Use of composition comprising stem cell-derived exosome as effective ingredient for suppression or alleviation of pruritus

Abstract

The present invention provides a composition for preventing, suppressing, alleviating, ameliorating or treating pruritus comprising stem cell-derived exosomes as an active ingredient. The composition of the present invention is able to act against pruritus-inducing multiple cytokine targets, for example, IL-4, IL-31 and TSLP, and thus is able to be widely applied against pruritus caused by various factors and is able to effectively suppress and alleviate pruritus. In addition, when the composition of the present invention is applied directly to human skin, it is able to remarkably ameliorate pruritus-associated clinical scores, erythema and the like. Thus, the composition of the present invention is able to be used as a pharmaceutical composition, a skin external preparation and a cosmetic composition for preventing, suppressing, alleviating, ameliorating or treating pruritus.

Claims

1. A method for suppressing, alleviating, ameliorating or treating pruritus mediated by thymic stromal lymphopoietin (TSLP) in a subject in need thereof, the method comprising: administering an effective amount of a composition comprising exosomes as an active ingredient to the subject, said exosomes being derived from adipose-derived stem cells; and decreasing expression and/or production of TSLP in the subject.

2. The method of claim 1, wherein the exosomes are obtained by performing the steps of: (a) adding trehalose to a conditioned medium of adipose-derived stem cells; (b) filtering the conditioned medium having the trehalose added thereto; (c) isolating exosomes from the filtered conditioned medium by tangential flow filtration (TFF); and (d) adding trehalose to a buffer for diafiltration, and performing diafiltration on the isolated exosomes by the TFF using the buffer having the trehalose added thereto.

3. The method of claim 2, wherein the diafiltration is performed continuously or discontinuously.

4. The method of claim 2, wherein the diafiltration is performed using a buffer having at least 4 times volume of the isolated exosomes.

5. The method of claim 2, wherein the TFF is carried out using a TFF filter having a molecular weight cutoff (MWCO) of 100,000 Da, 300,000 Da, 500,000 Da, or 750,000 Da, or a 0.05 μm filter.

6. The method of claim 2, wherein step (c) further comprises concentrating the isolated exosomes to a volume of 1/100 to 1/25 by the TFF.

7. The method of claim 1, wherein the exosomes decrease expression levels of IL-4, IL-31 and TSLP in skin tissue or skin cells.

8. The method of claim 1, wherein the subject is at least one selected from the group consisting of humans, dogs, cats, rodents, horses, cattle, monkeys and pigs.

9. A method for suppressing, alleviating, ameliorating or treating pruritus mediated by thymic stromal lymphopoietin (TSLP) in a subject in need thereof, the method comprising: (a) (a1) applying a composition comprising exosomes as an active ingredient to a skin of the subject, said exosomes being derived from adipose-derived stem cells; or (a2) contacting or attaching a patch, a mask pack or a mask sheet, which has the composition applied thereto or soaked therein, to the skin; or (a3) sequentially performing (a1) and (a2); and (b) decreasing expression and/or production of TSLP in the skin tissue and/or the skin cells of the subject.

10. The method of claim 9, wherein the exosomes are contained in or mixed with at least one of hydrogel, hyaluronic acid, salt of hyaluronic acid, and hyaluronate gel.

11. The method of claim 10, wherein the hydrogel is obtained by dispersing a gelled polymer in a polyhydric alcohol.

12. The method of claim 11, wherein the gelled polymer is at least one selected from the group consisting of pluronic, purified agar, agarose, gellan gum, alginic acid, carrageenan, cassia gum, xanthan gum, galactomannan, glucomannan, pectin, cellulose, guar gum, and locust bean gum, and the polyhydric alcohol is at least one selected from the group consisting of ethylene glycol, propylene glycol, 1,3-butylene glycol, isobutylene glycol, dipropylene glycol, sorbitol, xylitol, and glycerin.

13. The method of claim 9, wherein the composition is used in at least one form selected from the group consisting of patches, mask packs, mask sheets, creams, tonics, ointments, suspensions, emulsions, pastes, lotions, gels, oils, packs, sprays, aerosols, mists, foundations, powders, and oilpapers.

14. The method of claim 13, wherein the composition is applied to or soaked in at least one surface of the patch, mask pack or mask sheet.

15. The method of claim 9, further comprising (c) performing iontophoresis by allowing a microcurrent to flow through the skin having the composition applied thereto.

16. The method of claim 15, further comprising contacting or attaching an iontophoresis device to the skin.

17. The method of claim 16, wherein the iontophoresis device comprises at least one battery selected from the group consisting of flexible batteries, lithium-ion secondary batteries, alkaline batteries, dry cells, mercury batteries, lithium batteries, nickel-cadmium batteries, and reverse electrodialysis batteries, or comprises a patch, a mask pack or a mask sheet provided with the at least one battery.

