOC-saponin conjugate of the invention comprising the effector moiety of the invention, displays reduced HSP27 expression when compared to controls. The antisense BNA (HSP27) was BNA with oligo nucleic acid sequence 5′-GGCacagccagtgGCG-3′ according to Zhang et al. (2011) [Y Zhang, Z Qu, S Kim, V Shi, B Liao1, P Kraft, R Bandaru, Y Wu, L M Greenberger and ID Horak, Down-modulation of cancer targets using locked nucleic acid (LNA)-based antisense oligonucleotides without transfection, Gene Therapy (2011) 18, 326-333]. Noteworthy, to the best of the knowledge of the inventors, BNA is designed for application as a free nucleic acid. The inventors are now the first to demonstrate that the antisense BNA can be covalently coupled through a (non-)cleavable linker with a ligand or an antibody, in a way that gene-silencing activity is retained in vitro and more importantly in vivo in the tumor cells of a tumor-bearing animal. This approach of providing BNA based AOCs opens new ways to administer targeted BNA to human (cancer) patients in need thereof.
[0201] An embodiment is the conjugate of the invention, wherein the at least one effector moiety comprises or consists of at least one proteinaceous molecule, preferably selected from any one or more of a peptide, a protein, an enzyme such as urease and Cre-recombinase, a ribosome-inactivating protein, a proteinaceous toxin selected from Table A5 and more preferably selected from any one or more of a viral toxin such as apoptin; a bacterial toxin such as Shiga toxin, Shiga-like toxin, Pseudomonas aeruginosa exotoxin (PE) or exotoxin A of PE, full-length or truncated diphtheria toxin (DT), cholera toxin; a fungal toxin such as alpha-sarcin; a plant toxin including ribosome-inactivating proteins and the A chain of type 2 ribosome-inactivating proteins such as dianthin e.g. dianthin-30 or dianthin-32, saporin e.g. saporin-S3 or saporin-S6, bouganin or de-immunized derivative debouganin of bouganin, shiga-like toxin A, pokeweed antiviral protein, ricin, ricin A chain, modeccin, modeccin A chain, abrin, abrin A chain, volkensin, volkensin A chain, viscumin, viscumin A chain; or an animal or human toxin such as frog RNase, or granzyme B or angiogenin from humans, or any fragment or derivative thereof; preferably the protein toxin is dianthin and/or saporin.
[0202] An embodiment is the conjugate of the invention, wherein the at least one effector moiety comprises or consists of at least one payload, preferably selected from any one or more of a toxin targeting ribosomes, a toxin targeting elongation factors, a toxin targeting tubulin, a toxin targeting DNA and a toxin targeting RNA, more preferably any one or more of emtansine, pasudotox, maytansinoid derivative DM1, maytansinoid derivative DM4, monomethyl auristatin E (MMAE, vedotin), monomethyl auristatin F (MMAF, mafodotin), a Calicheamicin, N-Acetyl-γ-calicheamicin, a pyrrolobenzodiazepine (PBD) dimer, a benzodiazepine, a CC-1065 analogue, a duocarmycin, Doxorubicin, paclitaxel, docetaxel, cisplatin, cyclophosphamide, etoposide, docetaxel, 5-fluorouracyl (5-FU), mitoxantrone, a tubulysin, an indolinobenzodiazepine, AZ13599185, a cryptophycin, rhizoxin, methotrexate, an anthracycline, a camptothecin analogue, SN-38, DX-8951f, exatecan mesylate, truncated form of Pseudomonas aeruginosa exotoxin (PE38), a Duocarmycin derivative, an amanitin, α-amanitin, a spliceostatin, a thailanstatin, ozogamicin, tesirine, Amberstatin269 and soravtansine, or a derivative thereof.
[0203] An effector moiety useful in the present invention preferably relies on late endosomal escape for exerting its effect. Some effectors, such as, e.g., a pseudomonas exotoxin, are rerouted to other organelles prior to the “late endosomal stage” and, thus, would normally not benefit from coupling to the second proteinaceous molecule according to the present invention. However, such toxin may be adapted for use with the present invention, e.g., by deleting the signal peptide responsible rerouting. In particular toxins that are highly toxic and would require only one molecule to escape the endosomes to kill a cell maybe modified to be less potent. It is preferred to use a toxin that kills a cell if at least 2, more preferably at least 5, more preferably at least 10, more preferably at least 20, more preferably at least 50, most preferably at least 100 toxin molecules escape the endosome. It is further preferred that a conjugate of the invention comprises a covalently conjugated functionalized scaffold, i.e. a scaffold such as an oligomeric or polymeric scaffold or a tri-functional linker, comprising covalently bound effector moietie(s) for targeting the scaffold comprising the bound effector moietie(s) at a target cell such as a tumor cell or an auto-immune cell. Further, in order to reduce off-target toxicity, cell membrane non-permeable small molecule toxins are preferred effector molecules over cell membrane permeable toxins.
[0204] The term “ligand” as used in this invention has its ordinary meaning and preferably means a molecule or structure that is able to bind another molecule or structure on the cell surface of a target cell, wherein said molecule or structure on the cell surface can be endocytosed and is preferably absent or less prominent on off-target cells. Preferably, said molecule or structure on the cell surface is constitutively endocytosed. More preferably a conjugate or more specifically a cell-surface molecule targeting molecule, in this invention induces endocytosis of said molecule or structure on the cell surface of target cells after binding to said molecule or structure. This is for instance the case for Epidermal Growth Factor Receptor (EGFR), HER2 and CD71 present on the surface of a variety of cancer cells. Examples of molecules or structures on the cell surface of target cells that are constitutively endocytosed, are for instance Claudin-1 or major histocompatibility complex class II glycoproteins. A cell-surface molecule targeting molecule can, e.g., be an antibody, a growth factor or a cytokine. Combining in a conjugate of the invention a toxin with a cell-surface molecule targeting molecule and with at least one saponin of the invention is one possibility to create a targeted toxin. A toxin that is only toxic in a target cell because it interferes with processes that occur in target cells only can also be seen as a targeted toxin (as in off-target cells it cannot exert its toxic action, e.g. apoptin). Preferably, a targeted toxin is a toxin that is combined with a cell-surface molecule targeting molecule such as e.g. a monoclonal antibody in order to be active in target cells and not in off-target cells (as it is only bound to and endocytosed by target cells). In a conjugate of the invention comprising a functionalized scaffold comprising e.g. the effector moiety and/or the saponin(s), the cell-surface molecule targeting molecule such as the monoclonal antibody guides the effector moiety and/or the saponin(s) via the scaffold to the target cells. After internalization, the at least one glycoside, preferably a saponin comprised by the conjugate of the invention, mediates the endosomal escape of the effector moiety. The saponin is typically a saponin listed in Table A1 and Scheme I, and preferably the saponin is SO1861 and/or QS-21, and/or SA1641 and/or GE1741.
[0205] Preferably, the effector moiety comprised by the conjugate of the invention, which effect is enhanced by the saponins comprised by the conjugate, detaches from the conjugate, e.g. detaches from an antibody present in the conjugate as the cell-surface molecule targeting molecule, when endocytosed. This can be achieved by a cleavable bond that breaks, e.g. under acidic, reductive, enzymatic or light-induced conditions.
[0206] An embodiment is the conjugate of the invention, wherein the at least one effector moiety is covalently bound to the cell-surface molecule targeting molecule, either via at least one linker or bound directly to the cell-surface molecule targeting molecule.
[0207] An embodiment is the conjugate of the invention, wherein the at least one effector moiety is covalently bound to the cell-surface molecule targeting molecule, thereby forming any one of antibody-drug conjugates Gemtuzumab ozogamicin, Brentuximab vedotin, Trastuzumab emtansine, Inotuzumab ozogamicin, Moxetumomab pasudotox and Polatuzumab vedotin and an antibody-drug conjugate of Table A2 and Table A3.
[0208] An embodiment is the conjugate of the invention, wherein the at least one saponin is covalently bound to the cell-surface molecule targeting molecule preferably an amino-acid residue of the cell-surface molecule targeting molecule, via an aldehyde function in the saponin, and/or to the at least one effector moiety preferably via an amino-acid residue in the at least one effector moiety, via an aldehyde function in the saponin, preferably an aldehyde function in position C-23 in a bisdesmosidic triterpene saponin belonging to the type of a 12,13-dehydrooleanane.
[0209] An embodiment is the conjugate of the invention, wherein the aldehyde function in the at least one saponin, preferably the aldehyde function in position C-23 of the at least one saponin, is covalently coupled to linker N-ε-maleimidocaproic acid hydrazide, which linker is covalently coupled via a thio-ether bond to a sulfhydryl group in the cell-surface molecule targeting molecule and/or in the at least one effector moiety, such as a sulfhydryl group of a cysteine.
[0210] An embodiment is the conjugate of the invention, wherein the at least one saponin is a bisdesmosidic triterpene saponin belonging to the type of a 12,13-dehydrooleanane, with an aldehyde function in position C-23 and comprising a glucuronic acid function in a carbohydrate substituent at the C-3beta-OH group of the saponin, wherein the saponin is covalently bound to an amino-acid residue of the cell-surface molecule targeting molecule and/or to the at least one effector moiety via said glucuronic acid function and preferably via an amino-acid residue in the at least one effector moiety.
[0211] An embodiment is the conjugate of the invention, wherein the glucuronic acid function in the carbohydrate substituent at the C-3beta-OH group of the at least one saponin is covalently coupled to linker 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate, which linker is covalently coupled via an amide bond to an amine group in the cell-surface molecule targeting molecule and/or in the at least one effector moiety, such as an amine group of a lysine or an N-terminus of the cell-surface molecule targeting molecule and/or of the at least one effector moiety.
[0212] An embodiment is the conjugate of the invention, wherein the at least one saponin is covalently bound to the cell-surface molecule targeting molecule and/or to the at least one effector moiety either directly or via at least one linker such as a bi-functional linker, for example based on N-ε-maleimidocaproic acid hydrazide and/or based on 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate, or a tri-functional linker, such as the tri-functional linker of Scheme II and Structure B.
[0213] An embodiment is the conjugate of the invention, wherein the tri-functional linker comprises a second chemical group with at least one saponin covalently bound thereto, a third chemical group for covalent binding to the cell-surface molecule targeting molecule and a first chemical group for covalent binding to the at least one effector moiety, preferably the tri-functional linker is the trifunctional linker of Scheme II and Structure B.
[0214] An embodiment is the conjugate of the invention, wherein the at least one saponin is covalently bound to the cell-surface molecule targeting molecule and to the at least one effector moiety via at least one linker comprising a tri-functional linker to which tri-functional linker both the cell-surface molecule targeting molecule and the at least one effector moiety are bound, preferably the tri-functional linker is the trifunctional linker of Scheme II and Structure B.
[0215] An embodiment is the tri-functional linker of the invention such as the tri-functional linker of Scheme II and Structure B and/or
[0216] An embodiment is the use of the tri-functional linker according to the invention such as the tri-functional linker of Scheme II and Structure B, for the manufacture of a conjugate, such as an ADC or an AOC, preferably a conjugate comprising at least one saponin of the invention, ADC-saponin conjugate and/or AOC-saponin conjugate according to the invention.
[0217] An embodiment is the semi-finished product comprising the tri-functional linker of the invention, wherein at least one saponin according to the invention is covalently bound to the tri-functional linker and/or wherein at least one effector moiety according to the invention is covalently bound to the tri-functional linker, either directly or via at least one linker and/or via at least one oligomeric or polymeric scaffold of the invention, wherein the linker is preferably a cleavable linker according to the invention, the effector moiety of the invention being preferably a toxin such as a protein toxin selected from dianthin, saporin, and/or the saponin of the invention being preferably any one or more of Quil-A, QS-21, QS-7, QS1861, SO1861, SA1641, GE1741 and the water-soluble saponin fraction of Quillaja saponaria.
[0218] An embodiment is the conjugate of the invention, wherein the at least one linker comprises at least one cleavable linker, wherein optionally said cleavable linker is subject to cleavage under acidic, reductive, enzymatic or light-induced conditions, and preferably the cleavable linker comprises a cleavable bond selected from a hydrazone bond or a hydrazide bond subject to cleavage under acidic conditions, and/or a bond susceptible to proteolysis, for example proteolysis by Cathepsin B, and/or a bond susceptible for cleavage under reductive conditions such as a disulphide bond.
[0219] An embodiment is the conjugate of the invention, wherein the at least one linker comprises at least one cleavable linker, wherein said cleavable linker is subject to cleavage in vivo under acidic conditions as present in endosomes and/or in lysosomes of mammalian cells, preferably of human cells, preferably at pH 4.0-6.5, and more preferably at pH≤5.5.
[0220] An embodiment is the conjugate of the invention, wherein the at least one saponin is covalently bound to a lysine side chain, forming an amide bond, and/or to a cysteine side chain, forming a thio-ether linkage or a disulphide bond, wherein the lysine and/or cysteine is/are comprised by the cell-surface molecule targeting molecule and/or is/are comprised by the at least one effector moiety, and wherein the at least one saponin is either directly bound to the lysine and/or cysteine, or is bound via at least one linker optionally comprising a cleavable linker and/or a tri-functional linker such as the tri-functional linker of Scheme II and Structure B.
[0221] An embodiment is the conjugate of the invention, wherein the linker is based on N-ε-maleimidocaproic acid hydrazide and/or based on 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate, a tri-functional linker such as the tri-functional linker of Scheme II and Structure B, a cleavable linker, and/or involves any one or more of a disulphide bond, a thio-ether bond, an amide bond, a hydrazide bond.
[0222] An embodiment is the conjugate of the invention, wherein the at least one saponin is covalently bound to the cell-surface molecule targeting molecule and/or to the at least one effector moiety via at least one linker, wherein the linker is or comprises a scaffold comprising a polymeric or oligomeric structure and further comprising at least one fourth chemical group for covalently coupling of the scaffold to the cell-surface molecule targeting molecule and/or to the at least one effector moiety.
[0223] An embodiment is the conjugate of the invention, wherein the at least one saponin is covalently bound to the polymeric or oligomeric structure of the scaffold via a cleavable bond and/or via a non-cleavable bond.
[0224] An embodiment is the conjugate of the invention, wherein the cleavable bond is subject to cleavage under any of acidic conditions, reductive conditions, enzymatic conditions and light-induced conditions, and preferably the cleavable bond comprises a hydrazone bond or a hydrazide bond subject to cleavage under acidic conditions, and/or a bond susceptible to proteolysis, for example proteolysis by Cathepsin B, and/or a bond susceptible for cleavage under reductive conditions such as a disulphide bond.
[0225] An embodiment is the conjugate of the invention, wherein the cleavable bond is subject to cleavage in vivo under acidic conditions as present in endosomes and/or in lysosomes of mammalian cells, preferably of human cells, preferably at pH 4.0-6.5, and more preferably at pH≤5.5.
[0226] An embodiment is the conjugate of the invention, wherein the at least one saponin is covalently bound to the polymeric or oligomeric structure of the scaffold via any one or more of an imine bond, a hydrazone bond, a hydrazide bond, an oxime bond, a 1,3-dioxolane bond, a disulphide bond, a thio-ether bond, an amide bond, a peptide bond or an ester bond, preferably via at least one linker.
[0227] An embodiment is the conjugate of the invention, wherein the at least one saponin is covalently bound to the polymeric or oligomeric structure of the scaffold via any one or more of an imine bond, a hydrazone bond and a hydrazide bond, which bond is preferably cleavable according to the invention, wherein preferably the at least one saponin is covalently bound to the polymeric or oligomeric structure of the scaffold via the aldehyde function in position C-23 of the at least one saponin.
[0228] An embodiment is the conjugate of the invention, wherein the aldehyde function in position C-23 of the at least one saponin is covalently coupled to linker N-ε-maleimidocaproic acid hydrazide, which linker is covalently coupled via a thio-ether bond to a sulfhydryl group in the polymeric or oligomeric structure of the scaffold, such as a sulfhydryl group of a cysteine.
[0229] An embodiment is the conjugate of the invention, wherein the at least one saponin is covalently bound to the polymeric or oligomeric structure of the scaffold via an amide bond, wherein preferably the at least one saponin is covalently bound to the polymeric or oligomeric structure of the scaffold via the glucuronic acid function in the carbohydrate substituent at the C-3beta-OH group of the at least one saponin, when present.
[0230] An embodiment is the conjugate of the invention, wherein the glucuronic acid function in the carbohydrate substituent at the C-3beta-OH group of the at least one saponin is covalently coupled to linker 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate, which linker is covalently coupled via an amide bond to an amine group in the polymeric or oligomeric structure of the scaffold, such as an amine group of a lysine or an N-terminus of the polymeric or oligomeric structure of the scaffold.
[0231] An embodiment is the conjugate of the invention, wherein the at least one saponin is covalently bound to the polymeric or oligomeric structure of the scaffold, involving in the covalent bond the aldehyde function in position C-23 of the at least one saponin, when present, and/or involving in the covalent bond the glucuronic acid function in the carbohydrate substituent at the C-3beta-OH group of the at least one saponin, when present.
[0232] An embodiment is the conjugate of the invention, wherein the at least one fourth chemical group of the scaffold, for covalently coupling of the scaffold to the cell-surface molecule targeting molecule and/or to the at least one effector moiety, is a click chemistry group, preferably selected from any one or more of a tetrazine, an azide, an alkene or an alkyne, or a cyclic derivative of these groups, preferably an azide group.
[0233] An embodiment is the conjugate of the invention, wherein the polymeric or oligomeric structure of the scaffold comprises a linear, branched and/or cyclic polymer, oligomer, dendrimer, dendron, dendronized polymer, dendronized oligomer, a DNA, a polypeptide, poly-lysine, a poly-ethylene glycol, or an assembly of these polymeric or oligomeric structures which assembly is preferably built up by covalent cross-linking.
[0234] An embodiment is the conjugate of the invention, wherein the at least one saponin is a defined number of saponins or a defined range of saponins, preferably 1-128 saponins or at least 2, 3, 4, 5, 6, 8, 10, 16, 32, 64 or 128 saponins, or any number of saponins therein between, such as 7, 9, 12 saponins.
[0235] An embodiment is the conjugate of the invention, wherein the conjugate comprises more than one saponin, preferably 2, 3, 4, 5, 6, 8, 10, 16, 32, 64 or 1-100 saponins, or any number of saponins therein between, such as 7, 9, 12 saponins, covalently bound directly to an amino-acid residue of the cell-surface molecule targeting molecule and/or to the at least one effector moiety and preferably via an amino-acid residue in the at least one effector moiety, preferably to a cysteine and/or to a lysine, and/or covalently bound via at least one linker and/or via at least one cleavable linker and/or via at least one polymeric or oligomeric scaffold of any one of the claims 28-40, preferably 1-8 of such scaffolds or 2-4 of such scaffolds, wherein 1-32 saponins, preferably 2, 3, 4, 5, 6, 8, 10, 16 or 32 saponins, or any number of saponins therein between, such as 7, 9, 12 saponins, are covalently bound to the at least one scaffold.
[0236] An embodiment is the conjugate of the invention, wherein the at least one saponin is covalently bound to the cell-surface molecule targeting molecule and to the at least one effector moiety via a tri-functional linker, the tri-functional linker comprising a second chemical group with at least one saponin covalently bound thereto either directly or via a linker such as a cleavable linker and/or via the scaffold comprising a polymeric or oligomeric structure and a fourth chemical group according to the invention for covalently coupling of the scaffold to the tri-functional linker, the tri-functional linker further comprising a third chemical group for covalent binding to the cell-surface molecule targeting molecule and comprising a first chemical group for covalent binding to the at least one effector moiety, wherein the cell-surface molecule targeting molecule is bound to the third chemical group and/or the at least one effector moiety is bound to the first chemical group, preferably the trifunctional linker is the trifunctional linker of Scheme II and Structure B.
[0237] According to the invention, typically the saponin is a saponin listed in Table A1, Scheme I. It has been proven beneficial for the activity of the saponin, e.g. the endosomal escape enhancing activity inside cells when the entry into the cell and the accumulation inside the cytosol of an effector moiety covalently coupled to the cell-surface molecule targeting molecule of the conjugate of the invention, is considered, when the saponin is covalently coupled to the cell-surface molecule targeting molecule (directly or indirectly via first binding to the effector moiety, the effector moiety being directly coupled to the cell-surface molecule targeting molecule) involving a hydrazone bond, and/or a hydrazide bond, and/or a disulphide bond. Such bond types readily cleave under the acidic conditions inside (late) endosomes and lysosomes of mammalian cells, e.g. human cells, and/or under the reductive conditions. Alternatively, the inventors also demonstrate that covalent coupling of saponin to the cell-surface molecule targeting molecule via a bond that is not readily cleavable under the physiological conditions inside cells, e.g. (late) endosomes, lysosomes, cytosol, is also beneficial to the potentiating activity of the saponin on the biological effect of e.g. an effector moiety such as a nucleic acid (e.g. BNA silencing HSP27) and a proteinaceous toxin such as saporin. An example of such a bond is an amide bond, for coupling a saponin to a lysine side chain, either directly or via a (cleavable) linker and/or via an oligomeric or polymeric scaffold. Throughout the application, including the claims, the term ‘cleavable linker’, ‘cleavable bond’, etc., is also referred to as ‘labile linker’ (‘L’) and ‘labile bond’, for example in the context of cleavage of such a bond or linker in the (late) endosome and/or lysosome when a conjugate of the invention, e.g. a conjugate optionally comprising a scaffold with saponins coupled to the cell-surface molecule targeting molecule through a linker and/or via the scaffold via hydrazone bonds or disulphide bonds, is referred to. For example,
[0238] The skilled person will appreciate that a tri-functional linker is a scaffold of the invention suitable for covalently coupling one, two or three saponin moieties. For the tri-functional linker covalent coupling of one or two saponin moieties is preferred. The second and/or third binding site is for example suitable for covalent coupling a proteinaceous ligand such as the cell-surface molecule targeting molecule. Typical proteinaceous ligands are EGF for targeting (tumor) cells expressing EGFR at the cell surface, and cytokines for targeting tumor cells or autoimmune cells. Moreover, the second or third binding site of the tri-functional linker is suitable for covalent coupling of an immunoglobulin such as a monoclonal antibody, i.e. the cell-surface molecule targeting molecule for binding to a cell surface molecule such as a tumor cell surface molecule, preferably a tumor-cell specific molecule, more preferably a tumor cell receptor that is specifically (over-)expressed at the surface of the tumor cell. Similarly, the immunoglobulin, or any fragment(s) and/or domain(s) thereof which encompass the binding specificity of the immunoglobulin, is suitable for binding to a cell surface molecule such as a receptor, expressed at the surface of an autoimmune cell. Thus, in an embodiment, the conjugate of the invention comprises the tri-functional linker, said linker comprises or consists of a covalently bound saponin, e.g. QS-21, SO1861, and the covalently bound cell-surface molecule targeting molecule such as a cell targeting moiety such as a ligand or an antibody for (specific) binding to a tumor cell, an auto-immune cell, a diseased cell, an aberrant cell, a non-healthy cell, a B-cell disease.
[0239] An embodiment is the conjugate of the invention, comprising the oligomeric tri-functional linker as the scaffold core structure, according to Scheme II:
##STR00005##
wherein the saponin and the effector moiety are covalently bound to the tri-functional linker scaffold via labile, cleavable hydrazone linkers (acid sensitive) and/or via a maleimide comprising bond, whereas the binding of the scaffold to the cell-surface molecule targeting molecule such as an antibody is established via labile, cleavable hydrazone linkers (acid sensitive) and/or via a maleimide comprising bond with cysteines in the binding site, such as 1, 2, 3 or 4 cysteines, therewith forming Structure B:
##STR00006##
such that 1-4 scaffolds are covalently bound to a single cell-surface molecule targeting molecule, e.g. an antibody such as a monoclonal antibody.
[0240] An embodiment is the conjugate of the invention wherein the linkage between saponin and the cell-surface molecule targeting molecule preferably occurs via an acid-labile bond that is stable at pH 7.4 and, preferably releases the saponin below pH 6.5, more preferably between pH 6.5 and 5.0. This is, e.g., realized via an imine formed by an amino group of a linker linking the saponin and the cell-surface molecule targeting molecule and the aldehyde group of the saponin. Other chemical bonds that fulfill the pH-condition can also be used for aldehyde coupling, e.g. particular hydrazones or acetals, requiring hydrazides and hydroxyl groups as the functional group of the linker, respectively. If the bond is a cleavable bond, a saponin is preferably attached to the polymeric or oligomeric structure of a scaffold via an aldehyde function or via one of the carboxyl groups in saponin, more preferably through the aldehyde function, preferably an aldehyde function in position 23. Alternatively, a saponin is preferably attached to the cell-surface molecule targeting molecule via the polymeric or oligomeric structure of the scaffold via a linker that connects the polymeric or oligomeric structure of the scaffold either via the aldehyde function or via the carboxylic acid function of the saponin.
[0241] An embodiment is the conjugate of the invention, wherein the at least one saponin is bound to the cell-surface molecule targeting molecule via a stable bond. In a more preferred embodiment, the stable bond between the saponin and the cell-surface molecule targeting molecule preferably occurs via an amide coupling or amine formation. This is, e.g., realized via carbodiimide mediated amide bond formation by an amino group of a polymeric or oligomeric scaffold structure linking the saponin and the cell-surface molecule targeting molecule together, and the activated glucuronic acid group of the saponin. Chemical bonds that fulfill the stable bond definition can also be used for aldehyde coupling, e.g. particular amines derived after reductive amination, requiring primary amino groups as the functional group of a polymeric or oligomeric structure of a scaffold or a linker. If the bond is a stable bond, the saponin is preferably attached to a linker or a scaffold via one of the carboxyl groups of the saponin, the linker or scaffold further linked to the cell-surface molecule targeting molecule.
[0242] An embodiment is the conjugate of the invention wherein the saponin is coupled to the cell-surface molecule targeting molecule via a scaffold according to the invention, wherein the chemical group for covalently coupling of the scaffold to the binding site is a click chemistry group.
[0243] An embodiment is the conjugate of the invention wherein the saponin is coupled to the cell-surface molecule targeting molecule via a scaffold according to the invention, wherein the click chemistry group is a tetrazine, an azide, an alkene or an alkyne, or a cyclic derivative of any of these groups, preferably an azide. A click chemistry group is a functional chemical group suitable for click chemistry, which is defined as a reaction that is modular, wide in scope, gives very high yields, generates only inoffensive byproducts, offers high selectivity, and high tolerance over different functional groups, and is stereospecific. The required process characteristics include simple reaction conditions, readily available starting materials and reagents, the use of no solvent or a solvent that is benign (such as water) or easily removed, and simple product isolation. The click chemistry group for coupling the saponin to the cell-surface molecule targeting molecule in the conjugate of the invention optionally via a scaffold or a linker, is preferably a tetrazine, azide, alkene, or alkyne, or reactive derivates of them such as methyl-tetrazine or maleimide (alkene), more preferably an alkyne, or a cyclic derivative of these groups, such as cyclooctyne (e.g. aza-dibenzocyclooctyne, difluorocyclooctyne, bicyclo[6.1.0]non-4-yne, dibenzocyclooctyne).
[0244] A conjugate according to the invention thus comprises at least one saponin. With “at least one” in this context is meant that the conjugate comprises one saponin molecule but may also comprise a couple (e.g. two, three or four) of saponins or a multitude (e.g. 10, 20 or 100) of saponins. Depending on the application, the conjugate may comprise a covalently bound scaffold with covalently bound saponins, wherein the scaffold may be designed such that it comprises a defined number of saponins. Preferably, a conjugate according to the invention comprises a defined number or range of saponins, rather than a random number. This is especially advantageous for drug development in relation to marketing authorization. A defined number in this respect means that a conjugate preferably comprises a previously defined number of saponins. This is, e.g., achieved by designing a scaffold comprising a polymeric structure with a certain number of possible moieties for the saponin(s) to attach. Under ideal circumstances, all of these moieties are coupled to a saponin and the scaffold than comprises the prior defined number of saponins. It is envisaged to offer a standard set of scaffolds, comprising, e.g., two, four, eight, sixteen, thirty-two, sixty-four, etc., saponins so that the optimal number can be easily tested by the user according to his needs. An embodiment is the conjugate of the invention comprising the scaffold of the invention, wherein the saponin is present in a defined range as, e.g., under non-ideal circumstances, not all moieties present in a polymeric structure bind a saponin. Such ranges may for instance be 2-4 saponin molecules per scaffold, 3-6 saponin molecules per scaffold, 4-8 saponin molecules per scaffold, 6-8 saponin molecules per scaffold, 6-12 saponin molecules per scaffold and so on. In such case, a conjugate comprising a scaffold according to the invention thus comprises 2, 3 or 4 saponins if the range is defined as 2-4.
[0245] The scaffold is fundamentally independent of the type of saponin covalently bound to the scaffold, the scaffold subsequently (in sequential order) covalently coupled to the conjugate. Thus, the conjugate comprising the scaffold is the basis product for a new platform technology. Since the at least one covalently bound saponin mediates intracellular delivery of the effector moiety bound to the cell-surface molecule targeting molecule comprised by the conjugate of the invention, the scaffold technology according to the invention is the first system known that mediates controlled intracellular effector moiety delivery by saponins. The scaffold provides an optimized and functionally active unit that can be linked to the saponin(s) and to the cell-surface molecule targeting molecule comprised by the conjugate, e.g. a ligand, an antibody, etc., at a single and defined position.
[0246] An embodiment is the conjugate comprising a scaffold according to the invention, wherein the number of monomers of the polymeric or oligomeric structure is an exactly defined number or range. Preferably, the polymeric or oligomeric structure comprises structures such as poly(amines), e.g., polyethylenimine and poly(amidoamine), or structures such as polyethylene glycol, poly(esters), such as poly(lactides), poly(lactams), polylactide-co-glycolide copolymers, poly(dextrin), or a peptide or a protein, or structures such as natural and/or artificial polyamino acids, e.g. poly-lysine, DNA polymers, stabilized RNA polymers or PNA (peptide nucleic acid) polymers, either appearing as linear, branched or cyclic polymer, oligomer, dendrimer, dendron, dendronized polymer, dendronized oligomer or assemblies of these structures, either sheer or mixed. Preferably, the polymeric or oligomeric structures are biocompatible, wherein biocompatible means that the polymeric or oligomeric structure does not show substantial acute or chronic toxicity in organisms and can be either excreted as it is or fully degraded to excretable and/or physiological compounds by the body's metabolism. Assemblies can be built up by covalent cross-linking or non-covalent bonds and/or attraction. They can therefore also form nanogels, microgels, or hydrogels, or they can be attached to carriers such as inorganic nanoparticles, colloids, liposomes, micelles or particle-like structures comprising cholesterol and/or phospholipids. Said polymeric or oligomeric structures preferably bear an exactly defined number or range of coupling moieties for the coupling of glycoside molecules (and/or effector molecules and/or carrier molecules such as a ligand, monoclonal antibody or a fragment thereof). Preferably at least 50%, more preferably at least 75%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 98%, more preferably at least 99%, most preferably 100% of the exactly defined number or range of coupling moieties in the polymeric or oligomeric structure is occupied by a glycoside molecule in a scaffold according to the invention.
[0247] Preferably, a dendron is a branched, clearly defined tree-like polymer with a single chemically addressable group at the origin of the tree, called the focal point. A dendrimer is a connection of two or more dendrons at their focal point. A dendronized polymer is a connection of the focal point of one or more dendrons to a polymer. In a preferred embodiment, a scaffold according to the invention is provided, wherein the polymeric or oligomeric structure comprises a linear, branched or cyclic polymer, oligomer, dendrimer, dendron, dendronized polymer, dendronized oligomer or assemblies of these structures, either sheer or mixed, wherein assemblies can be built up by covalent cross-linking or non-covalent attraction and can form nanogels, microgels, or hydrogels, and wherein, preferably, the polymer is a derivative of a poly(amine), e.g., polyethylenimine and poly(amidoamine), and structures such as polyethylene glycol, poly(esters), such as poly(lactids), poly(lactams), polylactide-co-glycolide copolymers, and poly(dextrin), and structures such as natural and/or artificial polyamino acids such as poly-lysine, or a peptide or a protein or DNA polymers, stabilized RNA polymers or PNA (peptide nucleic acid) polymers. Preferably, the polymeric or oligomeric structures are biocompatible.
[0248] An embodiment is the conjugate of the invention for use according to the invention, wherein the conjugate comprises more than one covalently bound saponin, preferably 2, 3, 4, 5, 6, 8, 10, 16, 32, 64, 128 or 1-100 saponins, or any number of saponins therein between, such as 7, 9, 12 saponins, or any.
[0249] An embodiment is the conjugate of the invention, wherein the at least one saponin is covalently bound to the polymeric or oligomeric structure of the oligomeric or polymeric scaffold via at least one cleavable linker according to the invention.
[0250] An embodiment is the conjugate of the invention, wherein the chemical group of the oligomeric or polymeric scaffold, for covalently coupling of the oligomeric or polymeric scaffold to the amino-acid residue of the cell-surface molecule targeting molecule in the conjugate, is a click chemistry group, preferably selected from a tetrazine, an azide, an alkene or an alkyne, or a cyclic derivative of these groups, more preferably said chemical group is an azide.
[0251] An embodiment is the conjugate of the invention, wherein the polymeric or oligomeric structure of the oligomeric or polymeric scaffold comprises a linear, branched and/or cyclic polymer, oligomer, dendrimer, dendron, dendronized polymer, dendronized oligomer, a DNA, a polypeptide, poly-lysine, a poly-ethylene glycol, or an assembly of these polymeric or oligomeric structures which assembly is preferably built up by covalent cross-linking.
[0252] The inventors established that covalent coupling, preferably via cleavable bonds or linkers, of the saponin to the cell-surface molecule targeting molecule in the conjugate of the invention, according to any of the embodiments here above, provides efficient and cell-targeted potentiation of the activity of an effector moiety comprised by said conjugate. Coupling saponin to a cysteine side chain or a lysine side chain of the cell-surface molecule targeting molecule in the conjugate such as a monoclonal antibody, directly or via a linker, proved to be a beneficial way of specific and efficient delivery of effector-moiety potentiating activity inside the target cell, when also the effector moiety is delivered in the same target cell by using the very same cell-surface molecule targeting molecule to which also the saponin(s) is/are covalently bound.
[0253] To explain the invention in more detail, the process of cellular uptake of substances (although the inventors do not wish to be bound by any theory) and the used terminology in this invention is described. The uptake of extracellular substances into a cell by vesicle budding is called endocytosis. Said vesicle budding can be characterized by (1) receptor-dependent ligand uptake mediated by the cytosolic protein clathrin, (2) lipid-raft uptake mediated by the cholesterol-binding protein caveolin, (3) unspecific fluid uptake (pinocytosis), or (4) unspecific particle uptake (phagocytosis). All types of endocytosis run into the following cellular processes of vesicle transport and substance sorting called the endocytic pathways. The endocytic pathways are complex and not fully understood. Without wishing to be bound by any theory, organelles may be formed de novo and mature into the next organelle along the endocytic pathway. It is, however, now hypothesized that the endocytic pathways involve stable compartments that are connected by vesicular traffic. A compartment is a complex, multifunctional membrane organelle that is specialized for a particular set of essential functions for the cell. Vesicles are considered to be transient organelles, simpler in composition, and are defined as membrane-enclosed containers that form de novo by budding from a preexisting compartment. In contrast to compartments, vesicles can undergo maturation, which is a physiologically irreversible series of biochemical changes. Early endosomes and late endosomes represent stable compartments in the endocytic pathway while primary endocytic vesicles, phagosomes, multivesicular bodies (also called endosome carrier vesicles), secretory granules, and even lysosomes represent vesicles. The endocytic vesicle, which arises at the plasma membrane, most prominently from clathrin-coated pits, first fuses with the early endosome, which is a major sorting compartment of approximately pH 6.5. A large part of the cargo and membranes internalized are recycled back to the plasma membrane through recycling vesicles (recycling pathway). Components that should be degraded are transported to the acidic late endosome (pH lower than 6) via multivesicular bodies. Lysosomes are vesicles that can store mature lysosomal enzymes and deliver them to a late endosomal compartment when needed. The resulting organelle is called the hybrid organelle or endolysosome. Lysosomes bud off the hybrid organelle in a process referred to as lysosome reformation. Late endosomes, lysosomes, and hybrid organelles are extremely dynamic organelles, and distinction between them is often difficult. Degradation of an endocytosed molecule occurs inside an endolysosome or lysosome. Endosomal escape is the active or passive release of a substance from the inner lumen of any kind of compartment or vesicle from the endocytic pathway, preferably from clathrin-mediated endocytosis, or recycling pathway into the cytosol. Endosomal escape thus includes but is not limited to release from endosomes, endolysosomes or lysosomes, including their intermediate and hybrid organelles.
[0254] Unless specifically indicated otherwise and in particular when relating to the endosomal escape mechanism of the glycoside molecule such as the saponin of the invention, whenever the word “endosome” or “endosomal escape” is used herein, it also includes the endolysosome and lysosome, and escape from the endolysosome and lysosome, respectively. After entering the cytosol, said substance might move to other cell units such as the nucleus.
