RAPID ANEUPLOIDY DETECTION

20220259668 · 2022-08-18

    Inventors

    Cpc classification

    International classification

    Abstract

    This document provides methods and materials for identifying chromosomal anomalies that can be used to identify a mammal as having a disease (e.g., cancer or congenital abnormality). For example, this document provides methods and materials for evaluating sequencing data to identify a mammal as having a disease associated with one or more chromosomal anomalies (e.g., cancer or congenital abnormalities). For example, this document provides methods and materials for evaluating sequencing data that can be used in cancer diagnostics, non-invasive prenatal testing (NIPT), preimplantation genetic diagnosis and evaluation of congenital abnormalities.

    Claims

    1. A method of testing for the presence of aneuploidy in a genome of a mammal comprising: a) amplifying a plurality of chromosomal sequences in a DNA sample with a pair of primers complementary to the chromosomal sequences to form a plurality of amplicons, wherein the primer pair amplifies a sufficient number of sequences to allow aneuploidy detection; b) determining at least a portion of the nucleic acid sequence of one or more of the plurality of amplicons; c) mapping the sequenced amplicons to a reference genome; d) dividing the DNA sample into a plurality of genomic intervals; e) quantifying a plurality of features for the amplicons mapped to the genomic intervals; f) comparing the plurality of features of amplicons in a first genomic interval with the plurality of features of amplicons in one or more different genomic intervals; and g) wherein a number of amplicons sufficient to detect aneuploidy are formed in the step of amplifying, thereby testing for the presence of aneuploidy in the genome of the mammal.

    2. The method of claim 1, wherein the DNA sample comprises a plurality of euploid DNA samples.

    3. The method of claim 1, wherein the DNA sample comprises a plurality of test DNA samples.

    4. The method of claim 3, wherein the test DNA comprises DNA of unknown ploidy.

    5. The method of claim 1, wherein the DNA sample is from plasma.

    6. The method of claim 1, wherein the DNA sample is from serum.

    7. The method of claim 1, wherein the DNA sample comprises cell free DNA.

    8. The method of any one of claims 1 to 7, wherein the DNA sample comprises at least 3 picograms of DNA.

    9. The method of any one of claims 1 to 8, wherein the mammal is a human.

    10. The method of any one of claims 1 to 9, wherein the pair of primers comprises a first primer and a second primer chosen from Table 1, e.g., a first primer comprising SEQ ID NO: 1 and a second primer comprising SEQ ID NO: 10, or a first primer with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 1 and a second primer with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 10.

    11. The method of any one of claims 1 to 10, wherein one or more additional pairs of primers amplifies one or more additional pluralities of chromosomal sequences in the DNA sample in step (a).

    12. The method of any one of claims 1 to 11, wherein said amplicons comprise one or more repetitive elements shown in Table 1.

    13. The method of claim 12, wherein said amplicons comprise unique short interspersed nucleotide elements (SINEs).

    14. The method of any one of claims 1 to 13, wherein the average length of the amplicons is 100 basepairs or less.

    15. The method of any one of claims 1 to 14, wherein said amplicons comprise one or more long amplicons where the average length of the long amplicons is 1000 basepairs or greater.

    16. The method of claim 15, wherein said long amplicons comprise DNA from a contaminating cell.

    17. The method of claim 16, wherein the contaminating cell is a leukocyte.

    18. The method of any one of claims 1 to 17, wherein the plurality of amplicons comprises sequences on a plurality of, e.g., 2 or more, different chromosomes.

    19. The method of any one of claims 1 to 18, wherein the genomic intervals comprise from about 100 nucleotides to about 125,000,000 nucleotides.

    20. The method of any one of claims 1 to 19, wherein quantifying amplicons mapped to genomic intervals comprises identifying a plurality of genomic intervals with one or more shared amplicon features.

    21. The method of claim 20, wherein the shared amplicon feature is the number of the mapped amplicons.

    22. The method of claim 20, wherein the shared amplicon feature is the average length of the mapped amplicons.

    23. The method as in any one of claims 20 to 22, wherein the plurality of genomic intervals with shared amplicon features are grouped into one or more clusters.

    24. The method of claim 23, wherein each cluster comprises about two hundred genomic intervals.

    25. The method of claim 23, wherein the clusters comprise predefined clusters.

    26. The method of any one of claims 1 to 25, wherein the comparison of the genomic intervals further comprises matching one or more genomic intervals from test samples to predefined clusters.

    27. The method of claim 26, wherein matching genomic intervals from test samples to predefined clusters further comprises identifying one or more genomic intervals with shared amplicon features outside a predetermined significance threshold for a predefined cluster.

    28. The method of any one of claims 1 to 27, wherein testing for the presence of aneuploidy comprises supervised machine learning.

    29. The method of claim 28, wherein the supervised machine learning employs a support vector machine model.

    30. A pair of primers for the amplification of a plurality of amplicons from a DNA sample comprising a first primer comprising a sequence that is at least 80% identical to SEQ ID NO: 1 and a second primer comprising a sequence that is at least 80% identical to SEQ ID NO: 10.

    31. The pair of primers of claim 30, wherein the sequence of the first primer is at least 90% identical to SEQ ID NO. 1

    32. The pair of primers of claim 30, wherein the sequence of the first primer is at least 95% identical to SEQ ID NO. 1.

    33. The pair of primers of claim 30, wherein the sequence of the first primer is or comprises a sequence that is 100% identical to SEQ ID NO. 1 and/or the sequence of the second primer is or comprises a sequence that is 100% identical to SEQ ID NO. 2.

    34. The pair of primers of any one of claims 30 to 32, wherein the sequence of the second primer is at least 90% identical to SEQ ID NO. 10.

    35. The pair of primers of any one of claims 30 to 32, wherein the sequence of the second primer is at least 95% identical to SEQ ID NO. 10.

    36. The pair of primers of any one of claims 30 to 32, wherein the sequence of the second primer is or comprises a sequence that is 100% identical to SEQ ID NO. 10.

    37. A kit for the amplification of a plurality of amplicons from a DNA sample comprising a pair of primers, wherein a first primer of the primer pair comprises SEQ ID NO: 1 and a second primer of the primer pair comprises SEQ ID NO: 10.

    38. The method of any one of claims 1 to 29, wherein at least 10,000 amplicons are formed in the step of amplifying.

    39. The method of any one of claims 1 to 37, wherein at least 20,000 amplicons are formed in the step of amplifying.

    40. The method of any one of claims 1 to 37, wherein at least 50,000 amplicons are formed in the step of amplifying.

    41. The method of any one of claims 1 to 37, wherein at least 100,000 amplicons are formed in the step of amplifying.

    42. A method of evaluating a subject for the presence of, or the risk of developing, each of a plurality of cancers in the subject comprising: (i) acquiring a value for the presence of one or more mutations in each of one or more driver genes, wherein each driver gene is associated with the presence, or risk, of a cancer of the plurality of cancers; (ii) acquiring, a value for the level of each of a plurality of protein biomarkers, wherein the level of each protein biomarker of the plurality is associated with the presence, or risk, of a cancer of the plurality of cancers; (iii) acquiring a value for aneuploidy, wherein the aneuploidy value is a function of the copy number or length of a genomic sequence disposed between at least two terminal repeated elements of a repeated element family (RE Family), wherein the RE family comprises: (a) a RE Family other than a long interspersed nucleotide element (LINE); (b) a RE Family which when amplified with a primer moiety complementary to its repeated terminal elements, provides amplicons having an average length of less than X nts, wherein X is 100, 105, or 110, (c) a RE family which is less than about 700 bp long; or (d) a RE family which is present in at least 100 copies per genome; wherein the aneuploidy is associated with the presence, or risk, of a cancer of the plurality of cancers; thereby evaluating the subject for the presence of or risk of developing, any of the plurality of cancers.

    43. The method of claim 42, wherein one of (i), (ii) and (iii) is directly acquired.

    44. The method of claim 42, wherein (i) and (ii) are directly acquired.

    45. The method of claim 42, wherein (i) and (iii) are directly acquired.

    46. The method of claim 42, wherein (i) and (ii) are directly acquired.

    47. The method of claim 42, wherein all of (i), (ii) and (iii) are directly acquired.

    48. The method of claim 42, wherein one of (i), (ii) and (iii) is indirectly acquired.

    49. The method of claim 42, wherein (i) and (ii) are indirectly acquired.

    50. The method of claim 42, wherein (i) and (iii) are indirectly acquired.

    51. The method of claim 42, wherein (i) and (ii) are indirectly acquired.

    52. The method of claim 42, wherein all of (i), (ii) and (iii) are indirectly acquired.

    53. The method of any one of claims 42 to 52, comprising: (1) sequencing one or more subgenomic intervals or amplicons comprising the genetic biomarkers; (2) analyzing one or more genomic sequences for aneuploidy, and/or (3) contacting a protein biomarker with a detection reagent.

    54. The method of any one of claims 42 to 53, wherein the aneuploidy value is a function of the copy number of the genomic sequence disposed between at least two terminal repeated elements of a RE Family.

    55. The method of any one of claims 42 to 54, wherein the aneuploidy value is a function of the length of the genomic sequence disposed between at least two terminal repeated elements of a repeated element family (RE Family).

    56. The method of any one of claims 42 to 55, further comprising: (i) acquiring a sequence for a subgenomic interval from cell-free DNA from a sample; and (ii) acquiring a leukocyte parameter from leukocyte DNA from the sample.

    57. The method of claim 55 or 56, wherein the leukocyte parameter comprises a sequence of the subgenomic interval.

    58. The method of claim 55 or 56, further comprising comparing (i) with (ii) to evaluate a genomic event found in the cell-free DNA subgenomic interval or cell-free DNA aneuploidy analysis sample.

    59. The method of claim 58, wherein the genomic event comprises a mutation.

    60. The method of any one of claims 42 to 59, wherein specificity of detection of the cancer in the plurality of cancers with (i), (ii) and (iii) is substantially the same as the specificity of detection of the cancer in the plurality of cancers with: (i); (ii); (iii); (i) and (ii); (i) and (iii); or (ii) and (iii).

    61. The method of any one of claims 42 to 59, wherein specificity of detection of the cancer in the plurality of cancers with (i), (ii) and (iii) is not substantially lower than the specificity of detection of the cancer in the plurality of cancers with: (i); (ii); (iii); (i) and (ii); (i) and (iii); or (ii) and (iii).

    62. The method of any one of claims 42 to 61, wherein sensitivity of detection of the cancer in the plurality of cancers with (i), (ii) and (iii) is higher than the sensitivity of detection of the cancer in the plurality of cancers with: (i); (ii); (iii); (i) and (ii); (i) and (iii); or (ii) and (iii).

    63. The method of claim 62, wherein sensitivity of detection of the cancer in the plurality of cancers with (i), (ii) and (iii) is about 1.1, 1.2, 1.3, 1.4, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 fold higher, than the sensitivity of detection of the cancer in the plurality of cancers with: (i); (ii); (iii); (i) and (ii); (i) and (iii); or (ii) and (iii).

    64. The method of any one of claims 42 to 63, wherein (i), (ii) and (iii) result in an increased sensitivity of detection at a specified specificity.

    65. The method of claim 64, wherein the increased sensitivity of detection is increased by about 1.1, 1.2, 1.3, 1.4, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 fold at the specified specificity.

    66. The method of claim 64 or 65, wherein the specificity is a predetermined specificity.

    67. The method of claim 66, wherein the predetermined specificity is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% specificity.

    68. The method of any one of claims 62 to 67, wherein the increase in sensitivity of detection of the cancer in the plurality of cancers does not affect the specificity of detection of the cancer in the plurality of cancer.

    69. The method of any one of claims 62 to 67, wherein the increase in sensitivity of detection of the cancer in the plurality of cancers does not reduce or substantially reduce the specificity of detection of the cancer in the plurality of cancer.

    70. The method of claim 68 or 69, wherein the specificity of detection of the cancer in the plurality of cancers is at a plateau.

    71. The method of any one of claims 42 to 70, wherein acquiring a value for the presence of one or more mutations comprises detecting the one or more mutations in the one or more driver genes.

    72. The method of claim 71, wherein the one or more mutations comprise one or more driver gene mutations.

    73. The method of any one of claims 42 to 72, wherein the one or more driver genes are chosen from: NRAS, CTNNB1, PIK3CA, FBXW7, APC, EGFR, BRAF, CDKN2A, PTEN, FGFR2, HRAS, KRAS, AKT1, TP53, PPP2R1A, or GNAS.

    74. The method of any one of claims 42 to 73, wherein the presence of one or more mutations are evaluated in at least four driver genes chosen from: NRAS, CTNNB1, PIK3CA, FBXW7, APC, EGFR, BRAF, CDKN2A, PTEN, FGFR2, HRAS, KRAS, AKT1, TP53, PPP2R1A, or GNAS.

    75. The method of any one of claims 42 to 74, wherein the presence of one or more mutations are evaluated in all sixteen of the following driver genes: NRAS, CTNNB1, PIK3CA, FBXW7, APC, EGFR, BRAF, CDKN2A, PTEN, FGFR2, HRAS, KRAS, AKT1, TP53, PPP2R1A, and GNAS.

    76. The method of any one of claims 42 to 75, wherein acquiring a value for each of the plurality of protein biomarkers comprises detecting each of the plurality of protein biomarkers, e.g., chosen from: CA19-9, CEA, HGF, OPN, CA125, prolactin (PRL), TIMP-1, CA15-3, AFP or MPO.

    77. The method of claim 76, wherein the plurality of protein biomarkers comprises at least four protein biomarkers.

    78. The method of any one of claims 42 to 77, wherein acquiring a value for aneuploidy comprises detecting aneuploidy.

    79. The method of any one of claims 42 to 78, wherein the plurality of cancers comprises at least four cancers.

    80. The method of any one of claims 42 to 79, further comprising subjecting the subject to a radiologic scan, e.g., a PET-CT scan, of an organ or body region.

    81. The method of claim 80, wherein the radiologic scanning of an organ or body region characterizes the cancer.

    82. The method of claim 80, wherein the radiologic scanning of an organ or body region identifies the location of the cancer.

    83. The method of any one of claims 80-82, wherein the radiologic scan is a PET-CT scan.

    84. The method of any one of claims 80-83, wherein the radiologic scanning is performed after the subject is evaluated for the presence of each of a plurality of cancers.

    85. The method of any one of claims 42-84, comprising administering to the subject one or more therapeutic interventions (e.g., surgery, adjuvant chemotherapy, neoadjuvant chemotherapy, radiation therapy, immunotherapy, targeted therapy, and/or an immune checkpoint inhibitor).