18. The method of claim 9, wherein the subject is at least one selected from the group consisting of humans, dogs, cats, rodents, horses, cattle, monkeys and pigs.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

(2) FIG. 1 is a flowchart illustrating a method of isolating and purifying exosomes in a method of preparing exosomes from culture media of stem cells according to one embodiment of the present invention.

(3) FIG. 2 shows the results of measuring the relative amount of proteins contained in a solution in each step of preparing exosomes from culture media of stem cells according to one embodiment of the present invention. The relative amount of proteins in each step was expressed as the relative ratio of the total amount of proteins in solution of each step to the total amount of proteins in conditioned media of stem cells. The experimental results as shown are the results obtained from two different batches, respectively.

(4) FIG. 3 shows the results of measuring the productivity and purity of exosomes obtained according to one embodiment of the present invention. The productivity of exosomes was calculated as the number of exosome particles obtained per mL of conditioned media of stem cells (CM), and the purity of exosomes was calculated as the number of exosome particles per μg of proteins contained in a final fraction. The experimental results as shown are the results obtained from five different batches, respectively.

(5) FIGS. 4A to 4E show the results of analyzing the physical properties of exosomes obtained according to one embodiment of the present invention. “FIG. 4A” shows the particle size distribution and the number of particles obtained by tunable resistive pulse sensing (TRPS) analysis. “FIG. 4B” shows the particle size distribution and the number of particles obtained by nanoparticle tracking analysis (NTA). “FIG. 4C” shows different magnifications of particle images obtained by transmitted electron microscopy (TEM) analysis. “FIG. 4D” shows the results of Western blot analysis of exosomes obtained according to one embodiment of the present invention. “FIG. 4E” shows the results of flow cytometry for CD63 and CD81 in the analysis of markers for exosomes obtained according to one embodiment of the present invention.

(6) FIGS. 5A to 5C show the results of NTA analysis of particle size distributions, which indicate that exosomes having a uniform particle size distribution and high purity are obtained by the addition of trehalose. As the amount of trehalose added increases, a particle size distribution with a single peak can be obtained.

(7) FIGS. 6A to 6C show the results of NTA analysis that indicate particle size distributions obtained depending on whether or not trehalose was added in a process of preparing exosomes according to one embodiment of the present invention. “FIG. 6A” shows the results obtained when trehalose was added throughout the preparation process; “FIG. 6B” shows the results obtained in the case that conditioned media are freeze-stored and thawed, and then trehalose was added to the thawed media; and “FIG. 6C” shows the results obtained when no trehalose was added. “FIG. 6D” shows the results of comparing the relative productivity and relative concentration of exosomes isolated by the methods of FIGS. 6A to 6C. “FIG. 6E” shows the mean size of exosomes isolated by the methods of FIGS. 6A to 6C.

(8) FIGS. 7A and 7B depict graphs showing the results of real-time PCR performed to examine changes in the mRNA expression levels of IL-4 and IL-31 (which cause pruritus) in samples obtained from skin lesion of animal model 1, after treating mice, in which atopy with pruritus was induced, with exosomes according to one embodiment of the present invention.

(9) FIGS. 8A and 8B depict graphs showing the results of real-time PCR performed to examine changes in the mRNA expression levels of IL-4 and IL-31 (which cause pruritus) in samples obtained from skin lesion of animal model 2, after treating mice, in which atopy with pruritus was induced, with exosomes according to one embodiment of the present invention.

(10) FIGS. 9A and 9B show results indicating that the mRNA expression and protein production of TSLP decreased when human keratinocyte HaCaT cells were treated with exosomes according to one embodiment of the present invention.

(11) FIG. 10 shows the results of measuring fluorescence intensity to identify exosomes stained with PKH67.

(12) FIG. 11 depicts fluorescence microscopic images showing the extent to which fluorescently stained exosomes were delivered into porcine skin tissue.

(13) FIG. 12 depicts confocal fluorescence microscopic images showing the extent to which fluorescently stained exosomes were delivered into mouse skin tissue.

(14) FIG. 13 shows graphs comparing the total fluorescence intensity obtained by measuring the fluorescence intensity on each image of FIG. 12.

(15) FIG. 14 shows results indicating that exosomes according to one embodiment of the present invention were not cytotoxic after human fibroblast HS68 cells were treated with the exosomes.

(16) FIG. 15 depicts photographs comparing skin conditions between before and after the treatment of human skin with a test product containing exosomes according to one embodiment of the present invention.

(17) FIG. 16 depicts photographs showing that erythema and the like on human skin (affected part) were remarkably ameliorated as a result of applying a composition including exosomes according to one embodiment of the present invention to human skin (affected part) and then performing iontophoresis to allow a microcurrent to flow through human skin (affected part) to which the composition was applied.