[0255] In formal terms, a glycoside is any molecule in which a sugar group is bound through its anomeric carbon to another group via a glycosidic bond. Glycoside molecules, such as saponins, in the context of the invention are such molecules that are further able to enhance the effect of an effector moiety, without wishing to be bound by any theory, in particular by facilitating the endosomal escape of the effector moiety. Without wishing to be bound by any theory, the glycoside molecules (saponins, such as those listed in Table A1) interact with the membranes of compartments and vesicles of the endocytic and recycling pathway and make them leaky for said effector moieties resulting in augmented endosomal escape. With the term “the scaffold is able to augment endosomal escape of the effector moiety” is meant that the at least one saponin (glycoside molecule), which is coupled via a linker or directly to the cell-surface molecule targeting molecule or via the polymeric or oligomeric structure of the scaffold, is able to enhance endosomal escape of an effector moiety when both molecules are within an endosome, e.g. a late endosome, optionally and preferably after the at least one glycoside such as a saponin is released from the conjugate such as from a linker or polymeric or oligomeric structure comprised by said conjugate, e.g., by cleavage of a cleavable bond between the at least one glycoside (saponin) and the conjugate (for example via a polymeric or oligomeric structure of a scaffold and/or via a linker). Even though a bond between the at least one glycoside such as a saponin according to the invention and the cell-surface molecule targeting molecule of the conjugate of the invention, optionally via a linker or a scaffold, may be a “stable bond”, that does not mean that such bond cannot be cleaved in the endosomes by, e.g., enzymes. For instance, the glycoside or saponin, optionally together with a linker or a part of the oligomeric or polymeric structure of a scaffold, may be cleaved off from the remaining linker fragment or oligomeric or polymeric structure. It could, for instance be that a protease cuts a (proteinaceous) linker or proteinaceous polymeric structure, e.g., albumin, thereby releasing the at least one glycoside, saponin. It is, however, preferred that the glycoside molecule (preferably saponin) is released in an active form, preferably in the original form that it had before it was (prepared to be) coupled to the cell-surface molecule targeting molecule of the conjugate optionally via a linker and/or an oligomeric or polymeric scaffold; thus the glycoside (saponin) has its natural structure after such cleavage or the glycoside (saponin) has (part of) a chemical group or linker bound thereto, after such cleavage, while glycoside biological activity (saponin biological activity), e.g. endosomal/lysosomal escape enhancing activity towards an effector moiety present in the same endosome or lysosome, is maintained or restored upon said cleavage of the bond between the glycoside (saponin) and the cell-surface molecule targeting molecule, e.g. an antibody, optionally comprising a linker and/or a scaffold of the invention. With regard to the present invention the term “stable” with respect to bonds between e.g. saponins and amino-acid residues of the cell-surface molecule targeting molecule in the conjugate, a linker, a polymeric or oligomeric structures (of the scaffold), ligands, (monoclonal) immunoglobulins or binding domains or -fragments thereof, and/or effectors (effector moieties, effector molecules), is meant that the bond is not readily broken or at least not designed to be readily broken by, e.g., pH differences, salt concentrations, or UV-light, reductive conditions. With regard to the present invention the term “cleavable” with respect to bonds between e.g. saponins and the cell-surface molecule targeting molecule, linkers, amino-acid residues, polymeric or oligomeric structures of the scaffold, ligands, antibodies and/or effectors, is meant that the bond is designed to be readily broken by, e.g., pH differences, salt concentrations, under reductive conditions, and the like. The skilled person is well aware of such cleavable bonds and how to prepare them.
[0256] Before the present invention one of the major hurdles of introducing ADCs and AOCs on the market was the small therapeutic window: a therapeutically effective dose of an ADC or an AOC is accompanied with (unacceptable) side effects, hampering development and implication in treatment of patients with the ADCs. By the application of the conjugate of the invention, such as ADC-saponin conjugate and AOC-saponin conjugate, it has now become possible to guide one or multiple glycoside molecules (saponin(s)) to a (target) cell, together with the ADC carrying a payload or together with a (monoclonal) antibody conjugated with an oligonucleotide such as a BNA according to the invention. In particular, it was previously not possible to specifically guide an effector moiety of an ADC or AOC or any other conjugate of a payload and a (proteinaceous) cell-surface molecule targeting molecule, and a (predefined, controllable) particular number or range of glycoside molecules (saponins) per effector moiety at the same time to the cytosol of cells, such as via the endocytic pathway of a cell.
[0257] A solution provided for by the invention comprises the covalent binding of at least one saponin to the cell-surface molecule targeting molecule of the conjugate of the invention. A further solution provided for by the invention comprises (first) polymerizing the glycoside molecules (saponins) using an oligomeric or polymeric scaffold, and providing the cell-surface molecule targeting molecule comprised by the conjugate of the invention with a cluster of covalently bound saponins, enabling re-monomerization of the one or more saponins at the intracellular site where the mode of action of the saponin is desired, e.g. after endocytosis. “Polymerizes” in this context means the reversible and/or irreversible multiple conjugation of saponin molecules to the first proteinaceous molecule, either via linker, or directly or via a polymeric or oligomeric structure to form a scaffold or the reversible and/or irreversible multiple conjugation of (modified) saponins thereby forming a polymeric or oligomeric structure to form a scaffold. “Re-monomerization” in this context means the cleavage of the saponins from the conjugate, from the linker linking the saponin(s) to the cell-surface molecule targeting molecule of the conjugate or from the scaffold, for example after endocytosis, and regaining the (native) chemical state of the unbound saponins, which unbound saponins may or may not comprise additional chemical groups such as a chemical group for linking the saponin to a linker, an amino-acid residue of the conjugate or to the scaffold, and/or a (chemical) linker bound to a chemical group of the saponin such as an aldehyde group or carboxylic acid group. Due to the complex chemistry of the saponins for example the ‘polymerization’ of saponins at a scaffold or other linking linker and their ‘re-monomerization’ at a desired location such as intracellularly e.g. after endocytosis, was a challenging task. In particular, the chemical reactions used for providing the linkers and the scaffold comprising covalently linked glycosides for covalent binding to the conjugate, e.g. triterpenoid saponins (polymerization of the glycosides), normally occur in water-free organic solvents, but saponins and for example biocompatible polymers applied as a scaffold for bearing bound saponins, are water-soluble molecules. The chemical properties of the unmodified saponin further prohibited polymerization by itself and, one other possible solution, to bind multiple saponins (directly) to the effector molecule was estimated not to be very promising, as an effector molecule (drug, toxin, polypeptide or polynucleotide) does typically not provide sufficient binding sites and because the coupling product would become quite heterogeneous and/or coupling biologically active molecules such as a saponin and e.g. a peptide, a toxin, a nucleic acid together bears the risk for influencing and hampering the activity of one or even both molecules bound together in such saponin-comprising conjugate. Further, there was a considerable risk that the effector moiety comprised by the conjugate of the invention loses its function when a saponin is coupled to the e.g. ADC or antibody-oligonucleotide conjugate (AOC). Embodiments of the present invention solves at least one of these drawbacks.
[0258] An effector molecule, or effector moiety, in the context of this invention is any substance that affects the metabolism of a cell by interaction with an intracellular effector molecule target, wherein this effector molecule target is any molecule or structure inside cells excluding the lumen of compartments and vesicles of the endocytic and recycling pathway but including the membranes of these compartments and vesicles. Said structures inside cells thus include the nucleus, mitochondria, chloroplasts, endoplasmic reticulum, Golgi apparatus, other transport vesicles, the inner part of the plasma membrane and the cytosol. Cytosolic delivery of an effector moiety in the context of the invention preferably means that the effector moiety is able to escape the endosome (and/or lysosome), which, as defined previously, also includes escaping the endolysosome and the lysosome, and is preferably able to reach the effector moiety target as described herein. The invention also encompasses a new type of molecule, referred to as scaffold that serves to bring both an effector moiety and at least one glycoside molecule such as a saponin of the invention in an endosome at the same time in a pre-defined ratio, when the effector moiety is comprised by the conjugate of the invention and the saponin is comprised by the conjugate. Within the context of the present invention, the polymeric or oligomeric structure of the scaffold is a structurally ordered formation such as a polymer, oligomer, dendrimer, dendronized polymer, or dendronized oligomer or it is an assembled polymeric structure such as a hydrogel, microgel, nanogel, stabilized polymeric micelle or liposome, but excludes structures that are composed of non-covalent assemblies of monomers such as cholesterol/phospholipid mixtures. The terms “polymer, oligomer, dendrimer, dendronized polymer, or dendronized oligomer” have their ordinary meaning. In particular a polymer is a substance which has a molecular structure built up chiefly or completely from a large number of equal or similar units bonded together and an oligomer is a polymer whose molecules consist of relatively few repeating units. There is no consensus about one specific cut-off for “many” and “a few” as used in the above definition of polymer and oligomer, respectively. However, as the scaffold may comprise a polymeric or an oligomeric structure, or both, the full range of numbers of similar units bonded together applies to such structure. i.e. from 2 monomeric units to 100 monomeric units, 1000 monomeric units, and more. A structure comprising 5 or less, for instance maybe called an oligomeric structure, whereas a structure comprising 50 monomeric units maybe called a polymeric structure. A structure of 10 monomeric units maybe called either oligomeric or polymeric. A scaffold as defined herein, further comprises at least one glycoside molecule such as a saponin of the invention. A scaffold preferably includes a polymeric or oligomeric structure such as poly- or oligo(amines), e.g., polyethylenimine and poly(amidoamine), and biocompatible structures such as polyethylene glycol, poly- or oligo(esters), such as poly(lactids), poly(lactams), polylactide-co-glycolide copolymers, and poly(dextrin), poly- or oligosaccharides, such as cyclodextrin or polydextrose, and poly- or oligoamino acids, such as poly-lysine or a peptide or a protein, or DNA oligo- or polymers. An assembled polymeric structure as defined herein comprises at least one scaffold and, optionally, other individual polymeric or oligomeric structures. Other individual polymeric or oligomeric structures of said assembly may be (a) scaffolds (thus comprising at least one glycoside molecule such as a saponin of the invention), (b) functionalized scaffolds (thus comprising at least one glycoside molecule such as a saponin, and at least one effector moiety, (c) polymeric or oligomeric structures without a glycoside molecule such as a saponin of the invention (See Table A1 for example), but with at least one effector moiety. A functionalized assembled polymeric structure is an assembled polymeric structure that contains (a) at least one functionalized scaffold or (b) at least one scaffold and at least one polymeric structure comprising at least one effector moiety, etc. bound to the cell-surface molecule targeting molecule of the conjugate of the invention. Polymeric or oligomeric structures within an assembled polymeric structure that do not comprise any of the above mentioned molecules (i.e. no glycosides such as saponins, no effector moieties) are in particular added as structural components of the assembled structures, which help to build up or to stabilize the assembled structure (“glue-like”). Without wishing to be bound by any theory, the acidic environment seems to be a prerequisite for the synergistic action between glycoside (saponin) and effector moiety.
[0259] Whether or not a conjugate of the invention comprising saponins, either or not further comprising one or more (cleavable) linkers and/or optionally a scaffold, is able to disturb the acidic environment and inhibit the endosomal escape function of the at least one glycoside (saponin) can be easily determined with an assay as described in Example 12 and as known in the art. The inhibition is described as “fold amount increases of glycoside necessary to induced 50% cell killing”. It is preferred that the scaffold does not lead to an increase that is at least the increase in glycoside molecules (saponins) necessary to obtain 50% cell killing observed when using Chloroquine as a positive control. Alternatively, and preferably, the conjugate comprising saponins, either or not further comprising one or more (cleavable) linkers and/or optionally a scaffold does not lead to an at least 4-fold increase of glycoside molecules to induce 50% cell killing, more preferably does not lead to an at least 2-fold increase. The fold increase is to be measured in assay, essentially as described in Example 12, wherein Chloroquine, as a positive control, induces a 2-fold increase in glycoside amount, preferably saponin amount wherein the saponin is any one or more of the saponins of the invention (see Table A1, Scheme I, previous embodiments) to observe 50% cell killing.
[0260] With the term “improving or enhancing an effect of an effector moiety” is meant that the glycoside molecule, preferably a saponin of the invention, increases the functional efficacy of that effector moiety (e.g. the therapeutic index of a toxin or a drug or an oligonucleotide such as a BNA; the metabolic efficacy of a modifier in biotechnological processes; the transfection efficacy of genes in cell culture research experiments), preferably by enabling or improving its target engagement. Acceleration, prolongation, or enhancement of antigen-specific immune responses are preferably not included. Therapeutic efficacy includes but is not limited to a stronger therapeutic effect, preferably with lower dosing and/or with less side effects. “Improving an effect of an effector moiety” can also mean that an effector moiety, which could not be used because of lack of effect (and was e.g. not known as being an effector moiety), becomes effective when used in combination with the present invention. Any other effect, which is beneficial or desired and can be attributed to the combination of effector moiety and the saponin, as provided by the invention is considered to be “an improved effect”. In an embodiment, the scaffold comprising bound saponin(s) and comprised by the conjugate of the invention enhances an effect of the effector moiety comprised by said conjugate which effect is intended and/or desired. In case of a conjugate comprising saponin bound to a proteinaceous scaffold, the proteinaceous polymeric structure of the scaffold as such may have, for instance, an effect on colloid osmotic pressure in the blood stream. If such effect is not the intended or desired effect of such a functionalized scaffold comprised by the conjugate, the proteinaceous structure of the scaffold is not an effector moiety as defined in the invention. Or, for instance in case of a DNA- or RNA-based scaffold carrying bound saponins and comprised by the conjugate, parts of that DNA or RNA may have an (unintended) function, e.g., by interfering with expression. If such interference is not the intended or desired effect of the ultimate functionalized scaffold, the DNA- or RNA polymeric structure of the scaffold is not the effector moiety as defined in the invention.
[0261] A number of preferred features can be formulated for endosomal escape enhancers comprised by the conjugate of the invention, i.e. a glycoside or saponin, preferably a saponin according to the invention: (1) they are preferably not toxic and do not invoke an immune response, (2) they preferably do not mediate the cytosolic uptake of the effector moiety into off-target cells, (3) their presence at the site of action is preferably synchronized with the presence of the effector moiety, (4) they are preferably biodegradable or excretable, and (5) they preferably do not substantially interfere with biological processes of the organism unrelated to the biological activity of the effector molecule with which the endosomal escape enhancer is combined with, e.g. interact with hormones. Examples of glycoside molecules such as saponins of the invention that fulfill the before mentioned criteria, at least to some extent, are bisdesmosidic triterpenes, preferably bisdesmosidic triterpene saponins, such as SO1861, SA1641, QS-21, GE1741, and the saponins in Table A1, Scheme I.
[0262] An embodiment is the conjugate of the invention such as the antibody-drug conjugate or antibody-oligonucleotide conjugate or ligand-drug conjugate of the invention, wherein the antibody can bind to any one of CD71, CA125, EpCAM(17-1A), CD52, CEA, CD44v6, FAP, EGF-IR, integrin, syndecan-1, vascular integrin alpha-V beta-3, HER2, EGFR, CD20, CD22, Folate receptor 1, CD146, CD56, CD19, CD138, CD27L receptor, PSMA, CanAg, integrin-alphaV, CA6, CD33, mesothelin, Cripto, CD3, CD30, CD239, CD70, CD123, CD352, DLL3, CD25, ephrinA4, MUC1, Trop2, CEACAM5, CEACAM6, HER3, CD74, PTK7, Notch3, FGF2, C4.4A, FLT3, CD38, FGFR3, CD7, PD-L1, CTLA4, CD52, PDGFRA, VEGFR1, VEGFR2, preferably CD71, HER2, EGFR, and/or is or comprises any one of cetuximab, daratumumab, gemtuzumab, trastuzumab, panitumumab, brentuximab, inotuzumab, moxetumomab, polatuzumab, obinutuzumab, OKT-9 anti-CD71 monoclonal antibody of the IgG type, pertuzumab, rituximab, ofatumumab, Herceptin, alemtuzumab, pinatuzumab, OKT-10 anti-CD38 monoclonal antibody, an antibody of Table A2 or Table A3 or Table A4, preferably cetuximab or trastuzumab or OKT-9, or at least one tumor-cell receptor binding-fragment thereof and/or at least one tumor-cell receptor binding-domain thereof, and/or wherein the antibody-drug conjugate comprises any one of Gemtuzumab ozogamicin, Brentuximab vedotin, Trastuzumab emtansine, Inotuzumab ozogamicin, Moxetumomab pasudotox and Polatuzumab vedotin and an antibody-drug conjugate of Table A2 and Table A3, or wherein the ligand-drug conjugate comprises at least one ligand for binding to a cell-surface molecule such as EGF or a cytokine.
[0263] As said before, the at least one saponin that is comprised by the conjugate according to the invention increases the efficacy of at least current and new effector moieties as defined in this invention. Potential side-effects will be decreased due to lowering of dosing of the effector moiety comprised by the conjugate, without lowering the efficacy. Therefore, the invention provides a conjugate according to the invention for use in medicine or for use as a medicament. Thus, an aspect of the invention relates to a conjugate according to the invention, the conjugate comprising at least a saponin and at least one effector moiety, for use as a medicament. Also provided is the use of a conjugate according to the invention for manufacturing a medicament. Especially cancer medicines, and in particular the classical chemotherapy medicaments, are notorious for their side effects. Because of targeting and synchronization in time and place of both the pharmaceutically active substance comprised by the conjugate and the saponin comprised by the very same conjugate molecule, a therapeutic conjugate according to the invention is especially valuable for use as a medicament, in particular for use in a method of treating cancer. The invention thus provides a therapeutic conjugate according to the invention for use in a method of treating cancer. The invention also provides a therapeutic conjugate according to the invention for use in a method of treating acquired or hereditary disorders, in particular monogenic deficiency disorders. The therapeutic conjugate thus comprises the at least one saponin and the at least one effector moiety. Thus, an aspect of the invention relates to a therapeutic conjugate according to the invention, wherein the conjugate comprises a covalently bound effector moiety and comprises a covalently bound saponin, for use in a method for the treatment of a cancer or an auto-immune disease.
[0264] A further application of the conjugate of the invention in medicine is the substitution of intracellular enzymes in target cells that produce these enzymes in insufficient amount or insufficient functionality. The resulting disease might be hereditary or acquired. In most cases, only symptomatic treatment is possible and for a number of rare diseases, insufficient treatment options lead to a shortened life span of concerned patients. An example for such a disease is phenylketonuria, which is an inborn error of metabolism that results in decreased metabolism of the amino acid phenylalanine. The disease is characterized by mutations in the gene for the hepatic enzyme phenylalanine hydroxylase. Phenylketonuria is not curable to date. The incidence is approximately 1:10,000 with the highest known incidence in Turkey with 1:2,600. A cell-surface molecule targeting molecule comprised by the conjugate of the invention, preferably an antibody, with bound phenylalanine hydroxylase or with a bound polynucleotide that encodes phenylalanine hydroxylase can be used to target liver cells by use of a suitable specific antibody, and to substitute the defect enzyme in hepatocytes. This is one example of use of the therapeutic conjugate of the invention comprising a saponin bound thereto and the enzyme or the oligonucleotide bound thereto according to the invention, for substitution or gene therapy. In a preferred embodiment, a therapeutic conjugate according to the invention for use in a method of gene therapy or substitution therapy is provided.
[0265] With the conjugate of the invention it has now become possible to design and manufacture a one-component, non-viral clinically applicable gene delivery technology. For example, the conjugate of the invention allows for development of non-viral based gene delivery technology, which enhances therapeutic efficacy with lower therapeutic dose thereby improving the health of patients. The conjugate of the invention, in particular when comprising a covalently bound cell-surface molecule targeting molecule such as a monoclonal antibody for binding to a (tumor, auto-immune) cell-surface specific molecule, and when bound to an effector moiety such as an oligonucleotide for example a BNA, allows for overcoming a longstanding and major bottleneck in the field of gene delivery, namely efficient, safe and cost-effective transfer of gene therapeutic products across the endosomal membrane into the cytosol/nucleosol. Indeed, gene therapy is one of the most promising treatment options for future advanced therapies in a broad range of diseases. Successful gene delivery requires the recognition of target cells as well as cytosolic and nucleosolic uptake of the gene. One of the major problems in the field of non-viral gene therapy is the inefficient and insufficiently safe delivery of genetic material for therapeutic use in patients.
[0266] Thus, when applying the conjugate of the invention, comprising a cell-targeting cell-surface molecule targeting molecule such as a ligand or preferably an antibody (fragment, domain thereof) and comprising an oligonucleotide such as an antisense BNA, the inventors now made it possible to overcome a longstanding and major bottleneck in the field of gene delivery: safe transfer of gene therapeutic products across the endosomal membrane into the cytosol/nucleosol. The conjugate of the invention represents technology designed for allowing targeting of any addressable cell type with all known genetic agents, thereby ensuring better patient therapy not limited to inherited disorders, but also for cancer therapy and therefore of importance for large patient groups. The technology based on the conjugate of the invention may comprise a polymeric or oligomeric scaffold that serves as a carrier for endosomal escape enhancers (EEEs), such as the saponins of Table A1 and Scheme I and any of the embodiments according to the invention, for the cell-surface molecule targeting molecule such as a targeting ligand or (monoclonal) (tumor-cell specific) antibody, and for the effector moiety, here an effector gene such as an LNA or BNA. Use of the conjugate of the invention, e.g. comprising a cell-targeting antibody (fragment) and an oligonucleotide such as a BNA, has potential to bring any kind of biological macromolecules into the cytosol and the nucleus. Development of new targeting ligands and monoclonal (human, humanized) antibodies is under continuous investigation by numerous research groups and companies worldwide. The same for the oligonucleotides that are aimed for delivery in the cytosol of diseases cells such as cancer cells. The conjugate of the invention thus also presents as a molecular interface in which present and future targeting ligands and antibodies and present and future therapeutic oligonucleotides (as well as payloads such as protein toxins) are linked or can be linked to for example an oligomeric or polymeric scaffold module of the invention by click chemistry, allowing for customized drug applications and for future developments in the field of tissue and cell targeting techniques. The conjugate of the invention can comprise antibodies and ligands as the cell-surface molecule targeting molecule. The worldwide market of gene therapeutics is rapidly growing and is covering potential treatments for a wide range of disease areas such as, cancer, cardiovascular diseases, Parkinson's, Alzheimer, HIV and many rare (monogenetic) diseases. The current viral vector-based gene therapeutic technologies have significant challenges, such as safety, manufacturing logistics, and associated high costs. The conjugate of the invention allows for use in a technology platform which represents an alternative for a current viral gene delivery technology. Therefore, the conjugate of the invention is suitable for implementing in approaches for developing non-viral gene treatments for diseases such as cancers, cardiovascular diseases, Parkinson's disease, Alzheimer's disease, HIV infection and many rare (monogenetic) diseases. The conjugate of the invention is suitable for developing novel treatments for transforming the field of antibody-drug conjugates (ADCs) and oligonucleotide-based therapeutics by making non-viral vector based gene therapeutics such as based on targeted antisense BNA. The application of the conjugate of the invention, in particular in a covalent conjugate with an antibody and an oligonucleotide such as a BNA and at least one saponin, is one of the many beneficial approaches made possible due to the present invention. For example, use of the conjugate of the invention now allows for exploitation of the endocytic pathway of mammalian cells. Endocytosis is exploited for the delivery of therapeutics, wherein the conjugate of the invention contributes to improved uptake and endosomal escape of e.g. siRNAs which are comprised by the conjugate. The conjugate of the invention is suitably used together with small molecules that act as delivery enhancers for e.g. payloads, oligonucleotides. Herewith, the conjugate of the invention bearing the covalently coupled oligonucleotide such as a BNA and bearing the covalently coupled cell targeting moiety such as a ligand and preferably an antibody (domain or fragment) and bearing the saponins of the invention, provides a solution for the current problem seen with current endosomal escape enhancers and gene therapeutic product, relating to their application as two components, thus complicating therapeutic approval and clinical applicability, since such a conjugate of the invention is a single-conjugate therapeutic molecule encompassing the saponin, gene product such as a BNA and the (tumor) cell targeting moiety such as a (monoclonal) antibody. Thus the invention provides a non-viral gene delivery technology where endosomal escape enhancers (e.g. the glycosides of Table A1, Scheme I, embodiments of the invention), gene therapeutic product (oligonucleotides according to the invention such as a BNA) and targeting ligand or antibody (according to e.g. Table A2, A3, A4, embodiments of the invention) are all comprised by the conjugate of the invention. Such a conjugate of the invention thus provides therapeutic opportunities for current and future macromolecule drugs for a broad range of diseases and large patient groups. With the application of such a conjugate of the invention comprising at least one saponin, at least one oligonucleotide and at least one specific cell-targeting moiety such as an immunoglobulin, the problem is addressed which is apparent for current methods of applying endosomal escape enhancers and gene therapeutic product separately, which current methods do not ensure that both compounds are at the same time at the site of interaction. This problem is now overcome by using the conjugate of the invention. That is to say, such a conjugate of the invention provides a non-viral gene delivery technology with increased synchronization (in time and place) of both compounds, i.e. the saponin and the gene product such as a BNA.
[0267] Gene therapies could help with hereditary, previously incurable diseases such as cystic fibrosis, chorea, Huntington's disease or hemophilia. However, currently some problems have not been overcome: for example, the therapeutic genes must precisely reach specific target cells in the body. On the other hand, the therapeutic genes should be absorbed by the targeted cells, but the therapeutic genes should not be destroyed. The current gene therapy approaches use viruses as a ferry for genes. However, these procedures involve considerable risks and cannot be transferred to the introduction of other biomolecules. An embodiment is the conjugate of the invention comprising (plant-derived) glycosides for use a platform technology that allows not only delivery of genes when comprised by the conjugate as the carrier molecule, but also allows for the delivery of different therapeutic biomolecules to be introduced into target cells. Therefore, the conjugate of the invention is used for developing treatments based on nucleic acids for cystic fibrosis, chorea, Huntington's disease or hemophilia. Herewith, with the conjugate of the invention, a new gene therapy strategy is available for improving the health of patients with genetic diseases, including those patients with cystic fibrosis, Huntington's disease, and hemophilia. As part of the invention, a non-viral gene delivery technology is developed that combines plant-derived endosomal escape enhancers (glycosides), gene therapeutic products, and a targeting ligand that are all comprised in a single conjugate. The resulting non-viral gene therapy based on the conjugate of the invention displays about 40 times increased delivery efficiency at a lower dosage over currently available strategies. Herewith, the conjugate of the invention is for use in clinical applications such as for the repair or replacement of defective genes, like in cystic fibrosis patients, and for the targeted delivery of specific genes, for instance, to destroy cancer cells. In fact, the conjugate of the invention is suitable for application in treatment regimens for any disease caused by a genetic defect—such as cystic fibrosis, Huntington's disease and hemophilia and which are currently incurable. Gene therapy which makes use of the conjugate of the invention helps in overcoming two current problems: Firstly, it is possible with the conjugate of the invention to deliver therapeutic genes to specific target cells in the body; Secondly, the therapeutic genes enter the interior of these cells, but are not destroyed, due to the presence of saponin(s), the oligonucleotide product and a targeting moiety such as an antibody for binding a target cell, all covalently linked together in the conjugate of the invention, for example by using an oligomeric or polymeric scaffold of the invention.
[0268] The present invention also provides a method of treating cancer, the method comprising administering a medicament comprising a therapeutic conjugate according to the invention to a patient in need thereof, preferably administering an effective dose of said medicament to a patient in need thereof, preferably a human cancer patient.
[0269] Considerations concerning forms suitable for administration are known in the art and include toxic effects, solubility, route of administration, and maintaining activity. For example, pharmacological compositions injected into the bloodstream should be soluble.
[0270] Suitable dosage forms, in part depend upon the use or the route of entry, for example transdermal or by injection. Such dosage forms should allow the compound to reach a target cell whether the target cell is present in a multicellular host. Other factors are known in the art, and include considerations such as toxicity and dosage form which retard the compound or composition from exerting its effect.