    86. The method of any of claims 42-85, wherein the subject is asymptomatic for a cancer.

    87. The method of any of claims 42-85, wherein the subject is asymptomatic for a cancer of the plurality of cancers.

    88. The method of any of claims 42-85, wherein the subject is not known or determined to harbor a cancer cell.

    89. The method of any of claims 42-85, wherein the subject has not been determined to have or diagnosed with a cancer.

    90. The method of any of claims 42-85, wherein the subject has an early stage cancer, e.g., Stage I or Stage II.

    91. A kit comprising: (a) at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 detection reagents, wherein a detection reagent mediates a readout that is a value of the level or presence of: (i) one or more genetic biomarkers referred to herein; (ii) one or more protein biomarkers referred to herein; and/or (iii) the copy number or length of a genomic sequence disposed between at least two terminal repeated elements of a repeated element family (RE Family) referred to herein; and (b) instructions for using said kit.

    92. The kit of claim 91 wherein the detection reagent mediates a readout that is a value of the level or presence of aneuploidy in the genomic sequence.

    93. A method of testing for the presence of cancer of a mammal comprising: a) amplifying a plurality of chromosomal sequences in a DNA sample with a pair of primers complementary to the chromosomal sequences to form a plurality of amplicons; b) determining at least a portion of the nucleic acid sequence of one or more of the plurality of amplicons; c) mapping the sequenced amplicons to a reference genome; d) dividing the DNA sample into a plurality of genomic intervals; e) quantifying a plurality of features for the amplicons mapped to the genomic intervals; f) comparing the plurality of features of amplicons in a first genomic interval with the plurality of features of amplicons in one or more different genomic intervals; and g) determining the presence of cancer in the mammal when the plurality of features of amplicons in a first genomic interval is different from the plurality of features of amplicons in one or more different genomic intervals.

    94. The method of claim 93, wherein at least 100,000 amplicons are formed in the step of amplifying.

    95. The method of claim 93 or 94, wherein the cancer is a Stage I cancer.

    96. The method of any one of claims 93 to 95, wherein the cancer is a liver cancer, an ovarian cancer, an esophageal cancer, a stomach cancer, a pancreatic cancer, a colorectal cancer, a lung cancer, a breast cancer, or a prostate cancer.

    97. The method of any one of claims 93-96, further comprising determining the presence of aneuploidy when the plurality of features of amplicons in a first genomic interval is different from the plurality of features of amplicons in one or more different genomic intervals.

    98. A method of detecting aneuploidy in a sample comprising low input DNA, using any of the methods disclosed herein.

    99. The method of claim 98, wherein the sample comprises about 0.01 picogram (pg) to 500 pg DNA.

    100. The method of claim 98 or 99, wherein the sample is a biological sample from a subject.

    101. The method of any one of claims 98-100, wherein the sample comprises a liquid sample, a blood sample, a cell-free DNA sample (e.g., a circulating tumor DNA sample), a plasma sample, a serum sample; or a tissue sample.

    102. The method of any one of claims 98-100 wherein the sample, e.g., biological sample, comprises cells (e.g., normal or cancer cells) and cell-free DNA.

    103. A method of identifying or distinguishing a sample using any of the methods disclosed herein.

    104. The method of claim 103, wherein the sample, e.g., first sample, from a subject, e.g., first subject, is distinguished from a second sample from a second subject.

    105. The method of claim 103, wherein the sample is identified as being from a subject based on a polymorphism (e.g., a plurality of polymorphisms, e.g., common polymorphisms).

    106. The method of claim 105, wherein the polymorphism, e.g., common polymorphism, is present in a repetitive element, e.g., as described herein.

    107. The method of any one of claims 1-90 or 93 to 106, wherein the method is an in vitro method.

    Description

    DESCRIPTION OF THE DRAWINGS

    [0304] FIG. 1A shows a distribution of amplicon size when using a single primer pair to amplify repetitive elements (see, e.g., Table 1 for a list of repetitive elements). The amplicon sizes shown in FIG. 1A includes the number of bases in the primers.

    [0305] FIG. 1B shows a distribution of amplicon size when using a single primer pair to amplify repetitive elements (see, e.g., Table 1 for a list of repetitive elements). The amplicon sizes shown in FIG. 1B do not include the number of bases in the primers.

    [0306] FIG. 1C shows a distribution of the number of amplicons observed in cell free DNA from 2231 plasma samples.

    [0307] FIG. 2A. Exemplary overview of an embodiment of a workflow described herein.

    [0308] FIG. 2B is an exemplary overview of an embodiment of the Repetitive Element AneupLoidy Sequencing System (RealSeqS).

    [0309] FIG. 3 shows aneuploidy sensitivity vs mutations (@99% specificity) in different cancer types. The percent of aneuploidy detected in each cancer type is depicted on the Y axis.

    [0310] FIG. 4 shows aneuploidy shows aneuploidy sensitivity compared to other cancer biomarkers. The percent of cancers detected (sensitivity) is depicted on the Y axis.

    [0311] FIG. 5 shows pseudocode to generate synthetics with multiple arm alterations.

    [0312] FIG. 6 shows estimation of the relationship between reads and DNA concentration.

    [0313] FIG. 7A shows a comparison of the sensitivity of cancer detection with different multi-analyte tests. Three different multi-analyte test evaluated sensitivity of detecting the eight indicated cancers. The three tests were: (1) aneuploidy status, somatic mutation analysis and protein biomarker evaluation; (2) aneuploidy status and somatic mutation analysis; and (3) aneuploidy status and protein biomarker evaluation.

    [0314] FIG. 7B shows the sensitivity of a test incorporating aneuploidy, mutations, and abnormally high levels of 8 proteins compared to a test comparing only aneuploidy+ proteins or only mutations and proteins. All sensitivities were calculated at an aggregate of 99% specificity (i.e., only 1% of the plasma samples was positive for aneuploidy, mutations, or proteins in the test incorporating aneuploidy, mutations, and proteins using 10 iterations of 10 fold cross validation).

    [0315] FIG. 8 is a graph showing the true positive fraction (sensitivity) on the y-axis and the false positive fraction of cancer detection using the various tests. The tests include: (1) aneuploidy status; somatic mutation; and protein biomarker; (2) aneuploidy status and protein biomarker; (3) somatic mutation and protein biomarker; (4) aneuploidy status and somatic mutation; (5) aneuploidy status; and (6) somatic mutation. The true positive fraction (sensitivity) was calculated using a threshold at 99% specificity.

    [0316] FIG. 9 shows sensitivity of cancer detection for aneuploidy alone (@98% or 99% specificity) compared to sensitivity with aneuploidy and protein biomarkers (@95% specificity) in different stages of cancer.

    [0317] FIG. 10 shows aneuploidy (@99% specificity) in different stages of cancer.

    [0318] FIG. 11 shows aneuploidy (@99% specificity) in different cancer types.

    [0319] FIG. 12 shows sensitivity when aneuploidy (@99% specificity) is combined with detection of protein biomarkers.

    [0320] FIG. 13 shows pseudocode to generate in silico trisomy and monosomy samples used for the comparison of whole genome sequencing, FAST-SeqS and Real SeqS.

    [0321] FIG. 14 shows pseudocode to generate in silico simulated samples with multiple arm alterations that were used in the Genome Wide Aneuploidy SVM training set.

    [0322] FIGS. 15A-15C show detection of Aneuploidy using Next Generation Sequencing Technologies. Sensitivities were calculated at 99% specificity. Error bars represent 95% confidence intervals. FIG. 15A Comparison of sensitivity for monosomies and trisomies across all 39 non-acrocentric chromosome arms at 5% cell fraction. FIG. 15B Comparison of sensitivity for the 1.5 Mb DiGeorge deletion on 22q at 5% cell fraction. FIG. 15C Comparison of sensitivity for a 20 copy ERBB2 focal amplification at 1% cell fraction.

    [0323] FIGS. 16A-16B show examples of plasma samples with focal deletions or amplifications. FIG. 16A shows RealSeqS data on a plasma sample from a normal individual with a ˜3 Mb deletion of chromosome 22, characteristic of DiGeorge Syndrome. Note that many patients with microdeletions at this locus have mild signs and symptoms and are clinically undetected. FIG. 16B shows RealSeqS data on a typical plasma sample from a normal individual, showing no deletion at the DiGeorge locus.

    [0324] FIGS. 17A-17B show examples of plasma samples with focal deletions or amplifications. FIG. 17A shows RealSeqS data on a plasma sample from a patient with cancer showing a 2.5 MB focal amplification that includes the ERBB2 locus on chromosome 17q. FIG. 17B shows RealSeqS data on a typical plasma sample from a normal individual, showing no amplification at the ERBB2 locus.

    [0325] FIG. 18 shows RealSeqS sensitivity for plasma samples with various amounts of tumor derived DNA. The amount of tumor DNA was estimated by the mutant allele frequency (MAF) of driver mutations present in the plasma sample.

    [0326] FIGS. 19A-19B show detection of cancer in liquid biopsies from samples with non-metastatic cancers of eight different types. Sensitivities were calculated at 99% specificity during cross validation. Error bars represent 95% confidence intervals. FIG. 19A shows the comparison of aneuploidy status as assessed by RealSeqS to somatic mutations status with respect to tumor type. FIG. 19B shows the comparison of aneuploidy status as calculated by RealSeqS to somatic mutations status with respect to Cancer Stage.

    DETAILED DESCRIPTION

    Definitions

    [0327] The term “driver gene mutation” or “driver mutation” as used herein, refers to a mutation that (i) occurs in a driver gene; and (ii) provides a growth advantage to the cell in which it occurs. A growth advantage for a cell can include:

    [0328] a) an increase in the rate of cell division in a cell having a driver gene mutation, e.g., an increase in rate of cell division as compared to a reference cell, e.g., to an otherwise similar cell, e.g., an otherwise similar cell adjacent to the cell, e.g., as compared to a cell of the same type not having the driver gene mutation;

    [0329] b) an increase in the rate of clonal expansion in a cell having a driver gene mutation, e.g., an increase in rate of clonal expansion as compared to a reference cell, e.g., to an otherwise similar cell, e.g., an otherwise similar cell adjacent to the cell, e.g., as compared to a cell of the same type not having the driver mutation;

    [0330] c) an increase in the number of cells that are progeny, e.g., a daughter cell, of the cell that has the driver gene mutation, e.g., an increase in number of progeny cells compared to the number of progeny cells expected if the cell did not have the driver gene mutation;

    [0331] d) an increase in the ability to form tumors or promote tumor growth, e.g., tumor progression, e.g., as compared to a reference cell, e.g., to an otherwise similar cell not having the driver gene mutation; or

    [0332] e) presence or appearance at a second or subsequent site or location in the subject.

    [0333] In an embodiment, a driver gene mutation provides a 0.1-5%, e.g., a 0.1-4.5%, 0.1-4%, 0.1-3.5%, 0.1-3%, 0.1-2.5%, 0.1-2%, 0.1-1.5%, 0.1-1%, 0.1-0.5%, 0.5-5%, 1-5%, 1.5-5%, 2-5%, 2.5-5%, 3-5%, 3.5-5%, 4-5%, 4.5-5%, 0.5-4.5%, 1-4%, 1.5-3.5%, or 2-3%, growth advantage, e.g., increase in the difference between cell birth and cell death. In an embodiment, a driver gene mutation provides at least 0.1% 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, or 4.5%, e.g., about a 0.4%, growth advantage, e.g., increase in the difference between cell birth and cell death. In an embodiment, a driver gene mutation, provides a proliferative capacity to the cell in which it occurs, e.g., allows for cell expansion, e.g., clonal expansion.

    [0334] In some embodiments, the driver gene mutation can be causally linked to cancer progression.

    [0335] In an embodiment, the driver gene mutation affects, e.g., alters the regulation, expression or function of, a protein coding gene. In an embodiment, a driver gene mutation affects, e.g., alters the function of, a noncoding region, e.g., non-protein coding region. In an embodiment, a driver gene mutation includes: a translocation, a deletion (e.g., a homozygous deletion), an insertion (e.g., an intragenic insertion), a small insertion and deletion (indels), a single base substitution (e.g., a synonymous mutation, non-synonymous mutation, nonsense mutation or a frameshift mutation), a copy number variation (CNV) (e.g., an amplification), or a single nucleotide variation (SNV) (e.g., a single nucleotide polymorphism (SNP)). Exemplary driver mutations are disclosed in Tables 60 and 61 of US2019/0256924A1.

    [0336] In some embodiments, the presence of a driver gene mutation in a cell can alter (e.g., increase or decrease) the expression of the gene product in that cell. In some embodiments, the presence of a driver gene mutation in a cell can alter the function of the gene product. In some cases, the presence of a driver gene mutation in a cell can provide that cell with a growth advantage. For example, the presence of a driver gene mutation in a cell can cause an increase the rate of proliferation (e.g., as compared to a reference cell). For example, the presence of a driver gene mutation in a cell can cause an increase in the rate of clonal expansion in a cell having a driver gene mutation (e.g., as compared to a reference cell). For example, the presence of a driver gene mutation in a cell can cause an increase in the number of progeny cells derived from the cell having the driver gene mutation (e.g., as compared to a reference cell). For example, the presence of a driver gene mutation in a cell can cause an increase in the ability of the cell to form a tumor (e.g., as compared to a reference cell). In some cases, a growth advantage can be measures as an increase in the difference between cytogenesis (e.g., the formation of new cells) and cell death. For example, the presence of a driver gene mutation in a cell can provide that cell with a growth advantage of at least about 0.1% (e.g., about 0.2%, about 0.3%, about 0.4%, about 0.5%, about 0.6%, about 0.7%, about 0.8%, about 0.9%, about 1%, about 1.5%, about 2%, about 2.5%, about 3%, about 3.5%, about 4%, about 4.5%, or more). For example, the presence of a driver gene mutation in a cell can provide that cell with a growth advantage of about from 0.1% to about 5% (e.g., from about 0.1 to about 5%, from about 0.1 to about 4.5%, from about 0.1 to about 4%, from about 0.1 to about 3.5%, from about 0.1 to about 3%, from about 0.1 to about 2.5%, from about 0.1 to about 2%, from about 0.1 to about 1.5%, from about 0.1 to about 1%, from about 0.1 to about 0.5%, from about 0.5 to about 5%, from about 1 to about 5%, from about 1.5 to about 5%, from about 2 to about 5%, from about 2.5 to about 5%, from about 3 to about 5%, from about 3.5 to about 5%, from about 4 to about 5%, from about 4.5 to about 5%, from about 0.5 to about 4.5%, from about 1 to about 4%, from about 1.5 to about 3.5%, or from about 2 to about 3%).

    [0337] In some cases, a driver gene can include more than one (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) driver gene mutations. In some cases, a driver gene including one or more driver gene mutations also can include one or more additional mutations (e.g., passenger gene mutations (somatic mutations which are not a driver mutation)).