EXAMPLES

(18) Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the following examples are only to illustrate the present invention and are not intended to limit or restrict the scope of the present invention. Those that can be easily inferred by those skilled in the art from the detailed description and examples of the present invention are interpreted as falling within the scope of the present invention. References referred to in the present invention are incorporated herein by reference.

(19) Throughout the present specification, it is to be understood that, when any part is referred to as “comprising” any component, it does not exclude other components, but may further include other components, unless otherwise specified.

Example 1

Cell Culture

(20) Human dermal fibroblast HS68 cells purchased from ATCC were subcultured in DMEM (purchased from ThermoFisher Scientific) medium containing 10% fetal bovine serum (FBS; purchased from ThermoFisher Scientific) and 1% antibiotics-antimycotics (purchased from ThermoFisher Scientific) at 37° C. under 5% CO.sub.2. Furthermore, human keratinocyte HaCaT cells were subcultured in DMEM medium supplemented with 10% FBS and 1 vol % penicillin-streptomycin at 37° C. under 5% CO.sub.2.

(21) According to a cell culture method known in the technical field to which the present invention pertains, adipose-derived stem cells were cultured at 37° C. under 5% CO.sub.2. Next, the cells were washed with phosphate-buffered saline (purchased from ThermoFisher Scientific), and then the medium was replaced with serum-free, phenol red-free medium, and the cells were cultured for 1 to 10 days. The supernatant (hereinafter, referred to as “conditioned medium”) was recovered.

(22) In order to obtain exosomes having a uniform particle size distribution and high purity in an exosome isolation process, 2 wt % of trehalose was added to the conditioned medium. After addition of trehalose, the conditioned medium was filtered through 0.22 μm filter to remove impurities, such as cell debris, waste, macroparticles and the like. From the filtered conditioned medium, exosomes were immediately isolated. In addition, the filtered conditioned medium was stored in a refrigerator (10° C. or below), and then used for exosome isolation. Furthermore, the filtered conditioned medium was freeze-stored in an ultra-low temperature freezer at −60° C. or below, thawed, and then subjected to exosome isolation. Thereafter, exosomes were isolated from the conditioned medium by TFF.

Example 2

Isolation and Purification of Exosomes by TFF Method

(23) For isolating, concentrating and diafiltrating exosomes from the conditioned medium filtered through 0.22 μm filter in Example 1, TFF method was used. The filtered conditioned medium was sonicated to loose potential aggregation of exosomes before isolating and concentrating exosomes using TFF. As a filter for TFF method, a cartridge filter (known as a hollow fiber filter; purchased from GE Healthcare) or a cassette filter (purchased from Pall, Sartorius or Merck Millipore) was used. The TFF filter may be selected with various molecular weight cutoffs (MWCOs). Using the filter having selected MWCO, exosomes were isolated and concentrated, and particles, proteins, lipids, nucleic acids, low-molecular-weight compounds, etc., were removed, which are smaller than the MWCO.

(24) To isolate and concentrate exosomes, a TFF filter having MWCO of 100,000 Da (Dalton), 300,000 Da or 500,000 Da was used. Exosomes were isolated from the conditioned medium by removing substances smaller than the MWCO and concentrating the conditioned medium to a volume of about 1/100 to 1/25 by the TFF method.

(25) The isolated and concentrated solution of exosomes was additionally subjected to diafiltration. The diafiltration was performed continuously (continuous diafiltration) or discontinuously (discontinuous diafiltration), using a buffer having at least 4 times, preferably at least 6 to 10 times, more preferably at least 12 times volume of the isolated exosomes. To obtain exosomes having a uniform particle size distribution and high purity, 2 wt % trehalose in PBS was added to the buffer. FIGS. 6A to 6E show the results that by the addition of trehalose, exosomes having a uniform particle size distribution and high purity can be obtained in high yield.

Example 3

Analysis of Characteristics of Isolated Exosomes

(26) The amounts of proteins of the isolated exosomes, the conditioned medium and the fractions of TFF isolation process were measured using BCA colorimetric assay (purchased from ThermoFisher Scientific) or FluoroProfile fluorescence assay (purchased from Sigma). With regard to exosomes isolated and concentrated by the TFF method according to one embodiment, the extent, to which proteins, lipids, nucleic acids, low-molecular-weight compounds, etc. were removed, was monitored by the protein assays, and the results of the monitoring are shown in FIG. 2. As a result, it could be seen that proteins present in the conditioned medium were very effectively removed by the TFF method according to one embodiment.

(27) FIG. 3 shows the results of comparing the productivity and purity of exosomes in each of five independent batches when exosomes were isolated by the TFF method according to one embodiment. The results obtained from the five independent batches were analyzed, and as a result, it was confirmed that exosomes were very stably isolated by the TFF method according to one embodiment.