[0271] An aspect of the invention relates to a kit comprising a container containing an endosomal escape enhancing conjugate according to the invention the kit further comprising instructions for using the conjugate.
TABLE-US-00001 TABLE A1 Saponins displaying (late) endosomal/lysosomal escape enhancing activity, and saponins comprising a structure reminiscent to such saponins displaying (late) endosomal/lysosomal escape enhancing activity Carbohydrate Carbohydrate substituent substituent at the C- Saponin Aglycon at the C- 28-OH group Name core 3beta-OH group NP- 2alpha- GlcA- Glc/Gal- 005236 Hydro- xyoleanolic acid AMA-1 16alpha- Glc- Rha-(1.fwdarw.2)-[Xyl- Hydro- (1.fwdarw.4)]-Rha- xyoleanolic acid AMR 16alpha- Glc- Rha-(1.fwdarw.2)-[Ara- Hydro- (1.fwdarw.3)-Xyl- xyoleanolic (1.fwdarw.4)]-Rha- acid alpha- Heder- Rha-(1.fwdarw.2)-Ara- — Hederin agenin (23-Hydro- xyoleanolic acid) NP- 16alpha, Ara/Xyl- Ara/Xyl- 012672 23- (1.fwdarw.4)-Rha/Fuc- Dihydro- (1.fwdarw.2)-Glc/ xyoleanolic Gal-(1.fwdarw.2)- acid Rha/Fuc-(1.fwdarw.2)- GlcA- NP- Gypsogenin Gal-(1.fwdarw.2)- Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)- 017777 [Xyl-(1.fwdarw.3)]-GlcA- [R-(.fwdarw.4)]-Fuc- (R = 4E- Methoxycinnamic acid) NP- Gypsogenin Gal-(1.fwdarw.2)- Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)- 017778 [Xyl-(1.fwdarw.3)]-GlcA- [R-(.fwdarw.4)]-Fuc- (R = 4Z- Methoxycinnamic acid) NP- Gypsogenin Gal-(1.fwdarw.2)- Xyl-(1.fwdarw.4)- 017774 [Xyl-(1.fwdarw.3)]-GlcA- [Gal-(1.fwdarw.3)]- Rha-(1.fwdarw.2)-4-OAc- Fuc- NP- Gypsogenin Gal-(1.fwdarw.2)- Xyl-(1-4)-[Glc-(1.fwdarw.3)]- 018110.sup.c, [Xyl-(1.fwdarw.3)]-GlcA- Rha-(1.fwdarw.2)-3,4-di- NP- OAc-Fuc- 017772.sup.d NP- Gypsogenin Gal-(1.fwdarw.2)- Xyl-(1.fwdarw.4)- 018109 [Xyl-(1.fwdarw.3)]-GlcA- [Glc-(1.fwdarw.3)]- Rha-(1.fwdarw.2)-[R-(.fwdarw.4)]- 3-OAc-Fuc- (R = 4E-Methoxy- cinnamic acid) NP- Gypsogenin Gal-(1.fwdarw.2)- Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)- 017888 [Xyl-(1.fwdarw.3)]-GlcA- [Glc-(1.fwdarw.3)]-Rha- (1.fwdarw.2)-4-OAc-Fuc- NP- Gypsogenin Gal-(1.fwdarw.2)- Glc-(1.fwdarw.3)-Xyl- 017889 [Xyl-(1.fwdarw.3)]-GlcA- (1.fwdarw.4)-Rha- (1.fwdarw.2)-4-OAc-Fuc- NP- Gypsogenin Gal-(1.fwdarw.2)- Ara/Xyl-(1.fwdarw.3)-Ara/ 018108 [Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.4)-Rha/Fuc- (1.fwdarw.2)-[4-OAc-Rha/ Fuc-(1.fwdarw.4)]-Rha/Fuc- SA1641.sup.a, Gypsogenin Gal-(1.fwdarw.2)- Xyl-(1.fwdarw.3)-Xyl- AE X55.sup.b [Xyl-(1.fwdarw.3)]-GlcA- (1.fwdarw.4)-Rha- (1.fwdarw.2)-[Qui-(1.fwdarw.4)]- Fuc- NP- Quillaic Gal-(1.fwdarw.2)- Api-(1.fwdarw.3)-Xyl- 017674 acid [Xyl-(1.fwdarw.3)]-GlcA- (1.fwdarw.4)-[Glc- (1.fwdarw.3)]-Rha-(1.fwdarw.2)-Fuc- NP- Quillaic Gal-(1.fwdarw.2)- Xyl-(1.fwdarw.4)-[Gal-(1.fwdarw.3)]- 017810 acid [Xyl-(1.fwdarw.3)]-GlcA- Rha-(1.fwdarw.2)-Fuc- AG1 Quillaic Gal-(1.fwdarw.2)- Xyl-(1.fwdarw.4)-[Gal-(1.fwdarw.3)]- acid [Xyl-(1.fwdarw.3)]-GlcA- Rha-(1.fwdarw.2)-Fuc- NP- Quillaic Gal-(1.fwdarw.2)- Ara/Xyl-(1.fwdarw.4)-Rha/ 003881 acid [Xyl-(1.fwdarw.3)]-GlcA- Fuc-(1.fwdarw.4)-[Glc/Gal- (1.fwdarw.2)]-Fuc- NP- Quillaic Gal-(1.fwdarw.2)- Api-(1.fwdarw.3)-Xyl- 017676 acid [Xyl-(1.fwdarw.3)]-GlcA- (1.fwdarw.4)-[Glc- (1.fwdarw.3)]-Rha- (1.fwdarw.2)-[R-(.fwdarw.4)]- Fuc- (R = 5-O-[5-O-Ara/ Api-3,5-dihydroxy-6- methyl-octanoyl]-3,5- dihydroxy-6-methyl- octanoic acid) NP- Quillaic Gal-(1.fwdarw.2)- Api-(1.fwdarw.3)-Xyl- 017677 acid [Xyl-(1.fwdarw.3)]-GlcA- (1.fwdarw.4)-Rha- (1.fwdarw.2)-[R-(.fwdarw.4)]-Fuc- (R = 5-O-[5-O-Ara/ Api-3,5-dihydroxy-6- methyl-octanoyl]-3,5- dihydroxy-6-methyl- octanoic acid) NP- Quillaic Gal-(1.fwdarw.2)- Api-(1.fwdarw.3)-Xyl- 017706 acid [Xyl-(1.fwdarw.3)]-GlcA- (1.fwdarw.4)-Rha- (1.fwdarw.2)-[Rha- (1.fwdarw.3)]-4-OAc-Fuc- NP- Quillaic Gal-(1.fwdarw.2)- Api-(1.fwdarw.3)-Xyl- 017705 acid [Xyl-(1.fwdarw.3)]-GlcA- (1.fwdarw.4)-Rha- (1.fwdarw.2)-[Rha- (1.fwdarw.3)]-4-OAc-Fuc- NP- Quillaic Gal-(1.fwdarw.2)- 6-OAc-Glc-(1.fwdarw.3)-Xyl- 017773 acid [Xyl-(1.fwdarw.3)]-GlcA- (1.fwdarw.4)-Rha-(1.fwdarw.2)-[3- OAc-Rha-(1.fwdarw.3)]-Fuc- NP- Quillaic Gal-(1.fwdarw.2)- Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)- 017775 acid [Xyl-(1.fwdarw.3)]-GlcA- Rha-(1.fwdarw.2)-[3-OAc- Rha-(1.fwdarw.3)]-Fuc- SA1657 Quillaic Gal-(1.fwdarw.2)- Xyl-(1.fwdarw.3)-Xyl- acid [Xyl-(1.fwdarw.3)]-GlcA- (1.fwdarw.4)-Rha- (1.fwdarw.2)-[Qui-(1.fwdarw.4)]- Fuc- AG2 Quillaic Gal-(1.fwdarw.2)- Glc-(1.fwdarw.3)-[Xyl- acid [Xyl-(1.fwdarw.3)]-GlcA- (1.fwdarw.4)]-Rha- (1.fwdarw.2)-[Qui-(1.fwdarw.4)]-Fuc- SO1861 Quillaic Gal-(1.fwdarw.2)- Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)- acid [Xyl-(1.fwdarw.3)]-GlcA- Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)- 4-OAc-Qui-(1.fwdarw.4)]-Fuc- GE1741 Quillaic Gal-(1.fwdarw.2)- Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)- acid [Xyl-(1.fwdarw.3)]-GlcA- Rha-(1.fwdarw.2)-[3,4-di-OAc- Qui-(1.fwdarw.4)]-Fuc- SO1542 Quillaic Gal-(1.fwdarw.2)- Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.4)]- acid [Xyl-(1.fwdarw.3)]-GlcA- Rha-(1.fwdarw.2)-Fuc- SO1584 Quillaic Gal-(1.fwdarw.2)- 6-OAc-Glc-(1.fwdarw.3)-[Xyl- acid [Xyl-(1.fwdarw.3)]-GlcA- (1.fwdarw.4)]-Rha-(1.fwdarw.2)-Fuc- SO1658 Gypsogenin Gal-(1.fwdarw.2)- Glc-(1.fwdarw.3)- [Xyl-(1.fwdarw.3)]-GlcA- [Xyl-(1.fwdarw.3)-Xyl- (1.fwdarw.4)]-Rha-(1.fwdarw.2)-Fuc- SO1674 Quillaic Gal-(1.fwdarw.2)- Glc-(1.fwdarw.3)- acid [Xyl-(1.fwdarw.3)]-GlcA- [Xyl-(1.fwdarw.3)-Xyl- (1.fwdarw.4)]-Rha-(1.fwdarw.2)-Fuc- SO1832 Quillaic Gal-(1.fwdarw.2)- Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)- acid [Xyl-(1.fwdarw.3)]-GlcA- Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)- 4-OAc-Qui-(1.fwdarw.4)]-Fuc- QS-7 Quillaic Gal-(1.fwdarw.2)- Api/Xyl-(1.fwdarw.3)-Xyl- (also acid [Xyl-(1.fwdarw.3)]-GlcA- (1.fwdarw.4)-[Glc-(1.fwdarw.3)]- referred Rha-(1.fwdarw.2)-[Rha- to as (1.fwdarw.3)]-4OAc-Fuc- QS1861) QS-7 api Quillaic Gal-(1.fwdarw.2)- Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)- (also acid [Xyl-(1.fwdarw.3)]-GlcA- [Glc-(1.fwdarw.3)]-Rha- referred (1.fwdarw.2)-[Rha- to as (1.fwdarw.3)]-4OAc-Fuc- QS1862) QS-17 Quillaic Gal-(1.fwdarw.2)- Api/Xyl-(1.fwdarw.3)-Xyl- acid [Xyl-(1.fwdarw.3)]-GlcA- (1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha- (1.fwdarw.2)-[R-(.fwdarw.4)]-Fuc- (R = 5-O-[5-O-Rha- (1.fwdarw.2)-Ara/Api-3,5- dihydroxy-6-methyl- octanoyl]-3,5-dihydroxy- 6-methyl-octanoic acid) QS-18 Quillaic Gal-(1.fwdarw.2)- Api/Xyl-(1.fwdarw.3)-Xyl- acid [Xyl-(1.fwdarw.3)]-GlcA- (1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha- (1.fwdarw.2)-[R-(.fwdarw.4)]-Fuc- (R = 5-O-[5-O-Ara/ Api-3,5-dihydroxy-6- methyl-octanoyl]-3,5- dihydroxy-6-methyl- octanoic acid) QS-21 Quillaic Gal-(1.fwdarw.2)- Api-(1.fwdarw.3)-Xyl- A-apio acid [Xyl-(1.fwdarw.3)]-GlcA- (1.fwdarw.4)-Rha- (1.fwdarw.2)-[R-(.fwdarw.4)]-Fuc- (R = 5-O-[5-O-Ara/ Api-3,5-dihydroxy-6- methyl-octanoyl]-3,5- dihydroxy-6-methyl- octanoic acid) QS-21 Quillaic Gal-(1.fwdarw.2)- Xyl-(1.fwdarw.3)-Xyl- A-xylo acid [Xyl-(1.fwdarw.3)]-GlcA- (1.fwdarw.4)-Rha- (1.fwdarw.2)-[R-(.fwdarw.4)]-Fuc- (R = 5-O-[5-O-Ara/ Api-3,5-dihydroxy-6- methyl-octanoyl]3,5- dihydroxy-6-methyl- octanoic acid) QS-21 Quillaic Gal-(1.fwdarw.2)- Api-(1.fwdarw.3)-Xyl- B-apio acid [Xyl-(1.fwdarw.3)]-GlcA- (1.fwdarw.4)-Rha- (1.fwdarw.2)-[R-(.fwdarw.3)]-Fuc- (R = 5-O-[5-O-Ara/ Api-3,5-dihydroxy-6- methyl-octanoyl]3,5- dihydroxy-6-methyl- octanoic acid) QS-21 Quillaic Gal-(1.fwdarw.2)- Xyl-(1.fwdarw.3)-Xyl- B-xylo acid [Xyl-(1.fwdarw.3)]-GlcA- (1.fwdarw.4)-Rha- (1.fwdarw.2)-[R-(.fwdarw.3)]-Fuc- (R = 5-O-[5-O-Ara/ Api-3,5-dihydroxy-6- methyl-octanoyl]3,5- dihydroxy-6-methyl- octanoic acid) beta- Proto- Glc-(1.fwdarw.2)- — Aescin aescigenin- [Glc-(1.fwdarw. (described: 21(2- 4)]-GlcA- Aescin Ia) methylbut- 2-enoate)- 22-acetat Teaseed 23-Oxo- Glc-(1.fwdarw.2)- — saponin I barring- Ara-(1.fwdarw.3)-[Gal- togenol C - (1.fwdarw.2)]-GlcA- 21,22- bis(2- methylbut- 2-enoate) Teaseed- 23-Oxo- Xyl-(1.fwdarw.2)- — saponin J barring- Ara-(1.fwdarw.3)-[Gal- togenol C - (1.fwdarw.2)]-GlcA- 21,22- bis(2- methylbut- 2-enoate) Assam- 23-Oxo- Glc-(1.fwdarw.2)- — saponin F barring- Ara-(1.fwdarw.3)-[Gal- togenol C - (1.fwdarw.2)]-GlcA- 21(2- methylbut- 2- enoate)-16, 22-diacetat Digitonin Digitogenin Glc-(1.fwdarw.3)- — Gal-(1.fwdarw.2)-[Xyl- (1.fwdarw.3)]-Glc- (1.fwdarw.4)-Gal- Primula 3,16,28- Rha-(1.fwdarw.2)- — acid 1 Trihydro- Gal-(1.fwdarw.3)-[Glc- xyoleanan- (1.fwdarw.2)]-GlcA- 12-en AS64R Gypsogenic — Glc-(1.fwdarw.3)- acid Carbohydrate [Glc-(1.fwdarw.6)]-Gal- substituent at the C-23-OH group AS6.2 Gypsogenic Gal- Glc-(1.fwdarw.3)- acid [Glc-(1.fwdarw.6)]-Gal- .sup.a, bDifferent names refer to different isolates of the same structure .sup.c, dDifferent names refer to different isolates of the same structure
TABLE-US-00002 TABLE A2 ADCs which were previously investigated in the human clinical setting, and subsequently retracted from further clinical investigation Last Devel- opment Drug Name Indication Target Stage Monoclonal Oncology Cells Expressing Dis- Antibody Epidermal Growth covery Conjugate to Factor Target EGFR Receptor (Proto for Oncology Oncogene c ErbB 1 or Receptor Tyrosine Protein Kinase erbB 1 or HER1 or ERBB1 or EGFR or EC 2.7.10.1) Affilutin Multiple Dis- Myeloma covery (Kohler Disease) IMGN-779 Myelodys- Cells Expressing IND/ plastic Myeloid Cell Surface CTA Syndrome Antigen CD33 (Sialic Filed Acid Binding Ig Like Lectin 3 or gp67 or CD33) Neuradiab Non-Hodgkin Cells Expressing Phase I Lymphoma Tenascin (Cytotactin or GMEM or GP 150- 225 or Glioma Associated Extracellular Matrix Antigen or Hexabrachion or JI or Myotendinous Antigen or Neuronectin or Tenascin C or TNC) IMGN-779 Refractory Cells Expressing Phase I Acute Myeloid Cell Surface Myeloid Antigen CD33 (Sialic Leukemia; Acid Binding Ig Like Relapsed Acute Lectin 3 or gp67 Myeloid or CD33) Leukemia AGS-67E Acute Cells Expressing Phase I Myelocytic Leukocyte Antigen Leukemia CD37 (AML, (Tetraspanin 26 or Acute CD37) Myeloblas- tic Leukemia) AGS-67E Hairy Cell Cells Expressing Phase I Leukemia; Leukocyte Antigen Non-Hodgkin CD37 Lymphoma; (Tetraspanin 26 Refractory or CD37) Chronic Lymphocy-tic Leukemia (CLL); Relapsed Chronic Lymphocy-tic Leukemia (CLL); T-Cell Leukemia ASG-15ME Metastatic Cells Expressing Phase I Transitional SLIT And NTRK Like (Urothelial) Protein 6 (SLITRK6) Tract Cancer vandortuzumab Metastatic Cells Expressing Phase I vedotin Hormone Metalloreductase Refractory STEAP1 (Six (Castration Transmembrane Resistant, Epithelial Androgen- Antigen Of The Indepen- Prostate dent) 1 or STEAP1 or Prostate Cancer EC 1.16.1.) CDX-014 Ovarian Cancer Cells Expressing Phase I Hepatitis A Virus Cellular Receptor 1 (Kidney Injury Molecule 1 or T Cell Immunoglobulin And Mucin Domain Containing Protein 1 or T-Cell Immunoglobulin Mucin Receptor 1 or T Cell Membrane Protein 1 or CD365 or HAVCR1) AGS-16M18 Liver Cancer; Phase I Renal Cell Carcinoma vorsetuzumab Non-Hodgkin Cells Expressing Phase I mafodotin Lymphoma; CD70 Antigen (CD27 Renal Cell Ligand or Tumor Carcinoma Necrosis Factor Ligand Superfamily Member 7 or CD70) denintuzumab Acute Lymph- Cells Expressing B Phase I mafodotin ocytic Lymphocyte Antigen Leukemia CD19 (B Lymphocyte (ALL, Surface Antigen B4 Acute Lympho- or Differentiation blastic Antigen CD19 or Leukemia); B- T Cell Cell Non- Surface Antigen Leu Hodgkin 12 or CD19) Lymphoma; Burkitt Lymphoma; Lympho-blastic Lymphoma; Mantle Cell Lymphoma SGN-CD70A Diffuse Large Cells Expressing Phase I B-Cell CD70 Antigen (CD27 Lymphoma; Ligand or Tumor Follicular Necrosis Factor Ligand Lymphoma; Superfamily Member Mantle Cell 7 or CD70) Lymphoma; Metastatic Renal Cell Carcinoma; Non- Hodgkin Lymphoma RG-7636 Metastatic Endothelin B Phase I Melanoma Receptor (Endothelin Receptor Non Selective Type or EDNRB) SC-006 Metastatic Phase I Colorectal Cancer MM-310 Breast Cancer; Ephrin Type Phase I Endome-trial A Receptor Cancer; 2 (Epithelial Cell Esophageal Kinase or Tyrosine Cancer; Protein Kinase Gastric Cancer; Receptor ECK or Gastroeso- EPHA2 or EC 2.7.10.1) phageal (GE) Junction Carcino-mas; Head And Neck Cancer Squamous Cell Carcinoma; Non-Small Cell Lung Cancer; Ovarian Cancer; Pancreatic Ductal Adenocar- cinoma; Prostate Cancer; Small-Cell Lung Cancer; Soft Tissue Sarcoma; Solid Tumor; Transitional Cell Carcinoma (Urothelial Cell Carcinoma) PF-06647263 Metastatic Cells Expressing Phase I Breast Ephrin A4 Cancer; (EPH Related Ovarian Receptor Tyrosine Cancer Kinase Ligand 4 or EFNA4) PF-06263507 Solid Tumor Cells Expressing Phase I Trophoblast Glycoprotein (M6P1 or 5T4 Oncofetal Antigen or 5T4 Oncofetal Trophoblast Glycoprotein or Wnt Activated Inhibitory Factor 1 or TPBG) PF-06650808 Metastatic Cells Expressing Phase I Breast Neurogenic Cancer; Locus Notch Non-Small Homolog Protein 3 Cell Lung (NOTCH3) Cancer; Ovarian Cancer XMT-1522 Breast Cancer; Receptor Tyrosine Phase I Gastric Cancer; Protein Kinase ERBB 2 Non-Small Cell (Metastatic Lymph Lung Cancer Node Gene 19 Protein or Proto Oncogene Neu or Proto Oncogene C ErbB 2 or Tyrosine Kinase Type Cell Surface Receptor HER2 or p185erbB2 or HER2 or CD340 or ERBB2 or EC 2.7.10.1); Tubulin AMG-595 Anaplastic Cells Expressing Phase I Astrocyto-ma; Epidermal Growth Recurrent Factor Glioblasto-ma Receptor (Proto Multiforme Oncogene c ErbB 1 or (GBM) Receptor Tyrosine Protein Kinase erbB 1 or HER1 or ERBB1 or EGFR or EC 2.7.10.1) pinatuzumab Chronic Cells Expressing B Phase I vedotin Lymphocytic Cell Receptor CD22 (B Leukemia Lymphocyte Cell (CLL) Adhesion Molecule or Sialic Acid Binding Ig Like Lectin 2 or T Cell Surface Antigen Leu 14 or CD22) cantuzumab Colorectal Phase I ravtansine Cancer; Non-Small Cell Lung Cancer; Pancreatic Cancer; Solid Tumor AVE-9633 Acute Cells Expressing Phase I Myelocytic Myeloid Cell Surface Leukemia Antigen CD33 (Sialic (AML, Acid Binding Ig Like Acute Lectin 3 or gp67 Myeloblas- or CD33) tic Leukemia) BIWI-1.sup.(1) Breast Cancer; Cells Expressing CD44 Phase I Carcino-mas; Antigen (CDw44 or Esophageal Epican or Extracellular Cancer; Matrix Receptor III Head And Neck or GP90 Lymphocyte Cancer Homing/Adhesion Squamous Receptor or HUTCH Cell Carcinoma I or Heparan Sulfate Proteoglycan or Hermes Antigen or Hyaluronate Receptor or Phagocytic Glycoprotein 1 or CD44) RG-7882 Epithelial Cells Expressing Phase I Ovarian Mucin 16 (Ovarian Cancer; Cancer Related Tumor Fallopian Marker CA125 or Tube Cancer; Ovarian Carcinoma Pancreatic Antigen CA125 or Cancer; MUC16) Peritoneal Cancer ASG-5ME Adenocar- Cells Expressing Phase I cinoma; Choline Hormone Transporter Like Refractory Protein 4 (Solute (Castration Carrier Family Resistant, 44 Member Androgen- 4 or SLC44A4) Indepen- dent) Prostate Cancer; Metastatic Adenocar- cinoma of The Pancreas DCDS-0780A B-Cell Non- Phase I Hodgkin Lymphoma SC-004 Endome-trial Phase I Cancer; Epithelial Ovarian Cancer; Fallopian Tube Cancer; Peritoneal Cancer RG-7600 Ovarian Cancer; Phase I Pancreatic Ductal Adenocar- cinoma sofituzumab Epithelial Cells Expressing Phase I vedotin Ovarian Mucin 16 (Ovarian Cancer; Cancer Related Tumor Fallopian Marker CA125 or Tube Cancer; Ovarian Carcinoma Ovarian Antigen CA125 or Cancer; MUC16) Pancreatic Cancer; Peritoneal Cancer IMGN-289 Breast Cancer; Cells Expressing Phase I Esophageal Epidermal Cancer; Growth Factor Gastric Cancer; Receptor (Proto Head And Neck Oncogene c ErbB 1 or Cancer Receptor Tyrosine Squamous Protein Kinase Cell erbB 1 or Carcinoma; HER1 or ERBB1 or Non-Small EGFR or EC 2.7.10.1) Cell Lung Cancer; Solid Tumor SAR-428926 Breast Cancer; Cells Expressing Phase I Colorectal Lysosome Associated Cancer; Membrane Gastric Cancer; Glycoprotein Non-Small 1 (CD107 Antigen Cell Lung Like Family Member Cancer; A or CD107a or Ovarian LAMP1) Cancer; Prostate Cancer; Solid Tumor SGNCD-19B B-Cell Non- Cells Expressing B Phase I Hodgkin Lymphocyte Antigen Lymphoma; CD19 (B Lymphocyte Diffuse Large Surface Antigen B4 B-Cell or Differentiation Lymphoma; Antigen CD19 or T Cell Follicular Surface Antigen Lymphoma Leu 12 or CD19) SGNCD-123A Refractory Cells Expressing Phase I Acute Interleukin 3 Receptor Myeloid Subunit Alpha (CD123 Leukemia; or IL3RA) Relapsed Acute Myeloid Leukemia SGNCD-352A Refractory Cells Expressing Phase I Multiple SLAM Family Myeloma; Member 6 Relapsed (Activating NK Multiple Receptor or Myeloma NK T B Antigen or CD352 or SLAMF6) RG-7841 Breast Cancer; Cells Expressing Phase I Non- Lymphocyte Small Cell Antigen 6E Lung (Retinoic Acid Induced Cancer; Solid Gene E Protein or Tumor Stem Cell Antigen 2 or Thymic Shared Antigen 1 or LY6E) IMGN-388 Solid Tumor Cells Expressing Phase I Integrin Alpha V (Vitronectin Receptor Subunit Alpha or CD51 or ITGAV) lorvotuzumab Refractory Cells Expressing Phase I mertansine Multiple Neural Cell Adhesion Myeloma; Molecule 1 (Antigen Relapsed Recognized By Multiple Monoclonal Antibody Myeloma 5.1H11 or CD56 or NCAM1) lorvotuzumab Neuroendo- Cells Expressing Neural Phase I mertansine crine Cell Adhesion Carcinoma; Molecule 1 (Antigen Neuroendo- Recognized By crine Monoclonal Antibody Tumors; 5.1H11 or CD56 or Non-Small NCAM1) Cell Lung Cancer; Ovarian Cancer; Skin Cancer BAY-794620 Lung Cancer; Cells Expressing Phase I Solid Tumor Carbonic Anhydrase 9 (Carbonate Dehydratase IX or pMW1 or Membrane Antigen MN or P54/58N or Renal Cell Carcinoma Associated Antigen G250 or CA9 or EC 4.2.1.1) RG-7598 Refractory Phase I Multiple Myeloma; Relapsed Multiple Myeloma Oncolysin B B-Cell Cells Expressing B Phase I Leukemia; Lymphocyte Antigen Lymphoma CD19 (B Lymphocyte Surface Antigen B4 or Differentiation Antigen CD19 or T Cell Surface Antigen Leu 12 or CD19) ADCT-502.sup.(1) Bladder Cells Expressing Phase I Cancer; Receptor Tyrosine Breast Cancer; Protein Kinase ERBB Esophageal 2 (Metastatic Lymph Cancer; Node Gene 19 Protein Gastric Cancer; or Proto Oncogene Non-Small Neu or Proto Oncogene Cell C ErbB 2 or Lung Cancer Tyrosine Kinase Type Cell Surface Receptor HER2 or p185erbB2 or HER2 or CD340 or ERBB2 or EC 2.7.10.1) AMG-172 Renal Cell Cells Expressing CD70 Phase I Carcinoma Antigen (CD27 Ligand or Tumor Necrosis Factor Ligand Superfamily Member 7 or CD70) ImmuRAIT- B-Cell Non- Cells Expressing Phase I/II LL2 Hodgkin B Cell Receptor Lymphoma CD22 (B Lymphocyte Cell Adhesion Molecule or Sialic Acid Binding Ig Like Lectin 2 or T Cell Surface Antigen Leu 14 or CD22) indusatumab Adenocar- Cells Expressing Heat Phase I/II vedotin cinoma Of Stable Enterotoxin The Gastroe- Receptor (Guanylyl sophageal Cyclase C or or Junction; Intestinal Guanylate Gastric Cancer Cyclase or GUCY2C or EC 4.6.1.2) clivatuzumab Pancreatic Cells Expressing Phase I/II tetraxetan Cancer Mucin 1 (Breast Carcinoma Associated Antigen DF3 or Episialin or H23AG or Krebs Von Den Lungen 6 or PEMT or Peanut Reactive Urinary Mucin or Polymorphic Epithelial Mucin or Tumor Associated Epithelial Membrane Antigen or Tumor Associated Mucin or CD227 or MUC1) depatuxizumab Recurrent Epidermal Growth Phase I/II mafodotin.sup.(2) Malignant Factor Receptor (Proto Glioma Oncogene c ErbB 1 or Receptor Tyrosine Protein Kinase erbB 1 or HER1 or ERBB1 or EGFR or EC 2.7.10.1) CDX-014 Metastatic Cells Expressing Phase I/II Renal Cell Hepatitis Carcinoma; A Virus Cellular Papillary Receptor 1 (Kidney Renal Injury Molecule 1 or T Cell Carcinoma Cell Immunoglobulin And Mucin Domain Containing Protein 1 or T-Cell Immunoglobulin Mucin Receptor 1 or T Cell Membrane Protein 1 or CD365 or HAVCR1) vadastuximab Refractory Cells Expressing Phase I/II talirine(1) Acute Myeloid Cell Surface Myeloid Antigen CD33 Leukemia; (Sialic Acid Binding Relapsed Acute Ig Like Lectin 3 or Myeloid gp67 or CD33) Leukemia vadastuximab Myelodys- Cells Expressing Phase I/II talirine plastic Myeloid Cell Surface Syndrome Antigen CD33 (Sialic Acid Binding Ig Like Lectin 3 or gp67 or CD33) MLN-2704 Metastatic Cells Expressing Phase I/II Hormone Glutamate Refractory Carboxypeptidase 2 (Castration (Folate Hydrolase 1 or Resistant, Prostate Specific Androgen- Membrane Antigen or Indepen-dent) PSMA or Pteroylpoly Prostate Gamma Glutamate Cancer Carboxypeptidase or Cell Growth Inhibiting Gene 27 Protein or FOLH1 or EC 3.4.17.21) Oncolysin B AIDS-Related Cells Expressing B Phase I/II Lymphoma Lymphocyte Antigen CD19 (B Lymphocyte Surface Antigen B4 or Differentiation Antigen CD19 or T Cell Surface Antigen Leu 12 or CD19) coltuximab Diffuse Cells Expressing B Phase II ravtansine Large B- Lymphocyte Antigen Cell CD19 (B Lymphocyte Lymphoma Surface Antigen B4 or Differentiation Antigen CD19 or T Cell Surface Antigen Leu 12 or CD19) coltuximab Acute (ALL, Cells Expressing Phase II ravtansine Lymphocy- B Lymphocyte Antigen tic Leukemia CD19 (B Lymphocyte Acute Lympho- Surface Antigen B4 blastic or Differentiation Leukemia) Antigen CD19 or T Cell Surface Antigen Leu 12 or CD19) coltuximab Diffuse Large Cells Expressing Phase II ravtansine B-Cell B Lymphocyte Antigen Lymphoma CD19 (B Lymphocyte Surface Antigen B4 or Differentiation Antigen CD19 or T Cell Surface Antigen Leu 12 or CD19) indusatumab Adenocar- Cells Expressing Heat Phase II vedotin.sup.(2) cinoma Stable Enterotoxin Of The Gastroe- Receptor (Guanylyl sophageal Cyclase C or or Junction; Intestinal Guanylate Gastric Cancer; Cyclase or GUCY2C Metastatic or EC 4.6.1.2) Adenocar- cinoma of The Pancreas depatuxizumab Squamous Epidermal Growth Phase II mafodotin Non- Factor Receptor (Proto Small Cell Oncogene c ErbB Lung 1 or Receptor Tyrosine Cancer Protein Kinase erbB 1 or HER1 or ERBB1 or EGFR or EC 2.7.10.1) depatuxizumab Anaplastic Epidermal Growth Phase II mafodotin.sup.(2) Astrocyto- Factor Receptor (Proto ma; Anaplastic Oncogene c ErbB 1 Oligoastro- or Receptor Tyrosine cytoma; Protein Kinase erbB Gliosar-coma; 1 or HER1 or ERBB1 High-Grade or EGFR or Glioma; EC 2.7.10.1) Oligoden- droglioma; Pediatric Diffuse Intrinsic Pontine Glioma; Recurrent Glioblasto- ma Multiforme (GBM) lifastuzumab Non-Small Sodium Dependent Phase II vedotin Cell Lung Phosphate Transport Cancer Protein 2B (Sodium Phosphate Transport Protein 2B or NaPi3b or Sodium/Phosphate Cotransporter 2B or NaPi 2b or Solute Carrier Family 34 Member 2 or SLC34A2) lifastuzumab Ovarian Cancer Sodium Dependent Phase II vedotin Phosphate Transport Protein 2B (Sodium Phosphate Transport Protein 2B or NaPi3b or Sodium/Phosphate Cotransporter 2B or NaPi 2b or Solute Carrier Family 34 Member 2 or SLC34A2) Bismab-A Acute Cells Expressing Phase II Myelocytic Myeloid Cell Surface Leukemia Antigen CD33 (AML, (Sialic Acid Acute Binding Ig Like Myeloblas- Lectin 3 or tic Leukemia) gp67 or CD33) denintuzumab Diffuse Large Cells Expressing B Phase II mafodotin B-Cell Lymphocyte Antigen Lymphoma; CD19 (B Lymphocyte Follicular Surface Antigen B4 Lymphoma or Differentiation Antigen CD19 or T Cell Surface Antigen Leu 12 or CD19) Avicidin.sup.(1) Colorectal Cells Expressing Phase II Cancer; Epithelial Cell Prostate Cancer Adhesion Molecule (Adenocarcinoma Associated Antigen or Cell Surface Glycoprotein Trop 1 or Epithelial Cell Surface Antigen or Epithelial Glycoprotein 314 or KS 1/4 Antigen or KSA or Tumor Associated Calcium Signal Transducer 1 or CD326 or EPCAM) pinatuzumab Diffuse Large Cells Expressing B Phase II vedotin B-Cell Cell Receptor Lymphoma; CD22 (B Follicular Lymphocyte Cell Lymphoma Adhesion Molecule or Sialic Acid Binding Ig Like Lectin 2 or T Cell Surface Antigen Leu 14 or CD22) SGN-15 Metastatic Cells Expressing Lewis Phase II Breast Y Antigen (CD174) Cancer; Non-Small Cell Lung Cancer; Ovarian Cancer; Prostate Cancer cantuzumab Gastric Cancer; Phase II ravtansine Gastroe- sophageal (GE) Junction Carcino-mas ASP-6183 Ovarian Cancer Phase II SAR-566658 Metastatic Cells Expressing Phase II Breast Cancer Sialoglycotope CA6 Antigen Oncolysin S Small-Cell Cells Expressing Phase II Lung Cancer Neural Cell Adhesion Molecule 1 (Antigen Recognized By Monoclonal Antibody 5.1H11 or CD56 or NCAM1) lorvotuzumab Small-Cell Cells Expressing Neural Phase II mertansine Lung Cancer Cell Adhesion Molecule 1 (Antigen Recognized By Monoclonal Antibody 5.1H11 or CD56 or NCAM1) glembatumumab Metastatic Cells Expressing Phase II vedotin Melanoma; Transmembrane Metastatic Glycoprotein NMB Uveal (Transmembrane Melanoma; Glycoprotein HGFIN Osteosar-coma; or GPNMB) Squamous Non- Small Cell Lung Cancer MM-302 Metastatic Cells Expressing Phase Breast Receptor Tyrosine II/III Cancer Protein Kinase ERBB 2 (Metastatic Lymph Node Gene 19 Protein or Proto Oncogene Neu or Proto Oncogene C ErbB 2 or Tyrosine Kinase Type Cell Surface Receptor HER2 or p185erbB2 or HER2 or CD340 or ERBB2 or EC 2.7.10.1) Neuradiab Brain Cancer; Cells Expressing Phase III Glioblasto-ma Tenascin (Cytotactin or Multiforme GMEM or GP (GBM) 150-225 or Glioma Associated Extracellular Matrix Antigen or Hexabrachion or JI or Myotendinous Antigen or Neuronectin or Tenascin C or TNC) clivatuzumab Metastatic Cells Expressing Phase III tetraxetan Adenocar- Mucin 1 (Breast cinoma of The Carcinoma Associated Pancreas Antigen DF3 or Episialin or H23AG or Krebs Von Den Lungen 6 or PEMT or Peanut Reactive Urinary Mucin or Polymorphic Epithelial Mucin or Tumor Associated Epithelial Membrane Antigen or Tumor Associated Mucin or CD227 or MUC1) depatuxizumab Glioblasto-ma Epidermal Growth Phase III mafodotin.sup.(2) Multiforme Factor Receptor (Proto (GBM) Oncogene c ErbB 1 or Receptor Tyrosine Protein Kinase erbB 1 or HER1 or ERBB1 or EGFR or EC 2.7.10.1) vadastuximab Acute Cells Expressing Phase III talirine.sup.(1) Myelocytic Myeloid Cell Surface Leukemia Antigen CD33 (Sialic (AML, Acid Binding Ig Like Acute Lectin 3 or gp67 Myeloblas- or CD33) tic Leukemia) glembatumumab Metastatic Cells Expressing Phase III vedotin.sup.(2) Breast Cancer Transmembrane Glycoprotein NMB (Transmembrane Glycoprotein HGFIN or GPNMB) Oncolysin B B-Cell Cells Expressing B Phase III Leukemia; Lymphocyte Antigen Lymphoma CD19 (B Lymphocyte Surface Antigen B4 or Differentiation Antigen CD19 or T Cell Surface Antigen Leu 12 or CD19) ImmuRAIT- B-Cell Cells Expressing B Pre- LL2 Leukemia Cell Receptor CD22 (B clinical Lymphocyte Cell Adhesion Molecule or Sialic Acid Binding Ig Like Lectin 2 or T Cell Surface Antigen Leu 14 or CD22) indusatumab Metastatic Cells Expressing Heat Pre- vedotin Colorectal Stable Enterotoxin clinical Cancer Receptor (Guanylyl Cyclase C or or Intestinal Guanylate Cyclase or GUCY2C or EC 4.6.1.2) ASG-15ME Lung Cancer Cells Expressing SLIT Pre- And NTRK Like clinical Protein 6 (SLITRK6) HTI-1511 Bile Duct Cells Expressing Pre- Cancer Epidermal Growth clinical (Cholangio- Factor Receptor (Proto carcinoma) ; Oncogene c ErbB 1 or Breast Cancer; Receptor Tyrosine Colorectal Protein Kinase erbB 1 Cancer; or HER1 or ERBB1 or Non-Small Cell EGFR or EC 2.7.10.1) Lung Cancer ZW-33 Gastric Cancer; Cells Expressing Pre- Metastatic Receptor Tyrosine clinical Breast Protein Kinase ERBB Cancer 2 (Metastatic Lymph Node Gene 19 Protein or Proto Oncogene Neu or Proto Oncogene C ErbB 2 or Tyrosine Kinase Type Cell Surface Receptor HER2 or p185erbB2 or HER2 or CD340 or ERBB2 or EC 2.7.10.1) ZW-33 Ovarian Cancer Cells Expressing Pre- Receptor Tyrosine clinical Protein Kinase ERBB 2 (Metastatic Lymph Node Gene 19 Protein or Proto Oncogene Neu or Proto Oncogene C ErbB 2 or Tyrosine Kinase Type Cell Surface Receptor HER2 or p185erbB2 or HER2 or CD340 or ERBB2 or EC 2.7.10.1) SGNCD-352A Non-Hodgkin Cells Expressing SLAM Pre- Lymphoma Family Member 6 clinical (Activating NK Receptor or NK T B Antigen or CD352 or SLAMF6) HuMax-CD74- Oncology Cells Expressing Pre- ADC HLA Class II clinical Histocompatibility Antigen Gamma Chain (HLA DR Antigens Associated Invariant Chain or la Antigen Associated Invariant Chain or p33 or CD74) sacituzumab Pancreatic Cells Expressing govitecan Ductal Tumor Associated Adenocar- Calcium Signal cinoma Transducer 2 (Cell Surface Glycoprotein Trop 2 or Membrane Component Chromosome 1 Surface Marker 1 or Pancreatic Carcinoma Marker Protein GA733-1 or TACSTD2) sacituzumab Adenocar- Cervical Cancer; Cells govitecan cinoma; Expressing Tumor Colorectal Associated Cancer; Calcium Signal Endome-trial Transducer Cancer; 2 (Cell Surface Epithelial Glycoprotein Trop Ovarian 2 or Membrane Cancer; Component Esophageal Chromosome Cancer; 1 Surface Follicular Marker 1 or Pancreatic Thyroid Carcinoma Marker Cancer; Gastric Protein GA733-1 Cancer; or TACSTD2) Glioblasto-ma Multiforme (GBM); Head And Neck Cancer Squamous Cell Carcinoma; Hepato-cellular Carcinoma; Kidney Cancer (Renal Cell Cancer); Metastatic Hormone Refractory (Castration Resistant, Androgen- Indepen-dent) Prostate Cancer; Metastatic Transitional (Urothelial) Tract Cancer; Transitional Cell Cancer (Urothelial Cell Cancer) sacituzumab Hepato-cellular Cells Expressing govitecan Carcinoma Tumor Associated Calcium Signal Transducer 2 (Cell Surface Glycoprotein Trop 2 or Membrane Component Chromosome 1 Surface Marker 1 or Pancreatic Carcinoma Marker Protein GA733-1 or TACSTD2) sacituzumab Metastatic Cells Expressing govitecan Breast Tumor Associated Cancer; Calcium Signal Transitional Transducer Cell Cancer 2 (Cell Surface (Urothelial Cell Glycoprotein Trop Cancer) 2 or Membrane Component Chromosome 1 Surface Marker 1 or Pancreatic Carcinoma Marker Protein GA733-1 or TACSTD2) sacituzumab Non-Small Cell Cells Expressing govitecan Lung Cancer; Tumor Associated Small- Calcium Signal Cell Lung Transducer Cancer 2 (Cell Surface Glycoprotein Trop 2 or Membrane Component Chromosome 1 Surface Marker 1 or Pancreatic Carcinoma Marker Protein GA733-1 or TACSTD2) sacituzumab Metastatic Cells Expressing govitecan Breast Tumor Associated Cancer Calcium Signal Transducer 2 (Cell Surface Glycoprotein Trop 2 or Membrane Component Chromosome 1 Surface Marker 1 or Pancreatic Carcinoma Marker Protein GA733-1 or TACSTD2) .sup.(1)Discontinued due to adverse events .sup.(2)Discontinued due to lack of efficacy
TABLE-US-00003 TABLE A3 ADCs that reached phase III clinical development Last Development Development Reason for Drug Name Indication Stage Stage Discontinuation trastuzumab emtansine Gastric Cancer Marketed Phase II/III Unspecified MM-302 Metastatic Breast Discontinued Phase II/III Business/Strategic Cancer Decision trastuzumab emtansine Metastatic Breast Marketed Phase III Unspecified Cancer trastuzumab emtansine Gastric Cancer Marketed Phase III Unspecified ibritumomab tiuxetan Diffuse Large B- Marketed Phase III Cell Lymphoma inotuzumab ozogamicin Follicular Marketed Phase III Lymphoma inotuzumab ozogamicin Diffuse Large B- Marketed Phase III Lack of Efficacy Cell Lymphoma; Non-Hodgkin Lymphoma rovalpituzumab tesirine Small-Cell Lung Phase III Phase III Cancer rovalpituzumab tesirine Small-Cell Lung Phase III Phase III Cancer Neuradiab Brain Cancer; Inactive Phase III Unspecified Glioblastoma Multiforme (GBM) clivatuzumab tetraxetan Metastatic Inactive Phase III Unspecified Adenocarcinoma of The Pancreas depatuxizumab mafodotin Glioblastoma Inactive Phase III Lack of Efficacy Multiforme (GBM) vadastuximab talirine Acute Myelocytic Discontinued Phase III Adverse Events Leukemia (AML, Acute Myeloblastic Leukemia) glembatumumab vedotin Metastatic Breast Discontinued Phase III Lack of Efficacy Cancer Oncolysin B B-Cell Leukemia; Discontinued Phase III Business/Strategic Lymphoma Decision
TABLE-US-00004 TABLE A4 Tumor-specific cell-surface receptor targets which can be targeted by a cell-surface molecule targeting molecule of the invention such as immunoglobulins according to the invention, and antibodies that can be used for the AOC-saponin conjugates of the invention, ADC-saponin conjugates of the invention (not presented as a limitation; further immunoglobulins are equally suitable for the invention) Target cell- surface receptor Example monoclonal antibodies HER2 anti-HER2 monoclonal antibody such as trastuzumab and pertuzumab CD20 anti-CD20 monoclonal antibody such as rituximab, ofatumumab, tositumomab and ibritumomab CA125 anti-CA125 monoclonal antibody such as oregovomab EpCAM (17-1A) anti-EpCAM (17-1A) monoclonal antibody such as edrecolomab EGFR anti-EGFR monoclonal antibody such as cetuximab, panitumumab and nimotuzumab CD30 anti-CD30 monoclonal antibody such brentuximab CD33 anti-CD33 monoclonal antibody such as gemtuzumab and huMy9-6 vascular integrin anti-vascular integrin alpha-v beta-3 alpha-v beta-3 monoclonal antibody such as etaracizumab CD52 anti-CD52 monoclonal antibody such as alemtuzumab CD22 anti-CD22 monoclonal antibody such as epratuzumab CEA anti-CEA monoclonal antibody such as labetuzumab CD44v6 anti-CD44v6 monoclonal antibody such as bivatuzumab FAP anti- FAP monoclonal antibody such as sibrotuzumab CD19 anti-CD19 monoclonal antibody such as huB4 CanAg anti-CanAg monoclonal antibody such as huC242 CD56 anti-CD56 monoclonal antibody such huN901 CD38 anti-CD38 monoclonal antibody such as daratumumab CA6 anti-CA6 monoclonal antibody such as DS6 IGF-IR anti-IGF-IR monoclonal antibody such as cixutumumab and 3B7 integrin anti-integrin monoclonal antibody such as CNTO 95 syndecan-1 anti-syndecan-1 monoclonal antibody such as B-B4