    [0338] The term “driver gene” as used herein, refers to a gene which includes a driver gene mutation. In one embodiment, the driver gene is a gene in which one or more (e.g., one, two, three, four, five, six, seven, eight, nine, ten, or more) acquired mutations, e.g., driver gene mutations, can be causally linked to cancer progression. In an embodiment, a driver gene modulates one or more cellular processes including: cell fate determination, cell survival and genome maintenance. A driver gene can be associated with (e.g., can modulate) one or more signaling pathways. Examples of signaling pathways include, without limitation, a TGF-beta pathway, a MAPK pathway, a STAT pathway, a PI3K pathway, a RAS pathway, a cell cycle pathway, an apoptosis pathway, a NOTCH pathway, a Hedgehog (HH) pathway, an APC pathway, a chromatin modification pathway, a transcriptional regulation pathway, and a DNA damage control pathway. Examples of driver genes include, without limitation, ABL1, ACVR1B, AKT1, ALK, APC, AR, ARID1A, ARID1B, ARID2, ASXL1, ATM, ATRX, AXIN1, B2M, BAP1, BCL2, BCOR, BRAF, BRCA1, BRCA2, CARD11, CASP8, CBL, CDC73, CDH1, CDKN2A, CEBPA, CIC, CREBBP, CRLF2, CSF1R, CTNNB1, CYLD, DAXX, DNMT1, DNMT3A, EGFR, EP300, ERBB2, EZH2, FAM123B, FBXW7, FGFR2, FGFR3, FLT3, FOXL2, FUBP1, GATA1, GATA2, GATA3, GNA11, GNAQ, GNAS, H3F3A, HIST1H3B, HNF1A, HRAS, IDH1, IDH2, JAK1, JAK2, JAK3, KDM5C, KDM6A, KIT, KLF4, KRAS, MAP2K1, MAP3K1, MED12, MEN1, MET, MLH1, MLL2, MLL3, MPL, MSH2, MSH6, MYD88, NCOR1, NF1, NF2, NFE2L2, NOTCH1, NOTCH2, NPM1, NRAS, PAX5, PBRM1, PDGFRA, PHF6, PIK3CA, PIK3R1, PPP2R1A, PRDM1, PTCH1, PTEN, PTPN11, RB1, RET, RNF43, RUNX1, SETD2, SETBP1, SF3B1, SMAD2, SMAD4, SMARCA4, SMARCB1, SMO, SOCS1, SOX9, SPOP, SRSF2, STAG2, STK11, TET2, TNFAIP3, TRAF7, TP53, TSC1, TSHR, U2AF1, VHL, WT1, CCND1, CDKN2C, IKZF1, LMO1, MAP2K4, MDM2, MDM4, MYC, MYCL1, MYCN, NCOA3, NKX2-1, and SKP2. Exemplary driver genes include oncogenes and tumor suppressors. In an embodiment, a driver gene has one or more driver gene mutations, e.g., as described herein. In an embodiment, a driver gene is a gene listed in Tables 60 or 61 in US2019/0256924A1. In an embodiment, a driver gene is a gene that modulates one or more cellular processes described in Tables 60 or 61 in US2019/0256924A1, e.g., cell fate determination, cell survival and genome maintenance. In an embodiment, a driver gene is a gene that modulates one or more pathways described in Tables 60 or 61 in US2019/0256924A1. In an embodiment, a driver gene is a gene that modulates one or more signaling pathways described in Table 62 of US2019/0256924A1.

    [0339] In an embodiment, a driver gene includes more than one driver mutation, and the first driver gene mutation, provides a selective growth advantage to the cell in which it occurs. In an embodiment, the subsequent mutation, e.g., second, third, fourth, fifth or later mutation, e.g., driver mutation in the driver gene, provides a proliferative capacity to the cell in which it occurs, e.g., allows for cell expansion, e.g., clonal expansion. In an embodiment, a driver gene has one or more passenger gene mutations, e.g., a somatic mutation that arises in the development of a cancer but which is not a driver mutation. In an embodiment, a driver gene can be present, e.g., expressed, in any cell type, e.g., a cell type derived from any one of the three germ cell layers: ectoderm, endoderm or mesoderm. In an embodiment, a driver gene is present, e.g., expressed, in a somatic cell. In an embodiment, a driver gene is present, e.g., expressed, in a germ cell. In an embodiment, a driver gene can be present in a large number of cancers, e.g., in more than 5% of cancers. In an embodiment, a driver gene can be present in a small number of cancer, e.g., in less than 5% of cancers. In an embodiment, a driver gene has a mutation pattern that is non-random and/or recurrent, i.e., the location at which a driver mutation occurs in the driver gene is the same in different cancer types. Exemplary recurrent driver gene mutations include mutations in the IDH1 gene at the substrate binding site, e.g., at codon 132, and mutations in the PIK3CA gene in the helical domain or the kinase domain, as depicted in Vogelstein et al (2013) Science 339: 1546-1558.

    [0340] In an embodiment, a driver gene having a driver gene mutation is an oncogene. In an embodiment, an oncogene is a gene with an oncogene score of at least 20%, e.g., at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100%. In an embodiment, an oncogene score is defined as the number of mutations, e.g., clustered mutations (e.g., missense mutations at the same amino acid, or identical in-frame insertions or deletions) divided by the total number of mutations. In an embodiment, a driver gene having an amplification, e.g., as described herein, is an oncogene. In an embodiment, a driver gene having a driver gene mutation is a tumor suppressor gene (TSG). In an embodiment, a tumor suppressor gene is a gene with a tumor suppressor gene score of at least 20%, e.g., at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100%. In an embodiment, a tumor suppressor gene score is defined as the number of inactivating mutations divided by the total number of mutations. In an embodiment, a driver gene having a deletion, e.g., as described herein, is a tumor suppressor gene.

    [0341] The phrase “repeated element family” or “RE family” as used herein, refers to a family of repeat DNA elements (also known as repetitive DNA elements or repeating units or DNA repeats) which are present in the genome of an organism. A DNA repeat element can be interspersed throughout the genome of an organism or can be present in select chromosomes. An RE family can include one or more repeat DNA elements. Exemplary RE families in the human genome include: interspersed repeats (e.g., long interspersed nucleotide elements (LINE); short interspersed nucleotide elements (SINE)); and tandem repeats (e.g., microsatellites, mini-satellites, satellite DNA or multiple copy genes (e.g., ribosomal RNA)). In some embodiments, an RE family includes one or more repeat elements listed in Table 1, e.g., SINE.

    [0342] “Acquire” or “acquiring” as the terms are used herein, refer to obtaining possession of a physical entity, or a value, e.g., a numerical value, by “directly acquiring” or “indirectly acquiring” the physical entity or value. “Directly acquiring” as the term is used herein refers to performing a process (e.g., performing a synthetic or analytical method) to obtain the physical entity or value. “Indirectly acquiring” as the term is used herein refers to receiving the physical entity or value from another party or source (e.g., a third party laboratory that directly acquired the physical entity or value). Directly acquiring a physical entity includes performing a process that includes a physical change in a physical substance, e.g., a starting material. Directly acquiring a value includes performing a process that includes a physical change in a sample or another substance, e.g., performing an analytical process which includes a physical change in a substance, e.g., a sample, analyte, or reagent (sometimes referred to herein as “physical analysis”), performing an analytical method, e.g., a method which includes one or more of the following: separating or purifying a substance, e.g., an analyte, or a fragment or other derivative thereof, from another substance; combining an analyte, or fragment or other derivative thereof, with another substance, e.g., a buffer, solvent, or reactant; or changing the structure of an analyte, or a fragment or other derivative thereof.

    [0343] “Biological sample,” “sample,” “patient sample,” or “specimen” as the terms are used herein, each refer to a sample obtained from a subject or a patient. The source of the sample can be a biopsy (e.g., a liquid biopsy), an aspirate; blood or any blood constituents; bodily fluids (e.g., cerebral spinal fluid, amniotic fluid, peritoneal fluid or interstitial fluid). The sample can comprise cells (e.g., any cell from a human body, e.g., normal cells and/or cancer cells) and/or cell-free DNA, e.g., circulating tumor DNA or circulating DNA from a normal cell. In an embodiment, the sample, e.g., the tumor sample, includes tissue or cells from a surgical margin. In another embodiment, the sample, e.g., tumor sample, includes one or more circulating tumor cells (CTC) (e.g., a CTC acquired from a blood sample).

    [0344] As used herein, the term “sensitivity” refers to the ability of a method to detect or identify the presence of a disease in a subject. For example, when used in reference to any of the variety of methods described herein that can detect the presence of cancer in a subject, a high sensitivity means that the method correctly identifies the presence of cancer in the subject a large percentage of the time. For example, a method described herein that correctly detects the presence of cancer in a subject 95% of the time the method is performed is said to have a sensitivity of 95%. In some embodiments, a method described herein that can detect the presence of cancer in a subject provides a sensitivity of at least 70% (e.g., about 70%, about 72%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5%, or about 100%). In some embodiments, methods provided herein that include detecting the presence of one or more members of two or more classes of biomarkers (e.g., genetic biomarkers and/or protein biomarkers) provide a higher sensitivity than methods that include detecting the presence of one or more members of only one class of biomarkers.

    [0345] In some embodiments, sensitivity provides a measure of the ability of a method to detect a sequence variant in a heterogeneous population of sequences. A method has a sensitivity of S % for variants of F % if, given a sample in which the sequence variant is present as at least F % of the sequences in the sample, the method can detect the sequence at a confidence of C %, S % of the time. By way of example, a method has a sensitivity of 90% for variants of 5% if, given a sample in which the variant sequence is present as at least 5% of the sequences in the sample, the method can detect the sequence at a confidence of 99%, 9 out of 10 times (F=5%; C=99%; S=90%). Exemplary sensitivities include those of S=90%, 95%, 99%, 99.9% for sequence variants at F=0.5%, 1%, 5%, 10%, 20%, 50%, 100% at confidence levels of C=90%, 95%, 99%, and 99.9%.

    [0346] As discussed above, in embodiments, sensitivity is the ability of a test method to make an assignment of a first state identity to all first state samples, in other words, to find or identify all first state samples. (Sensitivity does not address the propensity of a method to mis-assign a first state sample as a second state sample). In an embodiment the first state is negativity, and sensitivity is the ability to identify all negative samples. In an embodiment the first state is positivity, and sensitivity is the ability to identify all positive samples.

    [0347] As used herein, the term “specificity” refers to the ability of a method to detect the presence of a disease in a subject (e.g., the specificity of a method can be described as the ability of the method to identify the true positive over true negative in a subject and/or to distinguish a truly occurring sequence variant from a sequencing artifact or other closely related sequences). For example, when used in reference to any of the variety of methods described herein that can detect the presence of cancer in a subject, a high specificity means that the method correctly identifies the absence of cancer in the subject a large percentage of the time (e.g., the method does not incorrectly identify the presence of cancer in the subject a large percentage of the time). A method has a specificity of X % if, when applied to a sample set of NTotal sequences, in which XTrue sequences are truly variant and XNot true are not truly variant, the method can select at least X % of the not truly variant as not variant. For example, a method has a specificity of 90% if, when applied to a sample set of 1,000 sequences, in which 500 sequences are truly variant and 500 are not truly variant, the method selects 90% of the 500 not truly variant sequences as not variant. For example, a method described herein that correctly detects the absence of cancer in a subject 95% of the time the method is performed is said to have a specificity of 95%. In some embodiments, a method described herein that can detect the absence of cancer in a subject provides a specificity of at least 80% (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or higher). A method having high specificity results in minimal or no false positive results (e.g., as compared to other methods). False positive results can arise from any source. For example, in various methods described herein that correctly detect the absence of cancer and include sequencing a nucleic acid, false positives can result from errors introduced into the sequence of interest during sample preparation, sequencing errors, and/or inadvertent sequencing of closely related sequences such as pseudo-genes or members of a gene family. In some embodiments, methods provided herein that include detecting the presence of one or more members of two or more classes of biomarkers (e.g., genetic biomarkers and/or protein biomarkers) provide a higher specificity than methods that include detecting the presence of one or more members of only one class of biomarkers.

    [0348] As discussed above, in embodiments, specificity is the ability of a test method to make a true assignment of a first state identity to a sample. (Specificity does not address the ability of the method to find all true first state samples, that is sensitivity). In an embodiment the first state is negativity, and specificity is the ability to make true (as opposed to incorrect) assignments of negativity (and not mis-assign second state (e.g., positive) samples as first state (negative) sample). In an embodiment the first state is positivity, and specificity is the ability to make true (as opposed to incorrect) assignments of positivity (and not mis-assign second state (e.g., negative) samples as first state (positive) samples).

    [0349] As used herein, the phrase “subgenomic interval” refers to a portion of a genomic sequence. A subgenomic interval can be any appropriate size (e.g., can include any appropriate number of nucleotides). In some embodiments, a subgenomic interval can include a single nucleotide (e.g., single nucleotide for which variants thereof are associated (positively or negatively) with a tumor phenotype). In some embodiments, a subgenomic interval can include more than one nucleotide. For example, a subgenomic interval can include at least about 2 (e.g., about 5, about 10, about 50, about 100, about 150, about 250, or about 300) nucleotides. In some cases, a subgenomic interval can include an entire gene. In some cases, a subgenomic interval can include a portion of gene (e.g., a coding region such as an exon, a non-coding region such as an intron, or a regulatory region such as a promoter, enhancer, 5′ untranslated region (5′ UTR), or 3′ untranslated region (3′ UTR)). In some cases, a subgenomic interval can include all or part of a naturally occurring (e.g., genomic) nucleotide sequence. For example, a subgenomic interval can correspond to a fragment of genomic DNA which can be subjected to a sequencing reaction. In some cases, a subgenomic interval can be a continuous nucleotide sequence from a genomic source. In some cases, a subgenomic interval can include nucleotide sequences that are not contiguous within the genome. For example, a subgenomic interval can include a nucleotide sequence that includes an exon-exon junction (e.g., in cDNA reverse transcribed from the subgenomic interval). In some cases, a subgenomic interval can include a mutation (e.g., a SNV, an SNP, a somatic mutation, a germ line mutation, a point mutation, a rearrangement, a deletion mutation (e.g., an in-frame deletion, an intragenic deletion, or a full gene deletion), an insertion mutation (e.g., an intragenic insertion), an inversion mutation (e.g., an intra-chromosomal inversion), an inverted duplication mutation, a tandem duplication (e.g., an intrachromosomal tandem duplication), a translocation (e.g., a chromosomal translocation, or a non-reciprocal translocation), a change in gene copy number, or any combination thereof.

    [0350] As used herein, the phrase “leukocyte parameter,” refers to the sequence of a leukocyte nucleic acid, e.g., a chromosomal nucleic acid.

    [0351] As used herein, the phrase “genomic event,” refers to a sequence of a subgenomic interval that differs from the sequence of a reference sequence. A genomic event can be, e.g., a mutation, e.g., a point mutation or a rearrangement, e.g., a translocation.