(28) The particle size and concentration of the isolated exosomes were measured by nanoparticle tracking analysis (NTA) instrument (purchased from Malvern) or tunable resistive pulse sensing (TRPS) instrument (purchased from Izon Science). The uniformity and size of the isolated exosomes were analyzed by transmission electron microscopy (TEM). FIGS. 4A to 4C show the results of TRPS, NTA and TEM of the exosomes isolated by the isolation method according to one embodiment of the present invention.

(29) After exosomes were isolated, the size distribution of the exosomes was analyzed by NTA depending on whether trehalose was added. The results of the analysis are shown in FIGS. 5A to 5C. The concentration of trehalose was increased from 0 wt % to 1 wt % and 2 wt % (from the top to the bottom in FIGS. 5A to 5C), and the experiment was repeated three times. It was confirmed that when no trehalose was used, particles having a size of 300 nm or more were observed, whereas as the amount of trehalose added was increased, the number of particles having a size of 300 nm or more decreased and the size distribution of the exosomes became uniform.

(30) The effect due to the addition of trehalose in the process of isolating exosomes by the TFF method was additionally examined. As shown in FIGS. 6A to 6C, when 2 wt % trehalose in PBS was added throughout the process of preparing exosomes, exosomes having a uniform size distribution could be obtained (FIG. 6A). However, when the conditioned medium, which had been freeze-stored without adding trehalose, was used, but the TFF process was performed with adding trehalose only in the diafiltration process, or the TFF process was performed without adding any trehalose, uneven exosomes including a large amount of large particles were obtained (FIGS. 6B and 6C).

(31) The relative productivity and concentration of the isolated exosomes were compared, and as a result, exosomes could be obtained with very high productivity when trehalose was added throughout the exosome production process. The obtained exosomes were at least 5 times concentration of the control (in which trehalose was not added throughout the exosome production process) (FIG. 6D). As shown in the NTA analysis result, it was confirmed that the mean size of the isolated exosomes was uniform (200 nm) when trehalose was added throughout the exosome production process (FIG. 6E).

(32) FIG. 4D shows the results of Western blot analysis of the exosomes isolated by the isolation method according to one embodiment of the present invention. As shown therein, the presence of CD9, CD63, CD81 and TSG101 markers was confirmed. As antibodies for each of the markers, anti-CD9 (purchased from Abcam), anti-CD63 (purchased from System Biosciences), anti-CD81 (purchased from System Biosciences) and anti-TSG101 (purchased from Abcam) were used, respectively.

(33) FIG. 4E shows the results of flow cytometry of the exosomes isolated by the isolation method according to one embodiment of the present invention. As shown therein, the presence of CD63 and CD81 markers was confirmed. To isolate CD63-positive exosomes, an Exosome-Human CD63 Isolation/Detection Reagent kit (purchased from ThermoFisher Scientific) was used according to the manufacturer's instruction. The markers were stained with PE-Mouse anti-human CD63 (purchased from BD) or PE-Mouse anti-human CD81 (purchased from BD), and then analyzed using a flow cytometer (ACEA Biosciences).

(34) Taking the above results together, it could be confirmed that the isolation method according to one embodiment of the present invention could economically and efficiently isolate and purify exosomes having a uniform particle size distribution and high purity in high yield by adding trehalose in the isolation and/or purification process based on tangential flow filtration. In addition, it could be seen that the processes of the isolation method according to one embodiment of the present invention can be scaled-up and are also suitable for GMP.

Example 4

Measurement of Cytotoxicity Following Exosome Treatment

(35) In order to evaluate the cytotoxicity of exosomes, isolated by the isolation method according to one embodiment of the present invention, in human skin fibroblast HS68 cells, the cells were treated with various concentrations of the exosomes, and the proliferation rate of the cells was examined. Specifically, HS68 cells were suspended in 10% FBS-containing DMEM, and then seeded and grown to 80 to 90% confluency and cultured in an incubator at 37° C. under 5% CO.sub.2 for 24 hours. After 24 hours, the medium was removed, and the cells were treated with various concentrations of the exosomes prepared in Example 2. Then, the viability of the cells was evaluated while the cells were cultured for 24 to 72 hours. The cell viability was measured using WST-1 reagent (purchased from Takara), MTT reagent (purchased from Sigma), CellTiter-Glo reagent (purchased from Promega) or alamarBlue reagent (purchased from ThermoFisher Scientific) with a microplate reader (purchased from Molecular Devices).

(36) As a control, the cells cultured in conventional cell culture medium not treated with the exosomes was used. It was confirmed that the exosomes of the present invention showed no cytotoxicity in the concentration range used in the test (FIG. 14).

Example 5

Animal Model 1

(37) Male NC/Nga mice (16 to 18 g, 5-week-old; purchased from Central Laboratory Animal Inc.) were purchased, adapted for 7 days, and then used in this experiment. The adapted mice were divided into five groups as follows after dermatitis with pruritus was induced in the mice.