TABLE-US-00005 TABLE A5 RIPs from plants* Plant Family Plant Species Proteins Classification Adoxaceae Sambucus ebulus L. Ebulitin α, Ebulitin β, Ebulitin γ RIP 1 Ebulin f, Ebulin l, Ebulin r1, Ebulin r2, SEA RIP 2 SEAII, SELfd, SELld, SELlm lectin Sambucus nigra L. α-Nigritin, β-Nigritin, γ-Nigritin, Nigritin f1, Nigritin f2 RIP 1 basic Nigrin b, Nigrin b = SNA-V, Nigrin f = SNA-Vf, Nigrin l1, Nigrin l2, Nigrin s, SNA-I, SNA-I′, SNA-If, RIP 2 SNAflu-I, SNLRP1, SNLRP2 SNA-ld, SNA-lm, SNA-II, SNA-III, SNA-IV = SNA-IVf, lectin SNA-IVl, SNApol-I, SNApol-II, TrSNA-I, TrSNA-If Sambucus racemosa L. basic racemosin b, SRA RIP 2 SRLbm = SRAbm lectin Sambucus sieboldiana SSA = SSA-b-1, Sieboldin-b = SSA-b-2 RIP 2 (Miq.) Blume ex Graebn. SSA-b-3, SSA-b-4 lectin Aizoaceae Mesembryanthe-mum RIP1 RIP 1 crystallinum L. Amaranthaceae Amaranthus caudatus L. Amaranthin = ACA lectin Amaranthus cruentus L. ACL lectin Amaranthus A. leucocarpus lectin lectin hypochondriacus L. [Syn.: Amaranthus leucocarpus S. Watson] Amaranthus mangostanus Amaramangin RIP 1 L. Amaranthus tricolor L. AAP-27 RIP 1 Amaranthus viridis L. Amaranthin RIP 1 Beta vulgaris L. Beetin-27 = BE27, Beetin-29 = BE29, Betavulgin RIP 1 Celosia argentea L. [Syn.: CCP-25, CCP-27 RIP 1 Celosia cristata L.] Chenopodium album L. CAP30 RIP 1 Spinacia oleracea L. SoRIP1 = BP31 RIP 1 SoRIP2 RIP 1 candidate Araliaceae Aralia elata (Miq.) Seem. Aralin RIP 2 Panax ginseng C.A. Mey Panaxagin peculiar RIP 1 candidate/RNase Panax quinquefolius L. Quinqueginsin peculiar RIP 1 candidate/RNase Asparagaceae Asparagus officinalis L. Asparin 1, Asparin 2 RIP 1 Drimia maritima (L.) Stearn Charybdin RIP 1 [Syn.: Charybdis maritima (L.) Speta] Muscari armeniacum Musarmin 1, Musarmin 2, Musarmin 3, Musarmin 4 RIP 1 Leichtlin ex Baker Polygonatum multiflorum PMRIPm, PMRIPt RIP 2 (L.) All. Yucca gloriosa var. tristis Yucca leaf protein = YLP RIP 1 Carri{grave over (e)}re [Syn.: Yucca recurvifolia Salisb.] Basellaceae Basella rubra L. Basella RIP 2a, Basella RIP 2b, Basella RIP 3 RIP 1 Caryophyllaceae Agrostemma githago L. Agrostin 2, Agrostin 5, Agrostin 6, Agrostin RIP 1 Dianthus barbatus L. Dianthin 29 RIP 1 Dianthus caryophyllus L. Dianthin 30, Dianthin 32 RIP 1 Dianthus chinensis L. [Syn.: D. sinensis RIP RIP 1 Dianthus sinensis Link] Gypsophila elegans M. Bieb. Gypsophilin RIP 1 Silene chalcedonica (L.) Lychnin RIP 1 E.H.L. Krause [Syn.: Lychnis chalcedonica L.] Silene glaucifolia Lag. [Syn.: Petroglaucin 1, Petroglaucin 2 RIP 1 Petrocoptis glaucifolia (Lag.) Boiss.] Silene laxipruinosa Mayol & Petrograndin RIP 1 Rosselló [Syn.: Petrocoptis grandiflora Rothm.] Saponaria ocymoides L. Ocymoidin RIP 1 Saponaria officinalis L. Saporin-L1 = SO-L1, Saporin-L2 = SO-L2, Saporin-L3 = RIP 1 SO-L3, Saporin-I = SO-I = SO-4, Saporin-R1 = SO- R1, Saporin-R2 = SO-R2, Saporin-R3 = SO-R3, SO3a, SO3b, Saporin-S5 = Saporin 5 = SO-S5, Saporin-S6 = Saporin 6 = SO-6 = SO-S6, Saporin-S8 = SO-S8, Saporin-S9 = Saporin 9 = SO-S9, SAP-C, SAP-S Myosoton aquaticum (L.) Stellarin RIP 1 Moench [Syn.: Stellaria aquatica (L.) Scop.] Stellaria media (L.) Vill. RIP Q3 RIP 1 Vaccaria hispanica (Mill.) Pyramidatin RIP 1 Rauschert [Syn.: Vaccaria pyramidata Medik.] Cucurbitaceae Benincasa hispida (Thunb.) Hispin RIP 1 Cogn. α-benincasin, β-benincasin sRIP 1 Bryonia cretica subsp. Bryodin 1 = BD1, Bryodin 2, Bryodin-L, Bryodin-R RIP 1 dioica (Jacq.) Tutin. [Syn.: BDA lectin/RIP 2 like Bryonia dioica L.] Citrullus colocynthis (L.) Colocin 1, Colocin 2 RIP 1 Schrad. Cucurbita foetidissima Foetidissimin peculiar RIP 2 Kunth Foetidissimin II RIP 2 Cucumis ficifolius A. Rich. Cucumis figarei RIP = CF-RIP RIP 1 candidate [Syn.: Cucumis figarei Delile ex Naudin] Cucurbita maxima Cucurmoschin sRIP 1 candidate Duchesne Cucurbita moschata Cucurmosin, Cucurmosin 2, C. moschata RIP, RIP 1 Duchesne [Syn.: Cucurbita Moschatin, PRIP 1, PRIP 2 moschata (Duchesne ex α-moschin, β-moschin sRIP 1 candidate Lam.) Duchesne ex Poir.] Cucurbita pepo L. Pepocin RIP 1 Cucurbita pepo var. texana Texanin RIP 1 (Scheele) D.S. Decker [Syn.: Cucurbita texana (Scheele) A. Gray] Gynostemma pentaphyllum Gynostemmin RIP 1 (Thunb.) Makino Lagenaria siceraria (Molina) Lagenin RIP 1 candidate Standl. Luffa acutangula (L.) Roxb. Luffaculin-1, Luffaculin-2 RIP 1 Luffangulin sRIP 1 Luffa acutangula fruit lectin lectin Luffa cylindrica (L.) M. Roem Luffin, Luffin-a, Luffin-b, α-luffin, β-luffin, LRIP RIP 1 [Syn.: Luffa aegyptiaca Mill] Luffacylin, Luffin P1 sRIP 1 Luffin-S, LuffinS(1), LuffinS(2) = luffin S2, LuffinS(3) sRIP 1 candidate Marah oreganus (Torr. & A. MOR-I, MOR-II RIP 1 Gray) Howell Momordica balsamina L. Balsamin, MbRIP-1, Momordin II RIP 1 Momordica charantia L. MAP 30, α-momorcharin = α-MC = α-MMC, β- RIP 1 momorcharin = β-MC = β-MMC, δ-momorcharin = δ- MMC, Momordin, Momordin = Momordica charantia inhibitor, Momordin II, Momordin-a, Momordin-b γ-momorcharin = γ-MMC, Charantin sRIP 1 RIP 1 candidate RIP 1 candidate MCL = M. charantia lectin, anti-H Lectin, Momordica lectin agglutinin, Momordin, protein fraction 1, protein fraction 2 MCL = Momordica charantia seed lectin = Momordica RIP 2 charantia lectin, MCL1 Momordica cochinchinensis Cochinin B, Momorcochin, Momorcochin-S RIP 1 Spreng. Siraitia grosvenorii (Swingle) Momorgrosvin RIP 1 C. Jeffrey ex A.M. Lu & Zhi Y. Zhang [Syn.: Momordica grosvenorii Swingle] Sechium edule (Jacq.) Sw Sechiumin RIP 1 Sechium edule fruit lectin lectin Trichosanthes anguina L. Trichoanguin RIP 1 SGSL lectin/RIP 2 like Trichosanthes cordata TCA-I, TCA-II lectin Roxb. Trichosanthes cucumerina TCSL lectin/RIP 2 L. candidate Trichosanthes β-trichosanthin = β-TCS RIP 1 cucumeroides (Ser.) Maxim. Trichosanthes kirilowii α-kirilowin, β-kirilowin, TAP 29, TK-35, Trichobitacin, RIP 1 Maxim. Trichokirin, Trichomislin = TCM, Trichosanthin = Trichosanthes antiviral protein = TAP = TCS = α- trichosanthin = α-TCS = GLQ223, Trichosanthin, β- trichosanthin = β-TCS, γ-trichosanthin = γ-TCS Trichokirin S1, S-Trichokirin, Trichosanthrip sRIP 1 TKL-1 = Trichosanthes kirilowii lectin-1 lectin/RIP 2 candidate TK-I, TK-II, TK-III, Trichosanthes kirilowii lectin lectin Trichosanthes kirilowii Karasurin-A, Karasurin-B, Karasurin-C RIP 1 Maximovicz var. japonica (Miguel) Kitamura Trichosanthes lepiniate Trichomaglin RIP 1 Trichosanthes dioica Roxb. TDSL lectin/RIP 2 candidate Trichosanthes sp. Bac Kan Trichobakin RIP 1 8-98 Cupressaceae Thuja occidentalis L. Arborvitae RIP RIP candidate Euphorbiaceae Croton tiglium L. Crotin I RIP 1 candidate Crotin 2 RIP 1 Euphorbia characias L. E. characias lectin lectin Suregada multiflora Gelonin = GAP 31 RIP 1 (A. Juss.) Baill. [Syn.: Gelonium multiflorum A. Juss.] Hura Crepitans L. Hura crepitans RIP, Hura crepitans RIP-5 RIP 1 Hura crepitans latex lectin RIP 2 Crepitin, Hurin, Hura crepitans seed lectin lectin Jatropha curcas L. Curcin, Curcin 2, Curcin-L, Jc-SCRIP RIP 1 Manihot palmata Müll. Arg. Mapalmin RIP 1 Manihot esculenta Crantz. Manutin 1, Manutin 2 RIP 1 [Syn.: Manihot utilissima Pohl] Ricinus communis L. Ricin = crystalline Ricin = Ricin D, Ricin E, RCA = RIP 2 Ricinus communis agglutinin = RCAI = RCA120 = R. communis hemagglutinin = RCB-PHA I, RCAII = RCA60 = RCB-PHA II Ricinus communis, USA Ricin 1, Ricin 2, Ricin 3 RIP 2 Ricinus communis, India Ricin I, Ricin II, Ricin III RIP 2 Ricinus sanguienus, France Ricin.sub.11, Ricin.sub.12, Ricin.sub.2 RIP 2 Fabaceae Abrus precatorius L. Abrin, Abrin-a = Abrin C = Abrin-III, Abrin-b, Abrin-c = RIP 2 Abrin A = Abrin-I, Abrin-d, Abrin-II, APA = Abrus precatorius agglutinin = Abrus lectin = AAG, APA-I, APA-II Abrus pulchellus Thwaites Pulchellin, Pulchellin PI, Pulchellin PII, Pulchellin PIII RIP 2 Pisum sativum subsp. α-pisavin, β-pisavin RIP 1 sativum L. [Syn.: Pisum sativum var. arvense (L.) Poir.] Pisum sativum var. Sativin RIP 1 candidate macrocarpon Iridaceae Iris hollandica var. Professor IrisRIP = IRIP, IrisRIP.A1, IrisRIP.A2, IrisRIP.A3 RIP 1 Blaauw IRA, IRAb, IRAr RIP 2 Lamiaceae Clerodendrum aculeatum CA-SRI RIP 1 candidate (L.) Schltdl. Clerodendrum inerme (L.) CIP-29 RIP 1 Gaertn. CIP-34 RIP 1 candidate Leonurus japonicus Houtt. Leonurin RIP candidate Lauraceae Cinnamomum bodinieri H. Bodinierin RIP 2 Lév. Cinnamomum camphora Camphorin RIP 1 (L.) J. Pres1 Cinnamomin, Cinnamomin 1, Cinnamomin 2, RIP 2 Cinnamomin 3 Cinphorin sRIP 2 Cinnamomum Porrectin RIP 2 parthenoxylon (Jack) Meisn. [Syn.: Cinnamomum porrectum (Roxb.) Kosterm] Malvaceae Abelmoschus esculentus Abelesculin RIP 1 (L.) Moench Nyctaginaceae Boerhaavia diffusa L. Boerhaavia inhibitor RIP 1 candidate Bougainvillea spectabilis BAP I, Bouganin = Bougainvillea RIP I RIP 1 Willd. Bougainvillea × buttiana cv. BBP-24, BBP-28 RIP 1 Enid Lancester Bougainvillea × buttiana cv. BBAP1 RIP 1 Mahara Mirabilis expansa (Ruiz & ME1, ME2 RIP 1 Pav.) Standl. Mirabilis jalapa L. MAP, MAP-2, MAP-3, MAP-4, MAP-S RIP 1 Olacaceae Malania oleifera Chun & S. Malanin lectin/RIP 2 K. Lee candidate Ximenia americana L. Riproximin = Rpx, Rpx-I, Rpx-II RIP 2 Passifloraceae Adenia digitata (Harv.) Engl. Modeccin = Modeccin 4B, Modeccin 6B RIP 2 Adenia ellenbeckii Harms A. ellenbeckii lectin RIP 2 candidate Adenia fruticosa Burtt Davy A. fruticosa lectin lectin Adenia glauca Schinz A. glauca lectin RIP 2 candidate Adenia goetzei Harms A. goetzei lectin RIP 2 (unresolved name) Adenia keramanthus Harms A. keramanthus lectin RIP 2 candidate Adenia lanceolata Engl. Lanceolin RIP 2 Adenia racemosa W. J. de A. racemosa lectin lectin Wilde Adenia spinosa Burtt Davy A. spinosa lectin RIP 2 candidate Adenia stenodactyla Harms Stenodactylin RIP 2 Adenia venenata Forssk. A. venenata lectin RIP 2 candidate Adenia volkensii Harms Volkensin RIP 2 Phytolaccaceae Phytolacca americana L. α-PAP, PAP = Phytolacca americana protein = RIP 1 pokeweed antiviral protein, PAP-I, PAP-II, PAP-III, PAP-C, PAP-H, PAP-R, PAP-S, PAP-S1, PAP-S2 Phytolacca dioica L. Diocin 1, Diocin 2, PD-L1, PD-L2, PD-L3, PD-L4, PD- RIP 1 S1, PD-S2, PD-S3 Phytolacca dodecandra Dodecandrin, Dodecandrin C RIP 1 L′Hér. Phytolacca heterotepala H. Heterotepalin 4, Heterotepalin 5b RIP 1 Walter Phytolacca insularis Nakai Insularin = PIP = Phytolacca insularis antiviral protein, RIP 1 PIP2 = P. insularis antiviral protein 2 Poaceae Hordeum vulgare L. Barley toxin = Barley translation inhibitor = Barley RIP 1 Protein Synthesis Inhibitor = BPSI = RIP 30, Barley toxin I= Barley translation inhibitor I, Barley toxin II = Barley translation inhibitor II = Barley Protein Synthesis Inhibitor II = BPSI II, Barley toxin III = Barley translation inhibitor III, JIP60 Oryza sativa L. Oryza sativa RIP RIP 1 Secale cereale L. RPSI RIP 1 Triticum aestivum L. Tritin, Tritin 1, Tritin 2, Tritin 3, Tritin-S, Tritin-L RIP 1 Zea mays L. b-32 = maize RIP = maize proRIP1, Maize proRIP2 RIP 3/peculiar RIP 1 Ranunculaceae Eranthis hyemalis (L.) EHL RIP 2 Salisb. Santalaceae Phoradendron californicum PCL RIP 2 Nutt. Viscum album L. HmRip, HmRip 1, HmRip 2, HmRip 3, HmRip 4 RIP 2 (Himalayan mistletoe) Viscum album L. (European ML-I = Mistletoe lectin I= Viscumin = Eu-ML = EML-1 = RIP 2 mistletoe) VAA-I, ML-II = Mistletoe lectin II = VAA-II, ML-III = Mistletoe lectin III = VAA-III Viscum articulatum Burm. f. Articulatin-D RIP 2 Viscum coloratum (Kom.) KML, KML-C, KML-IIL, KML-IIU, VCA RIP 2 Nakai [Syn.: Viscum album subsp. coloratum Kom.] Solanaceae Nicotiana tabacum L. CIP31 RIP-like protein TRIP RIP 1 candidate Thymelaeaceae Phaleria macrocarpa P. macrocarpa RIP RIP candidate (Scheff.) Boerl. *Schrot J, Weng A, Melzig MF, et al. Ribosome-inactivating and related proteins. Toxins (Basel). 2015 May 8;7(5):1556-615.
[0272] It is part of the invention that the therapeutic conjugate is further combined with a covalent conjugate (complex) of a binding molecule or a binding moiety and a saponin, or is further combined with a pharmaceutical compound, an antibody, etc., therewith providing a composition comprising two or even three or more enhancers, pharmaceutically active ingredients, etc., e.g. a conjugate of the invention combined with a binding moiety complexed with an effector molecule, further optionally combined with a pharmaceutical, which is either or not linked to a saponin, and which is either or not coupled to a ligand such as a targeting immunoglobulin, a domain or a fragment thereof. Furthermore, an embodiment is the therapeutic conjugate of the invention, wherein the cell-surface molecule targeting molecule is provided with two or more effector moieties such as a toxin or immunotoxin, wherein the two or more effector moieties are the same or different.
Exemplary Embodiments
[0273] An embodiment is the endosomal escape enhancing conjugate of the invention, wherein the saponin is a bisdesmosidic triterpene saponin belonging to the type of a 12,13-dehydrooleanane with an aldehyde function, in position 23, and wherein the saponin is preferably a saponin that can be isolated from Gypsophila or Saponaria species, more preferably the saponin is the saponin SO1861 or any of its diastereomers.
[0274] An embodiment is the endosomal escape enhancing conjugate of the invention, wherein the cell-surface molecule targeting molecule is at least a ligand, such as an immunoglobulin, with at least an effector moiety bound thereto.
[0275] An embodiment is the endosomal escape enhancing conjugate of the invention, wherein the cell-surface molecule targeting molecule is an immunoglobulin or at least a binding domain thereof for binding to a cell surface molecule, wherein preferably the cell surface molecule is selected from any of HER2, EGFR, CD20, CD22, Folate receptor 1, CD146, CD56, CD19, CD138, CD27L, PSMA, CanAg, integrin-alphaV, CA6, CD33, mesothelin, Cripto, CD3, CD30, CD33, CD239, CD70, CD123, CD352, DLL3, CD25, ephrinA4, MUC1, Trop2, CEACAM5, HER3, CD74, PTK7, Notch3, FGF2, C4.4A, FLT3, CD71.
[0276] An embodiment is the endosomal escape enhancing conjugate of the invention, wherein a linker is coupled to the saponin via a cleavable bond, and wherein the cell-surface molecule targeting molecule is an immunoglobulin, wherein preferably said cleavable bond is subject to cleavage under acidic, reductive, enzymatic or light-induced conditions, and preferably the cleavable bond is a covalent bond, preferably an imine bond, a hydrazone bond, an oxime bond, a 1,3-dioxolane bond or an ester bond, wherein preferably the cleavable bond is a disulfide bond or a peptide bond.
[0277] An embodiment is the endosomal escape enhancing conjugate of the invention, wherein the saponin moiety is a terminal saponin, preferably the saponin SO1861, the linker is a chemical linker covalently linking the saponin to the cell-surface molecule targeting molecule of the conjugate of the invention, and the cell-surface molecule targeting molecule is an immunoglobulin such as trastuzumab or cetuximab, the linker preferably providing a cleavable bond between the terminal saponin moiety and the cell-surface molecule targeting molecule comprised by the conjugate.
[0278] An embodiment is the conjugate according to the invention, wherein the saponin is a bisdesmosidic triterpene.
[0279] An embodiment is the conjugate according to the invention, wherein the saponin is a bisdesmosidic triterpene saponin.
[0280] An embodiment is the conjugate according to the invention, wherein the saponin is a bisdesmosidic triterpene saponin belonging to the type of a 12,13-dehydrooleanane with an aldehyde function in position 23.
[0281] An embodiment is the conjugate according to the invention, wherein the saponin is a saponin that can be isolated from Gypsophila or Saponaria species.
[0282] An embodiment is the conjugate according to the invention, wherein the saponin is a SO1861 or any of its diastereomers.
[0283] An embodiment is the conjugate according to the invention, wherein the at least one saponin is bound to the cell-surface molecule targeting molecule (binding site for the epitope on the cell-surface molecule) via a cleavable bond, wherein preferably said cleavable bond is subject to cleavage under acidic, reductive, enzymatic or light-induced conditions, and wherein the cleavable bond preferably is a disulfide bond or a peptide bond.
[0284] An embodiment is the conjugate according to the invention, wherein the cleavable bond is a covalent bond, preferably an imine bond, a hydrazone bond, an oxime bond, a 1,3-dioxolane bond or an ester bond.
[0285] An embodiment is the conjugate according to the invention, wherein the endosomal escape enhancing conjugate comprises a defined number of glycosides or a defined range.
[0286] An embodiment is the conjugate according to the invention, wherein the defined range is between 1-30 glycoside(s), preferably between 1-20, more preferably between 1-10, more preferably between 1-6, more preferably between 2-6, more preferably between 2-5, more preferably between 3-5, more preferably between 3-4 glycosides.
[0287] An embodiment is the conjugate according to the invention, wherein the effector moiety is a pharmaceutically active substance, such as a toxin such as a proteinaceous toxin, a drug, a polypeptide or a polynucleotide.
[0288] An embodiment is the conjugate according to the invention, wherein the target cell is a diseased cell or a disease-related cell, preferably a tumor cell or a tumor-associated cell (e.g. tumor vascular cell), or an immune cell (e.g. a T regulatory cell), or an autoimmune cell.
[0289] An embodiment is the conjugate according to the invention, wherein the at least one effector moiety is bound to the cell-surface molecule targeting molecule comprised by the conjugate via a cleavable bond, wherein preferably said cleavable bond is subject to cleavage under acidic, reductive, enzymatic or light-induced conditions, and/or wherein the cleavable bond is a disulfide bond or a peptide bond.
[0290] An embodiment is the conjugate according to the invention, wherein the saponin is capable of augmenting endosomal escape of the effector molecule.
[0291] An embodiment is the conjugate according to the invention, for use as a medicament.
[0292] An embodiment is the pharmaceutical composition comprising a conjugate according to the invention (previous embodiments) and a pharmaceutically acceptable excipient.
[0293] An embodiment is the pharmaceutical composition according to the invention, further comprising at least one further active pharmaceutically ingredient, such as a further immunoglobulin.
[0294] An embodiment is the conjugate for use according to the invention, or pharmaceutical composition according to the invention, for use in a method of treating cancer or an autoimmune disease.
[0295] An embodiment is a method of treating cancer, the method comprising administering a conjugate according to the invention to a patient in need thereof.
[0296] An embodiment is the method of treating cancer, the method comprising administering a pharmaceutical composition according to the invention, to a patient in need thereof.
[0297] An embodiment is a kit comprising a container containing an endosomal escape enhancing conjugate according to the invention, the kit further comprising instructions for using the binding molecules.
[0298] The scaffold comprising at least one saponin according to the invention is suitable for use as a semi-finished product for the manufacture of a functionalized ADC or a functionalized AOC wherein the functionalized ADC or the functionalized OAC comprises at least one covalently coupled saponin of the invention and at least one effector moiety of the invention. An embodiment is the scaffold of the invention further comprising a payload or effector moiety of the invention such as a toxin or an oligonucleotide covalently bound to the scaffold of the invention, either directly or via a linker of the invention, preferably a cleavable linker of the invention. Such functionalized scaffold can be used for the manufacture of an ADC-saponin conjugate or an AOC-saponin conjugate comprising said scaffold with covalently bound scaffold thereto and with an effector moiety bound thereto. For example, such a functionalized ADC or OAC comprises 2-4 saponins covalently coupled to e.g. a cysteine side chain in the conjugate according to the invention such as covalently coupled to the cell-surface molecule targeting molecule which is for example a ligand or an antibody (fragment), either directly or via a (cleavable) linker, or such a functionalized ADC or OAC comprises for example a dendron, such as a G4-dendron, the dendron comprising 1-16 covalently coupled saponins bound thereto, the dendron covalently coupled to e.g. a cysteine side chain and/or a lysine side chain of the cell-surface molecule targeting molecule comprised by the conjugate according to the invention.
[0299] An aspect of the invention relates to a pharmaceutical composition comprising the conjugate of the invention and optionally a pharmaceutically acceptable excipient and/or a pharmaceutically acceptable diluent.
[0300] An aspect of the invention relates to a conjugate of the invention or relates to the pharmaceutical composition of the invention, for use as a medicament.
[0301] An aspect of the invention relates to a conjugate of the invention or relates to the pharmaceutical composition of the invention, for use in the treatment or prevention of a cancer or an autoimmune disease.
[0302] The invention is further illustrated by the following examples, which should not be interpreted as limiting the present invention in any way.
EXAMPLES
Example A—Treating a Mammalian Tumor-Bearing Animal with a Conjugate of the Invention in Combination with an ADC Results in Survival and Tumor Regression
[0303] Female Balb/c nude mice were injected subcutaneously with a suspension of human A431 tumor cells. Under the skin of the mice, a human epidermal carcinoma developed in the xenograft animal tumor model. After injection of the tumor cells, the xenograft tumor was allowed to develop to a size of approximately 170-180 mm.sup.3. The A431 tumor cells have the following characteristics: high EGFR expressors, medium CD71 expressors, low HER2 expressors. The A431 tumor-cell based tumor model is an aggressive model since amongst others the tumor is rapidly growing.
[0304] In Table A, the results of the treatment of control mice and tumor-bearing mice are presented. Tumor-bearing mice were treated with the indicated antibodies directed to either human Her2/neu, human EGFR, or human CD71, which are cell-surface receptors on the xenograft tumor. Cetuximab was covalently conjugated with saponin SO1861. The SO1861 was first provided with the linker EMCH (N-ε-maleimidocaproic acid hydrazide), which EMCH is a maleimide-and-hydrazide crosslinker for covalently conjugating sulfhydryls (reduced cysteines of the antibody)) to carbonyls (aldehyde or ketones; here the carbonyl of the aldehyde at position C-23 of the saponin). The saponin-EMCH was covalently coupled to reduced cysteines of the Cetuximab, forming a covalent thio-ether bond between the EMCH and the cysteine side chain. The ADCs trastuzumab-saporin (covalent conjugate) and anti-CD71 mAb (OKT-9, IgG)-saporin (covalent conjugate) were tested for their tumor-attacking efficacy in the mice, measured as tumor volume in time after start of the treatment with the ADCs. The dose of the ADCs was sub-optimal in the tumor model. That is to say, from previous experiments, it was established at which sub-optimal dose of the ADCs no tumor-regression or arrest of tumor growth would be observable.
TABLE-US-00006 TABLE A RESULTS OF TREATING A MAMMALIAN TUMOR-BEARING ANIMAL WITH A CONJUGATE OF THE INVENTION IN COMBINATION WITH AN ADC RESULTS IN SURVIVAL AND TUMOR REGRESSION tumor size (volume in mm.sup.3 or ‘+’ for Treat- Patient/ growth, ‘−’ for regression, ment healthy and ‘stable’ for growth nor group animal treatment regression) 1 xenograft vehicle 2000 mm.sup.3 (death/euthanasia) 2 xenograft Trastuzumab-saporin 2000 mm.sup.3 (death/euthanasia) 3 xenograft Anti-CD71 mAb OKT-9 − 2000 mm.sup.3 (death/euthanasia) saporin (covalent conjugate) 4 xenograft Cetuximab-SO1861 2000 mm.sup.3 (death/euthanasia) (covalent conjugate) 5 xenograft Cetuximab >170 mm.sup.3, but <2000 mm.sup.3 (death/euthanasia) 6 xenograft Trastuzumab-saporin Tumor regression from (covalent conjugate) + 180 mm.sup.3 at the start of Cetuximab-SO1861 treatment back to conjugate (covalent 80 mm.sup.3 (survival) 7 xenograft Anti-CD71 Tumor regression mAb OKT-9 − from 180 mm.sup.3 saporin (covalent at the start of conjugate) + treatment back to Cetuximab- 40 mm.sup.3 (survival) SO1861 (covalent conjugate)
[0305] These results demonstrate that the combination therapy of an ADC at a dose which is ineffective when treatment of tumor-bearing mice with the ADC alone is considered (tumor growths, death of the mice is not prevented (euthanasia)), with a conjugate of the invention consisting of a tumor-cell specific receptor targeting antibody covalently bound to a saponin, i.e. SO1861, the covalent conjugate administered to the mice suffering from cancer, at a non-effective dose when administered alone (tumor growths, death of the mice is not prevented (euthanasia)), provides an efficient and efficacious treatment regimen, expressed as tumors in regression and prolonged survival of the treated animals (beyond the duration of the experiment). The sub-optimal dose of ADC combined with a covalently bound saponin-comprising conjugate of the invention which has no anti-tumor activity when administered alone, thus provide for an effective treatment option for cancer patients, wherein a relative low dose of the ADO is efficacious. A lower dose of ADO bears the promise of less risk for adverse events, or even no side effects at all. In addition, the stimulatory effect of the saponin-bearing conjugate of the invention when the efficacy of the ADO is considered, shows that ADCs which previously have proven to lack efficacy when tumor patient treatment is concerned, may gain renewed attention and value, since ADC efficacy is improved in combination therapy setting, as the current example demonstrated. Reference is made to Table A2 and Table A3, summarizing ADCs which were previously investigated in the human clinical setting, but then were for some ADCs retracted from further clinical investigation. Especially the ADCs for which clinical development was terminated due to observed lack of efficacy and/or due to occurrence of unacceptable adverse event are ADCs which may gain renewed value for cancer patients when combined with a covalently bound saponin-comprising conjugate of the invention, such as the cetuximab-saponin tested.
Example B—Saponins Mixture of Quillaja saponaria Comprising OS-21, with Endosomal/Lysosomal Escape Enhancing Activity
[0306] Scheme I displays the common molecular structure of a series of QS-21 saponins (in part adapted from: Conrado Pedebos, Laércio Pol-Fachin, Ramon Pons, Cilaine V. Teixeira Hugo Verli, Atomic Model and Micelle Dynamics of QS-21 Saponin, Molecules 2014, 19, 3744-3760). A mixture of water-soluble saponins obtained from Quillaja saponaria (Sigma-Aldrich, product No. S4521; Roth, Item No. 6857; InvivoGen, product ‘Quil-A’) may be applied in the endosomal/lysosomal escape enhancing conjugate, composition, combination of the invention, based on endosomal/lysosomal escape enhancing properties of at least one individual saponin present in the mixture, e.g. QS-21, or based on a combination of two or more of the saponins comprised by the mixture, such as QS-21 and QS-7.
[0307] The inventors demonstrated that the mixture of saponins from Quillaja saponaria at 2.5 microgram/ml dose was capable of enhancing endosomal escape of dianthin, as tested with mammalian tumor cells in a cell-based bioassay. The effector moiety exposed to the cells was dianthin covalently coupled to the ligand EGF: EGF-dianthin. Cells tested were tumor cell lines HeLa for free saponins, and A431, MDA-MB-468, CaSki and A2058 for testing the saponins when covalently coupled to cetuximab.
Example 1
[0308] SO1861 was conjugated (labile) via cysteine residues (Cys) and dianthin (protein toxin) was conjugated (stable) via lysine residues (Lys) to cetuximab (monoclonal antibody recognizing and binding human EGFR), resulting in the production of: Cetuximab-(Cys-L-SO1861).sup.3,9(Lys-S-dianthin).sup.2. The conjugate was tested in a A431 (EGFR.sup.++) xenograph mouse tumor model for EGFR tumor targeted cell killing as illustrated in
[0309] Next, SO1861 was conjugated (labile) via cysteine residues (Cys) and dianthin (protein toxin) was conjugated (labile) via lysine residues (Lys) to cetuximab (monoclonal antibody recognizing and binding human EGFR), resulting in the production of: Cetuximab-(Cys-L-SO1861).sup.3,9(Lys-L-dianthin).sup.2. The conjugate was tested in a A431 (EGFR.sup.++) xenograph mouse tumor model for EGFR tumor targeted cell killing as illustrated in
[0310] Next, SO1861-EMCH was conjugated via cysteine residues (Cys) to cetuximab (monoclonal antibody recognizing and binding human EGFR), with a DAR 3,9 and the antisense HSP27BNA oligo nucleotide (targeting and inducing degradation of the onco-target hsp27 mRNA (gene silencing) in cancer cells) via a labile (L) linker to the lysine residues (Lys) of the antibody, with a DAR 1,8 resulting in the production of cetuximab-(Cys-L-SO1861).sup.3,9(Lys-L-HSP27BNA).sup.1,8. Cetuximab-(Cys-L-SO1861).sup.3,9(Lys-L-HSP27BNA).sup.1,8 was tested in a A431 xenograph ‘nude’ mouse tumor model for EGFR-mediated tumor targeted HSP27 gene silencing, according to the invention as illustrated in
Example 2
[0311] In another example according to the invention, SO1861 (labile) and the protein toxin, dianthin (labile or stable) were conjugated to the HER2 targeting antibody, trastuzumab. Trastuzumab-(Cys-L-SO1861).sup.3,8(Lys-L-dianthin).sup.1,7 or trastuzumab-(Cys-L-SO1861).sup.3,8(Lys-S-dianthin).sup.1,7, were produced and tested for enhanced cell killing in SK-BR-3 (HER2.sup.++) and MDA-MB-468 (HER2.sup.−) cells as illustrated in
[0312] In another example according to the invention, SO1861 (labile) and the protein toxin, dianthin (labile or stable) were conjugated to the EGFR targeting antibody, cetuximab. Cetuximab-(Cys-L-SO1861).sup.3,9(Lys-L-dianthin).sup.2 or cetuximab-(Cys-L-SO1861).sup.3,9(Lys-S-dianthin).sup.2, was tested for enhanced cell killing in A431 cells (EGFR.sup.++) and A2058 cells (EGFR.sup.−) as illustrated in
Example 3
[0313] In another example according to the invention, SO1861 (labile) and the HSP27BNA oligo (labile) were conjugated to the EGFR targeting antibody, cetuximab. Cetuximab-(Cys-L-SO1861).sup.3,8(Lys-L-HSP27BNA).sup.3,8 was tested for enhanced HSP27 gene silencing in A431 cells (EGFR.sup.−) and A2058 (EGFR.sup.−) cells, according to the invention as illustrated in
[0314] In another example according to the invention, SO1861 (labile) and the HSP27BNA oligo (labile) were conjugated to the HER2 targeting antibody, trastuzumab. Trastuzumab-(Cys-L-SO1861).sup.3,8(Lys-L-HSP27BNA).sup.3,5 was tested for enhanced HSP27 gene silencing in SK-BR-3 cells (HER2.sup.++) cells, according to the invention as illustrated in
[0315] In another example, cetuximab-Cys-(SO1861-L-trifunctional linker-L-HSP27BNA).sup.3,7 was tested for enhanced HSP27 gene silencing in A431 (EGFR.sup.++) and A2058 (EGFR.sup.−) cells according to the invention as illustrated in
Example 4
[0316]
[0317] Trastuzumab and cetuximab do not or hardly influence cell viability when exposed to most of the cell lines, with some effect on cell growth inhibition via blocking the function of the HER2 growth factor receptor when trastuzumab is exposed to SK-BR-3 cells at relatively high dose and with some effect on cell growth inhibition via blocking the function of the EGFR growth factor receptor when cetuximab is exposed to MDA-MB-468 cells at relatively high dose.
[0318] TDM-1, or ado-trastuzumab emtansine, is a targeted therapy approved by the U.S. Food and Drug Administration to treat: HER2-positive metastatic breast cancer that has previously been treated with Herceptin (chemical name: trastuzumab) and taxane chemotherapy; early-stage HER2-positive breast cancer after surgery if residual disease was found after neoadjuvant (before surgery) treatment with Herceptin and taxane chemotherapy. The TDM-1 is a combination of Herceptin (Trastuzumab) and the chemotherapy medicine emtansine.
[0319] The free toxins saporin and dianthin and the toxin saporin coupled to a control IgG with no affinity for any of the cell surface molecules on the cell lines tested, do not or hardly have any influence on cell viability over a wide range of concentrations toxin tested, up to 100.000 pM (
Example 5
Dendron(-L-SO1861).SUP.n .Synthesis (FIGS. 13, 14, 15)
Materials and Methods
Abbreviations
[0320] DCM dichloromethane
DIPEA N,N-diisopropylethylamine
DMF N,N-dimethylformamide
[0321] EDCI.HCl 3-((Ethylimino)methyleneamino)-N,N-dimethylpropan-1-aminium chloride
EMCH.TFA N-(ε-maleimidocaproic acid) hydrazide, trifluoroacetic acid salt
min minutes
r.t. retention time
TCEP tris(2-carboxyethyl)phosphine hydrochloride
Temp temperature
TFA trifluoroacetic acid
THF tetrahydrofuran
Analytical Methods
LC-MS Method 1, .SUP.1
[0322] Apparatus: Agilent 1200 Bin. Pump: G1312A, degasser; autosampler, ColCom, DAD: Agilent G1316A, 210, 220 and 220-320 nm, PDA: 210-320 nm, MSD: Agilent LC/MSD G6130B ESI, pos/neg 100-1000; ELSD Alltech 3300 gas flow 1.5 ml/min, gas temp: 40° C.; column: Waters XSelect™ CSH C18, 30×2.1 mm, 3.5 μm, Temp: 35° C., Flow: 1 mL/min, Gradient: t.sub.0=5% A, t.sub.1.6 min=98% A, t.sub.3 min=98% A, Posttime: 1.3 min, Eluent A: 0.1% formic acid in acetonitrile, Eluent B: 0.1% formic acid in water.
LC-MS Method 2, .SUP.2
[0323] Apparatus: Agilent 1260 Bin. Pump: G7112B, Multisampler, Column Comp, DAD: Agilent G7115A, 210, 220 and 220-320 nm, PDA: 210-320 nm, MSD: Agilent LC/MSD G6130B ESI, mass ranges depending on the molecular weight of the product:
.SUP.A.pos/neg 100-1000
.SUP.B.pos/neg 100-1400;
[0324] ELSD Alltech 3300 gas flow 1.5 ml/min, gas temp: 40° C.; column: Waters XSelect™ C18, 30×2.1 mm, 3.5 μm, Temp: 40° C., Flow: 1 mL/min, Gradient: t.sub.0=5% A, t.sub.1.6 min=98% A, t.sub.3 min=98% A, Posttime: 1.3 min, Eluent A: 0.1% formic acid in acetonitrile, Eluent B: 0.1% formic acid in water.
LC-MS Method 3, .SUP.3
[0325] Apparatus: Waters IClass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, pos/neg 800-1500; ELSD: gas pressure 40 psi, drift tube temp: 50° C.; column: Waters XSelect™ CSH C18, 50×2.1 mm, 2.5 μm Temp: 25° C., Flow: 0.6 mL/min, Gradient: t.sub.0=5% A, t.sub.2.0 min=98% A, t.sub.2.7 min=98% A, Posttime: 0.3 min, Eluent A: acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).
LC-MS Method 4, .SUP.4
[0326] Apparatus: Waters IClass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, pos/neg 1500-2500; ELSD: gas pressure 40 psi, drift tube temp: 50° C.; column: Waters XSelect™ CSH C18, 50×2.1 mm, 2.5 μm Temp: 25° C., Flow: 0.6 mL/min, Gradient: t.sub.0=15% A, t.sub.2.0 min=60% A, t.sub.2.7 min=98% A, Posttime: 0.3 min, Eluent A: acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).
LC-MS Method 5, .SUP.5
[0327] Apparatus: Waters IClass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, mass ranges depending on the molecular weight of the product:
.SUP.A.pos/neg 1500-2500
.SUP.B.neg 2000-3000;
[0328] ELSD: gas pressure 40 psi, drift tube temp: 50° C.; column: Acquity C18, 50×2.1 mm, 1.7 μm Temp: 60° C., Flow: 0.6 mL/min, Gradient: t.sub.0=2% A, t.sub.5.0 min=50% A, t.sub.6.0 min=98% A, Posttime: 1.0 min, Eluent A: acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).
Preparative Methods
Preparative MP-LC Method 1, .SUP.1
[0329] Instrument type: Reveleris™ prep MPLC; column: Waters XSelect™ CSH C18 (145×25 mm, 10μ); Flow: 40 mL/min; Column temp: room temperature; Eluent A: 10 mM ammoniumbicarbonate in water pH=9.0); Eluent B: 99% acetonitrile+1% 10 mM ammoniumbicarbonate in water; Gradient: t.sub.0 min=5% B, t.sub.1 min=5% B, t.sub.2 min=10% B, t.sub.17 min=50% B, t.sub.18 min=100% B, t.sub.23 min=100% B; Detection UV: 210, 225, 285 nm.
Preparative MP-LC Method 2, .SUP.2
[0330] Instrument type: Reveleris™ prep MPLC; Column: Phenomenex LUNA C18(3) (150×25 mm, 10μ); Flow: 40 mL/min; Column temp: room temperature; Eluent A: 0.1% (v/v) Formic acid in water, Eluent B: 0.1% (v/v) Formic acid in acetonitrile; Gradient: t.sub.0 min=5% B, t.sub.1 min=5% B, t.sub.2 min=10% B, t.sub.17 min=50% B, t.sub.18 min=100% B, t.sub.23 min=100% B; Detection UV: 210, 225, 285 nm.