    Aneuploidy Detection

    [0352] This document provides methods and materials for identifying one or more chromosomal anomalies (e.g., aneuploidies) in a sample. In some embodiments, methods and materials described herein are used to identify one or more chromosomal anomalies (e.g., aneuploidies) in an embryo. In some embodiments, methods and materials described herein are used to identify one or more chromosomal anomalies (e.g., aneuploidies) in a mammal (e.g., a juvenile mammal or an adult mammal). For example, a mammal (e.g., a sample obtained from a mammal) can be assessed for the presence or absence of one or more chromosomal anomalies. In some cases, this document provides methods and materials for using amplicon-based sequencing data to identify a mammal as having a disease associated with one or more chromosomal anomalies (e.g., cancer). For example, methods and materials described herein can be applied to a sample obtained from a mammal to identify the mammal as having one or more chromosomal anomalies. For example, methods and materials described herein can be applied to a sample obtained from a mammal to identify the mammal as having a disease associated with one or more chromosomal anomalies (e.g., cancer). This document also provides methods and materials for identifying and/or treating a disease or disorder associated with one or more chromosomal anomalies (e.g., one or more chromosomal anomalies identified as described herein). In some cases, one or more chromosomal anomalies can be identified in DNA (e.g., genomic DNA) obtained from a sample obtained from a mammal. For example, a prenatal mammal (e.g., prenatal human) can be identified as having a disease or disorder based, at least in part, on the presence of one or more chromosomal anomalies. In some embodiments, a mammalian embryo identified as having a disease or disease based, at least in part, on one or more chromosomal abnormalities can be assessed for the purposes of in vitro fertilization. In some embodiments, a mammal identified as having cancer based, at least in part, on the presence of one or more chromosomal anomalies can be treated with one or more cancer treatments. In some embodiments, a mammal can be identified as having congenital abnormalities based, at least in part, on the presence of one or more chromosomal abnormalities. In some embodiments, methods and materials provided herein are used to test an embryo (e.g., an embryo generated by in vitro fertilization) for chromosomal abnormalities prior to transfer to the uterus (e.g., a human uterus) for implantation.

    [0353] Disclosed herein, inter alia, is a method of increasing the sensitivity of detecting one or more cancers, or a plurality of cancers, without altering the specificity of detecting said cancer or a plurality of cancers. In an embodiment, the sensitivity of detection of a cancer by evaluating (i) a genetic biomarker, e.g. a somatic mutation; (ii) a protein biomarker; and (iii) aneuploidy status, is higher, e.g., about 1.1, 1.2, 1.3, 1.4, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 fold higher, than the sensitivity of detection of the cancer by evaluating (i) alone; (ii) alone; (iii) alone; (i) and (ii) only; (i) and (iii) only; or (ii) and (iii) only. The increase in sensitivity by a method comprising (i), (ii) and (iii) does not alter, e.g., reduce the specificity of detecting the cancer, or plurality of cancers. Exemplary increase in sensitivity of cancer detection using the method of the disclosure is demonstrated in Example 6 of this disclosure.

    [0354] Any appropriate mammal can be assessed as described herein. A mammal can be a prenatal mammal (e.g., prenatal human). A mammal can be a mammal suspected of having a disease associated with one or more chromosomal anomalies (e.g., cancer or a congenital abnormality). In some cases, humans or other primates such as monkeys can be assessed for the presence of one or more chromosomal anomalies as described herein. In some cases, dogs, cats, horses, cows, pigs, sheep, mice, and rats can be assessed for the presence of one or more chromosomal anomalies as described herein. For example, a human can be assessed for the presence of one or more chromosomal anomalies as described herein.

    [0355] Any appropriate sample from a mammal can be assessed as described herein (e.g., assessed for the presence of one or more chromosomal anomalies). A sample can include genomic DNA. In some cases, a sample can include cell-free circulating DNA (e.g., cell-free circulating fetal DNA). In some cases, a sample can include circulating tumor DNA (ctDNA). Examples of samples that can contain DNA (e.g., ctDNA) include, without limitation, blood (e.g., whole blood, serum, or plasma), amnion, tissue, urine, cerebrospinal fluid, saliva, sputum, broncho-alveolar lavage, bile, lymphatic fluid, cyst fluid, stool, ascites, pap smears, cerebral spinal fluid, endo-cervical, endometrial, and fallopian samples. For example, a sample can be a plasma sample. For example, a sample can be a urine sample. For example, a sample can be a saliva sample. For example, a sample can be a cyst fluid sample. For example, a sample can be a sputum sample. In some cases, a sample can include a neoplastic cell fraction (e.g., a low neoplastic cell fraction).

    [0356] In some embodiments, a sample can be processed to isolate and/or purify DNA from the sample. In some embodiments, DNA isolation and/or purification can include cell lysis (e.g., using detergents and/or surfactants). In some embodiments, further processing of DNA (e.g., an amplification reaction) is performed without purifying DNA from the cell lysis. In such cases, additional reagents are added to facilitate further processing including, without limitation, protease inhibitors. In some embodiments, DNA isolation and/or purification can include removing proteins (e.g., using a protease). In some cases, DNA isolation and/or purification can include removing RNA (e.g., using an RNase). In some embodiments, DNA isolation is performed using commercially available kits (for example, without limitation, Qiagen DNAeasy kit) or buffers known in the art (e.g., detergents in Tris-buffer).

    [0357] In some embodiments, the amount DNA inputted (“input DNA”) into the isolation and/or purification reaction may vary depending on a variety of factors including, without limitation, average length of DNA fragments, overall DNA quality, and/or type of DNA (e.g., gDNA, mitochondrial DNA, cfDNA). In some embodiments, any suitable amount of input DNA can be used in the methods described herein. In some embodiments, the amount of input DNA can be any amount from 1 picogram (pg) to 500 pg. In some embodiments, the amount of input DNA can be at least 0.01 pg, at least 0.01 pg, at least 0.1 pg or at least 1 pg. In some embodiments, the amount of input DNA can be at least 1 picogram (pg), at least 2 pg, at least 3 pg, at least 4 pg, at least 5 pg, at least 6 pg, at least 7 pg, at least 8 pg, at least 9 pg at least 10 pg, at least 11 pg, at least 12 pg, at least 13 pg, at least 14 pg, at least 15 pg, at least 16 pg, at least 17 pg, at least 18 pg, at least 19 pg, at least 20 pg, at least 21 pg, at least 22 pg, at least 23 pg, at least 24 pg, at least 25 pg, at least 26 pg, at least 27 pg, at least 28 pg, at least 29 pg, at least 30 pg, at least 31 pg, at least 32 pg, at least 33 pg, at least 34 pg, at least 35 pg, at least 36 pg, at least 37 pg, at least 38 pg, at least 39 pg or at least 40 pg. In some embodiments, the amount of input DNA is 3 pg.

    [0358] In some embodiments, methods and materials for identifying one or more chromosomal anomalies (e.g., aneuploidies) as described herein can include amplification of a plurality of amplicons. In some embodiments, the plurality of amplicons is amplified from a plurality of chromosomal sequences in a DNA sample. In some embodiments, the plurality of amplicons can be amplified from any variety of repetitive elements (see e.g., Table 1 for a list of repetitive elements). In some embodiments, the plurality of amplicons is amplified from a plurality of short interspersed nucleotide elements (SINEs). In some embodiments, the plurality of amplicons is amplified from a plurality of long interspersed nucleotide elements (LINEs). Methods of amplifying a plurality of amplicons include, without limitation, the polymerase chain reaction (PCR) and isothermal amplification methods (e.g., rolling circle amplification or bridge amplification). In some embodiments, a second amplification step is performed. In some embodiments, the amplified DNA from a first amplification reaction is used as a template in a second amplification reaction. In some embodiments, the amplified DNA is purified before the second amplification reaction (e.g., PCR purification using methods known in the art).

    [0359] In some embodiments, an amplification reaction includes using a single pair of primers comprising a first primer having or including SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9. In some embodiments, an amplification reaction includes using a single pair of primers comprising a first primer having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9. In some embodiments, an amplification reaction includes using a single pair of primers comprising a second primer having or including SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18 or SEQ ID NO: 19. In some embodiments, an amplification reaction includes using a single pair of primers comprising a second primer having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18 or SEQ ID NO: 19.

    [0360] In some embodiments, the first primer has a sequence that is at least 80% identical (e.g., at least 85%, at least 90%, at least 95% at least 99%, or 100% identical) to CGACGTAAAACGACGGCCAGTNNNNNNNNNNNNNNNNGGTGAAACCCCGTCTC TACA (SEQ ID NO: 1). In some embodiments, the second primer has a sequence that is at least 80% identical (e.g., at least 85%, at least 90%, at least 95% at least 99%, or 100% identical) to CACACAGGAAACAGCTATGACCATGCCTCCTAAGTAGCTGGGACTACAG (SEQ ID NO: 10). In some embodiments, an amplification reaction includes using a single pair of primers comprising a first primer having SEQ ID NO. 1 and a second primer having SEQ ID NO. 10. In some embodiments, an amplification reaction includes using a single pair of primers comprising a first primer having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to SEQ ID NO. 1 and a second primer having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to SEQ ID NO. 10.

    [0361] In some embodiments, the first primer comprises from the 5′ to 3′ end: a universal primer sequence (UPS), a unique identifier DNA sequence (UID), and an amplification sequence. In some embodiments, the first primer comprises from the 5′ to 3′ end: a UPS sequence and an amplification sequence. In some embodiments, the first primer comprises from the 5′ to 3′ end: an amplification sequence. In such cases in which the first primer comprises at least an amplification sequence, any variety of library generation techniques known in the art can be used to generate a next generation sequencing library from the amplified amplicons.

    [0362] In some embodiments, the universal primer sequence (UPS) facilitates the generation of a library of amplicons ready for next generation sequencing. For example, an amplicon generated during the amplification reaction using a first primer (SEQ ID NO. 1) and a second primer (SEQ ID NO. 10) is used as a template for a second amplification reaction. In such cases, a second set of primers designed to bind to the UPS includes the 5′ grafting sequences necessary for hybridization to an Illumina flow cell.

    [0363] In some embodiments, the UID comprises a sequence of 16-20 degenerate bases. In some embodiments, a degenerate sequence is a sequence in which some positions of a nucleotide sequence contain a number of possible bases. In some embodiments of any of the methods described herein, a degenerate sequence can be a degenerate nucleotide sequence comprising about or at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 nucleotides. In some embodiments, a nucleotide sequence contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 0, 10, 15, 20, 25, or more degenerate positions within the nucleotide sequence. In some embodiments, the degenerate sequence is used as a unique identifier DNA sequence (UID). In some embodiments, the degenerate sequence is used to improve the amplification of an amplicon. For example, a degenerate sequence may contain bases complementary to a chromosomal sequence being amplified. In such cases, the increased complementarity may increase a primers affinity for the chromosomal sequence. In some embodiments, the UID (e.g., degenerate bases) is designed to increase a primers affinity to a plurality of chromosomal sequences.

    [0364] In some embodiments, an amplification reaction includes one or more pairs of primers (e.g., one or more pairs of primers selected from Table 2). In some embodiments, an amplification reaction includes at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 pairs of primers. In some embodiments, when an amplification reaction includes more than one pair or primers, at least one pair of primers includes a primer having SEQ ID NO: 1 as a first primer and a primer having SEQ ID NO: 10 as a second primer. In some embodiments, when an amplification reaction includes more than one pair of primers, at least one pair of primers includes a first primer with a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to SEQ ID NO: 1 and a second primer with a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to SEQ ID NO: 10.

    [0365] In some embodiments when an amplification reaction includes one or more pairs of primers, any variety of combinations of primers or pairs of primers can be selected from Table 2. For example, an amplification reaction containing 2 pairs of primers (e.g., 4 primers selected from Table 2) can include a first pair of primers (e.g., a first primer pair 1 from Table 2) that includes a first primer (e.g., a first primer having SEQ ID NO: 1) and a second primer (e.g., a second primer having SEQ ID NO: 10) and a second pair of primers (e.g., a second primer pair 2 from Table 2) that includes a third primer (e.g., a third primer having SEQ ID NO: 2) and a fourth primer (e.g., a fourth primer having SEQ ID NO: 11). Combining any of the forward primers listed in Table 2 (e.g., a “FP” having SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9) with any of the reverse primers listed in Table 2 (e.g., a “RP” having SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18 or SEQ ID NO: 19) will generate amplicons from the repetitive elements as described herein (see e.g., Table 1 for a list of exemplary repetitive elements). For example, an amplification reaction containing 2 pairs of primers (e.g., 4 primers selected from Table 2) can include a first pair of primers (e.g., a first primer pair 1 from Table 2) that includes a first primer (e.g., a first primer having SEQ ID NO: 1) and a second primer (e.g., a second primer having SEQ ID NO: 10) and a second pair of primers (e.g., not listed as a primer pair in Table 2) that includes a third primer (e.g., a third primer having SEQ ID NO: 2) and a fourth primer (e.g., a fourth primer having SEQ ID NO: 12). In some embodiments, an amplification reaction includes one or more pairs of primers where a first primer is included in both pairs of primers. For example, an amplification reaction can include a first pair of primers (e.g., a first primer pair 1 from Table 2) that includes a first primer (e.g., a first primer having SEQ ID NO: 1) and a second primer (e.g., a second primer having SEQ ID NO: 10) and a second pair of primers that includes a third primer (e.g., a third primer having SEQ ID NO: 1) and a fourth primer (e.g., a fourth primer having SEQ ID NO: 11).

    [0366] In some embodiments, a pair of primers are complementary to a plurality of chromosomal sequences. As used herein, the term “complementary” or “complementarity” refers to nucleic acid residues that are capable or participating in Watson-Crick type or analogous base pair interactions that is enough to support amplification. In some embodiments, an amplification sequence of a first primer is designed to amplify one or more chromosomal sequences. In some embodiments, the one or more chromosomal sequence include any of a variety of repetitive elements as described herein (see e.g., Table 1 for a list of exemplary repetitive elements). In some embodiments, the chromosomal sequences are SINEs. In some embodiments, the chromosomal sequences are LINEs. In some embodiments, the chromosomal sequences are a mixture of different types of repetitive elements (e.g., SINEs, LINEs and/or other exemplary repetitive elements list in Table 1). In some embodiments when an amplification reaction includes two or more pairs of primers, each pair of primers amplifies a different type of repetitive element (see, e.g., Table 1 for a list of exemplary repetitive elements). For example, a first pair of primers can amplify SINEs, and a second pair of primers can amplify LINEs. Optionally, a third, fourth, fifth, etc. pair of primers can amplify a third, fourth, fifth, etc. type of repetitive element (see, e.g., Table 1 for a list of additional exemplary repetitive elements). In some embodiments when an amplification reaction includes two or more pairs of primers, each pair of primers generates amplicons from the same type of repetitive element (see, e.g., Table 1 for a list of exemplary repetitive elements). For example, a first pair of primers can amplify SINEs, and a second pair of primers amplify SINEs. Optionally, a third, fourth, fifth, etc. pair of primers can amplify SINEs. In some embodiments when an amplification reaction includes two or more primer pairs, each pair of primers generates amplicons from a mixture of different types of repetitive elements (see e.g., Table 1 for a list of exemplary repetitive elements).