(38) (1) Normal: Normal control group;

(39) (2) Vehicle (dermatitis-induced group): negative control group in which dermatitis with pruritus was induced by house dust mite extracts;

(40) (3) IV: a test group in which the exosomes prepared in Example 2 were intravenously (IV) injected at a dose of 2.8 μg/head three times a week for two weeks, after dermatitis with pruritus was induced by house dust mite extracts;

(41) (4) SC: a test group in which the exosomes prepared in Example 2 were subcutaneously (SC) injected at a dose of 2.8 μg/head three times a week for two weeks, after dermatitis with pruritus was induced by house dust mite extracts; and

(42) (5) Pred: a test group in which prednisolone was administered orally every day, after dermatitis with pruritus was induced by house dust mite extracts.

(43) The auricles of each of NC/Nga mice (purchased from Central Laboratory Animal Inc.) was shaved with a razor, and then depilated by applying a suitable amount of a depilatory. After wiping off the depilatory, AD induction reagent (house dust mite extracts; purchased from BioStir Inc.) was applied uniformly to the auricles by a micropipette tip. After shaving with a razor, if necessary, 150 μL of 4% SDS aqueous solution was applied uniformly to the auricles by a micropipette tip. After the auricles were dried with cold air from a dryer and further dried naturally for about 2 to 3 hours, AD induction reagent was applied uniformly to the auricles by a micropipette tip. All the pretreatments were performed twice a week for 3 weeks, i.e. six times in total.

(44) Before starting administration of the exosomes prepared in Example 2, clinical skin score assessment was performed. According to the ranked scores, the animals were randomly grouped so that the average score of each group was distributed as uniformly as possible.

Example 6

Animal Model 2

(45) To evaluate the dose-dependent effect of exosomes, mice were divided into 9 groups as follows after dermatitis with pruritus was induced as described in Example 5 above.

(46) (1) Normal: normal control group (indicated by “N” in FIGS. 8A and 8B);

(47) (2) Control (dermatitis-induced group): a negative control group in which dermatitis with pruritus was induced by house dust mite extracts (indicated by “C” in FIGS. 8A and 8B);

(48) (3) IV, L (exosome, low): a test group in which the exosomes prepared in Example 2 above were intravenously (IV) injected at a dose of 0.14 μg/head three times a week for 4 weeks, after dermatitis with pruritus was induced by house dust mite extracts;

(49) (4) W, M (exosome, medium): a test group in which the exosomes prepared in

(50) Example 2 above were intravenously (IV) injected at a dose of 1.4 μg/head three times a week for 4 weeks, after dermatitis with pruritus was induced by house dust mite extracts;

(51) (5) IV, H (exosome, high): a test group in which the exosomes prepared in Example 2 above were intravenously (IV) injected at a dose of 10 μg/head three times a week for 4 weeks, after dermatitis with pruritus was induced by house dust mite extracts;

(52) (6) SC, L (exosome, low): a test group in which the exosomes prepared in Example 2 above were subcutaneously (SC) injected at a dose of 0.14 μg/head three times a week for 4 weeks, after dermatitis with pruritus was induced by house dust mite extracts;

(53) (7) SC, M (exosome, medium): a test group in which the exosomes prepared in Example 2 above were subcutaneously (SC) injected at a dose of 1.4 μg/head three times a week for 4 weeks, after dermatitis with pruritus was induced by house dust mite extracts;

(54) (8) SC, H (exosome, high): a test group in which the exosomes prepared in Example 2 above were subcutaneously (SC) injected at a dose of 10 μg/head three times a week for 4 weeks, after dermatitis with pruritus was induced by house dust mite extracts; and (9) Pred: a test group in which prednisolone was administered orally every day, after dermatitis with pruritus was induced by house dust mite extracts (indicated by “P” in FIGS. 8A and 8B).

(55) Dermatitis induction was performed as described in Example 5, and an excessive amount of AD induction reagent was applied so that the mean clinical skin score at the time of administration of the exosomes was 9. Before starting administration of the exosomes prepared in Example 2, clinical skin score assessment was performed. According to the ranked scores, the animals were randomly grouped so that the average score of each group was distributed as uniformly as possible.