Preparative LC-MS Method 1, .SUP.3
[0331] MS instrument type: Agilent Technologies G6130B Quadrupole; HPLC instrument type: Agilent Technologies 1290 preparative LC; Column: Waters XSelect™ CSH (C18, 100×30 mm, 10μ); Flow: 25 ml/min; Column temp: room temperature; Eluent A: 100% acetonitrile; Eluent B: 10 mM ammonium bicarbonate in water pH=9.0; lin. gradient depending on the polarity of the product:
.sup.At.sub.0=20% A, t.sub.2 min=20% A, t.sub.8.5 min=60% A, t.sub.10 min=100% A, t.sub.13 min=100% A
.sup.Bt.sub.0=5% A, t.sub.2 min=5% A, t.sub.8.5 min=40% A, t.sub.10 min=100% A, t.sub.13 min=100% A
.sup.Ct.sub.0=10% A, t.sub.2 min=10% A, t.sub.8.5 min=50% A, t.sub.10 min=100% A, t.sub.13 min=100% A;
Detection: DAD (220-320 nm); Detection: MSD (ESI pos/neg) mass range: 100-800; Fraction collection based on DAD.
Preparative LC-MS method 2, .sup.4
[0332] MS instrument type: Agilent Technologies G6130B Quadrupole; HPLC instrument type: Agilent Technologies 1290 preparative LC; column: Waters XBridge Shield (C18, 150×19 mm, 5μ); Flow: 25 ml/min; Column temp: room temperature; Eluent A: 100% acetonitrile; Eluent B: 10 mM ammonium bicarbonate in water pH=9.0; lin. gradient: t.sub.0=5% A, t.sub.2.5 min=5% A, t.sub.11 min=40% A, t.sub.13 min=100% A, t.sub.17 min=100% A; Detection: DAD (220-320 nm); Detection: MSD (ESI pos/neg) mass range: 100-800; Fraction collection based DAD
Flash Chromatography
[0333] Grace Reveleris X2® C-815 Flash; Solvent delivery system: 3-piston pump with auto-priming, 4 independent channels with up to 4 solvents in a single run, auto-switches lines when solvent depletes; maximum pump flow rate 250 mL/min; maximum pressure 50 bar (725 psi); Detection: UV 200-400 nm, combination of up to 4 UV signals and scan of entire UV range, ELSD; Column sizes: 4-330 g on instrument, luer type, 750 g up to 3000 g with optional holder.
SO1861-EMCH Synthesis (FIG. 13)
[0334] To SO1861 (121 mg, 0.065 mmol) and EMCH.TFA (110 mg, 0.325 mmol) was added methanol (extra dry, 3.00 mL) and TFA (0.020 mL, 0.260 mmol). The reaction mixture stirred at room temperature. After 1.5 hours the reaction mixture was subjected to preparative MP-LC..sup.1 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (120 mg, 90%) as a white fluffy solid. Purity based on LC-MS 96%.
[0335] LRMS (m/z): 2069 [M−1].sup.1−
[0336] LC-MS r.t. (min): 1.08.sup.4
Dendron(-L-SO1861).SUP.4 .Synthesis (FIG. 14)
Intermediate 1:
Di-tert-butyl (((6-azidohexanoyl)azanediyl)bis(ethane-2,1-diyl))dicarbamate
[0337] 6-azidohexanoic acid (0.943 g, 6.00 mmol), EDCI.HCl (1.21 g, 6.30 mmol) and Oxyma Pure (0.938 g, 6.60 mmol) were dissolved in DMF (10.0 mL) and the mixture was stirred for 5 min. Next a solution of di-tert-butyl (azanediylbis(ethane-2,1-diyl))dicarbamate (1.82 g, 6.00 mmol) in DMF (5.00 mL) was added and the reaction mixture was stirred at room temperature. After 5 hours the reaction mixture was evaporated in vacuo and the residue was dissolved in ethyl acetate (50 mL). The resulting solution was washed with 1N potassium bisulphate solution (50 mL), saturated sodium bicarbonate solution (2×50 mL) and brine (50 mL), dried over Na.sub.2SO.sub.4, filtered and evaporated in vacuo. The residue was purified by flash chromatography (ethyl acetate-heptane gradient, 10:90 rising to 100:0) to give the title compound (2.67 g, 100%) as a white solid. Purity based on LC-MS 98%.
[0338] LRMS (m/z): 287/343/465 [M−155/M−99/M+23].sup.1+
[0339] LC-MS r.t. (min): 2.02.sup.2A
Intermediate 2:
N,N-bis(2-aminoethyl)-6-azidohexanamide dihydrochloride
[0340] To di-tert-butyl (((6-azidohexanoyl)azanediyl)bis(ethane-2,1-diyl))dicarbamate (2.66 g, 6.00 mmol) was added HCl in isopropanol (5-6 N, 20.0 mL, 110 mmol) and the reaction mixture was stirred at room temperature. After 4 hours, the reaction mixture was evaporated in vacuo and the resulting crude product was co-evaporated with DCM (3×20 mL) to give the crude title product (1.49 g, 79%) as a white solid.
[0341] LRMS (m/z): 243 [M+1].sup.1+
Intermediate 3:
Tetra-tert-butyl ((5S,5′S)-((((6-azidohexanoyl)azanediyl)bis(ethane-2,1-diyl))bis(azanediyl))bis(6-oxohexane-6,1,5-triyl))tetracarbamate
[0342] To a solution of N,N-bis(2-aminoethyl)-6-azidohexanamide dihydrochloride (1.19 g, 3.76 mmol) in DMF (30.0 mL) and DIPEA (2.62 mL, 15.1 mmol) was added Boc-Lys(Boc)-ONp (3.69 g, 7.90 mmol) and the mixture was stirred at room temperature overnight. The reaction mixture was evaporated in vacuo and the residue was dissolved in ethyl acetate (100 mL). The resulting solution was washed with 1N potassium bisulphate solution (100 mL) and saturated sodium bicarbonate solution (5×100 mL), dried over Na.sub.2SO.sub.4, filtered and evaporated in vacuo. The residue was purified by flash chromatography (DCM-methanol/DCM (1/9, v/v) gradient 100:0 rising to 0:100) to give the give the title product (3.07 g, 91%) as a slightly yellowish solid. Purity based on LC-MS 94%.
[0343] LRMS (m/z): 800/900/922 [M−99/M+1/M+23].sup.1+
[0344] LC-MS r.t. (min): 2.17.sup.2A
Intermediate 4:
4-nitrophenyl 3-(acetylthio)propanoate
[0345] 4-Nitrophenyl trifluoroacetate (5.17 g, 22.0 mmol) and 3-(Acetylthio)propionic Acid (2.96 g, 20.0 mmol) were dissolved in DCM (50.0 mL). Next, DIPEA (6.97 mL, 40.0 mmol) was added and the reaction mixture was stirred at room temperature overnight. The reaction mixture was evaporated in vacuo and the residue was dissolved in ethyl acetate (50 mL). The resulting solution was washed with 1N potassium bisulphate solution (50 mL), saturated sodium bicarbonate solution (5×50 mL) and brine (50 mL), dried over Na.sub.2SO.sub.4, filtered and evaporated in vacuo. The residue was purified by flash chromatography (DCM-methanol/DCM (1/9, v/v) gradient 100:0 rising to 0:100) to give the give the title product (4.90 g, 91%) as a slightly yellowish solid. Purity based on LC-MS 99%.
[0346] LRMS (m/z): 292 [M+23].sup.1+
[0347] LC-MS r.t. (min): 1.94.sup.2A
Intermediate 5:
(S)-2,6-diamino-N-(2-(6-azido-N-(2-((S)-2,6-diaminohexanamido)ethyl)hexanamido)ethyl)hexanamide tetrahydrochloride
[0348] tetra-tert-butyl ((5S,5′S)-((((6-azidohexanoyl)azanediyl)bis(ethane-2,1-diyl))bis(azanediyl))bis(6-oxohexane-6,1,5-triyl))tetracarbamate (1.80 g, 2.00 mmol) was dissolved in HCl in isopropanol (5-6N, 50.0 ml, 275 mmol) and the reaction mixture was stirred at room temperature overnight. The reaction mixture was evaporated in vacuo and the resulting crude product was co-evaporated with DCM (3×20 mL) to give the crude title product as a white solid.
[0349] LRMS (m/z): 250 [M+2].sup.2+, 500 [M+1].sup.1+
Intermediate 6:
(2S)-2,6-bis[3-(acetylsulfanyl)propanamido]-N-[2-(6-azido-N-{2-[(2S)-2,6-bis[3-(acetylsulfany)propanamido]hexanamido]ethyl}hexanamido)ethyl]hexanamide
[0350] To a solution of (S)-2,6-diamino-N-(2-(6-azido-N-(2-((S)-2,6-diaminohexanamido)ethyl)hexanamido) ethyl)hexanamide tetrahydrochloride (1.29 g, 2.00 mmol) in DMF (30 mL) and DIPEA (3.48 mL, 20.0 mmol) was added 4-nitrophenyl 3-(acetylthio)propanoate (2.26 g, 8.40 mmol) and the reaction mixture was stirred at room temperature over the weekend. The reaction mixture was evaporated in vacuo and the residue was dissolved in DCM/methanol (95:5, v/v, 100 mL). The resulting solution was washed with 1N potassium bisulphate solution (100 mL), 1 N sodium hydroxide solution (3×100 mL) and brine (100 mL), dried over Na.sub.2SO.sub.4, filtered and evaporated in vacuo. The residue was purified by flash chromatography (DCM-methanol/DCM (1/9, v/v) gradient 100:0 rising to 0:100) to give the title product (1.33 g, 65%) as a white solid. On LC-MS an impurity (15%) was found with m/z values corresponding to the product with one deprotected thioacetate group. The impurity was formed during or after work-up. Purity based on LC-MS 85%.
[0351] LRMS (m/z): 510 [M+2].sup.2+, 1019/1041 [M+1/M+23].sup.1+
[0352] LC-MS r.t. (min): 1.86.sup.2B
Intermediate 7:
N,N′-((9S,19S)-14-(6-aminohexanoyl)-1-mercapto-9-(3-mercaptopropanamido)-3,10,18-trioxo-4,11,14,17-tetraazatricosane-19,23-diyl)bis(3-mercaptopropanamide) formate
[0353] Scaffold 2 (102 mg, 0.100 mmol) was dissolved in methanol (1.00 ml). Next, a freshly prepared 1 N Sodium hydroxide solution (0.440 ml, 0.440 mmol) was added and the reaction mixture was stirred at room temperature. After 30 min a 1.0 M trimethylphosphine solution in THF (0.500 ml, 0.500 mmol) was added and the resulting mixture was stirred at room temperature. After 30 min the reaction mixture was evaporated in vacuo and co-evaporated with methanol (2×10 mL). The residue was dissolved in a mixture of methanol/water (9:1, v/v, 1.00 mL) and the resulting solution was subjected to preparative MP-LC..sup.2 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (75.6 mg, 87%) as a colorless sticky oil. Purity based on LC-MS 96%.
[0354] LRMS (m/z): 513 [M+2].sup.2+, 825 [M+1].sup.1+
[0355] LC-MS r.t. (min): 1.42.sup.2A
Intermediate 8:
Dendron(-L-SO1861).SUP.4.-Amine
[0356] N,N′-((9S,19S)-14-(6-aminohexanoyl)-1-mercapto-9-(3-mercaptopropanamido)-3,10,18-trioxo-4,11,14,17-tetraazatricosane-19,23-diyl)bis(3-mercaptopropanamide) formate (2.73 mg, 3.13 μmol) was dissolved in a mixture of 20 mM NH.sub.4HCO.sub.3 with 0.5 mM TCEP/acetonitrile (3:1, v/v, 3.00 mL). Next, SO1861-EMCH (29.2 mg, 0.014 mmol) was added and the reaction mixture was stirred at room temperature. After 1.5 hours the reaction mixture was subjected to preparative LC-MS..sup.3B Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (12.3 mg, 43%) as a white fluffy solid. Purity based on LC-MS 97%.
[0357] LRMS (m/z): 1517 [M−6].sup.6−, 1821 [M−5].sup.5−, 2276 [M−4].sup.4−
[0358] LC-MS r.t. (min): 4.39.sup.5A
Intermediate 9:
Dendron(-L-SO1861).SUP.4.-Azide
[0359] Dendron(SO1861).sub.4-amine (6.81 mg, 0.748 μmol) and 2,5-dioxopyrrolidin-1-yl 1-azido-3,6,9,12-tetraoxapentadecan-15-oate (2.90 mg, 7.48 μmol) were dissolved in DMF (1.00 mL). Next, DIPEA (1.302 μL, 7.48 μmol) was added and the mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative LC-MS..sup.3C Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (5.86 mg, 84%) as a white fluffy solid. Purity based on LC-MS 90%.
[0360] LRMS (m/z): 2344 [M−4].sup.4−
[0361] LC-MS r.t. (min): 4.78.sup.5B
Intermediate 10:
Dendron(-L-SO1861).SUP.4.-Maleimide1
[0362] Dendron(SO1861).sub.4-amine (8.12 mg, 0.891 μmol) and 2,5-dioxopyrrolidin-1-yl 1-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)-3,6,9,12-tetraoxapentadecan-15-oate (3.94 mg, 8.91 μmol) were dissolved in DMF (1.00 mL). Next, DIPEA (1.55 μL, 8.91 μmol) was added and the mixture was shaken for 1 min and left standing at room temperature. After 3 hours the reaction mixture was subjected to preparative LC-MS..sup.3C Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (6.76 mg, 80%) as a white fluffy solid. Purity based on LC-MS 66%.
[0363] LRMS (m/z): 2358 [M−4].sup.4−
[0364] LC-MS r.t. (min): 2.13.sup.6C
Intermediate 11:
Dendron(-L-SO1861).SUP.4.-Maleimide2
[0365] Scaffold 2 (5.10 mg, 5.00 μmol) was dissolved in methanol (100 μL). Next, a freshly prepared 1 N Sodium hydroxide solution (22.0 μL, 22.0 μmol) was added and the mixture was shaken for 1 min and left standing at room temperature. After 30 min a 1.0 M trimethylphosphine solution in THF (25.0 μL, 25.0 μmol) was added and the resulting mixture was shaken for 1 min and left standing at room temperature. After 30 min the reaction mixture was evaporated in vacuo and co-evaporated with methanol (2×5 mL). The resulting residue was dissolved in a mixture of 20 mM NH.sub.4HCO.sub.3 with 0.5 mM TCEP/acetonitrile (3:1, v/v, 3.242 mL). From this solution, directly, 1000 μL was added to SO1861-EMCH (14.4 mg, 6.94 μmol, 4.5 equiv. compared to the scaffold) and the mixture was shaken for 1 min and left standing at room temperature. After 10 min the reaction mixture was lyophilized overnight. To the resulting residue 2,5-Dioxopyrrolidin-1-yl 3-(2-(2-(3-(2,5-dioxo-2 h-pyrrol-1(5 h)-yl)propanamido)ethoxy)ethoxy)propanoate (5.84 mg, 0.014 mmol) and DMF (1.00 mL) were added. Next, DIPEA (2.39 μL, 0.014 mmol) was added and the suspension was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative LC-MS..sup.3C Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (10.9 mg, 85%) as a white fluffy solid. Purity based on LC-MS 80%.
[0366] LRMS (m/z): 2354 [M−4].sup.4−
[0367] LC-MS r.t. (min): 4.16.sup.5B
Dendron(-L-SO1861).SUP.8 .Synthesis (FIG. 15)
Intermediate 1:
tert-butyl N-[(1S)-1-{[(1S)-1-{[2-(6-azido-N-{2-[(2S)-2,6-bis[(2S)-2,6-bis({[(tert-butoxy)carbonyl]amino})hexanamido]hexanamido]ethyl}hexanamido)ethyl]carbamoyl}-5-[(2S)-2,6-bis({[(tert-butoxy)carbonyl]amino})hexanamido]pentyl]carbamoyl}-5-{[(tert-butoxy)carbonyl]amino}pentyl]carbamate
[0368] (S)-2,6-diamino-N-(2-(6-azido-N-(2-((S)-2,6-diaminohexanamido)ethyl)hexanamido)ethyl)hexanamide tetrahydrochloride (964 mg, 1.50 mmol) was dissolved in DMF (25.0 mL) and triethylamine (2.08 mL, 15.0 mmol). Next, Boc-Lys(Boc)-ONp (3.36 g, 7.18 mmol) was added and the reaction mixture was stirred at room temperature overnight. The reaction mixture was evaporated in vacuo and the residue was purified by flash chromatography (DCM-methanol/DCM (1/9, v/v) gradient 100-0 rising to 0:100) to give the title product (2.71 g, 100%) as a white solid. Purity based on LC-MS 97%.
[0369] LRMS (m/z): 807 [M−198].sup.2+
[0370] LC-MS r.t. (min): 20.35.sup.2B
Intermediate 2:
(2S,2′S)—N,N′-((5S,15S,22S)-22,26-diamino-10-(6-azidohexanoyl)-15-((S)-2,6-diaminohexanamido)-6,14,21-trioxo-7,10,13,20-tetraazahexacosane-1,5-diyl)bis(2,6-diaminohexanamide) octahydrochloride
[0371] Intermediate 1 (2.71 g, 1.50 mmol) was dissolved in HCl in isopropanol (5-6N, 25.0 ml, 138 mmol) and the reaction mixture was stirred at room temperature overnight. Next, the reaction mixture was evaporated in vacuo and the resulting crude product was co-evaporated with DCM (3×20 mL) to give the crude title product as a white solid.
[0372] LRMS (m/z): 203/254 [M−200/M+4].sup.4+, 338 [M+3].sup.3+, 507 [M+2].sup.2+, 1012 [M+1].sup.1+
Intermediate 3:
(2S)-2,6-bis[3-(acetylsulfanyl)propanamido]-N-[(1S)-1-{[2-(6-azido-N-{2-[(2S)-2,6-bis[(2S)-2,6-bis[3-(acetylsulfany)propanamido]hexanamido]hexanamido]ethyl}hexanamido)ethyl]carbamoyl}-5-[(2S)-2,6-bis[3-(acetylsulfanyl)propanamido]hexanamido]pentyl]hexanamide
[0373] To (2S,2′S)—N,N′-((5S,15S,22S)-22,26-diamino-10-(6-azidohexanoyl)-15-((S)-2,6-diaminohexanamido)-6,14,21-trioxo-7,10,13,20-tetraazahexacosane-1,5-diyl)bis(2,6-diaminohexanamide) octahydrochloride (300 mg, 0.230 mmol) was added DMF (20.0 mL), triethylamine (320 μl, 2.30 mmol) and 4-nitrophenyl 3-(acetylthio)propanoate (595 mg, 2.21 mmol). The resulting suspension was sonicated at 60° C. for 30 min and left stirring at room temperature overnight. The reaction mixture was evaporated in vacuo and the residue was purified by first performing flash chromatography (DCM-methanol/DCM (1/9, v/v) gradient 100:0 rising to 0:100), followed by preparative MP-LC.sup.2 to give the title product (70 mg, 15%) as a white solid. Purity based on LC-MS 100%.
[0374] LRMS (m/z): 685 [M+3].sup.3+
[0375] LC-MS r.t. (min): 1.91.sup.2A
Intermediate 4:
(2S)—N-[(1S)-1-{[2-(6-amino-N-{2-[(2S)-2,6-bis[(2S)-2,6-bis(3-sulfanylpropanamido)hexanamido]hexanamido]ethyl}hexanamido)ethyl]carbamoyl}-5-[(2S)-2,6-bis(3-sulfanylpropanamido)hexanamido]pentyl]-2,6-bis(3-sulfanylpropanamido)hexanamide formats
[0376] Scaffold 4 (10.0 mg, 4.87 μmol) was dissolved methanol (200 μL). Next, a freshly prepared 1 N Sodium hydroxide solution (42.9 μL, 0.043 mmol) was added and the resulting mixture was shaken for 1 min and left standing at room temperature. After 30 min a 1.0 M trimethylphosphine solution in THF (24.4 μL, 0.024 mmol) was added and the resulting mixture was shaken for 1 min and left standing at room temperature. After 30 min the reaction mixture was diluted with water (1 mL) and directly subjected to preparative MP-LC..sup.2 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (4.02 mg, 48%) as a white fluffy solid.
[0377] LRMS (m/z): 564 [M+3].sup.3+, 846 [M+2].sup.2.
[0378] LC-MS r.t. (min): 1.54.sup.2C
Intermediate 5:
Dendron(-L-SO1861).SUP.8.-Amine
[0379] Scaffold 5 (0.52 mg, 0.299 μmol) and SO1861-EMCH (29.2 mg, 0.014 mmol) were dissolved in a mixture of 20 mM NH.sub.4HCO.sub.3 with 0.5 mM TCEP/acetonitrile (3:1, v/v, 1.00 mL) and the resulting mixture was shaken for 1 min and left standing at room temperature. After 30 min TCEP (0.30 mg, 1.05 μmol) was added and the reaction mixture was shaken for 1 min. Next, the mixture was directly subjected to preparative LC-MS..sup.3 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (2.17 mg, 40%) as a white fluffy solid. Purity based on LC-MS 97%.
[0380] LRMS (m/z): 2282 [M−8]&, 2607 [M−7].sup.7−
[0381] LC-MS r.t. (min): 4.41.sup.5A
Example 6
SO1861-Trifunctional Linker-BNAoligo Synthesis (FIG. 16)
Materials and Methods
Trifunctional Linker
[0382] Trifunctional linker (DBCO, TCO, maleimide) was ordered at Bio-Synthesis Inc. (Lewisville, Tex.).
HSP27BNA Oligo
[0383] HSP27BNA(-thiol) oligos (sequence 5′-GGCacagccagtgGCG-3′) (Zhang et al., 2011) were purchased at Bio-synthesis Inc. (Lewisville, Tex.)
Intermediate 1:
SO1861-Azide
[0384] To SO1861 60 mg, 0.032 mmol)) and 1-azido-3,6,9,12-tetraoxapentadecane-15-hydrazide (39.3 mg, 0.129 mmol) was added methanol (extra dry, 1.00 mL) and TFA (9.86 μl, 0.129 mmol) and the reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative MP-LC..sup.1 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (58.4 mg, 84%) as a white fluffy solid. Purity based on LC-MS 100%.
[0385] LRMS (m/z): 2150 [M−1].sup.1−
[0386] LC-MS r.t. (min): 1.10.sup.3B
Intermediate 2:
SO1861-Trifunctional Linker
[0387] SO1861-azide (45 mg, 0.021 mmol) and trifunctional linker (26.5 mg, 0.022 mmol) were dissolved in DMF (2.50 mL) and the resulting mixture was shaken for 1 min and left standing at room temperature. After 30 min the reaction mixture was subjected to preparative LC-MS..sup.3C Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (58.4 mg, 84%) as a white fluffy solid. Purity based on LC-MS 89%.
[0388] LRMS (m/z): 1677 [M−2].sup.2−
[0389] LC-MS r.t. (min): 2.54.sup.6A
Intermediate 3:
(E)-1-(4-((2-(6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl)hydrazineylidene)methyl)benzamido)-N-(4-(6-methyl-1,2,4,5-tetrazin-3-yl)benzyl)-3,6,9,12-tetraoxapentadecan-15-amide
[0390] To 1-(4-formylbenzamido)-N-(4-(6-methyl-1,2,4,5-tetrazin-3-yl)benzyl)-3,6,9,12-tetraoxapentadecan-15-amide (28.0 mg, 0.048 mmol) and EMCH.TFA (24.5 mg, 0.072 mmol) was added methanol (extra dry, 2.00 mL) and TFA (11.1 μL, 0.145 mmol) and the reaction mixture stirred at 50° C. After 30 min the reaction mixture was evaporated in vacuo and the resulting residue was purified by MP-LC..sup.1 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (33.4 mg, 88%) as a bright purple fluffy solid. Purity based on LC-MS 92%.
[0391] LRMS (m/z): 394 [M+2].sup.2+, 789 [M+1].sup.1−
[0392] LC-MS r.t. (min): 1.28.sup.7A
Intermediate 4:
[0393] Methyltetrazine-BNA oligo
[0394] To HSP27 BNA oligo disulfide (70.0 mg, 0.012 mmol) was dissolved in 20 mM NH.sub.4HCO.sub.3 (20.0 mL). Next, TCEP (14.3 mg, 0.050 mmol) was added and the reaction mixture was shaken for 1 min and left standing at room temperature. The reaction mixture was filtered by using a centrifugal filter with a molecular weight cut-off of 3000 Da (5000×g for 30 min). Next, a solution of 20 mM NH.sub.4HCO.sub.3 with 2.5 mM TCEP (20.0 mL) was added to the residue solution and the resulting mixture was filtered again under the same conditions described above. The residue solution was diluted with 20 mM NH.sub.4HCO.sub.3 (30.0 mL) and the resulting mixture was added to a solution of (E)-1-(4-((2-(6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl)hydrazineylidene)methyl)benzamido)-N-(4-(6-methyl-1,2,4,5-tetrazin-3-yl)benzyl)-3,6,9,12-tetraoxapentadecan-15-amide (14.8 mg, 18.8 μmol) in acetonitrile (10.0 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 30 min the reaction mixture was frozen and lyophilized over the weekend to yield the crude title product as a pink fluffy solid. To the crude product was added a solution of 20 mM NH.sub.4HCO.sub.3 (20.0 mL) and the resulting suspension was filtered over a 0.45 μm syringe filter. The filtrate was filtered using a centrifugal filter with the same conditions as described above. Next, again a solution of 20 mM NH.sub.4HCO.sub.3 (20.0 mL) was added to the residue solution and the resulting mixture was again filtered by using a centrifugal filter with the same conditions described above. The residue solution was diluted with 20 mM NH.sub.4HCO.sub.3 (20.0 mL) and the resulting mixture was lyophilized overnight to yield the title product (90.0 mg, 115%) as a pink fluffy solid. Purity based on LC-MS 91%.
[0395] LRMS (m/z): 1631 [M−4].sup.4−, 2174 [M−3].sup.3−
[0396] LC-MS r.t. (min): 0.73.sup.7B
Intermediate 5:
SO1861-Trifunctional Linker-BNA Oligo
[0397] Methyltetrazine-BNA oligo (90.0 mg, 0.014 mmol) and SO1861-trifunctional linker (48.6 mg, 0.014 mmol) were dissolved in a mixture of water/acetonitrile (4:1, v/v, 12.0 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 15 min the mixture was subjected to preparative LC-MS..sup.4A Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (82.0 mg, 60%) as a white fluffy solid. Purity based on LC-MS 92% (2 peaks with both m/z values corresponding to the title compound).
[0398] LRMS (m/z): 1641 [M−6].sup.6−, 1970 [M−5].sup.5−
[0399] LC-MS r.t. (min): 3.24 and 3.40.sup.6B
Intermediate 1:
SO1861-Azide
[0400] To SO1861 60 mg, 0.032 mmol)) and 1-azido-3,6,9,12-tetraoxapentadecane-15-hydrazide (39.3 mg, 0.129 mmol) was added methanol (extra dry, 1.00 mL) and TFA (9.86 μl, 0.129 mmol) and the reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative MP-LC..sup.1 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (58.4 mg, 84%) as a white fluffy solid. Purity based on LC-MS 100%.
[0401] LRMS (m/z): 2150 [M−1].sup.1−
[0402] LC-MS r.t. (min): 1.10.sup.3B
Intermediate 2:
SO1861-Trifunctional Linker
[0403] SO1861-azide (45 mg, 0.021 mmol) and trifunctional linker (26.5 mg, 0.022 mmol) were dissolved in DMF (2.50 mL) and the resulting mixture was shaken for 1 min and left standing at room temperature. After 30 min the reaction mixture was subjected to preparative LC-MS..sup.3C Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (58.4 mg, 84%) as a white fluffy solid. Purity based on LC-MS 89%.
[0404] LRMS (m/z): 1677 [M−2].sup.2−
[0405] LC-MS r.t. (min): 2.54.sup.6A
Intermediate 3:
(E)-1-(4-((2-(6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl)hydrazinylidene)methyl)benzamido)-N-(4-(6-methyl-1,2,4,5-tetrazin-3-yl)benzyl)-3,6,9,12-tetraoxapentadecan-15-amide
[0406] To 1-(4-formylbenzamido)-N-(4-(6-methyl-1,2,4,5-tetrazin-3-yl)benzyl)-3,6,9,12-tetraoxapentadecan-15-amide (28.0 mg, 0.048 mmol) and EMCH.TFA (24.5 mg, 0.072 mmol) was added methanol (extra dry, 2.00 mL) and TFA (11.1 μL, 0.145 mmol) and the reaction mixture stirred at 50° C. After 30 min the reaction mixture was evaporated in vacuo and the resulting residue was purified by MP-LC..sup.1 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (33.4 mg, 88%) as a bright purple fluffy solid. Purity based on LC-MS 92%.
[0407] LRMS (m/z): 394 [M+2].sup.2+, 789 [M+1].sup.1+
[0408] LC-MS r.t. (min): 1.28.sup.7A
Intermediate 4:
Methyltetrazine-BNA Oligo
[0409] To HSP27 BNA oligo disulfide (70.0 mg, 0.012 mmol) was dissolved in 20 mM NH.sub.4HCO.sub.3 (20.0 mL). Next, TCEP (14.3 mg, 0.050 mmol) was added and the reaction mixture was shaken for 1 min and left standing at room temperature. The reaction mixture was filtered by using a centrifugal filter with a molecular weight cut-off of 3000 Da (5000×g for 30 min). Next, a solution of 20 mM NH.sub.4HCO.sub.3 with 2.5 mM TCEP (20.0 mL) was added to the residue solution and the resulting mixture was filtered again under the same conditions described above. The residue solution was diluted with 20 mM NH.sub.4HCO.sub.3 (30.0 mL) and the resulting mixture was added to a solution of (E)-1-(4-((2-(6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl)hydrazineylidene)methyl)benzamido)-N-(4-(6-methyl-1,2,4,5-tetrazin-3-yl)benzyl)-3,6,9,12-tetraoxapentadecan-15-amide (14.8 mg, 18.8 μmol) in acetonitrile (10.0 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 30 min the reaction mixture was frozen and lyophilized over the weekend to yield the crude title product as a pink fluffy solid. To the crude product was added a solution of 20 mM NH.sub.4HCO.sub.3 (20.0 mL) and the resulting suspension was filtered over a 0.45 μm syringe filter. The filtrate was filtered using a centrifugal filter with the same conditions as described above. Next, again a solution of 20 mM NH.sub.4HCO.sub.3 (20.0 mL) was added to the residue solution and the resulting mixture was again filtered by using a centrifugal filter with the same conditions described above. The residue solution was diluted with 20 mM NH.sub.4HCO.sub.3 (20.0 mL) and the resulting mixture was lyophilized overnight to yield the title product (90.0 mg, 115%) as a pink fluffy solid. Purity based on LC-MS 91%.
[0410] LRMS (m/z): 1631 [M−4].sup.4−, 2174 [M−3].sup.3−
[0411] LC-MS r.t. (min): 0.73.sup.7B
Intermediate 5:
SO1861-Trifunctional Linker-BNA Oligo
[0412] Methyltetrazine-BNA oligo (90.0 mg, 0.014 mmol) and SO1861-trifunctional linker (48.6 mg, 0.014 mmol) were dissolved in a mixture of water/acetonitrile (4:1, v/v, 12.0 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 15 min the mixture was subjected to preparative LC-MS..sup.4A Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (82.0 mg, 60%) as a white fluffy solid. Purity based on LC-MS 92% (2 peaks with both m/z values corresponding to the title compound).
[0413] LRMS (m/z): 1641 [M−6].sup.6−, 1970 [M−5].sup.5−
[0414] LC-MS r.t. (min): 3.24 and 3.40.sup.6B
Example 7
SO1861-BNA Oligo Conjugation
[0415] HSP27 BNA oligo disulfide (1.10 mg, 0.187 μmol) was dissolved in 20 mM NH.sub.4HCO.sub.3 with 1.0 mM TCEP (500 μL) and the mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was filtered by using a centrifugal filter with a molecular weight cut-off of 3000 Da (14000×g for 30 min). The residue solution was diluted with 20 mM NH.sub.4HCO.sub.3 with 1.0 mM TCEP (500 μL) and the resulting mixture was filtered again under the same conditions described above. The residue solution was diluted with 20 mM NH.sub.4HCO.sub.3/acetonitrile (3:1, v/v, 1.00 mL) and the resulting mixture was added to SO1861-EMCH (3.54 mg, 0.375 μmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 10 min the reaction mixture was subjected to preparative LC-MS..sup.4A Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (1.25 mg, 85%) as a white fluffy solid. Purity based on LC-MS 100%.
[0416] LRMS (m/z): 1561 [M−5].sup.5−, 1951 [M−4].sup.4−
[0417] LC-MS r.t. (min): 2.46.sup.6B
Dendron(SO1861).SUP.4.-BNA Oligo Conjugation (FIG. 17)
[0418] HSP27 BNA oligo disulfide (1.1 mg, 0.187 μmol) was dissolved in 20 mM NH.sub.4HCO.sub.3 with 1.0 mM TCEP (500 μL) and the mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was filtered by using a centrifugal filter with a molecular weight cut-off of 3000 Da (14000×g for 30 min). The residue solution was diluted with 20 mM NH.sub.4HCO.sub.3 with 1.0 mM TCEP (500 μL) and the resulting mixture was filtered again under the same conditions described above. The residue solution was diluted with 20 mM NH.sub.4HCO.sub.3/acetonitrile (3:1, v/v, 1.0 mL) and the resulting mixture was added to dendron(SO1861).sub.4-maleimide1 (3.54 mg, 0.375 μmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 10 min the reaction mixture was subjected to preparative LC-MS..sup.4A Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (1.25 mg, 85%) as a white fluffy solid. Purity based on LC-MS 94%
[0419] LRMS (m/z): 1896 [M−8].sup.8−, 2167 [M−7].sup.7−
[0420] LC-MS r.t. (min): 3.77.sup.6B
Dendron(NEM).SUP.4 .Synthesis (FIG. 18)
[0421] To benzyl bis(2-((S)-2,6-bis(3-mercaptopropanamido)hexanamido)ethyl)carbamate (1.69 mg, 2.00 μmol) and N-Ethylmaleimide (1.05 mg, 8.40 μmol) was added a mixture of 20 mM NH.sub.4HCO.sub.3/acetonitrile (3:1, v/v, 2.00 mL) and the reaction mixture was stirred at room temperature. After 2 hours, the reaction mixture was lyophilized overnight. The resulting residue was purified by using preparative LC-MS.sup.3A to give the title compound (1.53 mg, 57%) as a white fluffy solid. Purity based on LC-MS 98%.
[0422] LRMS (m/z): 1346 [M+1].sup.1+
[0423] LC-MS r.t. (min): 1.43.sup.3A
Example 8
A431 Mouse Tumor Mouse Model and Vitro and Vivo Gene Silencing Studies
Materials and Methods
[0424] HSP27BNA with linkers oligos (sequence 5′-GGCacagccagtgGCG-3′) (Zhang et al., 2011) were purchased at Bio-Synthesis Inc. (Lewisville, Tex.)
Vitro RNA Isolation and Gene Expression Analyses
[0425] RNA from cells was isolated and analysed according to standard protocols (Biorad)
Vivo Mouse Tumor Model
[0426] The mouse study was performed at CrownBio (China) according to standard protocols and procedures. Model: Subcutaneous A431 Human Epidermoid Carcinoma Xenograft Model in female BALB/c nude Mice. Tumor volume was monitored and tumor samples were collected for gene silencing analysis (see below)
RNA Isolation and Gene Expression Analyses of Tumor Samples from Mice
[0427] Total RNA was isolated from tumors using TriZol (Thermo Fisher) according to the manufacturer's instructions. Isolated RNA was resuspended in nuclease-free water (NFW). RNA samples were checked for their RNA integrity on the gel. To prepare cDNA, first 100 ng total RNA was mixed with Random Hexamers (Qiagen; final concentration 2 μM) in a final volume of 12.5 μl in NFW, denatured for 5 min at 70° C. and immediately cooled on ice. Next, 7.5 μl of a cDNA synthesis mix was added, consisting of 4 μl 5×RT Buffer (Promega), 0.4 μl 25 mM dNTPs (Promega), 1 μl 200 U/μL MMLV RT-enzyme (Promega), 0.5 μL 40 U/μL RNAse Inhibitor (Promega) and 1.6 μL NFW. The following cDNA synthesis protocol was used: 1) 10 minutes 25° C. 2) 60 minutes 37° C. 3) 5 minutes 85° C. 4)∞4° C.
[0428] For a single qPCR reaction the following mix was prepared: 1 μL cDNA, 0.05 μL forward primer (250 μM), 0.05 μL reverse primer (250 μM), 8.9 μl NFW, 10 μl SYBR Green (Bio-Rad). The following qPCR protocol was used: 1 cycle: 5 minutes 95° C., 40 cycles: 15 s 95° C.+30 s 60° C.
[0429] HSP27 gene expression was calculated using 2.sup.−(Ct.sub.HSP27.sup.−GEOMEAN(Ct.sub.ref1.sup.;Ct.sub.ref2.sup.;Ct.sub.ref3.sup.;Ct.sub.ref4.sup.)), where ref1, ref2, ref3 and ref4 are the reference genes IMMT, EIF2S2, GUSB and UBC for the analysis of the tumors. Four reference genes were chosen based on the performance of a GeNORM analysis among nine reference genes tested to choose the most ideal and stable reference gene for this tumor samples. To do so, qPCR results were imported in Qbase+ software program by which two quality measures are calculated: the coefficient of variation of the normalized reference gene expression levels (V); and the geNorm stability M-value (M)1. A reference gene with an M<0.2 and a V<0.15 is considered very stable. Based on this analysis IMMT and EIF2S2 were chosen as the most stable reference genes. However, UBC and GUSB were also added to the group of reference genes to further enhance the accuracy of the normalization. Each sample was analyzed as technical triplicate on a CFX96 Real-Time qPCR machine (Bio-Rad).