    TABLE-US-00001 TABLE 1 List of exemplary repetitive elements ACRO1_Satellite ALR/Alpha_Satellite (A)n_Simple A-rich_Low Arthur1A_DNA Arthur1B_DNA Arthur1_DNA AT_rich BLACKJACK_DNA (CAAAAA)n_Simple (CAAAA)n_Simple (CAA)n_Simple (CAAT)n_Simple (CA)n_Simple (CATA)n_Simple (CATATA)n_Simple (CATTC)n_Satellite (CCCCAG)n_Simple Charlie13a_DNA Charlie15a_DNA Charlie16a_DNA Charlie17a_DNA Charlie19a_DNA Charlie1a_DNA Charlie1b_DNA Charlie1_DNA Charlie21a_DNA Charlie22a_DNA Charlie23a_DNA Charlie25_DNA Charlie2b_DNA Charlie4a_DNA Charlie4z_DNA Charlie5_DNA Charlie6_DNA Charlie7a_DNA Charlie7_DNA Charlie8_DNA Cheshire_DNA (C)n_Simple C-rich_Low (CTA)n_Simple CT-rich_Low ERV3-16A3_I-int ERVL-B4-int_LTR ERVL-E-int_LTR ERVL-int_LTR Eulor11_DNA Eulor1_DNA HERV16-int_LTR HERV30-int_LTR HERV3-int_LTR HERV4_I-int HERVE_a-int HERVLH19-int_LTR HERVH48-int_LTR HERVH-int_LTR HERVI-int_LTR HERVK14C-int_LTR HERVK3-int_LTR HERVK-int_LTR HERVL66-int_LTR HERVL74-int_LTR HERVL-int_LTR HERVP71A-int_LTR HSAT4_Satellite HSMAR1_DNA HSMAR2_DNA HUERS-P1-int_LTR HUERS-P3-int_LTR Kanga1a_DNA Kanga1d_DNA Kanga1_DNA Looper_DNA LOR1b_LTR LOR1-int_LTR LTR10F_LTR LTR12C_LTR LTR15_LTR LTR16A1_LTR LTR16A2_LTR LTR16A_LTR LTR16B1_LTR LTR16B_LTR LTR16C_LTR LTR16E1_LTR LTR19B_LTR LTR1B_LTR LTR1D_LTR LTR24_LTR LTR25-int_LTR LTR25_LTR LTR27B_LTR LTR27_LTR LTR28_LTR LTR32_LTR LTR33C_LTR LTR33_LTR LTR34_LTR LTR35B_LTR LTR37B_LTR LTR3B.sub.— LTR40c_LTR LTR43_LTR LTR45C_LTR LTR48B_LTR LTR48_LTR LTR49-int_LTR LTR49_LTR LTR57-int_LTR LTR5B_LTR LTR5_Hs LTR64_LTR LTR66_LTR LTR67B_LTR LTR6A_LTR LTR71B_LTR LTR72_LTR LTR77_LTR LTR78B_LTR LTR78_LTR LTR79_LTR LTR80B_LTR LTR81A_LTR LTR81B_LTR LTR81C_LTR LTR81_LTR LTR82A_LTR LTR84b_LTR LTR85a_LTR LTR85b_LTR LTR86A2_LTR LTR87_LTR LTR8A_LTR LTR8_LTR LTR9_LTR MADE1_DNA MADE2_DNA MamGypLTR1b_LTR MamGypLTR1c_LTR MamRep1161_DNA MamRep1527_LTR MamRep38_DNA MamRep434_DNA MamRep564_Unknown MARNA_DNA MER101-int_LTR MER102a_DNA MER102b_DNA MER102c_DNA MER103C_DNA MER106A_DNA MER110A_LTR MER110-int_LTR MER113B_DNA MER113_DNA MER115_DNA MER11D_LTR MER121_DNA MER135_DNA MER1A_DNA MER1B_DNA MER20B_DNA MER20_DNA MER21B_LTR MER21-int_LTR MER2_DNA MER30_DNA MER31A_LTR MER31B_LTR MER31-int_LTR MER33_DNA MER34A1_LTR MER34A_LTR MER34B-int_LTR MER34B_LTR MER34C.sub.— MER34C2_LTR MER34D_LTR MER34_LTR MER39_LTR MER3_DNA MER41A_LTR MER41B_LTR MER41-int_LTR MER44A_DNA MER44C_DNA MER45R_DNA MER46C_DNA MER49_LTR MER4A1.sub.— MER4A_LTR MER4B-int_LTR MER4B_LTR MER4C_LTR MER4D1_LTR MER4D_LTR MER4E1_LTR MER4-int_LTR MER50_LTR MER51C_LTR MER52A_LTR MER52-int_LTR MER53_DNA MER54A_LTR MER57A-int_LTR MER57B2_LTR MER57E3_LTR MER57F_LTR MER57-int_LTR MER58A_DNA MER58B_DNA MER58C_DNA MER58D_DNA MER5A1_DNA MER5A_DNA MER5B_DNA MER5C_DNA MER61B_LTR MER61-int_LTR MER63C_DNA MER63D_DNA MER65A_LTR MER65-int_LTR MER66B_LTR MER66-int_LTR MER67B_LTR MER67C_LTR MER67D_LTR MER68-int_LTR MER6_DNA MER70A_LTR MER70B_LTR MER74A_LTR MER74B_LTR MER74C_LTR MER81_DNA MER82_DNA MER83B-int_LTR MER87_LTR MER89-int_LTR MER89_LTR MER8_DNA MER92B_LTR MER94_DNA MER96B_DNA MLT1A0_LTR MLT1A1_LTR MLT1A-int_LTR MLT1A_LTR MLT1B-int_LTR MLT1B_LTR MLT1C_LTR MLT1D_LTR MLT1E1A_LTR MLT1E2_LTR MLT1E3-int_LTR MLT1E3_LTR MLT1F2_LTR MLT1F-int_LTR MLT1F_LTR MLT1G1-int_LTR MLT1G1_LTR MLT1G3_LTR MLT1G-int_LTR MLT1G_LTR MLT1G_LTR MLT1H_LTR MLT1I_LTR MLT1J1-int_LTR MLT1J1_LTR MLT1J2_LTR MLT1J_LTR MLT1K_LTR MLT1L_LTR MLT1M_LTR MLT1N2_LTR MLT2B1_LTR MLT2B4_LTR MLT2D_LTR MSTA-int_LTR MSTA_LTR MSTB1_LTR MSTB-int_LTR MSTD-int_LTR ORSL-2b_DNA PABL_A-int PABL_B-int PRIMA41-int_LTR PRIMA4-int_LTR Ricksha_b Ricksha_c Ricksha_DNA SATR1_Satellite SVA_B SVA_C (TAAAA)n_Simple (TAAA)n_Simple (TAA)n_Simple (TAG)n_Simple (TA)n_Simple (TCCA)n_Simple (TCTCTG)n_Simple (TG)n_Simple THE1A-int_LTR THE1B-int_LTR THE1B_LTR THE1C-int_LTR THE1C_LTR THE1D_LTR Tigger10_DNA Tigger12c_DNA Tigger12_DNA Tigger13a_DNA Tigger15a_DNA Tigger16b_DNA Tigger1a_Art Tigger1_DNA Tigger2a_DNA Tigger2b_Pri Tigger2_DNA Tigger3a_DNA Tigger3b_DNA Tigger3_DNA Tigger4a_DNA Tigger4b_DNA Tigger4_DNA Tigger6a_DNA Tigger7_DNA Tigger8_DNA Tigger9b_DNA UCON23_DNA? Zaphod2_DNA Zaphod3_DNA Zaphod_DNA

    [0367] In some embodiments, one or both primers of a primer pair described herein include primer modifications. Examples of primer modifications include, without limitation, a spacer (e.g., C3 spacer, PC spacer, hexanediol, spacer 9, spacer 18, 1′,2′-dideoxyribose (dspacer)), phosphorylation, phosphorothioate bond modifications, modified nucleic acids, attachment chemistry and/or linker modifications. Examples of modified nucleic acids include, without limitation, 2-Aminopurine, 2,6-Diaminopurine (2-Amino-dA), 5-Bromo dU, deoxyUridine, Inverted dT, Inverted Dideoxy-T, Dideoxy-C, 5-Methyl dC, deoxyInosine, Super T®, Super G®, Locked Nucleic Acids (LNA's), 5-Nitroindole, 2′-O-Methyl RNA Bases, Hydroxymethyl dC, Iso-dG, Iso-dC, Fluoro C, Fluoro U, Fluoro A, Fluoro 2-MethoxyEthoxy A, 2-MethoxyEthoxy MeC, 2-MethoxyEthoxy and/or 2-MethoxyEthoxy T. Examples of attachment chemistries and linker modifications include, without limitation, Acrydite™, Adenylation, Azide (NHS Ester), Digoxigenin (NHS Ester), Cholesterol-TEG I-Linker, Amino Modifiers (e.g., amino modifier C6, amino nodifier C12, amino modifier C6 dT, amino modifier, and/or Uni-Link™ amino modifier), Alkynes (e.g., 5′ Hexynyl and/or 5-Octadiynyl dU), Biotinylation (e.g., biotin, biotin (Azide), biotin dT, biotin-TEG dual biotin, pC biotin, and/or desthiobiotin-TEG), and/or Thiol Modifications (e.g., thiol modifier C3 S—S, dithiol, and/or thiol modifier C6 S—S). In some embodiments, any primer as described herein includes synthetic nucleic acids.

    [0368] In some embodiments, one or both primers of a primer pair described herein include primer modifications that enhance processing of amplified DNA. In some embodiments, any primer as described herein includes primer modifications that facilitate elimination of primers (e.g., elimination of primers following an amplification reaction). In some embodiments, primer modifications are conveyed to a product of an amplification reaction (e.g., an amplification product contains modified bases). In such cases, the amplification product includes the modification and the inherent properties of the modification (e.g., the ability to select the amplification product containing the modification).

    [0369] In some embodiments, methods for identifying one or more chromosomal anomalies as described herein include using amplicon-based sequencing reads. In some embodiments, a plurality of amplicons (e.g., amplicons obtained from a DNA sample) are sequenced. In some embodiments, each amplicon is sequenced at least 1, 2,3,4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more times. In some embodiments, each amplicon can be sequenced between about 1 and about 20 (e.g., between about 1 and about 15, between about 1 and about 12, between about 1 and about 10, between about 1 and about 8, between about 1 and about 5, between about 5 and about 20, between about 7 and about 20, between about 10 and about 20, between about 13 and about 20, between about 3 and about 18, between about 5 and about 16, or between about 8 and about 12) times. In some cases, amplicon-based sequencing reads can include continuous sequencing reads. In some cases, amplicons include short interspersed nucleotide elements (SINEs). In some cases, amplicon-based sequencing reads can include from about 100,000 to about 25 million (e.g., from about 100,000 to about 20 million, from about 100,000 to about 15 million, from about 100,000 to about 12 million, from about 100,000 to about 10 million, from about 100,000 to about 5 million, from about 100,000 to about 1 million, from about 100,000 to about 750,000, from about 100,000 to about 500,000, from about 100,000 to about 250,000, from about 250,000 to about 25 million, from about 500,000 to about 25 million, from about 750,000 to about 25 million, from about 1 million to about 25 million, from about 5 million to about 25 million, from about 10 million to about 25 million, from about 15 million to about 25 million, from about 200,000 to about 20 million, from about 250,000 to about 15 million, from about 500,000 to about 10 million, from about 750,000 to about 5 million, or from about 1 million to about 2 million) sequencing reads. For example, sequencing a plurality of amplicons can include assigning a unique identifier (UID) to each template molecule (e.g., to each amplicon), amplifying each uniquely tagged template molecule to create UID-families, and redundantly sequencing the amplification products. For example, sequencing a plurality of amplicons can include calculating a Z-score of a variant on said selected chromosome arm using the equation

    [00001] Z .Math. i = 1 k w i z i .Math. i = 1 k w i z ,

    where w.sub.i is UID depth at a variant i, Z.sub.i is the Z-score of variant i, and k is the number of variants observed on the chromosome arm. In some embodiments, methods of sequencing amplicons includes methods known in the art (see, e.g., U.S. Pat. No. 2015/0051085; and Kinde et al. 2012 PloS ONE 7:e41162, which are herein incorporated by reference in their entireties). In some embodiments, amplicons are aligned to a reference genome (e.g., GRC37).

    [0370] In some embodiments, a plurality of amplicons generated by methods described herein includes from about 10,000 to about 1,000,000 (e.g., from about 15,000 to about 1,000,000, from about 25,000 to about 1,000,000, from about 35,000 to about 1,000,000, from about 50,000 to about 1,000,000, from about 75,000 to about 1,000,000, from about 100,000 to about 1,000,000, from about 125,000 to about 1,000,000, from about 160,000 to about 1,000,000, from about 180,000 to about 1,000,000, from about 200,000 to about 1,000,000, from about 300,000 to about 1,000,000, from about 500,000 to about 1,000,000, from about 750,000 to about 1,000,000, from about 10,000 to about 800,000, from about 10,000 to about 500,000, from about 10,000 to about 250,000, from about 10,000 to about 150,000, from about 10,000 to about 100,000, from about 10,000 to about 75,000, from about 10,000 to about 50,000, from about 10,000 to about 40,000, from about 10,000 to about 30,000, or from about 10,000 to about 20,000) amplicons (e.g., unique amplicons). As one non-limiting example, a plurality of amplicons can include about 745,000 amplicons (e.g., 745,000 unique amplicons). Amplicons in a plurality of amplicons can include from about 50 to about 140 (e.g., from about 60 to about 140, from about 76 to about 140, from about 90 to about 140, from about 100 to about 140, from about 130 to about 140, from about 50 to about 130, from about 50 to about 120, from about 50 to about 110, from about 50 to about 100, from about 50 to about 90, from about 50 to about 80, from about 60 to about 130, from about 70 to about 125, from about 80 to about 120, or from about 90 to about 100) nucleotides. As one non-limiting example, an amplicon can include about 100 nucleotides.

    [0371] In some embodiments, one or more amplicons in a plurality of amplicons generated by methods described herein can be greater than 1000 basepairs (bp) in length (“long amplicons”). In some embodiments, one or more long amplicons make up at least 4.0% of all amplicons within the total plurality of amplicons. In some embodiments, methods and materials described herein can detect long amplicons when the long amplicons make up at least 4.0% of all the amplicons within the total plurality of amplicons. In some embodiments, methods and materials described herein can detect long amplicons when the long amplicons make up between 0.01% and 3.9% of all amplicons within the total plurality of amplicons.