Example 7

Measurement of mRNA Expression Levels of Cytokines

(56) In order to examine whether the exosomes of the present invention have the effect of suppressing and alleviating pruritus and whether the exosomes can be widely applied against pruritus caused by various factors, the mRNA expression levels of IL-4 and IL-31 were analyzed. IL-4 is widely known as a pruritus-inducing cytokine, and it was reported that skin pruritus is induced in transgenic mice expressing IL-4 in the epidermis (Journal of Investigative Dermatology (2001) 117, pp. 977-983). In addition, it was reported that IL-31 is overexpressed in atopic dermatitis patients showing pruritus and that pruritus is induced in transgenic mice overexpressing IL-31 (J Allergy Clin Immunol (2006) 117, pp. 411-417). Furthermore, it was reported that IL-31 induces pruritus by binding to 31RA/OSMR receptor (European Journal of Allergy and Clinical Immunology (2018) 73, pp. 29-36) and that treatment with an antibody against IL-31 receptor A alleviates pruritus (New England Journal of Medicine (2017) 376; 9, pp. 826-835). Accordingly, if the production or expression levels of IL-4 and IL-31 in skin tissue or blood are analyzed after treatment with a candidate substance, the effects of the candidate substance on the suppression and alleviation of pruritus could be evaluated.

(57) First, animals from animal model 1 of Example 5 and animal model 2 of Example 6 were sacrificed and the tissue of skin lesion site was dissected therefrom. Thereafter, from the total RNA obtained from the tissue dissected from animals from animal model 1, cDNA was synthesized and subjected to real-time PCR. The changes in the mRNA expression levels of IL-4 and IL-31 which are the major causes of pruritus were measured by the real-time PCR. In addition, from the total RNA obtained from the tissue dissected from animals of animal model 2, cDNA was synthesized and subjected to real-time PCR. The changes in the mRNA expression levels of IL-4 and IL-31 which are the major causes of pruritus were measured by the real-time PCR. As a reference gene for normalizing the above genes expression, GAPDH gene was used. The sequences of primers used in the real-time PCR are shown in Table 1 below.

(58) TABLE-US-00001 TABLE 1 Nucleotide Sequences of Primers used in Real-Time PCR Sequences Forward primer Reverse primer Genes (5′ .fwdarw. 3′) (5′ .fwdarw. 3′) IL-4 ACA GGA GAA GGG GAA GCC CTA CAG ACG CCA T ACG AGC T CA (SEQ ID NO: 1) (SEQ ID NO: 2) IL-31 CAC ACA GGA ACA  CGA TAT TGG GGC  ACG AAG C C ACC GAA G (SEQ ID NO: 3) (SEQ ID NO: 4) GAPDH CAT GGC CTT CCG  CCT GCT TCA CCA  TGT TCC TA CCT TCT TG A T (SEQ ID NO: 5) (SEQ ID NO: 6)

(59) Through the experiment on animal model 1, it was confirmed that the expression levels of both IL-4 and IL-31 (which cause pruritus) in all the groups (IV and SC) treated with the exosomes of the present invention decreased (FIGS. 7A and 7B). In addition, through the experiment on animal model 2, it was confirmed that the expression levels of both IL-4 and IL-31 (which cause pruritus) in all the groups (IV and SC) treated with the exosomes of the present invention decreased in a dose-dependent manner (FIGS. 8A and 8B). Thus, the exosomes of the present invention are able to act against both of IL-4 and IL-31 (which are major targets causing pruritus), and thus are able to be widely applied against pruritus caused by various factors and can effectively suppress and alleviate pruritus.

Example 8

Measurement of TSLP Suppressing Effect Using HaCaT Cells

(60) It is known that TSLP is overexpressed in human epithelial cells or keratinocytes of patients with severe pruritus and is a substance that causes skin pruritus. Thus, by confirming if a specific candidate substance suppresses TSLP induced in skin keratinocytes or not, the effect of the candidate substance on the suppression or alleviation of pruritus can be confirmed. Human keratinocyte HaCaT cells were suspended in DMEM (purchased from ThermoFisher Scientific) supplemented with 10% FBS, 1% amphotericin B (purchased from Sigma) and 1% penicillin-streptomycin, and then seeded into each well of a 12-well plate at a density of 1×10.sup.5 cells and cultured for 24 hours. Next, the cells were additionally cultured in serum-free DMEM medium for 24 hours. Then, the adherent cells were washed twice with PBS, and in serum-free medium, not treated or treated with Poly I:C (purchased from Sigma) and histamine (purchased from Sigma) without or with the exosomes of the present invention (exosomes prepared in Example 2) according to the groups shown in FIG. 9A, and cultured for 24 hours. From RNA isolated from HaCaT cells of each group, cDNA was synthesized and subjected to real-time PCR, and the change in the mRNA expression level of TSLP which is the major cause of pruritus was measured by the real-time PCR. As a reference gene for normalizing the TSLP gene expression, β-actin gene was used. The sequences of primers used in the real-time PCR are shown in Table 2 below.