TABLE-US-00007 TABLE 1 Primers used in qPCR are shown below: Gene Primer Sequence (5′-3′) UBC Forward CAGCCGGGATTTGGGTCG Reverse CACGAAGATCTGCATTGTCAAGT GUSB Forward TGCGTAGGGACAAGAACCAC Reverse GGGAGGGGTCCAAGGATTTG IMMT Forward AACCCACACCTGCACTTTCA Reverse TTTTCCTGTTGTGCAAGGCG EIF2S2 Forward CCACAAGTCGTCCGAGTAGG Reverse GGAGATGTTTGGGCTGACGA HSP27 Forward GCAGTCCAACGAGATCACCA Reverse TAAGGCTTTACTTGGCGGCA
Example 9
Conjugate Synthesis
Monoclonal Antibodies, SO1861, QS Saponins
[0430] Trastuzumab (Herceptin®), cetuximab (Erbitux®) and T-DM1 (Kadcyla®) were purchased from the pharmacy (Charite, Berlin). CD71 monoclonal antibody was purchased from BioCell (Okt9, #BE0023). SO1861 was isolated and purified by Analyticon Discovery GmbH from raw plant extract obtained from Saponaria officinalis L. Quillaja Saponaria saponin extract (QSmix) was purchased (Sigma Aldrich, #S4521)
Materials
[0431] Trastuzumab (Tras, Herceptin®, Roche), Cetuximab (Cet, Erbitux®, Merck KGaA), Tris(2-carboxyethyl)phosphine hydrochloride (TCEP, 98%, Sigma-Aldrich), 5,5-Dithiobis(2-nitrobenzoic acid) (DTNB, Ellman's reagent, 99%, Sigma-Aldrich), Zeba™ Spin Desalting Columns (2 mL, Thermo-Fisher), NuPAGE™ 4-12% Bis-Tris Protein Gels (Thermo-Fisher), NuPAGE™ MES SDS Running Buffer (Thermo-Fisher), Novex™ Sharp Pre-stained Protein Standard (Thermo-Fisher), PageBlue™ Protein Staining Solution (Thermo-Fischer), Pierce™ BCA Protein Assay Kit (Thermo-Fisher), N-Ethylmaleimide (NEM, 98%, Sigma-Aldrich), 1,4-Dithiothreitol (DTT, 98%, Sigma-Aldrich), Sephadex G25 (GE Healthcare), Sephadex G50 M (GE Healthcare), Superdex 200P (GE Healthcare), Isopropyl alcohol (IPA, 99.6%, VWR), Tris(hydroxymethyl)aminomethane (Tris, 99%, Sigma-Aldrich), Tris(hydroxymethyl)aminomethane hydrochloride (Tris.HCL, Sigma-Aldrich), L-Histidine (99%, Sigma-Aldrich), D-(+)-Trehalose dehydrate (99%, Sigma-Aldrich), Polyethylene glycol sorbitan monolaurate (TWEEN 20, Sigma-Aldrich), Dulbecco's Phosphate-Buffered Saline (DPBS, Thermo-Fisher), Guanidine hydrochloride (99%, Sigma-Aldrich), Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA-Na.sub.2, 99%, Sigma-Aldrich), sterile filters 0.2 μm and 0.45 μm (Sartorius), Succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC, Thermo-Fisher), Dianthin-Cys (Dia-Cys, Dianthin mutant with a single C-terminal cysteine function, Proteogenix), Vivaspin T4 and T15 concentrator (Sartorius), Superdex 200PG (GE Healthcare), Tetra(ethylene glycol) succinimidyl 3-(2-pyridyldithio)propionate (PEG.sub.4-SPDP, Thermo-Fisher), HSP27 BNA disulfide oligonucleotide (Biosynthesis), [O-(7-Azabenzotriazol-1-yl)-N,N,N,N-tetramethyluronium-hexafluorphosphat] (HATU, 97%, Sigma-Aldrich), Dimethyl sulfoxide (DMSO, 99%, Sigma-Aldrich), N-(2-Aminoethyl)maleimide trifluoroacetate salt (AEM, 98%, Sigma-Aldrich), L-Cysteine (98.5%, Sigma-Aldrich), deionized water (DI) was freshly taken from Ultrapure Lab Water Systems (MilliQ, Merck), Nickel-nitrilotriacetic acid agarose (Ni-NTA agarose, Protino), Glycine (99.5%, VWR), 5,5-Dithiobis(2-nitrobenzoic acid (Ellman's reagent, DTNB, 98%, Sigma-Aldrich), S-Acetylmercaptosuccinic anhydride Fluorescein (SAMSA reagent, Invitrogen) Sodium bicarbonate (99.7%, Sigma-Aldrich), Sodium carbonate (99.9%, Sigma-Aldrich), PD MiniTrap desalting columns with Sephadex G-25 resin (GE Healthcare), PD10 G25 desalting column (GE Healthcare), Zeba Spin Desalting Columns in 0.5, 2, 5, and 10 mL (Thermo-Fisher), Vivaspin Centrifugal Filters T4 10 kDa MWCO, T4 100 kDa MWCO, and T15 (Sartorius), Biosep s3000 aSEC column (Phenomenex), Vivacell Ultrafiltration Units 10 and 30 kDa MWCO (Sartorius), Nalgene Rapid-Flow filter (Thermo-Fisher),
Methods
MALDI-TOF-MS
[0432] Matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) spectra were recorded on a MALDI-Mass Spectrometer (Bruker Ultrafex III). Typically, the sample dissolved in MilliQ water in nanomole to micromole range was spotted on the target (MTP 384 target plate polished steel T F, Bruker Daltons) using either super-DHB (99%, Fluka) or sinapinic acid (SA, 99%, Sigma-Aldrich) as the matrix that was dissolved in acetonitrile (MADLI-TOF-MS tested, Sigma)/0.1% TFA (7:3 v/v) via the dried-droplet-method. PepMix (Peptide Calibration Standard, Bruker Daltons) or ProteoMass (Protein Calibration Standard, Sigma-Aldrich) served as calibration standards. RP mode refers to reflector positive mode. RN mode refers to reflector negative mode. LP mode refers to linear positive mode.
Dialysis
[0433] Regenerated cellulose membranes: MWCO=1 and 2 kDa (Spectra/Por), and MWCO=12-14 kDa (Carl Roth) were used to perform dialysis. Typically, dialysis was carried out for 24 h with 1 L of solvent that was exchanged after first 6 h of the process.
Lyophilization
[0434] Freeze-drying was performed on an Alpha 1-2 LD plus (Martin Christ Gefriertrocknungsanlagen GmbH). Typically, samples were frozen with liquid nitrogen and placed into the freeze-dryer at high vacuum.
UV-Vis
[0435] Absorbance measurements were performed on a Perkin Elmer Lambda 25 UV-Vis or on a Thermo NanoDrop ND-2000 spectrophotometer in the spectral range of 200-750 nm.
[0436] Concentrations were determined using a Thermo Nanodrop 2000 or Lambda 25 spectrometer using the following parameters:
Trastuzumab OD.sub.280=1.5 (mg/ml).sup.−1 cm.sup.−1
Cetuximab OD.sub.280=1.4 (mg/ml).sup.−1 cm.sup.−1
HSP27 Oligonucleotide OD.sub.260=153,000 M.sup.−1 cm.sup.−1; Rz.sub.260:280=1.819
Dia-Cys OD.sub.280=0.57 (mg/ml).sup.−1 cm.sup.−1
PEG.sub.4-SPDP (PDT) OD.sub.343=8,080 M.sup.−1 cm.sup.−1
SAMSA-Fluorescein OD.sub.495=64,500 M.sup.−1 cm.sup.−1; Rz.sub.280:495=0.232
Ellmans (TNB) OD.sub.412=14,150 M.sup.−1 cm.sup.−1
Immobilized Metal Ion Affinity Chromatography (IMCA)
[0437] Nickel-nitrilotriacetic acid (Ni-NTA) chromatography was performed to purify histidine-tagged protein and protein-conjugates. Briefly, Ni-NTA agarose (10 mL) was pipetted into a gravity flow column for 5 mL bed volume. The resin was washed with 20 mL deionized water and recharged with 5 mL of 100 mM NiSO4 solution. The resin was washed again five times with 5 mL deionized water and equilibrated five times with DPBS. The protein solution was incubated with the washed Ni-NTA agarose rotating at 4° C. for 30 min. Afterwards, the Ni-NTA protein solution was pipetted back into the gravity flow column. The flow through was collected and the resin was washed three times with 5 mL DPBS. The immobilized sample was then eluted by increasing the imidazole concentration from 50 mL of 125 mM, pH 8 to 50 mL of 250 mM, pH 8. Elution fractions were dialyzed against PBS pH 7.4 to obtain the purified sample.
Size Exclusion Chromatography
[0438] Size exclusion chromatography (SEC) was carried out on an AKTA purifier. Samples were analyzed by SEC using either a Biosep SEC-S3000 column or an Sephadex G50M column (10×40 cm) eluting with TBS/isopropyl alcohol solution (85:15 v/v). Sample purities were determined by integration of the antibody sample peak with respect to the trace aggregate peaks.
Ellman's Assay
[0439] Ellman's test (or Ellman's assay) was carried out to quantitatively determine thiol concentration in a sample via spectrophotometry. Presence of thiols was indicated via the stoichiometric release of the 2-nitro-5-thiobenzoate (TNB) from Ellman's reagent in the presence of thiols. TNB obtains an absorption maximum at 412 nm and an extinction coefficient of OD.sub.412=14,150 M.sup.−1 cm.sup.−1 in buffered systems. Briefly, 2 μL of a 0.5 mg/mL solution of the Ellman's reagent (5,5-Dithiobis(2-nitrobenzoic acid), DTNB) in phosphate buffer (0.1 M, 1 mM EDTA, pH 7.4) was mixed with 20 μL of a thiol containing sample in buffer. The mixture was vortexed for 5 sec. Then, UV-Vis absorbance at 412 nm was measured on a Thermo Nanodrop 2000 to determine TNB concentration and thus thiol content of the sample.
Dianthin Production
[0440] Dianthin was expressed in a bacterium culture and the protein was purified following conventional cell culturing and protein purification steps known in the art.
Production of Saporin Conjugates
[0441] Custom trastuzumab-saporin cetuximab-saporin, CD71 mab-saporin conjugates were produced and purchased from Advanced Targeting Systems (San Diego, Calif.). IgG-saporin and saporin was purchased from Advanced Targeting Systems
Antibody-(Cys-Dendron-(L-SO1861).sup.n).sup.n Synthesis
[0442] Trastuzumab and Cetuximab are referred hereafter as “Ab”. Ab was conjugated to dendritic saponin [dendron-(L-SO1861).sub.4-maleimide] via a tetra(ethylene glycol) succinimidyl 3-(2-pyridyldithio)propionate (PEG.sub.4-SPDP) linker conducting a thiole-ene Michael-type reaction between Ab and dendritic saponin. The procedure is exemplary described for Cetuximab-(S-dendron-(L-SO1861).sub.4).sub.4:
[0443] Cetuximab was desalted into DPBS pH 7.5 buffer and then normalized to 2.50 mg/ml. To an aliquot of Ab (9.19 mg, 61 nmol) was added an aliquot of freshly prepared PEG.sub.4-SPDP solution (5.0 mg/ml, 6.70 mole equivalents, 411 nmol), the mixture vortexed briefly then incubated for 60 minutes at 20° C. with roller-mixing. After incubation, the reaction was quenched with the addition of glycine (20 mg/ml, 7.7 μl), then the SPDP moiety reduced in situ by the addition of TCEP (5.0 mg/ml, 4.0 mole equivalents per SPDP, 1.64 μmol). This mixture was roller-mixed for 15 minutes at 20° C. with roller-mixing. The resulting Ab-SH was purified by gel filtration using a zeba spin desalting column into TBS pH 7.5. The Ab-SH was characterized by UV-vis analysis and Ellman's assay (thiol to Ab ratio=5.4). To the bulk Ab-SH (7.41 mg, 1.93 mg/ml, 49 nmol) was added an aliquot of freshly prepared dendron-(L-SO1861).sub.4-maleimide solution in DMSO (10 mg/ml, 8.0 mole equivalents per Ab, 0.4 μmol, 3.16 mg, 0.32 ml), the mixture vortexed briefly then incubated overnight at 20° C. Besides the conjugation reaction, two aliquots of the desalted Ab-SH (0.25 mg, 1.67 nmol) were removed prior to conjugation, and were reacted with NEM (8.0 mole equivalents per Ab, 13.3 nmol, 6.7 μl of a 0.25 mg/ml solution) or TBS pH 7.5 buffer (6.7 μl) overnight at 20° C., as positive and negative controls, respectively. After incubation for 18 hours (prior to addition of NEM), the crude conjugate mixture was centrifuged briefly and 100 μl aliquot removed for analysis by UV-vis and alongside positive and negative controls were characterized by Ellman's assay to obtain dendron-(L-SO1861).sub.4 incorporation. To the bulk Ab-dendron-(L-SO1861).sub.4 mixture was added an aliquot of freshly prepared NEM solution (2.5 mg/ml, 5.0 mole equivalents, 0.25 μmol) and the mixture purified by 1.6×30 cm Sephadex G50 column eluting with DPBS pH 7.5 to give purified Cetuximab-(S-dendron-(L-SO1861).sub.4).sub.4 conjugate. The product was filtered to 0.2 μm to clarify and then concentrated carefully to ca. 3 mg/ml using a vivaspin T15 concentrator (3,000 g, 5 minute intervals, 5° C.) to give the final Cetuximab-(S-dendron(L-SO1861).sub.4).sub.4 conjugate. Yield: 4.41 mg, 48%. Dendron-(L-SO1861).sub.4 to Ab ratio=4.4.
TABLE-US-00008 TABLE 2 Summarized reaction outcomes Ab PEG.sub.4- Dendron(SO1861).sup.4- Purity by feed SPDP mol maleimide mol Obtained analytical Batch (mg) equivalents equivalents DAR SEC Yield Trastuzumab- 9.0 6.81 8 4.7 99.2% 2.34 mg (Cys-dendron- (26%) (L-SO1861).sup.4).sup.4 Cetuximab- 9.2 6.7 8 4.4 96.7% 4.41 mg (Cys-dendron- (48%) (L-SO1861).sup.4).sup.4
Antibody-(L-SO1861).SUP.n .(as Illustrated in FIG. 12)
[0444] Trastuzumab, Cetuximab, are referred hereafter as “Ab”. Ab was conjugated to the saponin SO18161-EMCH via Michael-type thiol-ene conjugation reaction at DARs of 1, 2, 3, 4, 5, and 6. The SO1861-EMCH molecule obtains a labil (L) hydrazone bond between its structure and its maleimide function generating a labil bond between the saponin and Ab. The procedure is exemplary described for Trastuzumab-(L-SO1861).sub.4:
[0445] To a solution of Cetuximab (40 mg, 8.0 ml) was added 10 μl/ml each of Tris concentrate (127 mg/ml, 1.05M), Tris.HCl concentrate (623 mg/ml, 3.95M) and EDTA-Na.sub.2 concentrate (95 mg/ml, 0.26M) to give a 50 mM TBS, 2.5 mM EDTA buffer pH 7.5.
[0446] To Cetuximab divided into four portions (each of 9.73 mg, 4.864 mg/ml, 65 nmol) was added an aliquot of freshly prepared TCEP solution (0.5-2.0 mg/ml, 1.15-7.02 mole equivalents, 75-455 nmol), the mixtures vortexed briefly then incubated for 300 minutes at 20° C. with roller-mixing. After incubation (prior to addition of SO1861-EMCH), a ca. 1 mg (0.210 ml) aliquot of Ab-SH was removed from each mixture and purified by gel filtration using a zeba spin desalting column into TBS pH 7.5. These aliquots were characterized by UV-vis analysis and Ellman's assay (thiol to Ab ratio=2.0, 4.2, 5.9 and 6.8 respectively). To each of the bulk Ab-SH was added an aliquot of freshly prepared SO1861-EMCH solution (2 mg/ml, 1.3 mole equivalents per ‘thiol’, 0.15-0.61 μmol, 0.16-0.63 ml), the mixtures vortexed briefly then incubated for 120 minutes at 20° C. Besides each conjugation reaction, two aliquots of desalted Ab-SH (0.25 mg, 1.67 nmol) were reacted with NEM (1.3 mole equivalents per ‘thiol’, 4.3-17.4 nmol, 2.2-8.7 μl of a 0.25 mg/ml solution) or TBS pH 7.5 buffer (2.2-8.7 μl) for 120 minutes at 20° C., as positive and negative controls, respectively. After incubation (prior to addition of NEM), a 0.200 ml aliquot of Ab-SO1861-EMCH mixture was removed and purified by gel filtration using zeba spin desalting column into TBS pH 7.5. This aliquot was characterized by UV-vis and alongside positive and negative controls were characterized by Ellman's assay to obtain SO1861-EMCH incorporations. To the bulk Ab-SO1861-EMCH mixture was added an aliquot of freshly prepared NEM solution (2.5 mg/ml, 2.5-10 mole equivalents, 0.15-0.58 μmol) and the mixtures purified by zeba spin desalting columns eluting with DPBS pH 7.5 to give purified Cetuximab-(L-SO1861) conjugates. The products were normalized to 2.5 mg/ml and filtered to 0.2 μm prior to dispensing for biological evaluation.
TABLE-US-00009 TABLE 3 Summarized reaction conditions and results for Trastuzumab-L-SO1861 conjugates Purity by TCEP feed analytical mole SO1861- Obtained SEC Batch Ab feed equivalents EMCH feed DAR (%) Yield (%) Tras-(L- 9.91 mg 1.10 0.15 μmol 1.6 99.2 79 SO1861).sub.2 66 nmol Tras-(L- 9.91 mg 2.35 0.31 μmol 3.0 99.0 81 SO1861).sub.3 66 nmol Tras-(L- 9.91 mg 3.83 0.46 μmol 4.0 98.4 81 SO1861).sub.4 66 nmol Tras-(L- 9.91 mg 5.77 0.62 μmol 5.3 98.5 79 SO1861).sub.5 66 nmol
TABLE-US-00010 TABLE 4 Summarized reaction conditions and results for Cetuximab-L-SO1861 conjugates Purity by TCEP feed analytical mole SO1861- Obtained SEC Batch Ab feed equivalents EMCH feed DAR (%) Yield (%) Cet-(L- 9.73 mg 1.15 0.15 μmol 1.4 99.7 74 SO1861).sub.1 65 nmol Cet-(L- 9.73 mg 2.49 0.31 μmol 2.8 99.6 80 SO1861).sub.3 65 nmol Cet-(L- 9.73 mg 4.19 0.46 μmol 4.1 99.0 77 SO1861).sub.4 65 nmol Cet-(L- 9.73 mg 7.02 0.61 μmol 5.6 98.3 80 SO1861).sub.6 65 nmol
Antibody-(S-SO1861).SUP.n .Synthesis
SO1861-S-Mal Synthesis
[0447] SO1861 from Saponaria officinalis L (15.4 mg, 8.28 mol) and HATU (140 mg, 368 mol, 44.5 mole equivalents) were placed as solid into a 20 mL glass vial with magnetic stirrer and 5 mL DMSO was added to dissolve the materials. The dissolved mixture was stirred for 30 min at room temperature. After 30 min, 1 mL of freshly prepared AEM solution (65 mg, 256 mol, 31 mole equivalents) in DMSO was added to the stirring SO1861-HATU mixture. The reaction mixture was stirred for 17 hours at room temperature. After stirring for 17 hours, the mixture was diluted with deionized water and dialyzed extensively for 24 h against deionized water using regenerated cellulose membrane tubes (Spectra/Por 7) with a MWCO of 1 kDa. After dialysis, the solution was lyophilized to obtain a white powder.
Yield: 7.22 mg (44%).
[0448] Dried aliquots were further used for characterization via MALDI-TOF-MS.
MALDI-TOF-MS (RN mode) (Figure x a): m/z 1983 Da ([M−H].sup.−, SO1861-S-Mal conjugate), 2136 Da ([M−H].sup.−, saponin-S-Mal conjugate).
MALDI-TOF-MS (RP mode) (Figure x b): m/z 2007 Da ([M+Na].sup.+, SO1861-S-Mal conjugate), 2107 Da ([M−Na].sup.+, saponin-S-Mal conjugate).
[0449] Maleimide functionality was verified by mixing the purified SO1861-S-Mal with a freshly prepared L-cysteine solution (1000 mole excess) and observing the expected mass shift in MALDI-TOF-MS (Figure x) yielding a cysteine-conjugate at m/z 2103 Da.
Antibody Conjugation
[0450] Trastuzumab and Cetuximab are referred hereafter as “Ab”. Ab was conjugated to the saponin SO18161-S-Mal via Michael-type thiol-ene conjugation reaction. The saponin obtains a stable (S) amide bond between its structure and its maleimide function generating a stable bond between the saponin and Ab.
[0451] 5 mg of Ab dissolved in phosphate buffer saline (PBS) was buffer exchanged into tris(hydroxymethyl)-aminomethan buffer saline (TBS) pH 7.5 via zeba spin desalting column and normalized to a concentration of 3 mg/mL. To Ab was added an aliquot of freshly prepared tris(2-carboxyethyl)phosphine (TCEP) solution (0.25 mg/mL, 2.92 mole equivalents), the mixture vortexed briefly then incubated for 90 min at 20° C. After, the resulting Ab-SH was purified by gel filtration using zeba spin desalting column into TBS pH 7.5. An aliquot was analyzed by Ellman's assay to ascertain sulfhydryl content. The Ab-SH obtained was split into a single portion for conjugation and two aliquots of 0.25 mg for controls. To the main portion of AB-SH was added an aliquot of freshly prepared SO1861-S-Mal solution (2 mg/mL, 2 mol equivalents with respect to sulfhydryl content), to the second control aliquot was added buffer TBS pH 7.5. Each mixture was vortexed briefly then incubated for 2 hours at 20° C. After, an aliquot from each was analyzed by Ellman's assay to ascertain sulfhydryl content remaining in the conjugate with respect to controls. After purification by gel filtration via zeba spin desalting column into Dulbecco's PBS pH 7.1, Ab-S-SO1861 was obtained. The conjugate was further analyzed by SEC to ascertain % purity. For the Trastuzumab-(S-SO1861).sub.4 sample a purity of 99% was determined. For the Cetuximab-(S-SO1861).sub.4 sample a purity of 98.3% was determined. Retention volumes for Trastuzumab-(S-SO1861).sub.4 (9.1 mL) and Cetuximab-(S-SO1861).sub.4 (8.8 mL) were noted to be similar and are consistent with a non-modified Ab (e.g. IgG).
Antibody-(L-HSP27 BNA).SUP.n
[0452] Trastuzumab-(L-HSP27).sup.4, Cetuximab-(L-HSP27).sup.4, Synthesis Via PEG.sub.4-SPDP with a DAR4 and Cetuximab-(L-HSP27).sup.2 Synthesis Via PEG.sub.4-SPDP with a DAR2
[0453] Trastuzumab, Cetuximab, are referred hereafter as “Ab”. Ab was conjugated to HSP27 BNA disulfide via a tetra(ethylene glycol) succinimidyl 3-(2-pyridyldithio)propionate (PEG.sub.4-SPDP) linker forming a labil (L) disulfide bond between Ab and HSP27 BNA. The procedure is exemplary described for Trastuzumab-(L-HSP27 BNA).sub.4:
[0454] HSP27 BNA disulfide oligo (2.7 mg, 470 nmol, 6.10 mg/ml) was reacted with TCEP (10 mole equivalents, 4.7 μmol, 1.34 mg, 50 mg/ml) for 30 minutes at 20° C. with roller mixing. After, the oligo-SH was purified by PD10 G25 desalting column eluting into TBS pH 7.5 and used promptly. Oligo-SH was obtained (2.48 mg, 90%, 1.24 mg/ml, SH to oligo ratio=0.8)
[0455] Trastuzumab (1.5 mg, 10.3 nmol, 2.50 mg/ml) was reacted with an aliquot of freshly prepared PEG.sub.4-SPDP solution (6.81 mole equivalents, 70.1 nmol, 39 μg) in DMSO (1 mg/ml) for 60 minutes at 20° C. with roller mixing. After, the reaction was quenched with glycine (15.1 μl of 2 mg/ml freshly prepared solution in TBS pH 7.5) and then desalted via zeba desalting column eluting with TBS pH 7.5. An aliquot of the resulting Tras-S-PEG.sub.4-SPDP was taken out and tested by UV-Vis analysis. SPDP incorporation was determined using TCEP to liberate pyridiyl-2-thione (PDT) and by UV-vis analysis at 343 nm (SPDP to Ab ratio: 4). The remaining Tras-(S-PEG.sub.4-SPDP).sub.4 was reacted with an aliquot of freshly prepared HSP27 oligonucleotide (oligo-SH) (8 mole equivalents, 82.4 nmol, 1.24 mg/ml) and incubated overnight at 20° C. with roller mixing. After 17 hours, the conjugate was analysed by UV-vis analysis to ascertain incorporation of HSP27 by displacement of pyridiyl-2-thione (PDT) at 343 nm. The crude conjugate was purified using a 1.6×33 cm Sephadex G50 column eluting with DPBS pH 7.5. The resulting Trastuzumab-(L-HSP27).sub.4 was obtained as a single fraction. Yield: n.d. Purity: 96%, HSP27 BNA to Ab ratio=4.4
TABLE-US-00011 TABLE 5 Summarized reaction conditions and results HSP27 Purity by PEG.sub.4- (oligo-SH) analytical SPDP mol mol Obtained SEC Yield Batch equivalents equivalents DAR (%) (%) Tras-(L-HSP27 6.81 8 4.4 96.0 n.d. BNA).sup.4 Cet-(L-HSP27 6.70 8 3.9 93.9 n.d. BNA).sup.4 Cet-(L-HSP27).sup.2 2.3 3.6 1.5 94.9 87 n.d. = not determined
Antibody-(L-HSP27 BNA-L-Blocked).SUP.n
Trastuzumab-(L-HSP27-L-Blocked).SUP.4., Cetuximab-(L-HSP27-L-Blocked)
[0456] Trastuzumab and Cetuximab are referred hereafter as “Ab”. Ab was conjugated a maleimido (Mal) bearing HSP27 derivate which is referred hereafter as “HSP27-Mal”. Ab was conjugated to the HSP27-Mal via Michael-type thiol-ene conjugation reaction. The HSP17-Mal obtains a labile (L) hydrazone bond between its structure and its maleimide function generating a labile bond between the HSP27 BNA and Ab. The procedure is exemplary described for Trastuzumab-(L-HSP27 BNA-L-blocked).sup.n:
[0457] Trastuzumab was reconstituted to 21 mg/ml with deionized water (DI), then diluted to 5 mg/ml using histidine buffer pH 6. To a 20 mg (4.0 ml) aliquot was added 10 μl/ml each of Tris concentrate (127 mg/ml, 1.05M), Tris.HCl concentrate (623 mg/ml, 3.95M) and EDTA-Na.sub.2 concentrate (95 mg/ml, 0.26M) to give a 50 mM TBS, 2.5 mM EDTA buffer pH 7.5. To Trastuzumab (20.30 mg, 4.920 mg/ml, 0.14 μmol) was added an aliquot of freshly prepared TCEP solution (1.00 mg/ml, 2.35 mole equivalents, 0.32 μmol), the mixture vortexed briefly then incubated for 90 minutes at 20° C. with roller-mixing. After incubation (prior to addition of HSP27-Mal), a ca. 2 mg (0.439 ml) aliquot of Ab-SH was removed from each mixture and purified by gel filtration using a zeba spin desalting column into TBS pH 7.5. This aliquot was characterized by UV-vis analysis and Ellman's assay (thiol to ab ratio=4.0). To the bulk Ab-SH (5.1 mg, 35 nmol) was added an aliquot of the HSP27-Mal derivative (freshly prepared in TBS pH 7.5, 2 mg/ml, 1.3 mole equivalents per ‘thiol’, 182 nmol), the mixture vortexed briefly then incubated for 120 minutes at 20° C. Besides the Trasuzumab-HSP27 BNA derivative conjugation reaction, two aliquots of desalted Ab-SH (0.5 mg, 3.3 nmol) were reacted with NEM (1.3 mole equivalents per ‘thiol’, 17.3 nmol, 6.7 μl of a 0.25 mg/ml solution) or TBS pH 7.5 buffer (6.7 μl) for 120 minutes at 20° C., as positive and negative controls, respectively. After incubation (prior to addition of NEM), a 0.100 ml aliquot of Ab-HSP27 BNA mixture was removed and purified by gel filtration using zeba spin desalting column into TBS pH 7.5. This aliquot was characterized by UV-vis and alongside positive and negative controls was characterized by Ellman's assay to obtain HSP27 incorporation. To the bulk Ab-HSP27 mixture was added an aliquot of freshly prepared NEM solution (0.25 mg/ml, 2.5 mole equivalents, 89 nmol) and the mixture purified by gel filtration using a 1.6×30 cm Sephadex G50M eluting with DPBS pH 7.5 followed by repeated centrifugal filtration and washing using a 100 KDa MWCO concentrator to give purified Trastuzumab-(L-HSP27-L-blocked).sub.4 conjugate. The products were filtered to 0.2 μm prior to dispensing for biological evaluation.
TABLE-US-00012 TABLE 6 Summarized reaction conditions and results Purity by analytical Ab-SH Thiol to HSP27-Mal Obtained SEC Batch feed Ab ratio feed DAR (%) Yield (%) Tras-(L-HSP27 5.1 mg 3.98 1.36 mg 3.6 99.4 40 BNA-L-blocked).sup.4 35 nmol Cet-(L-HSP27 5.1 mg 4.16 1.36 mg 3.6 97.9 50 BNA-L-blocked).sup.4 35 nmol
Antibody-(Cys-Trifunctional Linker-(L-SO1861)-(L-HSP27 BNA)).SUP.n
[0458] Trastuzumab-[S-Tri-(L-SO1861)-(L-HSP27)].sup.4, Trastuzumab-[S-Tri-(Blocked)-(L-HSP27)].sup.4, Cetuximab-[S-Tri-(L-SO1861)-(L-HSP27)].sup.4, Cetuximab-[S-Tri-(Blocked)-(L-HSP27)].sup.4
[0459] Trastuzumab and Cetuximab are referred hereafter as “Ab”. Ab was conjugated via Michael-type thiol-ene reaction to two different maleimide (Mal) bearing HSP27 BNA derivatives which are referred hereafter as “HSP27-Mal”. These HSP27-Mal derivatives were namely: 1) Mal-Trifunctional linker-(L-SO1861)-(L-HSP27), 2) Mal-Trifunctional linker-(blocked)-(L-HSP27). The procedure is exemplary described for Trastuzumab-[S-Trifunctional linker-(L-SO1861)-(L-HSP27 BNA)].sup.4:
[0460] Trastuzumab was reconstituted to 21 mg/ml with deionized water (DI), then diluted to 5 mg/ml using histidine buffer pH 6. To a 20 mg (4.0 ml) aliquot was added 10 μl/ml each of Tris concentrate (127 mg/ml, 1.05M), Tris.HCl concentrate (623 mg/ml, 3.95M) and EDTA-Na.sub.2 concentrate (95 mg/ml, 0.26M) to give a 50 mM TBS, 2.5 mM EDTA buffer pH 7.5.
[0461] To Trastuzumab (20.30 mg, 4.920 mg/ml, 0.14 μmol) was added an aliquot of freshly prepared TCEP solution (1.00 mg/ml, 2.35 mole equivalents, 0.32 μmol), the mixture vortexed briefly then incubated for 90 minutes at 20° C. with roller-mixing. After incubation (prior to addition of construct), a ca. 2 mg (0.439 ml) aliquot of Ab-SH was removed from each mixture and purified by gel filtration using a zeba spin desalting column into TBS pH 7.5. These aliquots were characterized by UV-vis analysis and Ellman's assay (thiol to ab ratio=4.0). The bulk Ab-SH was split into two aliquots (1.1 mg, 7.6 nmol and 1.2 mg, 8.3 nmol), and to each aliquot was added an aliquot of each of the HSP27 BNA-Mal derivatives 1-2 (freshly prepared in TBS pH 7.5, 2 mg/ml, 1.3 mole equivalents per ‘thiol’, 40 nmol and 43 nmol), the mixtures vortexed briefly then incubated for 120 minutes at 20° C. Besides the Trastuzumab-HSP27 BNA derivatives 2 conjugation reaction, two aliquots of desalted Ab-SH (0.5 mg, 3.3 nmol) were reacted with NEM (1.3 mole equivalents per ‘thiol’, 17.3 nmol, 6.7 μl of a 0.25 mg/ml solution) or TBS pH 7.5 buffer (6.7 μl) for 120 minutes at 20° C., as positive and negative controls, respectively. After incubation (prior to addition of NEM), a 0.100 ml aliquot of Ab-construct 2 mixture was removed and purified by gel filtration using zeba spin desalting column into TBS pH 7.5. This aliquot was characterized by UV-vis and alongside positive and negative controls was characterized by Ellman's assay to obtain HSP27 BNA derivatives 2 incorporation. To each bulk Ab-construct mixture was added an aliquot of freshly prepared NEM solution (0.25 mg/ml, 2.5 mole equivalents, 19 and 21 nmol) and the mixtures purified by gel filtration using a 1.6×30 cm Sephadex G50M eluting with DPBS pH 7.5 followed by repeated centrifugal filtration and washing using a 100 KDa MWCO concentrator to give purified Trastuzumab-construct 1-2 conjugates. The products were filtered to 0.2 μm prior to dispensing for biological evaluation.
TABLE-US-00013 TABLE 7 Summarized reaction conditions and results Purity by Thiol analytical Ab-SH TCEP to ab SEC Yield Batch feed equivalents ratio (%) (%) Tras-[S-Trifunctional 1.1 mg 2.35 3.98 97.0 57 linker-(L-SO1861)-(L- 7.6 nmol HSP27 BNA)].sup.4 Tras-[S-Trifunctional 1.2 mg 2.35 3.98 96.6 33 linker-(blocked)-(L- 8.3 nmol HSP27 BNA)].sup.4 Cet-[S-Trifunctional 1.1 mg 2.72 4.16 98.9 47 linker-(L-SO1861)-(L- 7.6 nmol HSP27 BNA)].sup.4 Cet-[S-Trifunctional 1.2 mg 2.72 4.16 99.1 50 linker-(blocked)-(L- 8.3 nmol HSP27 BNA)].sup.4
Antibody-(L-SO1861).sub.4L-HSP27 BNA).sup.n
Trastuzumab-(L-SO1861).sup.4-(L-HSP27).sup.4, Cetuximab-(L-SO1861).sup.4-(L-HSP27).sup.4 Synthesis Via PEG.sub.4-SPDP with a DAR4 Cetuximab-(L-SO1861).sup.4-(L-HSP27).sup.2 (FBR703 STB17/7-8) Synthesis Via PEG.sub.4-SPDP with a DAR2
[0462] Trastuzumab-(L-SO1861).sub.4, Cetuximab-(L-SO1861).sub.4 are referred hereafter as “Ab”. Ab was conjugated to HSP27 BNA disulfide via a tetra(ethylene glycol) succinimidyl 3-(2 pyridyldithio)propionate (PEG.sub.4-SPDP) linker forming a labil (L) disulfide bond between Ab and HSP27 BNA. The procedure is exemplary described for Trastuzumab-(L-SO1861).sub.4-(L-HSP27).sub.4:
[0463] HSP27 BNA disulfide oligo (2.7 mg, 470 nmol, 6.10 mg/ml) was reacted with TCEP (10 mole equivalents, 4.7 μmol, 1.34 mg, 50 mg/ml) for 30 minutes at 20° C. with roller mixing. After, the oligo-SH was purified by PD10 G25 desalting column eluting into TBS pH 7.5 and used promptly. Oligo-SH was obtained (2.48 mg, 90%, 1.24 mg/ml, SH to oligo ratio=0.8)
[0464] Trastuzumab-(L-SO1861).sub.4 (1.3 mg, 8.7 nmol, 2.50 mg/ml) was reacted with an aliquot of freshly prepared PEG.sub.4-SPDP solution (9.26 mole equivalents, 80.3 nmol, 45 μg) in DMSO (1 mg/ml) for 60 minutes at 20° C. with roller mixing. After, the reaction was quenched with glycine (15.1 μl of 2 mg/ml freshly prepared solution in TBS pH 7.5) and then desalted via zeba desalting column eluting with TBS pH 7.5. An aliquot of the resulting Tras-(L-SO1861)-(L-PEG.sub.4-SPDP) was taken out and tested by UV-Vis analysis. SPDP incorporation was determined using TCEP to liberate pyridiyl-2-thione (PDT) and by UV-vis analysis at 343 nm (SPDP to Ab ratio=4). The remaining Tras-(L-SO1861)-(L-PEG.sub.4-SPDP) was reacted with an aliquot of freshly prepared HSP27 oligonucleotide (oligo-SH) (8 mole equivalents, 54.8 nmol, 0.32 mg, 1.24 mg/ml) and incubated overnight at 20° C. with roller mixing. After 17 hours, the conjugate was analyzed by UV-vis analysis to ascertain incorporation of HSP27 by displacement of pyridiyl-2-thione (PDT) at 343 nm. The crude conjugate was purified using a 1.6×33 cm Sephadex G50 column eluting with DPBS pH 7.5. The resulting Trastuzumab-(L-SO1861).sub.4-(L-HSP27 BNA).sub.4 was obtained as a single fraction. Yield: 0.47 mg, 45% (0.49 mg/ml), HSP27 to Ab ratio=3.5
TABLE-US-00014 TABLE 8 Summarized reaction conditions and results HSP27 Purity by PEG.sub.4- (oligo-SH) analytical SPDP mol mol Obtained SEC Yield Batch equivalents equivalents DAR (%) (%) Tras-(L-SO1861).sup.4- 9.26 8 3.5 85.1 45 (L-HSP27 BNA.sup.)4 Cet-(L-SO1861).sub.4- 7.21 8 3.8 80.8 n.d. (L-HSP27 BNA).sup.4 Cet-(L-SO1861).sub.4- 3.34 3.6 1.8 76.2 81 (L-HSP27 BNA).sup.2 n.d. = not determined
Antibody-(L-OS Mix).SUP.n
[0465] Trastuzumab, Cetuximab, are referred hereafter as “Ab”. Ab was conjugated to the saponin QS Mix-EMCH via Michael-type thiol-ene conjugation reaction. The procedure is exemplary described for Trastuzumab-L-QS Mix:
[0466] Trastuzumab (“Ab”, 600 mg) was reconstituted to 21 mg/mL with deionized water (DI), then diluted to 5 mg/mL using freshly prepared histidine buffer pH 6 (5 mM histidine pH 6, 2% trehalose, 0.01% Tween 20). 10 μL/mL each of Tris concentrate (127 mg/mL, 1.05M), Tris.HCL concentrate (623 mg/mL, 3.95M) and EDTA-Na.sub.2 concentrate (95 mg/ml, 0.26M) was added to give a 50 mM TBS, 2.5 mM EDTA buffer pH 7.5. To Trastuzumab (603.8 mg, 4.887 mg/mL, 4.0 μmol) was added an aliquot of freshly prepared TCEP solution (1 mg/mL, 2.35 mole equivalents, 9.5 μmol, 2.72 mg), the mixture swirled by hand to mix then incubated for 90 minutes at 20° C. with roller-mixing. After incubation (prior to addition of QS Mix-EMCH), a 2 mg (0.409 mL) aliquot of Ab-SH was removed and purified by gel filtration using zeba spin desalting column into TBS pH 7.5. This aliquot was characterized by UV-vis analysis and Ellman's assay. To the bulk Ab-SH was added an aliquot of freshly prepared QS Mix-EMCH solution (2 mg/mL, 5.2 mole equivalents, 21 μmol, 21.6 mL), the mixtures vortexed briefly then incubated for 120 minutes at 20° C. Besides the conjugation reaction, two aliquots of desalted Ab-SH (0.5 mg, 0.134 mL, 3.33 nmol) were reacted with NEM (8.00 equivalents, 26.6 nmol, 3.3 μg, 13.3 μL of a 0.25 mg/mL solution) or TBS pH 7.5 buffer (13.3 μL) for 120 minutes at 20° C., as positive and negative controls, respectively. After incubation (prior to addition of NEM), a ca. 2 mg (0.481 mL) aliquot of Ab-QS Mix-EMCH mixture was removed and purified by gel filtration using zeba spin desalting column into TBS pH 7.5. This aliquot was characterized by UV-vis and alongside positive and negative controls were characterized by Ellman's assay to obtain QS Mix-EMCH incorporations. To the bulk Ab-QS Mix-EMCH mixture was added an aliquot of freshly prepared NEM solution (2.5 mg/mL, 5 mole equivalents, 20 μmoL, 2.51 mg) and the mixture stored at 2-8° C. overnight. The conjugate was purified by 10×40 cm Sephadex G50M column eluting with DPBS pH 7.5 to give purified Trastuzumab-(L-QS Mix) conjugate. The product as a whole was concentrated then normalized to 5 mg/mL using a vivacell 100 concentrator (2,000 g, 4° C., 200 minutes). The product were filtered to 0.2 μm and dispensed for biological evaluation. Yield: n.d. QS Mix to Ab ratio=4.1.