    [0372] In some embodiments, one or more amplicons with a length >1000 bp originate from amplification of DNA from cells that do not contain a chromosomal abnormality. In some embodiments, cells that do not contain chromosomal abnormalities are considered contaminating cells. In some embodiments, cells that do not contain chromosomal abnormalities are used as control cells or samples. In some embodiments, contaminating cells can be any variety of cells that might be found in a plasma sample that may dilute amplification of the intended target. In some embodiments, contaminating cells are white blood cells (e.g., leukocyte, granulocyte, eosinophil, basophile, B-cell, T-cell or Natural Killer cell). For example, contaminating cells can be leukocytes.

    [0373] In some embodiments, methods and materials for identifying one or more chromosomal anomalies as described herein include grouping sequencing reads (e.g., from a plurality of amplicons) into clusters (e.g., unique clusters) of genomic intervals. In some embodiments, a genomic interval is included in one or more clusters. In some embodiments, a genomic interval can belong to from about 100 to about 252 (e.g., from about 125 to about 252, from about 150 to about 252, from about 175 to about 252, from about 200 to about 252, from about 225 to about 252, from about 100 to about 250, from about 100 to about 225, from about 100 to about 200, from about 100 to about 175, from about 100 to about 150, from about 125 to about 225, from about 150 to about 200, or from about 160 to about 180) clusters. As one non-limiting example, a genomic interval can belong to about 176 clusters. In some embodiments, each cluster includes any appropriate number of genomic intervals. In some embodiments, each cluster includes the same number of genomic intervals. In some embodiments, different clusters include varying numbers of genomic clusters. As one non-limiting example, each cluster can include about 200 genomic intervals.

    [0374] In some embodiments, genomic intervals are identified as having shared amplicon features. As used herein, the term “shared amplicon feature” refers to amplicons with one or more features that are similar. In some embodiments, a plurality of genomic intervals are grouped into a cluster based on one or more shared amplicon features of the sequencing reads mapped to a genomic interval. In some embodiments, the shared amplicon feature is the number amplicons mapped to a genomic interval (e.g., sums of the distributions of the sequencing reads in each genomic interval). In some embodiments, the shared amplicon feature is the average length of the mapped amplicons.

    [0375] In some embodiments, a cluster of genomic intervals includes from about 5000 to about 6000 (e.g., from about 5100 to about 6000, from about 5200 to about 6000, from about 5300 to about 6000, from about 5400 to about 6000, from about 5500 to about 6000, from about 5600 to about 6000, from about 5700 to about 6000, from about 5800 to about 6000, from about 5900 to about 6000, from about 5000 to about 5900, from about 5000 to about 5800, from about 5000 to about 5700, from about 5000 to about 5600, from about 5000 to about 5500, from about 5000 to about 5400, from about 5000 to about 5300, from about 5000 to about 5200, from about 5000 to about 5100, from about 5100 to about 5800, from about 5100 to about 5700, from about 5100 to about 5600, from about 5100 to about 5500, from about 5100 to about 5400, from about 5100 to about 5300, from about 5100 to about 5200, from about 5200 to about 5600, from about 5200 to about 5500, from about 5200 to about 5400, from about 5200 to about 5300, from about 5300 to about 5500, from about 5300 to about 5400, or from about 5400 to 5500 from about 5200 to about 5700, or from about 5300 to about 5500) genomic intervals. As one non-limiting example, a cluster of genomic intervals can include about 5344 genomic intervals. A genomic interval can be any appropriate length. For example, a genomic interval can be the length of an amplicon sequenced as described herein. For example, a genomic interval can be the length of a chromosome arm. In some cases, a genomic interval can include from about 100 to about 125,000,000 (e.g., from about 250 to about 125,000,000, from about 500 to about 125,000,000, from about 750 to about 125,000,000, from about 1,000 to about 125,000,000, from about 1,500 to about 125,000,000, from about 2,000 to about 125,000,000, from about 5,000 to about 125,000,000, from about 7,500 to about 125,000,000, from about 10,000 to about 125,000,000, from about 25,000 to about 125,000,000, from about 50,000 to about 125,000,000, from about 100,000 to about 125,000,000, from about 250,000 to about 125,000,000, from about 500,000 to about 125,000,000, from about 100 to about 1,000,000, from about 100 to about 750,000, from about 100 to about 500,000, from about 100 to about 250,000, from about 100 to about 100,000, from about 100 to about 50,000, from about 100 to about 25,000, from about 100 to about 10,000, from about 100 to about 5,000, from about 100 to about 2,500, from about 100 to about 1,000, from about 100 to about 750, from about 100 to about 500, from about 100 to about 250, from about 500 to about 1,000,000, from about 5000 to about 900,000, from about 50,000 to about 800,000, or from about 100,000 to about 750,000) nucleotides. As one non-limiting example, a genomic interval can include about 500,000 nucleotides. In some embodiments, clusters of genomic intervals are formed using any appropriate method known in the art. In some embodiments, clusters of genomic intervals are formed based on shared amplicon features of the genomic intervals (see, e.g., Douville et al. PNAS 201 115(8):1871-1876, which is herein incorporated by reference in its entirety).

    [0376] In some embodiments, methods and materials described herein for identifying one or more chromosomal anomalies include assessing a genome (e.g., a genome of a mammal) for the presence or absence of one or more chromosomal anomalies (e.g., aneuploidies). The presence or absence of one or more chromosomal anomalies in the genome of a mammal can, for example, be determined by sequencing a plurality of amplicons obtained from a sample (e.g., a test sample) obtained from the mammal to obtain sequencing reads, and grouping the sequencing reads into clusters of genomic intervals. In some cases, read counts of genomic intervals can be compared to read counts of other genomic intervals within the same sample. In some cases where read counts of genomic intervals are compared to read counts of other genomic intervals within the same sample, a second (e.g., control or reference) sample is not assayed. In some cases, read counts of genomic intervals can be compared to read counts of genomic intervals in another sample. For example, when using methods and materials described herein to identify genetic relatedness, polymorphisms (e.g., somatic mutations), and/or microsatellite instability, genomic intervals can be compared to read counts of genomic intervals in a reference sample. A reference sample can be a synthetic sample. A reference sample can be from a database. In some cases where methods and materials described herein are used to identify anomalies (e.g., aneuploidies), a reference sample can be a normal sample obtained from the same cancer patient (e.g., a sample from the cancer patient that does not harbor cancer cells) or a normal sample from another source (e.g., a patient that does not have cancer). In some cases where method and materials described herein are used to identify anomalies (e.g., aneuploidies), a reference sample can be a normal sample obtained from the same patient (e.g., a sample from pre-natal human that contains only maternal cells).

    [0377] In some embodiments, methods and materials described herein are used for detecting aneuploidy in a preimplantation embryo (e.g., an embryo generated via in vitro fertilization). In some embodiments, the presence or absence of one or more chromosomal anomalies in a preimplantation embryo is determined by sequencing a plurality of amplicons obtained from a sample taken from the preimplantation embryo (e.g., a test sample such, as without limitation, one or more cells obtained from a blastocyst) to obtain sequencing reads, and grouping the sequencing reads into clusters of genomic intervals. In some cases, read counts of genomic intervals can be compared to read counts of other genomic intervals within the same sample. In some cases where read counts of genomic intervals are compared to read counts of other genomic intervals within the same sample, a second (e.g., control or reference) sample is not assayed. In some cases, read counts of genomic intervals can be compared to read counts of genomic intervals in another sample (e.g., a reference sample). In some embodiments, a reference sample is a sample obtained from a reference mammal. In some embodiments, a reference sample is obtained from a database (e.g., the reference sample is an in silico sample having a known sequence and/or ploidy at the genomic position of interest). Exemplary aneuploidies that can be detected in preimplantation embryos include trisomies at chromosome 21 (e.g., resulting in Down's Syndrome), trisomies at chromosome 13, trisomies at chromosome 18, Turner Syndrome (e.g., women with only one X chromosome) and Klinefelter Syndrome (e.g., men with two or more X chromosomes). In some embodiments, methods and materials described herein are used for detecting aneuploidy in a genome of mammal. For example, a plurality of amplicons obtained from a sample obtained from a mammal can be sequenced, the sequencing reads can be grouped into clusters of genomic intervals, the sums of the distributions of the sequencing reads in each genomic interval can be calculated, a Z-score of a chromosome arm can be calculated, and the presence or absence of an aneuploidy in the genome of the mammal can be identified.

    [0378] The distributions of the sequencing reads in each genomic interval can be summed. For example, sums of distributions of the sequencing reads in each genomic interval can be calculated using the equation Σ.sub.1.sup.I R˜N(Σ.sub.1.sup.l μ.sub.i, Σ.sub.1.sup.I σ.sub.i.sup.2), where R.sub.i is the number of sequencing reads, I is the number of clusters on a chromosome arm, N is a Gaussian distribution with parameters μ.sub.i and σ.sub.l.sup.2, and μ.sub.i is the mean number of sequencing reads in each genomic interval, and σ.sub.i.sup.2 is the variance of sequencing reads in each genomic interval. A Z-score of a chromosome arm can be calculated using any appropriate technique. For example, a Z-score of a chromosome arm can be calculated using the quantile function 1-CDF(Σ.sub.1.sup.I μ.sub.i, Σ.sub.1.sup.I σ.sub.i.sup.2). The presence of an aneuploidy in the genome of the mammal can be identified in the genome of the mammal when the Z-score is outside a predetermined significance threshold, and the absence of an aneuploidy in the genome of the mammal can be identified in the genome of the mammal when the Z-score is within a predetermined significance threshold. The predetermined threshold can correspond to the confidence in the test and the acceptable number of false positives. For example, a significance threshold can be ±1.96, ±3, or ±5. In some embodiments, methods and materials described herein employ supervised machine learning. In some embodiments, supervised machine learning can detect small changes in one or more chromosome arms. For example, supervised machine learning can detect changes such as chromosome arm gains or losses that are often present in a disease or disorder associated with chromosomal anomalies, such as cancer or congenital anomalies. In some embodiments, supervised machine learning can detect changes such as chromosome arm gains or losses that are present in a preimplantation embryo (e.g., a preimplantation embryo generated by in vitro fertilization methods). In some cases, supervised machine learning can be used to classify samples according to aneuploidy status. For example, supervised machine learning can be employed to make genome-wide aneuploidy calls. In some cases, a support vector machine model can include obtaining an SVM score. An SVM score can be obtained using any appropriate technique. In some cases, an SVM score can be obtained as described elsewhere (see, e.g., Cortes 1995 Machine learning 20:273-297; and Meyer et al. 2015 R package version:1.6-3). At lower read depths, a sample will typically have a higher raw SVM score. Thus, in some cases, raw SVM probabilities can be corrected based on the read depth of a sample using the equation

    [00002] log ( 1 - 1 r ) = A x + B ,

    where r is the ratio of the SVM score at a particular read depth/minimum SVM score of a particular sample given sufficient read depth. A and B can be determined as described in Example 1. For example, A=−7.076*10{circumflex over ( )}−7, x=the number of unique template molecules for the given sample, and B=−1.946*10{circumflex over ( )}−1.

    [0379] Also provided herein are new methods of normalization that reduce the amount of variability between samples. In some embodiments, a principal component analysis (PCA) can be used for normalization. In some embodiments, a PCA is performed on sequencing data from the controls. For example, a PCA may reduce the number of 500 kb genomic intervals from n=5,344 to a more manageable number of dimensions. Using the PCA coordinates of the controls, a model can be generated that predicts whether a particular 500 kb interval will be amplified more or less efficiently in future samples based on their PCA coordinates.


    Correction Factor for 500 kb Interval.sub.i=β.sub.oi+β.sub.1i*PCA.sub.1β.sub.2i*PCA.sub.2+β.sub.3i*PCA.sub.3+β.sub.4i*PCA.sub.4+β.sub.5i*PCA.sub.5

    [0380] For example, for each test sample, a sample can be projected into PCA space and the correction factor can be calculated for each 500 kb interval as function of its PCA coordinates. After applying the correction factor to each 500 kb genomic interval, the test sample may be matched to one or more control samples based on the closest Euclidean distance of the 500 kb intervals.

    [0381] In some embodiments, samples are excluded in order to ensure the quality of the data. In some embodiments, samples are excluded before, contemporaneously with, and/or after data analysis. In some embodiments, a list of factors can be applied to the data in order to exclude data that does not meet the criteria set forth in the list of factors. In some embodiments, the list of factors may be any reasonable number of factors. For example, a list of five factors can be used to exclude samples. Any combination of factors can be used to determine that a sample should be excluded. In some embodiments, samples with fewer than 2.5M reads may be excluded. In some embodiments, samples with sufficient evidence of contamination may be excluded. For example, a sample may be considered contaminated if the sample has at least 10 significant allelic imbalanced chromosome arms (z score >=2.5) and fewer than ten significant chromosome arms gains or losses (z>=2.5 or z<=−2.5). In some embodiments, allelic imbalance can be determined from SNPs, while gains or losses can be assessed through WALDO. In some embodiments, when examining the quality of the plasma samples, samples may be excluded in which more than 8.5% of the amplicons were larger than 94 bps (50 base pairs between the forward and reverse primers). Without wishing to be bound by theory, such samples may be contaminated with leukocyte DNA. In some embodiments, samples outside the dynamic range of the assay, as defined by the equation below, may be excluded.

    [00003] QC Dynamic Range Metric = .Math. i 2 q , 3 q , 4 q , 5 q , 6 q , 8 q , 13 q Reads on chr i .Math. 39 j = 1 Reads on chr j

    [0382] For example, the distribution of this metric has long tails. The values of >0.2450 and 0.2320 may be selected as a dynamic range that could evaluate cutoffs. In some embodiments, plasma samples with known aneuploidy in the leukocytes of the same patients may be excluded. For example, such patients may have Clonal Hematopoiesis of Indeterminate Potential (CHIP) or congenital disorders.

    [0383] In some embodiments, provided herein are methods to detect copy number variants (CNVs) of indeterminate length. In some embodiments, provided herein are methods to detect copy number variation of near-fixed length. In some embodiments, detecting copy number variation include calculating the values of one or more variables. In some embodiments, using a log ratio of the observed test sample and WALDO predicted values from every 500 kb interval across each chromosomal arm, a circular binary segmentation algorithm can be applied to determine copy number variants throughout each chromosome arm. For example, copy number variant ≤5 Mb in size can be flagged. In some embodiments, the flagged CNVs can be removed before, contemporaneously with, and/or after the analysis. In some embodiments, small CNVs may be used to assess microdeletions or microamplifications. For example, microdelections or microamplifications occur in DiGeorge Syndrome (chromosome 22q11.2 or in breast cancers (chromosome 17q12).

    [0384] In some embodiments, provided herein are methods of using synthetic aneuploid samples. In some embodiments, synthetic aneuploidy samples can be created by adding (or subtracting) reads from several chromosome arms to the reads from these normal DNA samples. For example, reads can be added or subtracted from 1, 10, 15, or 20 chromosome arms to each sample. The additions and subtractions can be designed to represent neoplastic cell fractions ranging from 0.5% to 1.5% and resulted in synthetic samples containing exactly ten million reads. The reads from each chromosome arm can be added or subtracted uniformly. In some embodiments, provided herein are methods of generating synthetic aneuploid samples using exemplary pseudocode (FIG. 5). In some embodiments, a person of ordinary skill in the art will be able to generate a synthetic sample by applying known coding languages and techniques to the exemplary pseudocode shown in FIG. 5.