(61) TABLE-US-00002 TABLE 2 Nucleotide sequences of primers used in real-time PCR Sequences Forward primer Reverse primer Genes (5′ .fwdarw. 3′) (5′ .fwdarw. 3′) TSLP GCTATCTGGTGCCCAGGCTAT CGACGCCACAATCCTTGTAAT (SEQ ID NO: 7) (SEQ ID NO: 8) β-actin GGCCATCTCTTGCTCGAAGT GACACCTTCAACACCCCAGC (SEQ ID NO: 9) (SEQ ID NO: 10)

(62) In addition, human keratinocyte HaCaT cells were suspended in DMEM (purchased from ThermoFisher Scientific) supplemented with 10% FBS (fetal bovine serum), 1% amphotericin B (purchased from Sigma) and 1% penicillin-streptomycin, and then seeded into each well of a 6-well plate at a density of 5×10.sup.5 cells and cultured for 24 hours. Next, the cells were additionally cultured in serum-free DMEM medium for 24 hours. Then, the adherent cells were washed twice with PBS, and in serum-free medium, not treated or treated with Poly I:C (purchased from Sigma) without or with the exosomes of the present invention (exosomes prepared in Example 2) according to the groups shown in FIG. 9B, and cultured for 24 hours. In each group, the amount of TSLP protein was measured by Western Blotting using TSLP antibody (Abcam, Cambridge, Mass.). The amount of protein was quantified by BCA assay using BSA (bovine serum albumin) as a reference material. The amount of TSLP protein in each group was normalized by the amount of GAPDH protein.

(63) As a result, it was confirmed that the exosomes of the present invention decreased the mRNA expression level and protein production of TSLP (which causes pruritus) in skin keratinocytes (FIGS. 9A and 9B). Thus, the exosomes of the present invention are able to act against TSLP (which is a major target causing pruritus), and thus effectively suppress and alleviate pruritus.

Example 9

Test for Skin Penetration Ability of Exosomes

(64) To prepare fluorescently stained exosomes, PKH67 dye (purchased from Sigma) was used. 1 mM PKH67 was diluted in Diluent C (purchased from Sigma) to prepare 10 μM PKH67 solution. The solution was mixed with a suitable concentration of exosome solution and allowed to react at room temperature under a light-shielded condition for 10 minutes. After completion of the reaction, MW3000 spin column (purchased from ThermoFisher Scientific) was used to remove the remaining free PKH67 dye from the exosomes stained with PKH67 (hereinafter, abbreviated as “PKH-exosomes”). After removing PKH67 that did not react with the exosomes, analysis was performed using a fluorometer (purchased from Molecular Devices), and as a result, it was confirmed that fluorescence with sufficient intensity was detected in the PKH-exosomes (FIG. 10).

(65) The PKH-exosomes were dispersed in phosphate buffered saline (PBS) at a suitable concentration, for example, a concentration of 1×10.sup.5 particles/mL to 1×10.sup.9 particles/mL, and applied to the outer surface of porcine skin. The porcine skin was covered with nonwoven fabric to prevent drying of the PKH-exosome solution, and then the PKH-exosomes and the skin tissue allowed to react for a suitable time, for example 30 minutes to 1 hour, so that the PKH-exosomes reached the subcutaneous tissue of the porcine skin. Alternatively, after the PKH-exosomes were applied to the outer surface of the porcine skin and the skin was covered with nonwoven fabric, a microcurrent was allowed to flow through the skin for a predetermined time, for example, 30 minutes to 1 hour. After completion of the reaction, the porcine skin tissue was fixed overnight in 3.7% formaldehyde solution, and washed three times with PBS for 5 minutes each time. The washed porcine skin tissue was soaked in 30% sucrose solution, and then treated with OCT compound. Next, the tissue was washed three times with PBS for 5 minutes each time, and then sectioned using a microtome. The tissue section was placed on a slide glass. Meanwhile, preparation of the tissue section may be performed before the tissue is fixed with formaldehyde solution. The fluorescence detected from the PKH-exosomes in the tissue section was observed using a fluorescence microscope. As a result, it was confirmed that the PKH-exosomes were delivered through the epidermis of the porcine skin tissue into the subcutaneous tissue (FIG. 11). As shown in FIG. 11, the exosomes of the present invention could effectively penetrate through the skin barrier, so that it could be delivered deep into the skin tissue and effectively absorbed into the skin.

(66) Therefore, a skin external preparation or cosmetic composition containing the exosomes as an active ingredient will effectively act in the prevention, suppression, alleviation, amelioration or treatment of pruritus.