TABLE-US-00015 TABLE 9 Summarized reaction outcomes Method Measure Result Analytical SEC Purity n.d. Yield Mass (percent) n.d. Ellman's assay QS Mix-EMCH incorpoation 4.1
Antibody-(L-HSP27BNA-L-SO1861).SUP.n
[0467] Trastuzumab-(L-HSP27BNA-L-SO1861).sup.4, Cetuximab-(L-HSP27BNA-L-SO1861).sup.4 with a DAR4 Trastuzumab and Cetuximab are referred hereafter as “Ab”. Ab was conjugated a saponin SO1861 and maleimido (Mal) bearing HSP27 derivate which is referred hereafter as “HSP27-Mal”. Ab was conjugated to the HSP27-Mal via Michael-type thiol-ene conjugation reaction. The HSP17-Mal obtains a labile (L) hydrazone bond between its structure and its maleimide function generating a labile bond between the HSP27 BNA and Ab. The procedure is exemplary described for Trastuzumab-(L-HSP27 BNA-L-SO1861).sub.4: Trastuzumab was reconstituted to 21 mg/ml with deionized water (DI), then diluted to 5 mg/ml using histidine buffer pH 6. To a 20 mg (4.0 ml) aliquot was added 10 μl/ml each of Tris concentrate (127 mg/ml, 1.05M), Tris.HCl concentrate (623 mg/ml, 3.95M) and EDTA-Na.sub.2 concentrate (95 mg/ml, 0.26M) to give a 50 mM TBS, 2.5 mM EDTA buffer pH 7.5. To Trastuzumab (20.30 mg, 4.920 mg/ml, 0.14 μmol) was added an aliquot of freshly prepared TCEP solution (1.00 mg/ml, 2.35 mole equivalents, 0.32 μmol), the mixture vortexed briefly then incubated for 90 minutes at 20° C. with roller-mixing. After incubation (prior to addition of HSP27-Mal), a ca. 2 mg (0.439 ml) aliquot of Ab-SH was removed from each mixture and purified by gel filtration using a zeba spin desalting column into TBS pH 7.5. This aliquot was characterized by UV-vis analysis and Ellman's assay (thiol to ab ratio=4.0). To the bulk Ab-SH (4.7 mg, 32 nmol) was added an aliquot of the HSP27-Mal derivative (freshly prepared in TBS pH 7.5, 2 mg/ml, 1.3 mole equivalents per ‘thiol’, 166 nmol), the mixture vortexed briefly then incubated for 120 minutes at 20° C. Besides the Trasuzumab-HSP27 BNA derivative conjugation reaction, two aliquots of desalted Ab-SH (0.5 mg, 3.3 nmol) were reacted with NEM (1.3 mole equivalents per ‘thiol’, 17.3 nmol, 6.7 μl of a 0.25 mg/ml solution) or TBS pH 7.5 buffer (6.7 μl) for 120 minutes at 20° C., as positive and negative controls, respectively. After incubation (prior to addition of NEM), a 0.100 ml aliquot of Ab-HSP27 BNA mixture was removed and purified by gel filtration using zeba spin desalting column into TBS pH 7.5. This aliquot was characterized by UV-vis and alongside positive and negative controls was characterized by Ellman's assay to obtain HSP27 incorporation. To the bulk Ab-HSP27 mixture was added an aliquot of freshly prepared NEM solution (0.25 mg/ml, 2.5 mole equivalents, 80 nmol) and the mixture purified by gel filtration using a 1.6×30 cm Sephadex G50M eluting with DPBS pH 7.5 followed by repeated centrifugal filtration and washing using a 100 KDa MWCO concentrator to give purified Trastuzumab-(L-HSP27 BNA-L-SO1861).sub.4 conjugate. The products were filtered to 0.2 μm prior to dispensing for biological evaluation.
TABLE-US-00016 TABLE 10 Summarized reaction conditions and results Purity by Ab-SH Thiol to HSP27-Mal analytical Yield Batch feed Ab ratio feed SEC (%) (%) Tras-(L-H5P27 4.7 mg 3.98 1.57 mg 99.4 40 BNA-L-SO1861).sup.4 32 nmol Cet-(L-HSP27 4.7 mg 4.16 1.57 mg 97.9 50 BNA-L-SO1861).sup.4 32 nmol
Antibody-(L-SO1861).sup.n-(S-Dianthin).sup.n
Trastuzumab-(L-SO1861).sub.4-(S-Dianthin).sub.2 and Cetuximab-(L-SO1861).sub.4-(S-Dianthin).sub.2 synthesis via SMCC with a DAR2
[0468] Trastuzumab-L-SO1861 and Cetuximab-L-SO1861 are referred hereafter as “Ab”. Ab was conjugated to Dianthin-Cys via a succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC) linker providing a stable (S) amide bond between Ab and Dianthin. The procedure is exemplary described for Trastuzumab-(L-SO1861).sub.4-(S-Dianthin).sub.2: Dianthin-Cys (7.8 mg, 261 nmol, 0.78 mg/ml) was reacted with TCEP (5 mole equivalents, 1.31 μmol, 0.37 mg, 1 mg/ml) for 30 minutes at 20° C. with roller mixing. After, the protein-SH was purified by zeba desalting column eluting into TBS pH 7.5 and used promptly. Protein-SH was obtained (5.2 mg, 67%, 0.52 mg/ml, SH to protein ratio=1±0.1).
[0469] Trastuzumab-(L-SO1861).sub.4 (1.5 mg, 10 nmol, 2.50 mg/ml) was reacted with an aliquot of freshly prepared SMCC solution (4.83 mole equivalents, 48.3 nmol, 16 μg) in DMSO (0.5 mg/ml) for 60 minutes at 20° C. with roller mixing. After, the reaction was quenched with glycine (18.1 μl of 1 mg/ml freshly prepared solution in TBS pH 7.5) and then desalted via zeba desalting column eluting with TBS pH 7.5. The resulting Tras-(L-SO1861)-(S-SMCC) (1.22 mg, 8.1 nmol, 2.03 mg/ml) was reacted with an aliquot of freshly reduced Dianthin-Cys (3.2 mole equivalents, 32.5 nmol, 0.97 mg, 0.52 mg/ml) and incubated overnight at 20° C. with roller mixing. After 17 hours, the conjugate was concentrated to 51 ml using a vivaspin T4 concentrator and purified using a 1.6×37 cm Superdex 200PG column eluting with DPBS pH 7.5. The resulting Tras-(L-SO1861).sub.4-(S-Dianthin).sub.2 conjugate was obtained as High-Molecular-Weight (HMW) (0.36 mg, 30%, 0.34 mg/ml, Dianthin to Ab ratio=not determined) and Low-Molecular-Weight (LMW) (0.49 mg, 40%, 0.30 mg/ml, Dianthin to Ab ratio=not determined) fractions. Yield: n.d. Purity: 79.3%.
TABLE-US-00017 TABLE 11 Summarized reaction conditions and results Dianthin- Purity by SMCC mol Cys mol Obtained analytical Yield Batch equivalents equivalents DAR SEC (%) (%) Tras-(L-SO1861).sub.4- 4.82 3.2 n.d. 79.3 n.d. (S-Dianthin).sub.x Cet-(L-SO1861).sub.4- 4.46 3.2 2.0 87.6 92 (S-Dianthin).sub.2 n.d. = not determined
12. Antibody-(S-Dianthin).SUP.n
[0470] Trastuzumab-(S-Dianthin).sup.2, Cetuximab-(S-Dianthin).sup.2, Synthesis Via SMCC with a DAR2
[0471] Trastuzumab and Cetuximab are referred hereafter as “Ab”. Ab was conjugated to Dianthin-Cys via a succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC) linker providing a stable (S) amide bond between Ab and Dianthin. The procedure is exemplary described for Trastuzumab-(S-Dianthin).sub.2:
[0472] Dianthin-Cys (7.8 mg, 261 nmol, 0.78 mg/ml) was reacted with TCEP (5 mole equivalents, 1.31 μmol, 0.37 mg, 1 mg/ml) for 30 minutes at 20° C. with roller mixing. After, the protein-SH was purified by zeba desalting column eluting into TBS pH 7.5 and used promptly. Protein-SH was obtained (5.2 mg, 67%, 0.52 mg/ml, SH to protein ratio=1±0.1).
[0473] Trastuzumab (1.5 mg, 10 nmol, 2.50 mg/ml) was reacted with an aliquot of freshly prepared SMCC solution (3.16 mole equivalents, 31.6 nmol) in DMSO (0.5 mg/ml) for 60 minutes at 20° C. with roller mixing. After, the reaction was quenched with glycine (18.1 μl of 1 mg/ml freshly prepared solution in TBS pH 7.5) and then desalted via zeba desalting column eluting with TBS pH 7.5. The resulting Tras-(S-SMCC) (1.22 mg, 8.1 nmol, 2.03 mg/ml) was reacted with an aliquot of freshly reduced Dianthin-Cys (3.2 mole equivalents, 32.5 nmol, 0.97 mg, 0.52 mg/ml) and incubated overnight at 20° C. with roller mixing. After 17 hours, the conjugate was concentrated to 51 ml using a vivaspin T4 concentrator and purified using a 1.6×37 cm Superdex 200PG column eluting with DPBS pH 7.5.
[0474] Yield: n.d. Purity: 99%.
TABLE-US-00018 TABLE 12 Summarized reaction conditions and results Dianthin- Purity by SMCC mol Cys mol Obtained analytical Yield Batch equivalents equivalents DAR SEC (%) (%) Tras-(S-Dianthin).sub.x 3.16 3.2 n.d. 99.0 n.d. Cet-(S-Dianthin).sub.2 3.70 3.2 1.6 97.2 93 n.d. = not determined
Antibody-(L-SO1861).sup.n-(L-Dianthin).sup.n
Trastuzumab-(L-SO1861).sub.4-(L-Dianthin).sub.2, and Cetuximab-(L-SO1861).sub.4-(L-Dianthin).sub.2 Synthesis Via PEG.sub.4-SPDP with a DAR2
[0475] Trastuzumab-L-SO1861, and Cetuximab-L-SO1861 are referred hereafter as “Ab”. Ab was conjugated to Dianthin-Cys via a tetra(ethylene glycol) succinimidyl 3-(2-pyridyldithio)propionate (PEG.sub.4-SPDP) linker forming a labil (L) disulfide bond between Ab and Dianthin. The procedure is exemplary described for Trastuzumab-L-SO1861: Dianthin-Cys (7.8 mg, 261 nmol, 0.78 mg/ml) was reacted with TCEP (5 mole equivalents, 1.31 μmol, 0.37 mg, 1 mg/ml) for 30 minutes at 20° C. with roller mixing. After, the protein-SH was purified by zeba desalting column eluting into TBS pH 7.5 and used promptly. Protein-SH was obtained (5.2 mg, 67%, 0.52 mg/ml, SH to protein ratio=1±0.1).
[0476] Trastuzumab-(L-SO1861).sub.4 (0.75 mg, 5 nmol, 2.50 mg/ml) was reacted with an aliquot of freshly prepared PEG.sub.4-SPDP solution (4.95 mole equivalents, 24.75 nmol, 14 μg) in DMSO (1 mg/ml) for 60 minutes at 20° C. with roller mixing. After, the reaction was quenched with glycine (18.1 μl of 1 mg/ml freshly prepared solution in TBS pH 7.5) and then desalted via zeba desalting column eluting with TBS pH 7.5. An aliquot of the resulting Tras-(L-SO1861)-(S-PEG.sub.4-SPDP) was taken out and tested by UV-Vis analysis. SPDP incorporation was determined using TCEP to liberate pyridiyl-2-thione (PDT) and by UV-vis analysis at 343 nm (SPDP to Ab ratio=2.4). The remaining Tras-(L-SO1861)-(S-PEG.sub.4-SPDP) was reacted with an aliquot of freshly prepared Dianthin-Cys (protein-SH) (4 mole equivalents, 20 nmol, 0.6 mg, 0.52 mg/ml) and incubated overnight at 20° C. with roller mixing. After 17 hours, an aliquot of the conjugate was analyzed by UV-vis analysis to ascertain incorporation of Dianthin-Cys by displacement of PDT. After, the conjugate was concentrated to 51 ml using a vivaspin T4 concentrator and purified using a 1.6×37 cm Superdex 200PG column eluting with DPBS pH 7.5. Dianthin to Ab ratio=2). Yield: n.d. Purity: 60.5%.
TABLE-US-00019 TABLE 13 Summarized reaction conditions and results PEG.sub.4-SPDP Dianthin-Cys Ob- Purity by mol mol tained analytical Yield Batch equivalents equivalents DAR SEC (%) (%) Tras-(L- 4.95 4 1.7 60.5 n.d. SO1861).sub.4-(L- Dianthin).sub.2 Cet-(L-SO1861).sub.4- 4.95 4 2.1 85.2 89 (L-Dianthin).sub.2 n.d. = not determined
Antibody-(L-Dianthin).SUP.n
[0477] Trastuzumab-(L-Dianthin).sub.2, Cetuximab-(L-Dianthin).sub.2 and Synthesis Via PEG.sub.4-SPDP with a DAR2
[0478] Trastuzumab and Cetuximab are referred hereafter as “Ab”. Ab was conjugated to Dianthin-Cys via a tetra(ethylene glycol) succinimidyl 3-(2-pyridyldithio)propionate (PEG.sub.4-SPDP) linker forming a labil (L) disulfide bond between Ab and Dianthin. The procedure is exemplary described for Trastuzumab-L-SO1861:
[0479] Dianthin-Cys (7.8 mg, 261 nmol, 0.78 mg/ml) was reacted with TCEP (5 mole equivalents, 1.31 μmol, 0.37 mg, 1 mg/ml) for 30 minutes at 20° C. with roller mixing. After, the protein-SH was purified by zeba desalting column eluting into TBS pH 7.5 and used promptly. Protein-SH was obtained (5.2 mg, 67%, 0.52 mg/ml, SH to protein ratio=1±0.1).
[0480] Trastuzumab (0.75 mg, 5 nmol, 2.50 mg/ml) was reacted with an aliquot of freshly prepared PEG.sub.4-SPDP solution (3.35 mole equivalents, 16.75 nmol) in DMSO (1 mg/ml) for 60 minutes at 20° C. with roller mixing. After, the reaction was quenched with glycine (18.1 μl of 1 mg/ml freshly prepared solution in TBS pH 7.5) and then desalted via zeba desalting column eluting with TBS pH 7.5. An aliquot of the resulting Tras-(S-PEG.sub.4-SPDP) was taken out and tested by UV-Vis analysis. SPDP incorporation was determined using TCEP to liberate pyridiyl-2-thione (PDT) and by UV-vis analysis at 343 nm. The remaining Tras-(S-PEG.sub.4-SPDP) was reacted with an aliquot of freshly prepared Dianthin-Cys (protein-SH) (4 mole equivalents, 20 nmol, 0.6 mg, 0.52 mg/ml) and incubated overnight at 20° C. with roller mixing. After 17 hours, an aliquot of the conjugate was analyzed by UV-vis analysis to ascertain incorporation of Dianthin-Cys by displacement of PDT. After, the conjugate was concentrated to 51 ml using a vivaspin T4 concentrator and purified using a 1.6×37 cm Superdex 200PG column eluting with DPBS pH 7.5. Dianthin to Ab ratio=2). Yield: n.d. Purity: 67.7%.
TABLE-US-00020 TABLE 14 Summarized reaction conditions and results PEG.sub.4-SPDP Dianthin-Cys Purity by mol mol Obtained analytical Yield Batch equivalents equivalents DAR SEC (%) (%) Tras- 3.35 4 1.6 67.7 n.d. (L-Dianthin).sub.2 Cet- (L-Dianthin).sub.2 3.35 4 1.6 95.2 88 n.d. = not determined
Example 10
Materials and Methods
[0481] In our current work, we investigated a model scaffold consisting of four molecular arms for saponin binding via a Schiff base (imine) and one arm for click chemistry. The polymeric structure (
Results
[0482] The inset of
Example 11
[0483] Materials and Methods As an example for a pharmaceutical active substance, we used the targeted toxin dianthin-Epidermal Growth Factor (dianthin-EGF). The plasmid His-dianthin-EGF-pET11d (Weng et al, 2009) (100 ng) was added to 20 μL Escherichia coli Rosetta™ 2 (DE3) pLysS Competent Cells (Novagen, San Diego, Calif., USA). Cells were transformed by a heat-shock (30 min on ice, 90 s at 42° C. and 1 min on ice). Thereafter, 300 μL lysogeny broth (LB) was added and the suspension incubated for 1 h at 37° C. while shaking at 200 rpm. A preheated lysogeny broth agar plate with 50 μg/mL ampicillin was inoculated with 100 μl bacteria suspension and the plate incubated overnight at 37° C. Lysogeny broth (3 mL) with 50 μg/mL ampicillin was inoculated with a colony from the plate and the bacteria were incubated for 8 h at 37° C. and 200 rpm. The suspension (50 μL) was added to 500 mL of lysogeny broth with 50 μg/mL ampicillin and incubated overnight at 37° C. and 200 rpm. Subsequently, the volume was scaled-up to 2.0 L and bacteria grew under the same conditions until an optical density at wavelength 600 nm of 0.9 was reached. Thereafter, protein expression was induced by the addition of isopropyl β-D-1-thiogalactopyranoside (IPTG) at a final concentration of 1 mM. Protein expression lasted for 3 h at 37° C. and 200 rpm. Finally, the bacterial suspension was centrifuged at 5,000×g and 4° C. for 5 min, resuspended in 20 mL PBS (137 mM NaCl, 2.7 mM KCl, 8.1 mM Na.sub.2HPO.sub.4, 1.47 mM KH.sub.2PO.sub.4) and stored at −20° C. until use. For purification, bacterial suspensions were thawed and lysed by sonication. Lysates were centrifuged (15,800×g, 4° C., 30 min) and imidazole added to a final concentration of 20 mM. The supernatant was incubated with 2 mL of Ni-nitrilotriacetic acid agarose under continuous shaking for 30 min at 4° C. in the presence of 20 mM imidazole. Subsequently, the material was poured into a 20-mL-column and washed three times with 10 mL wash buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 20 mM imidazole) and dianthin-EGF eluted by 10-mL-portions of increasing concentrations of imidazole (31, 65, 125 and 250 mM) in wash buffer. Eluate fractions (2 mL) were dialyzed overnight at 4° C. against 2.0 L PBS. Desalted dianthin-EGF was concentrated by an Amicon® Ultra-15 (10 kDa) and the protein concentration quantified.
[0484] To introduce a suitable click chemistry group into dianthin-EGF, alkyne-PEG.sub.5-N-hydroxysuccinimidyl ester in 8-fold molar excess referred to dianthin-EGF was solved in dimethyl sulfoxide and added to 9 volumes of dianthin-EGF (1 mg in 0.2 M NaH.sub.2PO.sub.4/Na.sub.2HPO.sub.4, pH 8). After incubation at room temperature for 4 h, non-bound alkyne was separated by use of a PD10 column (GE-Healthcare, Freiburg, Germany). Click chemistry with the polymeric structure was conducted by copper(I)-catalyzed alkyne-azide cycloaddition. Alkyne-dianthin-EGF (0.02 mM), dendrimer (0.05 mM), CuSO.sub.4 (0.1 mM), tris(3-hydroxypropyltriazolylmethyl)amine (0.5 mM) and sodium ascorbate (5 mM) were incubated under gentle agitation for 1 h at room temperature in 0.1 M NaH.sub.2PO.sub.4/Na.sub.2HPO.sub.4, pH 8. Low molecular mass substances were then separated using a PD10 column.
[0485] To test the efficacy of the invention, we conducted a viability assay with HER14 cells. These cells are fibroblasts stably transfected with the human epidermal growth factor receptor and therefore target cells for the targeted toxin dianthin-EGF. HER14 cells (2,000 cells/100 μL/well) were seeded into wells of 96-well-cell culture plates and incubated for 24 h in DMEM medium supplemented with 10% fetal calf serum and 1% penicillin/streptomycin at 37° C., 5% CO.sub.2 and 98% humidity. The different test substances (see results and
Results
[0486] The polymeric structure, in the example a pentameric dendrimer (pentrimer), does not have any cytotoxic effect on the target cells, neither in absence nor in presence of SA1641 (
Example 12
Materials
[0487] The following chemicals were used as purchased: methanol (MeOH, LiChrosolv, Merck), N-ε-maleimidocaproic acid hydrazide (EMCH, 95%, TCI Chemicals), trifluoroacetic acid (TFA, 99.8%, Carl Roth), 2-mercaptoethanol (98%, Sigma-Aldrich), poly(amidoamine) (PAMAM dendrimer, ethylenediamine core, generation 5.0 solution, Sigma-Aldrich), cyanine 3 carboxylic acid (Cy3-COOH, 95%, Lumiprobe), 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate, N-[(Dimethylamino)-1H-1,2,3-triazolo-[4,5-b]pyridin-1-ylmethylene]-N-methylmethanaminium hexafluorophosphate N-oxide (HATU, 97%, Sigma-Aldrich), bovine serum albumin fraction V (BSA, Carl Roth), dimethylsulfoxide (DMSO, 99%, Carl Roth), 2-Iminothiolane hydrochloride (98%, Sigma-Aldrich), rhodamine b (RhodB, 95%, Merck), Dulbecco's phosphate buffered saline (PBS, Gibco), hydrochloric acid (HCl, 37%, Merck), NHS-PEG.sub.13-DBCO (Click Chemistry Tools), Alexa Fluor™ 488 5-TFP (Thermo-Fischer), azido-PEG.sub.3-SS-NHS (Conju-Probe), sodium cyanoborohydride (NaCNBH3, 95%, Sigma-Aldrich), ammonium persulfate (APS, 98%, Sigma-Aldrich), N,N,N′,N′-tetramethylethylenediamine (TMEDA, 99%, Sigma-Aldrich), customized peptide SESDDAMFCDAMDESDSK (95%, PeptideSynthetics), azido-dPEG.sub.12-NHS (95%, Quanta Biodesign), PFd-G4-Azide-NH-BOC Dendron (G4-dendron, 95%, Polymer Factory), Cyanin5-DBCO (Cy5-DBCO, 95%, Lumiprobe), Chloroform (CHCl.sub.3, 99.5%, Sigma), Amicon Ultra 0.5 mL centrifugal filters (3 kDa MWCO, Sigma), mPEG-SCM (mPEG.sub.2k-NHS, 95.6%, Creative PEG Works), Amicon Ultra 15 mL centrifugal filters (10 kDa MWCO, Sigma).
Methods
MALDI-TOF-MS
[0488] MALDI-TOF spectra were recorded on a MALDI-Mass Spectrometer (Bruker Ultrafex III). Typically, the sample dissolved in MilliQ water in nanomolar to micromolar range was spotted on the target (MTP 384 target plate polished steel T F, Bruker Daltons) using either super-DHB (99%, Fluka) or sinapinic acid (SA, 99%, Sigma-Aldrich) as the matrix dissolved in acetonitrile (MADLI-TOF-MS tested, Sigma)/0.1% TFA (7:3 v/v) via the dried-droplet-method. PepMix (Peptide Calibration Standard, Bruker Daltons) or ProteMass (Protein Calibration Standard, Sigma-Aldrich) served as calibration standards. RP mode refers to reflector positive mode. RN mode refers to reflector negative mode. LP mode refers to linear positive mode.
H-NMR
[0489] .sup.1H NMR analysis was performed using a Bruker 400 MHz NMR spectrometer. The sample preparation, in which 2 mg of sample had been dissolved in 0.8 mL of methanol-D.sub.4 (99%, Deutero), was performed 24 h prior to the measurement.
UV-Vis
[0490] UV-Vis measurements were performed on a NanoDrop ND-1000 spectrophotometer in the spectral range of 200-750 nm.
Size Exclusion Chromatography
[0491] Size exclusion chromatography (SEC) was performed with Sephadex G 25 Superfine from GE Healthcare and on prepacked PD10 columns (GE Healthcare, Sephadex G 25 M). The material was activated by swelling in the respective eluent prior to performing chromatography.
Dialysis
[0492] Regenerated cellulose membranes: MWCO=1 and 2 kDa (Spectra/Por), and MWCO=12-14 kDa (Carl Roth) were used to perform dialysis. Typically, dialysis was carried out for 24 h with 1 L of solvent that was exchanged after first 6 h of the process.
Lyophilization
[0493] Freeze-drying was performed on an Alpha 1-2 LD plus (Martin Christ Gefriertrocknungsanlagen GmbH). Typically, samples were frozen with liquid nitrogen and placed into the freeze-dryer at high vacuum.
SO1861-EMCH Synthesis
[0494] SO1861 from Saponaria officinalis L (59 mg, 31.7 μmol) and EMCH (301 mg, 888 μmol) were placed in a round flask with stirrer and dissolved in 13 mL methanol. TFA (400 μL, cat.) was added to the solution and the reaction mixture was stirred for 3 h at 800 rpm and room temperature on a RCT B magnetic stirrer (IKA Labortechnik). After stirring for 3 h, the mix was diluted either with MilliQ water or PBS and dialyzed extensively for 24 h against either with MilliQ water or PBS using regenerated cellulose membrane tubes (Spectra/Por 7) with a MWCO of 1 kDa. After dialysis, the solution was lyophilized to obtain a white powder. Yield 62.4 mg (95%). Dried aliquots were further used for characterization via .sup.1H NMR and MALDI-TOF-MS.
[0495] .sup.1H NMR (400 MHz, methanol-D.sub.4) (
[0496] .sup.1H NMR (400 MHz, methanol-D.sub.4) (
[0497] MALDI-TOF-MS (RP mode) (
SO1861-EMCH-Mercaptoethanol
[0498] To SO1861-EMCH (0.1 mg, 48 nmol) 200 μL mercaptoethanol (18 mg, 230 μmol) was added and the solution was shaken for 1 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 1 h, the solution was diluted with methanol and dialyzed extensively for 4 h against methanol using regenerated cellulose membrane tubes (Spectra/Por 7) with a MWCO of 1 kDa. After dialysis, an aliquot was taken out and analyzed via MALDI-TOF-MS.
[0499] MALDI-TOF-MS (
BSA-SO1861 Synthesis
[0500] 2-iminothiolane (231 μg, 1.1 μmol) dissolved in 47 μL PBS was added to a BSA-RhodB solution (10 mg, 0.15 μmol) in 200 μL PBS and the mix was shaken for 40 min at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 40 min, the reaction mix was immediately run through a Sephadex G25 superfine size exclusion column (16 mL column volume) and SO1861-EMCH (1 mg, 0.5 μmol) dissolved in 100 μL PBS was added to the collected BSA-SH fraction. The reaction mixture was shaken for 12 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 12 h the BSA-SO1861 concentrated using centrifugal filtration at 4,000 rpm (15° C.) via Amicon Ultra 15 filters with a MWCO of 3 kDa. The conjugate was stored as solution in the fridge and aliquots were taken for analysis. Yield: not determined.
[0501] MALDI-TOF-MS (
Cy3-PAMAM
[0502] 720 μL PAMAM dissolved in methanol (30 mg, 1.04 μmol) was placed into a 250 mL round flask and methanol was removed via a rotary evaporator (20 mbar, 60° C.). Remaining PAMAM was dissolved in 9 mL DMSO. HATU (7.6 mg, 20 μmol) dissolved in 0.5 mL DMSO was added to a Cy3-COOH (0.6 mg, 1.2 μmol) solution in DMSO and the mix was shaken for 1 h at 800 rpm at room temperature on a ThermoMixer C (Eppendorf). After shaking for 1 h, the HATU-Cy3 solution was added to the stirring PAMAM solution and the reaction mix was stirred for 12 h at room temperature. After stirring for 12 h, the reaction mix was diluted with MilliQ water and dialyzed extensively for 24 h against MilliQ water using regenerated cellulose membrane tubes (Spectra/Por 6) with a MWCO of 2 kDa. After dialysis, the volume of the conjugate solution was reduced via a rotary evaporator (20 mbar, 60° C.) and the concentrated conjugate solution was run through a Sephadex G25 superfine size exclusion column (16 mL column volume). The first fraction was collected and lyophilized to obtain the viscous pink PAMAM-Cy3 conjugate. PAMAM-Cy3 conjugate formation was confirmed by chromatography on thin layer chromatography (methanol/water, v/v 1:1), and the appearance of a faster band on a Sephadex G 25 superfine column. Yield 21.3 mg (63%). The dye per PAMAM molar ratio determined by UV-Vis spectrophotometry was 0.43.
[0503] MALDI-TOF-MS (
Cy3-PAMAM-SO1861 Synthesis
[0504] Procedure is described exemplary for Cy3-PAMAM-(SO1861).sub.5. 2-iminothiolane (1 mg, 6.7 μmol) dissolved in 250 μL MilliQ water was added to a PAMAM-Cy3 solution (0.5 mg, 17 nmol) in 125 μL MilliQ water and the mix was shaken for 40 min at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 40 min, the reaction mix was immediately run through a Sephadex G25 superfine size exclusion column (16 mL column volume) and SO1861-EMCH (176 μg, 85 nmol) dissolved in 40 μL MilliQ water was added to the collected Cy3-PAMAM-SH fraction. The reaction mixture was shaken for 12 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 12 h, the reaction mix was diluted with MilliQ water and dialyzed extensively for 24 h against MilliQ water using regenerated cellulose membrane tubes (ZelluTrans, Carl Roth) with a MWCO of 12-14 kDa. After dialysis, the Cy3-PAMAM-SO1861 solution was concentrated using centrifugal filtration at 4000 rpm (15° C.) via Amicon Ultra 15 filters with a MWCO of 3 kDa. The conjugate was stored as solution in the fridge and aliquots were taken for analysis. Yield: 0.5 mg (75%).
[0505] MALDI-TOF-MS spectra are illustrated in
[0506] The synthesis of Cy3-PAMAM-(SO1861), Cy3-PAMAM-(SO1861).sub.13, Cy3-PAMAM-(SO1861).sub.51, and Cy3-PAMAM-(SO1861).sub.27, has been performed via the above described methodology but differ in the feed equivalents of the starting materials 2-iminothiolane and SO1861-EMCH. The respective feed equivalents of the starting materials and the respective mass of the conjugates are highlighted in Table 15.
TABLE-US-00021 TABLE 15 Reaction parameter for Cy3-PAMAM-SO1861 synthesis. SO1861- EMCH Mass of SO1861 feed conjugate molecules 2-Iminothiolane equivalents via attached feed equivalents to Cy3- MALDI- per Resulting to Cy3-PAMAM PAMAM TOF-MS PAMAM conjugate 384 6 38.7 kDa ~5 Cy3-PAMAM- (SO1861).sub.6, FIG. 33 B 384 20 53.9 kDa ~13 Cy3-PAMAM- (SO1861).sub.13, FIG. 33 C 384 57 133.9 kDa ~51 Cy3-PAMAM- (SO1861).sub.51, FIG. 33 D 8 5 37.7 kDa ~5 Cy3-PAMAM- (SO1861).sub.5, FIG. 34 A 32 30 87.0 kDa ~27 Cy3-PAMAM- (SO1861).sub.27, FIG. 34 B
Cy3-PAMAM-NC-SO1861 Synthesis
[0507] Cy3-PAMAM (0.5 mg, 18 nmol), SO1861 (2.3 mg, 1.24 μmol), and HATU (64.6 mg, 170 μmol) were dissolved separately in 200 μL DMSO. SO1861 and HATU solutions were mixed and shaken for 20 min at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 20 min, Cy3-PAMAM solution was added to the shaking SO1861-HATU solution and the reaction mixture was allowed to shake for 12 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 12 h, the reaction mix was diluted with MilliQ water and dialyzed extensively for 24 h against MilliQ water using regenerated cellulose membrane tubes (ZelluTrans, Carl Roth) with a MWCO of 12-14 kDa. After dialysis, the Cy3-PAMAM-NC-SO1861 solution was concentrated using centrifugal filtration at 4,000 rpm (15° C.) via Amicon Ultra 15 filters with a MWCO of 3 kDa. The Cy3-PAMAM-NC-(SO1861).sub.17 conjugate was stored as solution in the fridge and aliquots were taken for analysis. Yield: 0.77 mg (69%).
[0508] MALDI-TOF-MS (
G4-Dendron Dye Labeling and Deprotection
[0509] PFd-G4-Azide-NH-BOC (G4-dendron) (9.75 mg, 2.11 μmol) was placed into a 2 mL reaction tube (Eppendorf) and dissolved in 200 μL DMSO. 100 μL of a Cy5-DBCO solution in DMSO (1.72 μmol*mL.sup.−1, 170 nmol) was added to the G4-dendron solution and the mix was shaken for 12 hours at room temperature and 800 rpm on a ThermoMixer C (Eppendorf). After shaking for 12 h, the reaction mix was diluted with MilliQ water and dialyzed extensively for 24 h against MilliQ water using regenerated cellulose membrane tubes (Spectra/Por 7) with a MWCO of 1 kDa. After dialysis, the solution was lyophilized to obtain a blue powder. The crude product was used as obtained from lyophilization for the deprotection step.
[0510] Partially Cy5 labeled lyophilized G4-dendron was dissolved in 12 mL CHCl.sub.3 in 50 mL round flask with stirrer. 12 mL TFA was added and the reaction mix was stirred for 3 h at 800 rpm and room temperature on a RCT B magnetic stirrer (IKA Labortechnik). After stirring for 3 h, the solvent was removed under reduced pressure (50° C., 30 mbar) on a rotary evaporator (Heidolph WB 2000). After evaporation, the batch was dissolved in MilliQ water and run through a PD10 size exclusion column. G4-dendron conjugate formation was confirmed by chromatography on thin layer chromatography (methanol/water, v/v 1:1), and the appearance of a faster band on a PD10 column. Obtained fraction of size exclusion chromatography was lyophilized to obtain a blue powder.
[0511] Yield 5.7 mg (93%). The dye per G4-dendron molar ratio determined by UV-Vis spectrophotometry was 0.012.
[0512] MALDI-TOF-MS (
G4-Dendron-SO1861 Synthesis
[0513] Procedure is described exemplary for the lowest G4-dendron to SO1861-EMCH ratio. 2-iminothiolane (2.65 mg, 19.2 μmol) dissolved in 300 μL MilliQ water was added to a partially Cy5 labeled G4-dendron solution (0.577 mg, 192 nmol) in 252 μL MilliQ water and the mix was shaken for 40 min at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 40 min, the reaction mix was immediately run through a PD10 size exclusion column and SO1861-EMCH (1.19 mg, 575 nmol) dissolved in 100 μL MilliQ water was added to the collected G4-dendron-SH fraction. The reaction mixture was shaken for 12 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 12 h, the reaction mix was concentrated via centrifugal filtration using Amicon Ultra centrifugal filters (3 kDa MWCO). The conjugate was stored as solution in the fridge and aliquots were taken for analysis. Yield: 90 nmol (47%).
[0514] MALDI-TOF-MS spectra are illustrated in
[0515] The synthesis of other G4-dendron-(SO1861).sub.n conjugates has been performed via the above described methodology but differs in the feed equivalents of the starting material SO1861-EMCH. The respective feed equivalents of the starting materials and the respective mass of the conjugates are highlighted in Table 16.
TABLE-US-00022 TABLE 16 Reaction parameter for G4-dendron-SO1861 synthesis. SO1861- EMCH Mass of SO1861 2-Iminothiolane feed conjugates via molecules Resulting feed equivalents equivalents to MALDI- attached per MS to G4-dendron G4-dendron TOF-MS G4-dendron spectrum 100 3 5.07-10.18 kDa ~1-3 FIG. 49 C 100 10 5.07-11.64 kDa ~1-4 FIG. 49 B 100 22 6.20-22.02 kDa ~1-9 FIG. 49 A
PAMAM Thiolation
[0516] Procedure is described exemplary for the highest PAMAM to 2-iminothiolane ratio. To a PAMAM (333 μg, 12.8 nmol) solution dissolved in 30 μL methanol 2-iminothiolane (0.53 mg, 3.84 μmol) dissolved in 128 μL MilliQ water was added. The reaction mixture was shaken for 12 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 12 h, the reaction mix was washed 4 times with MilliQ water via centrifugal filtration using Amicon Ultra centrifugal filters (3 kDa MWCO) at 15° C. and 13500 rpm. After washing the sample was lyophilized to obtain a white solid. Yield was not determined.