    [0385] Examples of chromosomal anomalies that can be detected using methods and materials described herein include, without limitation, numerical disorders, structural abnormalities, allelic imbalances, and microsatellite instabilities. A chromosomal anomaly can include a numerical disorder. For example, a chromosomal anomaly can include an aneuploidy (e.g., an abnormal number of chromosomes). In some cases, an aneuploidy can include an entire chromosome. In some cases, an aneuploidy can include part of a chromosome (e.g., a chromosome arm gain or a chromosome arm loss). Examples of aneuploidies include, without limitation, monosomy, trisomy, tetrasomy, and pentasomy. A chromosomal anomaly can include a structural abnormality. Examples of structural abnormalities include, without limitation, deletions, duplications, translocations (e.g., reciprocal translocations and Robertsonian translocations), inversions, insertions, rings, and isochromosomes. Chromosomal anomalies can occur on any chromosome pair (e.g., chromosome 1, chromosome 2, chromosome 3, chromosome 4, chromosome 5, chromosome 6, chromosome 7, chromosome 8, chromosome 9, chromosome 10, chromosome 11, chromosome 12, chromosome 13, chromosome 14, chromosome 15, chromosome 16, chromosome 17, chromosome 18, chromosome 19, chromosome 20, chromosome 21, chromosome 22, and/or one of the sex chromosomes (e.g., an X chromosome or a Y chromosome). For example, aneuploidy can occur, without limitation, in chromosome 13 (e.g., trisomy 13), chromosome 16 (e.g., trisomy 16), chromosome 18 (e.g., trisomy 18), chromosome 21 (e.g., trisomy 21), and/or the sex chromosomes (e.g., X chromosome monosomy; sex chromosome trisomy such as XXX, XXY, and XYY; sex chromosome tetrasomy such as XXXX and XXYY; and sex chromosome pentasomy such as XXXXX, XXXXY, and XYYYY). For example, structural abnormalities can occur, without limitation, in chromosome 4 (e.g., partial deletion of the short arm of chromosome 4), chromosome 11 (e.g., a terminal 11q deletion), chromosome 13 (e.g., Robertsonian translocation at chromosome 13), chromosome 14 (e.g., Robertsonian translocation at chromosome 14), chromosome 15 (e.g., Robertsonian translocation at chromosome 15), chromosome 17 (e.g., duplication of the gene encoding peripheral myelin protein 22), chromosome 21 (e.g., Robertsonian translocation at chromosome 21), and chromosome 22 (e.g., Robertsonian translocation at chromosome 22).

    [0386] In some embodiments, methods and materials as described herein are used for identifying and/or treating a disease associated with one or more chromosomal anomalies (e.g., one or more chromosomal anomalies identified as described herein, such as, without limitation, an aneuploidy). In some cases, a DNA sample (e.g., a genomic DNA sample) obtained from a mammal can be assessed for the presence or absence of one or more chromosomal anomalies. For example, a mammal (e.g., a human) can be identified as having a disease based, at least in part, on the presence of one or more chromosomal anomalies can be treated with one or more cancer treatments. In some embodiments, a mammal identified as having cancer based, at least in part, on the presence of one or more chromosomal anomalies is treated with one or more cancer treatments. In some embodiments, a mammal (e.g., a prenatal human) can be identified as having a disease or disorder based, at least in part, on the presence of one or more chromosomal anomalies. In some embodiments, an embryo (e.g., an embryo generated by in vitro fertilization) can be identified as being unsuitable for to transfer to the uterus (e.g., a human uterus) for implantation based, at least in part, on the presence of one or more chromosomal anomalies. In some embodiments, an embryo (e.g., an embryo generated by in vitro fertilization) can be identified as being suitable for to transfer to the uterus (e.g., a human uterus) for implantation based, at least in part, on the absence of one or more chromosomal anomalies.

    [0387] In some embodiments, a mammal identified as having a disease or disorder associated with one or more chromosomal anomalies as described herein (e.g., based at least in part on the presence of one or more chromosomal anomalies, such as, without limitation, an aneuploidy) can have the disease or disorder diagnosis confirmed using any appropriate method. Examples of methods that can be used to confirm the presence of one or more chromosomal anomalies include, without limitation, karyotyping, fluorescence in situ hybridization (FISH), quantitative PCR of short tandem repeats, quantitative fluorescence PCR (QF-PCR), quantitative PCR dosage analysis, quantitative mass spectrometry of SNPs, comparative genomic hybridization (CGH), whole genome sequencing, and exome sequencing.

    Multi-Analyte Test for Cancer Detection

    [0388] In some embodiments, detection of aneuploidy is used to identify a mammal as having cancer (e.g., any of the exemplary cancers described herein). In some embodiments, detection of one or more genetic biomarkers is used to confirm or identify a mammal as having cancer (e.g., any of the exemplary cancers described herein). In some embodiments, an elevated level of one or more peptide biomarkers is used to confirm or identify a mammal as having cancer (e.g., any of the exemplary cancers described herein). In some embodiments, a mammal identified as having cancer as described herein (e.g., based on detection of aneuploidy, and/or at least in part on the presence or absence of one or more genetic biomarkers (e.g., mutations) and/or an elevated level of one or more protein biomarkers (e.g., peptides)) can have the cancer diagnosis confirmed using any appropriate method. Examples of methods that can be used to diagnose or confirm diagnosis of a cancer include, without limitation, physical examinations (e.g., pelvic examination), imaging tests (e.g., ultrasound or CT scans), cytology, and tissue tests (e.g., biopsy).

    [0389] In some embodiments, methods for identifying one or more chromosomal anomalies (e.g., aneuploidy) provided herein are used to identify a mammal as having a distinct stage of cancer. In some embodiments, a cancer can be a Stage I cancer. In some embodiments, a cancer can be a Stage II cancer. In some embodiments, a cancer can be a Stage III cancer. In some embodiments, a cancer can be a Stage IV cancer. In some embodiments, methods for identifying one or more chromosomal anomalies (e.g., aneuploidy) provided herein are used to identify a mammal as having a stage of cancer that conventional methods of detecting cancer cannot reliably detect. For example, methods for identifying one or more chromosomal anomalies (e.g., aneuploidy) provided herein can be used to identify a mammal as having a Stage I cancer that conventional methods of detecting cancer cannot reliably detect. In some embodiments, methods provided herein for identifying: 1) one or more chromosomal anomalies (e.g., aneuploidy), and 2) one or more genetic biomarkers (e.g., any of the genetic biomarkers provided herein) are used to identify a mammal as having a stage of cancer that conventional methods of detecting cancer cannot reliably detect. In some embodiments, methods provided herein for identifying: 1) one or more chromosomal anomalies (e.g., aneuploidy), and 2) one or more protein biomarkers (e.g., any of the protein biomarkers provided herein) are used to identify a mammal as having a stage of cancer that conventional methods of detecting cancer cannot reliably detect. Non-limiting examples of cancers that be identified as described herein (e.g., based on detection of aneuploidy, and/or at least in part on the presence or absence of one or more genetic biomarkers (e.g., mutations) and/or an elevated level of one or more protein biomarkers (e.g., peptides)) include, liver cancer, ovarian cancer, esophageal cancer, stomach cancer, pancreatic cancer, colorectal cancer, lung cancer, breast cancer, and prostate cancer.

    [0390] In some embodiments, the subject in which the presence of one or more chromosomal anomalies (e.g., aneuploidies) is detected may be selected for further diagnostic testing. In some embodiments, methods provided herein can be used to select a subject for further diagnostic testing at a time period prior to the time period when conventional techniques are capable of diagnosing the subject with an early-stage cancer. For example, methods provided herein for selecting a subject for further diagnostic testing can be used when a subject has not been diagnosed with cancer by conventional methods and/or when a subject is not known to harbor a cancer. In some embodiments, a subject selected for further diagnostic testing can be administered a diagnostic test (e.g., any of the diagnostic tests described herein) at an increased frequency compared to a subject that has not been selected for further diagnostic testing. For example, a subject selected for further diagnostic testing can be administered a diagnostic test at a frequency of twice daily, daily, bi-weekly, weekly, bi-monthly, monthly, quarterly, semi-annually, annually, or any at frequency therein. In some embodiments, a subject selected for further diagnostic testing can be administered one or more additional diagnostic tests compared to a subject that has not been selected for further diagnostic testing. For example, a subject selected for further diagnostic testing can be administered two diagnostic tests or more, whereas a subject that has not been selected for further diagnostic testing is administered only a single diagnostic test (or no diagnostic tests). In some embodiments, the diagnostic testing method can determine the presence of the same type of cancer as the originally detected cancer. Additionally or alternatively, the diagnostic testing method can determine the presence of a different type of cancer from the originally detected cancer.

    [0391] In some embodiments, the diagnostic testing method is a scan. In some embodiments, the scan is a bone scan, a computed tomography (CT), a CT angiography (CTA), an esophagram (a Barium swallow), a Barium enema, a gallium scan, a magnetic resonance imaging (MRI), a mammography, a monoclonal antibody scan (e.g., ProstaScint® scan for prostate cancer, OncoScint® scan for ovarian cancer, and CEA-Scan® for colon cancer), a multigated acquisition (MUGA) scan, a PET scan, a PET/CT scan, a thyroid scan, an ultrasound (e.g., a breast ultrasound, an endobronchial ultrasound, an endoscopic ultrasound, a transvaginal ultrasound), an X-ray, a DEXA scan.

    [0392] In some embodiments, the diagnostic testing method is a physical examination, such as, without limitation, an anoscopy, a biopsy, a bronchoscopy (e.g., an autofluorescence bronchoscopy, a white-light bronchoscopy, a navigational bronchoscopy), a digital breast tomosynthesis, a digital rectal exam, an endoscopy, including but not limited to a capsule endoscopy, virtual endoscopy, an arthroscopy, a bronchoscopy, a colonoscopy, a colposcopy, a cystoscopy, an esophagoscopy, a gastroscopy, a laparoscopy, a laryngoscopy, a neuroendoscopy, a proctoscopy, a sigmoidoscopy, a skin cancer exam, a thoracoscopy, an endoscopic retrograde cholangiopancreatography (ERCP), an ensophagogastroduodenoscopy, a pelvic exam.

    [0393] In some embodiments, the diagnostic testing method is a biopsy (e.g., a bone marrow aspiration, a tissue biopsy). In some embodiments, the biopsy is performed by fine needle aspiration or by surgical excision. In some embodiments, the diagnostic testing method(s) further include obtaining a biological sample (e.g., a tissue sample, a urine sample, a blood sample, a check swab, a saliva sample, a mucosal sample (e.g., sputum, bronchial secretion), a nipple aspirate, a secretion or an excretion). In some embodiments, the diagnostic testing method(s) include determining exosomal proteins (e.g., an exosomal surface protein (e.g., CD24, CD147, PCA-3)) (Soung et al. (2017) Cancers 9(1):pii:E8). In some embodiments, the diagnostic testing method is an oncotype DX® test (Baehner (2016) Ecancermedicalscience 10:675).

    [0394] In some embodiments, the diagnostic testing method is a test, such as without limitation, an alpha-fetoprotein blood test, a bone marrow test, a fecal occult blood test, a human papillomavirus test, low-dose helical computed tomography, a lumbar puncture, a prostate specific antigen (PSA) test, a pap smear, or a tumor marker test.

    [0395] In some embodiments, the diagnostic testing method includes determining the level of a known protein biomarker (e.g., CA-125 or prostate specific antigen (PSA)). For example, a high amount of CA-125 can be found in subject's blood, which subject has ovarian cancer, endometrial cancer, fallopian tube cancer, pancreatic cancer, stomach cancer, esophageal cancer, colon cancer, liver cancer, breast cancer, or lung cancer. The term “biomarker” as used herein refers to “a biological molecule found in blood, other bodily fluids, or tissues that is a sign of a normal or abnormal process, or of a condition or disease”, e.g., as defined by the National Cancer Institute. (see, e.g., the URL www.cancer.gov/publications/dictionaries/cancer-terms? CdrID=45 618). A biomarker can include a genetic biomarker such as, without limitation, a nucleic acid (e.g., a DNA molecule, a RNA molecule (e.g., a microRNA, a long non-coding RNA (lncRNA) or other non-coding RNA) A biomarker can include a protein biomarker such as, without limitation, a peptide, a protein, or a fragment thereof.

    [0396] In some embodiments, the biomarker is FLT3, NPM1, CEBPA, PRAM1, ALK, BRAF, KRAS, EGFR, Kit, NRAS, JAK2, KRAS, HPV virus, ERBB2, BCR-ABL, BRCA1, BRCA2, CEA, AFP, and/or LDH. See e.g., Easton et al. (1995) Am. J. Hum. Genet. 56: 265-271, Hall et al. (1990) Science 250: 1684-1689, Lin et al. (2008) Ann. Intern. Med. 149: 192-199, Allegra et al. (2009) (2009) J. Clin. Oncol. 27: 2091-2096, Paik et al. (2004) N. Engl. J. Med. 351: 2817-2826, Bang et al. (2010) Lancet 376: 687-697, Piccart-Gebhart et al. (2005) N. Engl. J. Med. 353: 1659-1672, Romond et al. (2005) N. Engl. J. Med. 353: 1673-1684, Locker et al. (2006) J. Clin. Oncol. 24: 5313-5327, Giligan et al. (2010) J. Clin. Oncol. 28: 3388-3404, Harris et al. (2007) J. Clin. Oncol. 25: 5287-5312; Henry and Hayes (2012) Mol. Oncol. 6: 140-146. In some embodiments, the biomarker is a biomarker for detection of breast cancer in a subject, such as, without limitation, MUC-1, CEA, p53, urokinase plasminogen activator, BRCA1, BRCA2, and/or HER2 (Gam (2012) World J. Exp. Med. 2(5): 86-91). In some embodiments, the biomarker is a biomarker for detection of lung cancer in a subject, such as, without limitation, KRAS, EGFR, ALK, MET, and/or ROS1 (Mao (2002) Oncogene 21: 6960-6969; Korpanty et al. (2014) Front Oncol. 4: 204). In some embodiments, the biomarker is a biomarker for detection of ovarian cancer in a subject, such as, without limitation, HPV, CA-125, HE4, CEA, VCAM-1, KLK6/7, GST1, PRSS8, FOLR1, ALDH1 (Nolen and Lokshin (2012) Future Oncol. 8(1): 55-71; Sarojini et al. (2012) J. Oncol. 2012:709049). In some embodiments, the biomarker is a biomarker for detection of colorectal cancer in a subject, such as, without limitation, MLH1, MSH2, MSH6, PMS2, KRAS, and BRAF (Gonzalez-Pons and Cruz-Correa (2015) Biomed. Res. Int. 2015: 149014; Alvarez-Chaver et al. (2014) World J. Gastroenterol. 20(14): 3804-3824). In some embodiments, the diagnostic testing method determines the presence and/or expression level of a nucleic acid (e.g., microRNA (Sethi et al. (2011) J. Carcinog. Mutag. S1-005), RNA, a SNP (Hosein et al. (2013) Lab. Invest doi: 10.1038/labinvest.2013.54; Falzoi et al. (2010) Pharmacogenomics 11: 559-571), methylation status (Castelo-Branco et al. (2013) Lancet Oncol 14: 534-542), a hotspot cancer mutation (Yousem et al. (2013) Chest 143: 1679-1684)). Non-limiting examples of methods of detecting a nucleic acid in a sample include: PCR, RT-PCR, sequencing (e.g., next generation sequencing methods, deep sequencing), a DNA microarray, a microRNA microarray, a SNP microarray, fluorescent in situ hybridization (FISH), restriction fragment length polymorphism (RFLP), gel electrophoresis, Northern blot analysis, Southern blot analysis, chromogenic in situ hybridization (CISH), chromatin immunoprecipitation (ChIP), SNP genotyping, and DNA methylation assay. See, e.g., Meldrum et al. (2011) Clin. Biochem. Rev. 32(4): 177-195; Sidranksy (1997) Science 278(5340): 1054-9.