(67) Next, the skin tissue of hairless mice was dissected and placed in the upper chamber of a Franz diffusion cell. The inside of the diffusion cell was filled with PBS. The PKH-exosomes were dispersed in PBS at a suitable concentration, for example, a concentration of 1×10.sup.5 particles/mL to 1×10.sup.9 particles/mL, and then applied to the outer surface of the mouse skin tissue. At this time, nonwoven fabric was pre-placed on the outer surface of the mouse skin tissue in order to prevent drying of the PKH-exosome solution, and the PKH-exosome solution was injected between the nonwoven fabric and the skin tissue. Then, the PKH-exosomes and the skin tissue were allowed to react for 30 minutes to 1 hour. Alternatively, after the PKH-exosome solution was injected between the nonwoven fabric and the skin tissue, a microcurrent was allowed to flow through the skin tissue for a predetermined time, for example, 30 minutes to 1 hour. After completion of the reaction, the PKH-exosomes delivered into the skin tissue were immediately observed with a confocal fluorescence microscope (Leica, SP8X), or the skin tissue and the PKH-exosome solution were additionally allowed to react for 1 to 6 hours, and then the PKH-exosomes were observed with a confocal fluorescence microscope. As a result, it was confirmed that the exosomes of the present invention are able to effectively penetrate through the skin barrier, so that exosomes of the present invention are able to be delivered deep into the skin tissue and effectively absorbed into the skin (FIGS. 12 and 13).

(68) Therefore, a skin external preparation or cosmetic composition containing the exosomes as an active ingredient will effectively act in the prevention, suppression, alleviation, amelioration or treatment of pruritus.

Example 10

Treatment of Human Skin with Composition Containing Exosomes as Active Ingredient

(69) A “test product” composed of an ampoule which contains the exosomes obtained according to one embodiment of the present invention (containing a translucent milky liquid composition), a liquid-soaked sheet mask (a white sheet mask soaked with the above translucent milky liquid) and a percutaneous penetration-promoting sheet mask (a silvery sheet mask including an iontophoresis device) was applied once to the face of a person with severe face flushing and skin trouble associated with pruritus (hereinafter, referred to as “case 1”). It was evaluated whether the skin trouble and the face flushing were alleviated or ameliorated. In addition, the test product was applied once to the face of a person with face flushing (hereinafter, referred to as “case 2”). It was evaluated whether the overall skin tone and the face flushing were ameliorated.

(70) With only single use of the “test product” containing the exosomes of the present invention, the face flushing and skin trouble of “case 1” was remarkably ameliorated (see case 1 of FIG. 15), and the overall skin tone of “case 2” was ameliorated and the face flushing of “case 2” was alleviated (see case 2 of FIG. 15). Thus, a skin external preparation or cosmetic composition containing the exosomes of the present invention as an active ingredient has the effect of preventing, suppressing, alleviating or ameliorating face flushing and skin trouble associated with pruritus.

(71) In addition, the composition containing the exosomes obtained according to one embodiment of the present invention, that is, a suspension containing the exosomes of the present invention, was applied to the affected parts (hand, neck, arm, etc.) of three severe atopic patients complaining of pruritus, three times a week for 1 to 2 weeks, and then iontophoresis allowing a microcurrent to flow through the composition-applied affected part was performed using an iontophoresis device. As a result, severe pruritus in the patients was remarkably alleviated, and erythema of the patients was also remarkably ameliorated (FIG. 16). In the patients to which the composition containing the exosomes of the present invention was applied, severe pruritus and erythema were alleviated and ameliorated so that the prescription of steroids or anti-histamines for these patients would be stopped.

(72) Thus, a skin external preparation or cosmetic composition containing, as an active ingredient, the exosomes obtained by the isolation method according to one embodiment of the present invention, exhibits the effect of preventing, suppressing, alleviating, ameliorating or treating pruritus, as confirmed through the above-described clinical tests.

Example 11

Preparation of Cosmetic Composition Containing Exosomes of the Present Invention

(73) 1704 μg/mL of the exosomes prepared in Example 2 above was mixed with and suspended in the components shown in Table 3 below, thereby preparing a cosmetic composition (lotion). The content of each component is shown in Table 3 below.

(74) TABLE-US-00003 TABLE 3 Components and their contents of lotion containing exosomes of the present invention Components Contents (wt %) Exosomes prepared in Example 2 1 Glycerin 7.375 Caprylic/capric triglyceride 6 Cetyl ethylhexanoate 5 Propanediol 5 Phenyl trimethicone 3.5 Stearic acid 3 1,2-hexanediol 2 Panthenol 2 Cetearyl olivate 1.8 Sorbitan olivate 1.2 Diisostearyl malate 1 Fructan 1 Ammonium acryloyldimethyl taurate/VP copolymer 0.3 Arachidyl alcohol 0.25 Behenyl alcohol 0.15 Arachidyl glucoside 0.1 Hydrogenated lecithin 0.1 Shea butter 0.09 Xanthan gum 0.05 Lavender oil 0.02 Bergamot oil 0.02 Ceramide NP 0.02 Orange peel oil 0.02 Phytospingosine 0.015 Palmitoyl tetrapeptide-7 0.01 Palmitoyl tripeptide-1 0.01 Purified water Balance

(75) Although the present invention has been described with reference to the embodiments, the scope of the present invention is not limited to these embodiments. Any person skilled in the art will appreciate that various modifications and changes are possible without departing from the spirit and scope of the present invention and these modifications and changes also fall within the scope of the present invention.