[0517] MALDI-TOF-MS spectra are illustrated in
[0518] The synthesis of other PAMAM-iminothiolane conjugates has been performed via the above described methodology but differs in the feed equivalents of the starting material 2-iminothiolane. For the lowest 2-iminothiolane feed reaction Cy3-PAMAM has been used.
[0519] The respective feed equivalents of the starting materials and the respective mass of the conjugates are highlighted in Table 17.
TABLE-US-00023 TABLE 17 Reaction parameter for PAMAM-SH synthesis. 2-Iminothiolane Mass of Resulting feed equivalents conjugates via Iminothiolane molecules MS to PAMAM MALDI-TOF-MS attached per PAMAM spectrum 50 34.4 kDa ~16 FIG. 51 C 100 35.9 kDa ~65 FIG. 51 D 300 41.5 kDa ~108 FIG. 51 E
PAMAM PEGylation
[0520] Procedure is described exemplary for the lowest PAMAM to mPEG.sub.2k ratio. To a PAMAM (333 μg, 12.8 nmol) solution dissolved in 10 μL DMSO mPEG.sub.2k-NHS (0.268 mg, 128 nmol) dissolved in 13 L DMSO was added. The reaction mixture was shaken for 12 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 12 h, the reaction mix was diluted with MilliQ water and dialyzed extensively for 24 h against MilliQ water using regenerated cellulose membrane tubes (Spectra/Por 6) with a MWCO of 2 kDa. After dialysis, the batch was concentrated via centrifugal filtration using Amicon Ultra 15 mL centrifugal filters (10 kDa MWCO). The concentrated batch was run through a PD1 size exclusion column followed by lyophilization to obtain a white fluffy powder. Yield was not determined.
[0521] MALDI-TOF-MS spectra are illustrated in
[0522] The synthesis of other PAMAM-mPEG.sub.2k conjugates has been performed via the above described methodology but differs in the feed equivalents of the starting material mPEG.sub.2k-NHS. The respective feed equivalents of the starting materials and the respective mass of the conjugates are highlighted in Table 18.
TABLE-US-00024 TABLE 18 Reaction parameter for PAMAM-mPEG.sub.2k synthesis. mPEG.sub.2k-NHS feed Mass of Resulting equivalents conjugates via mPEG.sub.2k molecules MS to PAMAM MALDI-TOF-MS attached per PAMAM spectrum 10 28.5 kDa ~3 FIG. 52 C 20 43.0 kDa ~8 FIG. 52 D 100 62.8 kDa ~18 FIG. 52 E
Cy3-PAMAM-SO1861-DBCO Synthesis
[0523] Procedure is described exemplary for Cy3-PAMAM-(SO1861).sub.27-(DBCO).sub.10. Cy3-PAMAM-(SO1861).sub.27 (0.41 mg, 4.71 nmol) was freeze-fried and dissolved in 100 μL DMSO. DBCO-PEG 13-NHS ester (0.197 mg, 188 nmol) dissolved in DMSO was added to the Cy3-PAMAM-SO1861 solution and the mixture was shaken at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 3 h, the reaction mix was diluted with MilliQ water and dialyzed extensively for 24 h against MilliQ water using regenerated cellulose membrane tubes (ZelluTrans, Carl Roth) with a MWCO of 12-14 kDa. After dialysis, the Cy3-PAMAM-SO1861-DBCO solution was concentrated using centrifugal filtration at 4,000 rpm (15° C.) via Amicon Ultra 15 filters with a MWCO of 3 kDa. The conjugate was stored as solution in the fridge and aliquots were taken for analysis. Yield: 0.1 mg (22%).
[0524] MALDI-TOF-MS (
[0525] The synthesis of Cy3-PAMAM-(SO1861).sub.5-(DBCO).sub.38, and Cy3-PAMAM-(SO1861).sub.27-(DBCO).sub.10, have been performed via the above described methodology. The respective feed equivalents of the starting material and the respective mass of the conjugates are highlighted in Table 19.
TABLE-US-00025 TABLE 19 Reaction parameter for Cy3-PAMAM-SO1861-DBCO synthesis. DBCO- DBCO Used PEG13- Mass via molecules Cy3-PAMAM- NHS feed MALDI- attached per Resulting saponin batch equivalents TOF-MS PAMAM conjugate Cy3-PAMAM- 40 76.3 kDa ~38 Cy3- (SO1861).sub.5 PAMAM- (SO1861).sub.5- (DBCO).sub.38, FIG. 36 C Cy3-PAMAM- 40 92.5 kDa ~10 Cy3- (SO1861).sub.27 PAMAM- (SO1861).sub.27- (DBCO).sub.10, FIG. 36 D
Cy3-PAMAM-NC-SO1861-DBCO Synthesis
[0526] Cy3-PAMAM-NC-(SO1861).sub.17 (0.3 mg, 4.8 nmol) was freeze-fried and dissolved in 100 μL DMSO. DBCO-PEG.sub.13-NHS ester (0.202 mg, 194 nmol) dissolved in DMSO was added to the Cy3-PAMAM-NC-SO1861 solution and the mixture was shaken at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 3 h, the reaction mix was diluted with MilliQ water and dialyzed extensively for 24 h against MilliQ water using regenerated cellulose membrane tubes (ZelluTrans, Carl Roth) with a MWCO of 12-14 kDa. After dialysis, the Cy3-PAMAM-SO1861-DBCO solution was concentrated using centrifugal filtration at 4,000 rpm (15° C.) via Amicon Ultra 15 filters with a MWCO of 3 kDa. The conjugate was stored as solution in the fridge and aliquots were taken for analysis. Yield: 0.1 mg (22%). Mass spectrometry indicates the conjugation of 30 DBCO moieties per PAMAM molecule.
[0527] MALDI-TOF-MS (
EGFDianthin and Dianthin Expression
[0528] Plasmid-DNA (His-dianthin-EGF-pET11d or His-dianthin-pET11d) [20] was transformed into chemically competent Escherichia coli NiCo21 (DE3) (New England Biolabs®, Inc.) and grown in 3 mL lysogeny broth supplemented with 50 μg/mL ampicillin at 37° C. for 5 h at 200 rpm. These bacteria were used to inoculate 500 mL lysogeny broth supplemented with 50 μg/mL ampicillin for overnight culture at 37° C. Subsequently, the culture volume was scaled up to 2 L and bacteria were grown until an optical density (A600) of 0.9. Protein expression was induced by the addition of isopropyl β-D-1-thiogalactopyranoside (IPTG) at a final concentration of 1 mM. Cells were further grown for 3 h at 37° C. and 200 rpm. After centrifugation (5 min, 5,000 g, 4° C.) cell pellets were resuspended in 20 mL phosphate buffered saline (Dulbecco's phosphate-buffered saline (PBS) with Ca.sup.2+ and Mg.sup.2+, pH 7.4) and stored at −20° C. After thawing, proteins were released by ultrasound device (Branson Sonifier 250, G. Heinemann). The solution was centrifuged (15,800×g, 30 min, 4° C.) and adjusted to 20 mM imidazole concentration. The construct contained an N-terminal His-tag and was purified by nickel nitrilotriacetic acid chromatography (Ni-NTA Agarose, Qiagen, Hilden, Germany). After elution with imidazole (20-250 mM) the eluates were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) (12%). Fractions containing dianthin-EGF or dianthin were dialyzed against 2 L chitin binding domain buffer (20 mM tris(hydroxymethyl)-aminomethane/HCl, 500 mM NaCl, 1 mM EDTA, 0.1% Tween-20, pH 8.0) at 4° C. Further purification by chitin column affinity chromatography served to remove bacterial proteins with binding activity for Ni-NTA agarose. After elution with chitin binding domain buffer, the fractions were analyzed by SDS-PAGE (12%). Fractions containing dianthin-EGF or dianthin were dialyzed against 5 L PBS at 4° C. Purified proteins were concentrated by Amicon centrifugal filter devices (10 kDa, Millipore, Eschborn, Germany). The protein concentration was determined by a bicinchoninic acid assay (Pierce, Rockford, USA).
Dianthin-EGF-Alexa488 Synthesis
[0529] Dianthin-EGF (240 μg, 6.7 nmol) solution in PBS was placed into an Amicon Ultra 15 filter with a MWCO of 3 kDa and centrifuged at 4,000 rpm and 4° C. for 30 min three times. After each cycle, the Amicon filter was refilled with 0.1 M sodium carbonate buffer at pH 9. After the third centrifugation cycle, the volume was reduced to 0.5 mL via centrifugation. The dianthin-EGF sodium carbonate solution was placed into a 2 mL reaction tube and Alexa Fluor™ 488 5-TFP (50 μg, 56 nmol) dissolved in 10 μL DMSO was added to the protein solution. The mix was shaken at 800 rpm and room temperature on a ThermoMixer C (Eppendorf) for 80 min. After shaking, the mix was run through a Sephadex G25 M size exclusion column (GE Healthcare, PD10 column). The dianthin-EGF-Alexa488 conjugate was stored in solution in 0.1 M sodium carbonate buffer at pH 9 in the fridge and aliquots were taken for analysis.
[0530] Yield: 210 μg (85%).
[0531] MALDI-TOF-MS (
Dianthin-Alexa488 Synthesis
[0532] Dianthin (184 μg, 6.2 nmol) solution in PBS was placed into an Amicon Ultra 15 filter with a MWCO of 3 kDa and centrifuged at 4,000 rpm and 4° C. for 30 min three times. After each cycle, the Amicon filter was refilled with 0.1 M sodium carbonate buffer at pH 9. After the third centrifugation cycle, the volume was reduced to 0.5 mL via centrifugation. The dianthin sodium carbonate solution was placed into a 2 mL reaction tube and Alexa Fluor™ 488 5-TFP (16.7 μg, 19 nmol) dissolved in 3.5 μL DMSO was added to the protein solution. The mix was shaken at 800 rpm and room temperature on a ThermoMixer C (Eppendorf) for 80 min. After shaking, the mix was run through a Sephadex G25 M size exclusion column (GE Healthcare, PD 10 column). The dianthin-Alexa488 conjugate was stored in solution in 0.1 M sodium carbonate buffer at pH 9 in the fridge and aliquots were taken for analysis. Yield: not determined MALDI-TOF-MS (
Dianthin-EGF-Alexa488-S-S-PEG-N.sub.3, and Dianthin-EGF-Aexa488-PEG.sub.12-N.sub.3 Synthesis
[0533] Procedure is described exemplary for dianthin-EGF-Alexa488-S-S-PEG-N.sub.3. Dianthin-EGF-Alexa488 (70 μg, 1.9 nmol) sodium carbonate solution was placed into a 2 mL reaction tube and azido-PEG.sub.3-S—S-NHS (120 μg, 272 nmol) dissolved in 9 μL DMSO was added to the protein solution. The mix was shaken at 800 rpm and 15° C. on a ThermoMixer C (Eppendorf) for 12 h. After shaking, the reaction mix was diluted with PBS and was washed with PBS via centrifugal filtration at 4,000 rpm and 4° C. using Amicon Ultra 15 filter with a MWCO of 3 kDa.
[0534] Yield: 54 μg (70%).
[0535] MALDI-TOF-MS (
[0536] The synthesis of dianthin-EGF-Alexa488-S-S-PEG-N.sub.3, and dianthin-EGF-Alexa488-PEG.sub.12-N.sub.3 have been performed via the above described methodology but differed in the used azido-PEG linker. The respective azido-PEG linker, their feed equivalents, and the respective mass of the conjugates are highlighted in Table 20.
TABLE-US-00026 TABLE 20 Reaction parameter for dianthin-EGF-Alexa488-PEG-N3 synthesis Mass of conjugate Azido-PEG Azido-PEG via Used toxin linker linker feed MALDI- Resulting batch used equivalents TOF-MS conjugate Dianthin-EGF- Azido-PEG.sub.3- 135 40.8 kDa Dianthin-EGF- Alexa488 S-S-NHS Alexa488-S-S- PEG.sub.3-N.sub.3 Dianthin-EGF- Azido-PEG.sub.12- 135 43.3 kDa Dianthin-EGF- Alexa488 NHS Alexa488- PEG.sub.12-N.sub.3
Dianthin-Alexa488-S-S-PEG-N.SUB.3
[0537] Dianthin-Alexa488 (24.5 μg, 0.8 nmol) sodium carbonate solution was placed into a 2 mL reaction tube and azido-PEG.sub.3-S-S-NHS (34 μg, 78 nmol) dissolved in 9 μL DMSO was added to the protein solution. The mix was shaken at 800 rpm and 15° C. on a ThermoMixer C (Eppendorf) for 12 h. After shaking, the reaction mix was diluted with PBS and was washed with PBS via centrifugal filtration at 4,000 rpm and 4° C. using Amicon Ultra 15 filter with a MWCO of 3 kDa.
[0538] Yield: 10.3 μg (39%).
[0539] MALDI-TOF-MS (
Cy3-PAMAM-Saponin-Toxin Conjugate Synthesis
[0540] Procedure is described exemplary for Cy3-PAMAM-(SO1861).sub.27-DBCO. Cy3-PAMAM-(SO1861).sub.27-DBCO (17 Dg, 0.184 nmol) solution in MilliQ water was mixed with a dianthin-EGF-Aexa488-SS-PEG.sub.3-N.sub.3 (3.6 μg, 0.089 nmol) solution in PBS in a 1.5 mL reaction tube and the reaction mix was shaken at 800 rpm and 15° C. on a ThermoMixer C (Eppendorf) for 2 h. After shaking, small aliquots were taken out for analysis via SDS-PAGE and fluorescence imaging on a Molecular Imager® VersaDoc™ MP 4000 imaging system (Bio-Rad) (
[0541] The synthesis of Cy3-PAMAM-(SO1861).sub.5-S-S-Dianthin-EGF-Alexa488, Cy3-PAMAM-(SO1861).sub.27-S-S-Dianthin-EGF-Alexa488, Cy3-PAMAM-NC-(SO1861).sub.17-S-S-Dianthin-EGF-Alexa488, Cy3-PAMAM-NC-(SO1861).sub.17-S-S-Dianthin-Alexa488, and Cy3-PAMAM-NC-(SO1861).sub.17-Dianthin-EGF-Alexa488, have been performed via the above described methodology but differ in the used PAMAM-saponin-DBCO batch, the used azido-toxin batch, and their feed equivalents. The respective feed equivalents of the starting materials are highlighted in Table 21.
TABLE-US-00027 TABLE 21 Reaction parameter for Cy3-PAMAM-saponin-toxin synthesis. PAMAM- saponin- Azido- PAMAM- DBCO toxin saponin- feed feed DBCO equiv- Azido-toxin equiv- Resulting batch used alents batch used alents conjugate Cy3-PAMAM- 3 Dianthin-EGF- 1 Cy3-PAMAM- (SO1861).sub.5- Alexa488-S-S- (SO1861).sub.5-S-S- (DBCO).sub.38 PEG.sub.3-N.sub.3 Dianthin-EGF- Alexa488 Cy3-PAMAM- 2.1 Dianthin-EGF- 1 Cy3-PAMAM- (SO1861).sub.27- Alexa488-S-S- (SO1861).sub.27-S- (DBCO).sub.10 PEG.sub.3-N.sub.3 S-Dianthin- EGF-Alexa488 Cy3-PAMAM- 2.3 Dianthin-EGF- 1 Cy3-PAMAM- NC-(SO1861).sub.17- Alexa488-S-S- NC- (DBCO).sub.30 PEG.sub.3-N.sub.3 (SO1861).sub.17-S- S-Dianthin- EGF-Alexa488 Cy3-PAMAM- 7.1 Dianthin- 1 Cy3-PAMAM- NC-(SO1861).sub.17- Alexa488-S-S- NC- (DBCO).sub.30 PEG.sub.3-N.sub.3 (SO1861).sub.17-S- S-Dianthin- Alexa488 Cy3-PAMAM- 2.3 Dianthin-EGF- 1 Cy3-PAMAM- NC-(SO1861).sub.17- Alexa488- NC- (DBCO).sub.30 PEG.sub.12-N.sub.3 (SO1861).sub.17- Dianthin-EGF- Alexa488
Cy3-PAMAM-NC-SO1861 Synthesis Via Reductive Amination
[0542] Cy3-PAMAM (0.19 mg, 13 nmol) and SO1861 (0.73 mg, 0.39 μmol) were dissolved separately in 200 μL 0.1 M acetate buffer at pH 5. SO1861 and Cy3-PAMAM solutions were mixed and shaken for 20 min at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 20 min, NaCNBH.sub.3 (5 mg, 81 μmol) was added to the shaking reaction solution and the reaction mixture was allowed to shake for 12 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 12 h, the reaction mix was diluted with MilliQ water and dialyzed extensively for 24 h against MilliQ water using regenerated cellulose membrane tubes (ZelluTrans, Carl Roth) with a MWCO of 12-14 kDa. After dialysis, the Cy3-PAMAM-NC-SO1861 solution was concentrated using centrifugal filtration at 4,000 rpm (15° C.) via Amicon Ultra 15 filters with a MWCO of 3 kDa. The conjugate was stored as solution in the fridge and aliquots were taken for analysis. Yield: not determined MALDI-TOF-MS (
[0543] The synthesis of Cy3-PAMAM-NC-(SO1861).sub.30, and Cy3-PAMAM-NC-(SO1861).sub.10, have been performed via the above described methodology but differed in the time after which the reducing agent NaCNBH.sub.3 was added to the reaction batch. The respective time of the NaCNBH.sub.3 addition and the respective mass of the conjugates are highlighted in Table 22.
TABLE-US-00028 TABLE 22 Reaction parameter Cy3-PAMAM-NC-SO1861 synthesis via reductive amination. Time of shaking reaction SO1861 mix before Mass via molecules NaCNBH.sub.3 MALDI-TOF- attached per Resulting addition MS PAMAM conjugate 20 min 88.8 kDa ~30 Cy3-PAMAM-NC- (SO1861).sub.30, FIG. 40 C 12 h 48.0 kDa ~10 Cy3-PAMAM-NC- (SO1861).sub.10, FIG. 40 B
Poly(SO1861) Synthesis
[0544] SO1861-EMCH (0.13 mg, 63 nmol) was dissolved in 30 μL degassed MilliQ water. APS (0.2 μg, 0.8 nmol) dissolved in 4 μL degassed MilliQ water was added to the SO1861-EMCH solution and the solution was placed into a ThermoMixer C (Eppendorf) at 60° C. Then, TMEDA (cat., 0.5 μL) was added to the mix and the mix was shaken at 800 rpm and 60° C. on a ThermoMixer C (Eppendorf) for 2 h. After 2 h, a small aliquot was taken out for analysis via mass spectrometry.
[0545] MALDI-TOF-MS (
SO1861-EMCH Peptide Coupling
[0546] Customized peptide with the sequence SESDDAMFCDAMDESDSK (0.6 mg, 0.3 μmol) and SO1861-EMCH (0.8 mg, 0.39 μmol) were dissolved separately in 200 μL PBS. SO1861-EMCH and peptide solutions were mixed and shaken for 12 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking small aliquots were taken out for analysis. Yield: not determined MALDI-TOF-MS (
Cell Viability Assay
[0547] After treatment the cells were incubated for 72 hr at 37° C. before the cell viability was determined by a MTS-assay, performed according to the manufacturer's instruction (CellTiter 96® AQueous One Solution Cell Proliferation Assay, Promega). Briefly, the MTS solution was diluted 20× in DMEM without phenol red (PAN-Biotech GmbH) supplemented with 10% FBS (PAN-Biotech GmbH). The cells were washed once with 200 μL PBS per well, after which 100 μL diluted MTS solution was added per well. The plate was incubated for approximately 20-30 minutes at 37° C. Subsequently, the optical density at 492 nm was measured on a Thermo Scientific Multiskan FC plate reader (Thermo Scientific). For quantification the background signal of ‘medium only’ wells was subtracted from all other wells, before the ratio of untreated/treated cells was calculated, by dividing the background corrected signal of untreated wells over the background corrected signal of the treated wells.
FACS Analysis
[0548] HeLa cells were seeded in DMEM (PAN-Biotech GmbH) supplemented with 10% fetal calf serum (PAN-Biotech GmbH) and 1% penicillin/streptomycin (PAN-Biotech GmbH), at 500,000 c/plate in 10 cm dishes and incubated for 48 hrs (5% CO.sub.2, 37° C.), until a confluency of 90% was reached. Next, the cells were trypsinized (TryplE Express, Gibco Thermo Scientific) to single cells. 0.75×10.sup.6 Cells were transferred to a 15 mL falcon tube and centrifuged (1,400 rpm, 3 min). The supernatant was discarded while leaving the cell pellet submerged. The pellet was dissociated by gentle tapping the falcon tube on a vortex shaker and the cells were washed with 4 mL cold PBS (Mg.sup.2+ and Ca.sup.2+ free, 2% FBS). After washing the cells were resuspended in 3 mL cold PBS (Mg.sup.2+ and Ca.sup.2+ free, 2% FBS) and divided equally over 3 round bottom FACS tubes (1 mL/tube). The cells were centrifuged again and resuspended in 200 μL cold PBS (Mg.sup.2+ and Ca.sup.2+ free, 2% FBS) or 200 μL antibody solution; containing 5 μL antibody in 195 μL cold PBS (Mg.sup.2+ and Ca.sup.2+ free, 2% FBS). APC Mouse IgG1, κ Isotype Ctrl FC (#400122, Biolegend) was used as isotype control, and APC anti-human EGFR (#352906, Biolegend) was used to stain the EGFR receptor, HER2: APC anti-human CD340 (erbB2/HER-2) (324408, Biolegend). CD71: APC anti-human CD71 #334108, Biolegend. Samples were incubated for 30 min at 4° C. on a tube roller mixer. Afterwards, the cells were washed 3× with cold PBS (Mg.sup.2+ and Ca.sup.2+ free, 2% FBS) and fixated for 20 min at room temperature using a 2% PFA solution in PBS. Cells were washed 2× with cold PBS, and resuspended in 250-350 μL cold PBS for FACS analysis. Samples were analyzed with a BD FACSCanto II flow cytometry system (BD Biosciences) and FlowJo software.
TABLE-US-00029 TABLE 23 Expression levels of EGFR, HER2 and CD71 of various cells EGFR HER2 CD71 expression expression expression Cell line level (MFI) level (MFI) level (MFI) MDA-MB-468 1656 1 186 A431 1593 10 322 CaSki 481 12 189 SK-BR-3 28 1162 331 JIMT-1 58 74 107 HeLa 91 7 312 A2058 1 5 59
Results
[0549] Considering available chemical groups for conjugation reactions to the SO1861 molecule, four chemical groups have been identified. The alcohols and diols of the sugar residues, the aldehyde group on the triterpenoid backbone, the carboxylic acid on one of the sugar residues (glucuronic acid), and the alkene group on the triterpenoid backbone as highlighted in
[0550] In view of the pros and cons of each identified chemical group (Table 24), the aldehyde and alcohol groups are best suitable for reversible conjugation reactions, while the alkene and the carboxylic acid (glucuronic acid) are the groups best suitable for irreversible/stable conjugation reactions. The aldehyde group within the molecule structure of SO1861, however, is the most suitable for reversible conjugation reactions over the alcohols. On the one hand, because there is only one aldehyde present in the structure that allows chemoselective reactions. On the other hand, because the aldehyde can perform reversible conjugation reactions with a variety of chemical groups such as amines, hydrazides, and hydroxylamines forming acid-cleavable moieties like imines, hydrazones, and oximes. This factor enables a freedom of choice over the chemical group for the desired reversible conjugation reaction. Contrary, the alcohols are good candidates for reversible conjugation reaction via the formation of acetals and ketals as well, but lack in chemoselectivity since they are present in a large quantity on the glycosidic structure.
[0551] For the formation of an irreversible and stable bond the carboxylic acid is the most suitable since it can form amides and esters with the common tools used in peptide chemistry (e.g. reaction with amines via carbodiimide mediated amide formation).
TABLE-US-00030 TABLE 24 Functional groups that are available for saponin conjugation reactions Functional Group Pros Cons Alcohol Suitable for reversible Acetal/ketal formation (Diols) acetal/ketal formation without chemoselectivity Suitable for ester formations Ester formation without with activated carboxylic acids chemoselectivity Aldehyde Suitable for chemoselective Not suitable for acetal reversible hydrazone formation formation in the presence with hydrazides of unprotected saponin Suitable for chemoselective sugar diols reversible imine formation with amines Suitable for chemoselective reversible oxime formation with hydroxylamines Alkene Suitable for chemoselective Not suitable for reversible irreversible radical reactions conjugation reactions Not suitable for reactions involving a hydrogenation step Carboxylic Suitable for chemoselective Not suitable for reversible acid amide/ester formation with conjugation reactions amines and alcohols under mild conditions after activation
[0552] Thus, for the development of an endosomal escape enhancing saponin (such as SO1861) a methodology has been established that allows the generation of a non-cleavable and cleavable ‘ready to conjugate’ saponins (
[0553] For producing non-cleavable ‘ready to conjugate’ saponins the carboxylic group of SO1861 is activated via a reagent used in peptide coupling chemistry to generate an active ester (e.g. 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate, HATU). The resulting active ester of SO1861 is able to react with amines forming stable amide bonded conjugates (
[0554] For producing cleavable ‘ready to conjugate’ saponins the aldehyde group of SO1861 is reacted with an EMCH (ε-maleimidocaproic acid hydrazide) linker. The hydrazide group of EMCH forms an acid cleavable hydrazone band with the aldehyde of SO1861. At the same time the EMCH linker presents a maleimide group that is thiol (sulfhydryl group) reactive and thus can be conjugated to thiols (
[0555] The maleimide group of SO1861-EMCH performs a rapid and specific Michael addition reaction with thiols and thiol bearing polymeric structures when carried out in a pH range of 6.5-7.5 (
[0556] Regarding an ideal EMCH spacer length for conjugation to a polymeric structure, computer simulation (PerkinElmer, ChemBio3D, Ver. 13.0.0.3015) shows that the maleimide group on SO1861-EMCH is located at the periphery of the molecule and thus should be accessible for thiol bearing polymeric structures (
[0557] To synthesize the SO1861-EMCH, a strategy has been developed that allows the conversion of the aldehyde group on the SO1861 to EMCH (
[0558] For testing the pH dependent hydrolysis of the hydrazone bond, SO1861-EMCH was dissolved in an HCl solution at pH 3 and MALDI-TOF-MS spectra were recorded at two different points in time (
[0559] In order to conjugate SO1861-EMCH to a polymeric structure, accessible amines of the polymeric structure are converted into thiols with the aid of the agent 2-iminothiolane. The generated free thiols on the polymeric structure act then as the nucleophile for the thiol-ene Michael-type addition to the maleimide group of SO1861-EMCH (
[0560] First proof of concept for conjugation of ‘ready-to conjugate saponins’ to a polymeric structure was obtained by use of the amine of a protein (poly amino acid scaffold example), bovine serum albumin (BSA). After conjugation, mass spectrometry obtained the corresponding peaks of BSA-SO1861 at m/z ˜70, ˜72, and ˜74 kDa (
[0561] Next proof of concept for conjugation of ‘ready-to conjugate saponins’ to a polymeric structure was obtained by the use of the amine bearing generation 5 (G5) dendrimer poly(amidoamine) (PAMAM with covalently coupled red-fluorescent dye (Cy3)). PAMAM-Cy3 was utilized as the polymeric structure for the conjugation to both SO1861-EMCH and SO1861-HATU and served as a model for conjugation of SO1861 to a polymeric structure (
[0562] All accessible amine groups of Cy3-PAMAM were converted into thiols using a 3 fold excess of 2-iminothiolane per Cy3-PAMAM amines followed by the reaction with SO1861-EMCH. Three different feed equivalents (5, 20 and 57) of SO1861-EMCH were used for the three reaction batches. After reaction, the recorded masses of the Cy3-PAMAM-SO1861 conjugates at MALDI-TOF-MS show an increment of the corresponding masses with increasing the SO1861-EMCH feed (
[0563] In another reaction, only a certain number of PAMAM amines were converted into thiols prior to reaction with SO1861-EMCH. Here, two different feed equivalents of 2-Iminothiolane (8 and 32) and two different feed equivalents of SO1861-EMCH (5 and 30) were used, respectively. After reaction, the respective spectra of the Cy3-PAMAM-SO1861 conjugates at MALDI-TOF-MS show peaks at m/z 37.7 kDa (5 feed equivalents of SO1861-EMCH) and at m/z 87.0 kDa (30 feed equivalents of SO1861-EMCH) as shown in
[0564] For the generation of a non-pH-cleavable saponin conjugate the carboxylic acid of SO1861 was activated with HATU and then reacted with the amines of Cy3-PAMAM forming a pH stable amide bound between Cy3-PAMAM and SO1861. The resulting mass of the conjugate was detected via MALDI-TOF-MS with a mass of m/z 62.3 kDa that corresponds to Cy3-PAMAM-NC-SO1861 (NC=non-cleavable) conjugate with 17.5 SO1861 molecules attached per PAMAM (
[0565] Next, the saponin conjugated scaffolds were conjugated to linking points for a possible conjugation to targeted therapeutics (e.g. targeted toxins) via the so-called strain-promoted alkyne-azide cycloaddition (SPAAC, click chemistry) to obtain a functionalized scaffold. For this reaction, Cy3-PAMAM-SO1861 (
[0566] Dianthin-EGF served as a model targeted toxin and dianthin served as a non-targeted toxin. Both toxins were labeled with Alexa Fluor™ 488 using the tetrafluorophenyl ester (TFP) derivative of the dye. The dye labeled proteins were then conjugated to a heterobifunctional NHS-SS-PEG.sub.3-azide linker to obtain the corresponding chemical moiety for the SPAAC to the PAMAM-saponin conjugates. Maldi-TOF-MS measurements showed that one Alexa Fluor™ 488 dye and 9 NHS-SS-PEG.sub.3-azide molecules were attached per dianthin-EGF molecule (
[0567] The Cy3-PAMAM-NC-SO1861-DBCO and Cy3-PAMAM-SO1861-DBCO conjugates were reacted with Alexa Fluor™ 488 labeled azido-toxins to perform a strain-promoted alkyne-azide cycloaddition. The conjugation between the reacting agents was indicated via gel electrophoresis and the co-localization of the fluorescent signals of Cy3 that is only attached on the PAMAM polymer and Alexa Fluor™ 488 that is only attached on the toxins on a polyacrylamide gel after gel electrophoresis (
[0568] As an alternative polymeric structure to the PAMAM dendrimer, a G4-dendron (PFd-G4-Azide-NH-BOC, Polymer Factory) with 16 functional amino end groups and an azido group at the focal point was utilized for the conjugation to SO1861 (
[0569] The previous examples demonstrate that a methodology has been developed that allows the conjugation of a determined amount of SO1861 molecules or other endosomal escape enhancer molecules to a polymeric structure for enhanced cytoplasmic delivery of therapeutic substances such as targeted toxins.
[0570] To further test other conjugation methodologies of SO1861 to a polymeric structure, the reductive amination pathway was used. For this, the aldehyde group of SO1861 was directly conjugated to PAMAM amines forming an imine bound. The imine bond formation was followed a reductive amination step through the addition of the reductive agent sodium cyanoborohydride forming a pH-stable amine bond between SO1861 and PAMAM (
[0571] Another approach for the development of a SO1861 scaffold among the discussed polymer, and protein approach is the poly(SO1861) approach. The idea of this approach is to generate a polymer that consists of SO1861 molecules only, with pH sensitive cleavable bonds that release the SO1861. In addition, the poly(SO1861) should be able to perform conjugation reactions to toxins and biopolymers. The main goal with this approach is to keep it as simple and cost effective as possible. Since a protocol for the generation of acid cleavable SO1861 has been developed already (SO1861-EMCH approach) it would be interesting to see if it is possible to polymerize the SO1861-EMCH through simple addition of a polymerization initiator without further modifying the SO1861 or identifying other conjugation sites on the SO1861 molecule. In the past, several papers have discussed the polymerization of maleimide groups by using radical initiators which attack the double bond of the maleimide group and thus initiate a radical polymerization along the double bonds of the maleimides (29-31). Since SO1861-EMCH reveals a maleimide group in its structure this group could potentially be explored for radical polymerization reactions to yield a poly(SO1861) with acid cleavable function. If the polymerization reaction has a reasonable reaction time the generated SO1861 polymers could be quenched with a radical quencher that not only quenches the reaction but also generates a functional group for toxin or biopolymer conjugation. Such a reaction scheme is illustrated in
[0572] In free radical polymerization the reaction conditions have a huge influence on the polymer properties and the reaction outcome. For instance, temperature, monomer concentration, and initiator concentration play a major role for forming the polymer and have to be fine-tuned according to the desired polymer properties. As radical polymerizations are usually carried out at temperatures above 50° C., the first reactions have been performed at a temperature of 60° C. It was interesting to see if the SO1861-EMCH polymerization can be initiated spontaneously and if APS and TMEDA would have an influence on the polymerization degree. Thus, three reactions have been carried out, using the same SO1861-EMCH concentration, but differ in their APS/TMEDA composition. In the first reaction only the SO1861-EMCH was heated up to 60° C. for 3 h, while the second reaction contained SO1861-EMCH and APS, and the third reaction contained SO1861-EMCH, APS, and TMEDA. (For these experiments the same amount and concentration of starting materials have been used which are mentioned in the Materials and Methods section “Poly(SO1861) synthesis”). The batches have been analyzed via MALDI-TOF-MS as shown on
[0573] Another approach for the development of a SO1861 scaffold is the DNA approach. The idea of this approach is to utilize the concept of the so-called DNA-origami (Kolb et al, 2004; Bird et al, 1988). DNA-origami as the polymeric or assembled polymeric structure to conjugate saponins to it, can offer several inherent advantages including stability, scalability, and precise control of the final size and shape of the resulting DNA-saponin scaffold. Since these DNA nanocarriers are comprised of natural DNA, they are biocompatible and do not show toxicity to living cells, and can ease the release of cargo from internal cellular compartments. The multivalency of such a structure can further allow fine-tuning targeting capabilities and high capacity for a variety of payloads such as fluorophores and toxins. Thus, in this approach DNA strands are identified that offer chemical functional groups on the 3′ and 5′ endings respectively, and that are able to hybridize only in certain wanted areas of the sequence that allow a control over the final shape of the construct. The chemical groups should be utilized to couple saponins, for instance though a thiol-ene reaction between the already developed SO1861-EMCH and a thiol group on one of the 3′ and 5′ DNA strands. The complementary DNA strand can offer a click function group that can be used for coupling to a targeted toxin. The concept is illustrated in
[0574] A similar approach is imaginable by using a specific peptide sequence instead of DNA strands that is able to bind and release saponins and that can be polymerized forming a large poly(peptide)-like structure. In this approach, a peptide sequence has been identified and purchased that has a length fitting the calculated size of a SO1861-EMCH molecule, that offers a cysteine residue in the middle of the sequence, and that obtains an amine group at both the N-terminus and C-terminus. The cysteine residue can be utilized to conjugate SO1861-EMCH via a thiol-ene reaction of the maleimide group of SO1861-EMCH and the thiol group of the cysteine residue. The two amine groups can be utilized to polymerize the peptide-SO1861 conjugate with a suitable crosslinker as shown on
[0575] Conjugation studies have shown that the conjugation of SO1861-EMCH to the customized peptide (sequence: SESDDAMFCDAMDESDSK) was successful. The peptide that bears a maleimide reactive cysteine in the middle of the sequence and its conjugation to SO1861-EMCH was analyzed via MALDI-TOF-MS (
[0576] Since the endosomal escape enhancing properties of SO1861 are only exposed at low endosomal pH (<pH5), the scaffold or functionalized scaffold should not contain chemical groups that are able to interfere in acidification of the endosomes and thus block the activity of SO1861. The amine containing polymeric structures of a G5 PAMAM (128 primary amines as well as approximately 126 tertiary amines) and G4-dendron (16 primary amines) were tested, in order to determine if these molecules inhibit the endosomal escape enhancing capacity of SO1861. Co-administration experiments of PAMAM (native or thiolated) or dendron (native) in combination with dianthin-EGF and various SO1861 concentrations on HeLa cells were performed. As control for the inhibition of endosomal acidification chloroquine was used.
[0577] HeLa cells show sufficient EGFR cell surface levels (
[0578] These results demonstrate that the presence of a certain number of free amino groups on polymeric structures, such as PAMAM, can block endosomal acidification and thus inhibit the endosomal escape activity of SO1861 or other glycosides. When the number of amino groups is lower, as shown for the G4-dendron, or if the amino groups have been shielded, such as thiolation or PEGylation, the inhibitory effect is reversed.
REFERENCES
[0579] Weng, A.; Thakur, M.; Beceren-Braun, F.; Bachran, D.; Bachran, C.; Riese, S. B.; Jenett-Siems, K.; Gilabert-Oriol, R.; Melzig, M. F.; Fuchs, H. The toxin component of targeted anti-tumor toxins determines their efficacy increase by saponins. Molecular oncology 2012, 6, 323-332. saponinum album in a synergistic way. Journal of immunotherapy 2009, 32, 713-725. [0580] Sama, S.; Jerz, G.; Schmieder, P.; Joseph, J. F.; Melzig, M. F.; Weng, A. Plant derived triterpenes from Gypsophila elegans M. Bieb. enable non-toxic delivery of gene loaded nanoplexes. Journal of Biotechnology 2018, 284, 131-139 [0581] Kolb, H. C.; Finn, M. G.; Sharpless, K. B. Click Chemistry: Diverse Chemical Function from a Few Good Reactions. Angewandte Chemie 2001, 40, 2004-2021. [0582] Bird, R. E.; Hardmann, K. D.; Jacobson, J. W.; Johnson, S.; Kaufman, B. M.; Lee, S. M.; Lee, T.; Pope, S. H.; Riordan, G. S.; Whitlow, M. Single-chain antigen-binding proteins. Science 1988, 242, 423-426. [0583] Y Zhang, Z Qu, S Kim, V Shi, B Liao1, P Kraft, R Bandaru, Y Wu, L M Greenberger and I D Horak, Down-modulation of cancer targets using locked nucleic acid (LNA)-based antisense oligonucleotides without transfection, Gene Therapy (2011) 18, 326-333