    [0397] In some embodiments, the diagnostic testing method includes determining the presence of a protein biomarker in a sample (e.g., a plasma biomarker (Mirus et al. (2015) Clin. Cancer Res. 21(7): 1764-1771)). Non-limiting examples of methods of determining the presence of a protein biomarker include: western blot analysis, immunohistochemistry (IHC), immunofluorescence, mass spectrometry (MS) (e.g., matrix assisted laser desorption/ionization (MALDI)-MS, surface enhanced laser desorption/ionization time-of-flight (SELDI-TOF)-MS), enzyme-linked immunosorbent assay (ELISA), flow cytometry, proximity assay (e.g., VeraTag proximity assay (Shi et al. (2009) Diagnostic molecular pathology: the American journal of surgical pathology, part B: 18: 11-21, Huang et al. (2010) AM. J. Clin. Pathol. 134: 303-11)), a protein microarray (e.g., an antibody microarray (Ingvarsson et al. (2008) Proteomics 8: 2211-9, Woodbury et al. (2002) J. Proteome Res. 1: 233-237), an IHC-based microarray (Stromberg et al. (2007) Proteomics 7: 2142-50), a microarray ELISA (Schroder et al. (2010) Mol. Cell. Proteomics 9: 1271-80). In some embodiments, the method of determining the presence of a protein biomarker is a functional assay. In some embodiments, the functional assay is a kinase assay (Ghosh et al. (2010) Biosensors & Bioelectronics 26: 424-31, Mizutani et al. (2010) Clin. Cancer Res. 16: 3964-75, Lee et al. (2012) Biomed. Microdevices 14: 247-57), a protease assay (Lowe et al. (2012) ACS nano. 6: 851-7, Fujiwara et al. (2006) Breast cancer 13: 272-8, Darragh et al. (2010) Cancer Res 70: 1505-12). See, e.g., Powers and Palecek (2015) J. Heathc Eng. 3(4): 503-534, for a review of protein analytical assays for diagnosing cancer patients.

    [0398] In some embodiments, any appropriate disease or condition associated with one or more chromosomal anomalies as described herein (e.g., based at least in part on the presence of one or more chromosomal anomalies, such as, without limitation, an aneuploidy) is identified as described herein. In some embodiments, the disease is cancer. Examples of cancers that can be associated with one or more chromosomal anomalies include, without limitation, lung cancer (e.g., small cell lung carcinoma or non-small cell lung carcinoma), papillary thyroid cancer, medullary thyroid cancer, differentiated thyroid cancer, recurrent thyroid cancer, refractory differentiated thyroid cancer, lung adenocarcinoma, bronchioles lung cell carcinoma, multiple endocrine neoplasia type 2A or 2B (MEN2A or MEN2B, respectively), pheochromocytoma, parathyroid hyperplasia, breast cancer, colorectal cancer (e.g., metastatic colorectal cancer), papillary renal cell carcinoma, ganglioneuromatosis of the gastroenteric mucosa, inflammatory myofibroblastic tumor, or cervical cancer, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), cancer in adolescents, adrenal cancer, adrenocortical carcinoma, anal cancer, appendix cancer, astrocytoma, atypical teratoid/rhabdoid tumor, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain stem glioma, brain tumor, breast cancer, bronchial tumor, Burkitt lymphoma, carcinoid tumor, unknown primary carcinoma, cardiac tumors, cervical cancer, childhood cancers, chordoma, chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), chronic myeloproliferative neoplasms, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, bile duct cancer, ductal carcinoma in situ, embryonal tumors, endometrial cancer, ependymoma, esophageal cancer, esthesioneuroblastoma, Ewing sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, eye cancer, fallopian tube cancer, fibrous histiocytoma of bone, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumors (GIST), germ cell tumor, gestational trophoblastic disease, glioma, hairy cell tumor, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular cancer, histiocytosis, Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell tumors, pancreatic neuroendocrine tumors, Kaposi sarcoma, kidney cancer, Langerhans cell histiocytosis, laryngeal cancer, leukemia, lip and oral cavity cancer, liver cancer, lung cancer, lymphoma, macroglobulinemia, malignant fibrous histiocytoma of bone, osteocarcinoma, melanoma, Merkel cell carcinoma, mesothelioma, metastatic squamous neck cancer, midline tract carcinoma, mouth cancer, multiple endocrine neoplasia syndromes, multiple myeloma, mycosis fungoides, myelodysplastic syndromes, myelodysplastic/myeloproliferative neoplasms, myelogenous leukemia, myeloid leukemia, multiple myeloma, myeloproliferative neoplasms, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, non-small cell lung cancer, oral cancer, oral cavity cancer, lip cancer, oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, hepatobiliary cancer, upper urinary tract cancer, papillomatosis, paraganglioma, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromosytoma, pituitary cancer, plasma cell neoplasm, pleuropulmonary blastoma, pregnancy and breast cancer, primary central nervous system lymphoma, primary peritoneal cancer, prostate cancer, rectal cancer, renal cell cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, Sezary syndrome, skin cancer, small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer, stomach cancer, T-cell lymphoma, testicular cancer, throat cancer, thymoma and thymic carcinoma, thyroid cancer, transitional cell cancer of the renal pelvis and ureter, unknown primary carcinoma, urethral cancer, uterine cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom Macroglobulinemia, Wilms' tumor, 1p36 deletion syndrome, 1q21.1 deletion syndrome, 2q37 deletion syndrome, Wolf-Hirschhorn syndrome, Cri du chat, 5q deletion syndrome, Williams syndrome, Monosomy 8p, Monosomy 8q, Alfi's syndrome, Kleefstra syndrome, Monosomy 10p, Monosomy 10q, Jacobsen syndrome, Patau syndrome, Angelman syndrome, Prader-Willi syndrome, Miller-Dieker syndrome, Smith-Magenis syndrome, Edwards syndrome, Down syndrome, DiGeorge syndrome, Phelan-McDermid syndrome, 22q11.2 distal deletion syndrome, Cat eye syndrome, XYY syndrome, Triple X syndrome, Klinefelter syndrome, Wolf-Hirschhorn syndrome, Jacobsen syndrome, Charcot-Marie-Tooth disease type 1A, and Lynch Syndrome.

    [0399] Once identified as having a disease associated with one or more chromosomal anomalies as described herein (e.g., based at least in part on the presence of one or more chromosomal anomalies, such as, without limitation, an aneuploidy), a mammal (e.g., a human) can be treated accordingly. For example, when a mammal is identified as having a cancer associated with one or more chromosomal anomalies as described herein, the mammal can be treated with one or more cancer treatments. The one or more cancer treatments can include any appropriate cancer treatments. A cancer treatment can include surgery. A cancer treatment can include radiation therapy. A cancer treatment can include administration of a pharmacotherapy such chemotherapy, hormone therapy, targeted therapy, and/or cytotoxic therapy. Examples of cancer treatments include, without limitation, platinum compounds (such as cisplatin or carboplatin), taxanes (such as paclitaxel or docetaxel), albumin bound paclitaxel (nab-paclitaxel), altretamine, capecitabine, cyclophosphamide, etoposide (vp-16), gemcitabine, ifosfamide, irinotecan (cpt-11), liposomal doxorubicin, melphalan, pemetrexed, topotecan, vinorelbine, luteinizing-hormone-releasing hormone (LHRH) agonists (such as goserelin and leuprolide), anti-estrogen therapy (such as tamoxifen), aromatase inhibitors (such as letrozole, anastrozole, and exemestane), angiogenesis inhibitors (such as bevacizumab), poly(ADP)-ribose polymerase (PARP) inhibitors (such as olaparib, rucaparib, and niraparib), external beam radiation therapy, brachytherapy, radioactive phosphorus, and any combinations thereof.

    Multi-Analyte Test to Increase Sensitivity of Detection

    [0400] In some embodiments, methods provided herein to detect aneuploidy (e.g., using the analysis of chromosomal sequences (see e.g., Table 1 for an exemplary list of repetitive elements that can be analyzed)) increase sensitivity of cancer detection compared to cancer detection using the presence of one or more genetic biomarkers as indicators of cancer. In some embodiments, methods provided herein to detect aneuploidy (e.g., using the analysis of chromosomal sequences (see e.g., Table 1 for an exemplary list of repetitive elements that can be analyzed)) increase sensitivity of cancer detection compared to cancer detection using the presence of one or more protein biomarkers as indicators of cancer.

    [0401] In some embodiments, methods provided herein to detect aneuploidy (e.g., using the analysis of chromosomal sequences (see e.g., Table 1 for an exemplary list of repetitive elements that can be analyzed)) are combined with one or more methods to detect the presence of one or more genetic biomarkers (e.g., mutations). In some embodiments, the combination of aneuploidy detection with genetic biomarker detection increases the specificity and/or sensitivity of detecting cancer. In some embodiments, methods provided herein to detect aneuploidy (e.g., using the analysis of chromosomal sequences (see e.g., Table 1 for an exemplary list of repetitive elements that can be analyzed)) are combined with one or more methods to detect the presence of one or more members of a panel of protein biomarkers (e.g., peptides). In some embodiments, the combination of aneuploidy detection with protein biomarker detection increases the specificity and/or sensitivity of detecting cancer. In some embodiments, methods provided herein to detect aneuploidy (e.g., using the analysis of chromosomal sequences (see e.g., Table 1 for an exemplary list of repetitive elements that can be analyzed)) are combined with methods to detect the presence of one or more genetic biomarkers (e.g., mutations) and/or methods to detect the presence of one or more members of a panel of protein biomarkers (e.g., peptide). In some embodiments, the combination of aneuploidy detection with genetic and/or protein biomarker detection increases the specificity and/or sensitivity of detecting cancer.

    [0402] In some embodiments, methods provided herein to detect aneuploidy are combined with methods to detect the presence of one or more genetic biomarkers (e.g., mutations) in one or more genes selected from the group consisting of: NRAS, PTEN, FGFR2, KRAS, POLE, AKT1, TP53, RNF43, PPP2R1A, MAPK1, CTNNB1, PIK3CA, FBXW7, PIK3R1, APC, EGFR, BRAF. In some embodiments, methods provided herein to detect aneuploidy are combined with methods to detect the presence of one or more genetic biomarkers (e.g., mutations) in one or more genes selected from the group consisting of: PTEN, TP53, PIK3CA, PIK3R1, CTNNB1, KRAS, FGFR2, POLE, APC, FBXW7, RNF43, and PPP2R1A. In some embodiments, an assay includes detection of genetic biomarkers (e.g., mutations) in one or more of any of the genes disclosed herein including, without limitation, CDKN2A, FGF2, GNAS, ABL1, EVIL MYC, APC, IL2, TNFAIP3, ABL2, EWSR1, MYCL1, ARHGEF12, JAK2, TP53, AKT1, FEV, MYCN, ATM, MAP2K4, TSC1, AKT2, FGFR1, NCOA4, BCL11B, MDM4, TSC2, ATF1, FGFR1OP, NFKB2, BLM, MEN1, VHL, BCL11A, FGFR2, NRAS, BMPR1A, MLH1, WRN, BCL2, FUS, NTRK1, BRCA1, MSH2, WT1, BCL3, GOLGA5, NUP214, BRCA2, NF1, BCL6, GOPC, PAX8, CARS, NF2, BCR, HMGA1, PDGFB, CBFA2T3, NOTCH1, BRAF, HMGA2, PIK3CA, CDH1, NPM1, CARD11, HRAS, PIM1, CDH11, NR4A3, CBLB, IRF4, PLAG1, CDK6, NUP98, CBLC, JUN, PPARG, SMAD4, PALB2, CCND1, KIT, PTPN11, CEBPA, PML, CCND2, KRAS, RAF1, CHEK2, PTEN, CCND3, LCK, REL, CREB1, RB1, CDX2, LMO2, RET, CREBBP, RUNX1, CTNNB1, MAF, ROS1, CYLD, SDHB, DDB2, MAFB, SMO, DDX5, SDHD, DDIT3, MAML2, SS18, EXT1, SMARCA4, DDX6, MDM2, TCL1A, EXT2, SMARCB1, DEK, MET, TET2, FBXW7, SOCS1, EGFR, MITF, TFG FH, STK11, ELK4, MLL, TLX1, FLT3, SUFU, ERBB2, MPL, TPR, FOXPL SUZ12, ETV4, MYB, USP6, GPC3, SYK, ETV6, IDH1, and/or TCF3. In some embodiments, combining the detection of aneuploidy with the detection of one or more genetic biomarkers (e.g., mutations) increases the specificity and/or sensitivity of detecting cancer.

    [0403] In some embodiments, detection of a genetic biomarker (e.g., one or more genetic biomarkers) includes any of the variety of methods described in U.S. Pat. No. 7,700,286, which is hereby incorporated by reference in its entirety. Any of the variety of methods of messenger RNA (“mRNA”) isolation known in the art may be used to isolate RNA from a sample (e.g., Qiagen RNeasy Kit). Any of the variety of methods of genomic DNA (“gDNA”) isolation known in the art may be used to isolate gDNA from the sample (e.g., Qiagen DNeasy Kit). In some embodiments, detection of a genetic biomarker includes a cancer detection assay. In some embodiments, the amount of gDNA and/or mRNA in a sample are measured for any of the genetic biomarkers disclosed herein. Changes in the amount of gDNA and/or mRNA may indicate cancer. For example, when measuring gDNA, gene amplification (e.g., increased copy number of chromosomal sequences (e.g., coding regions of genes or non-coding DNA (see e.g., Table 1 for an exemplary list of repetitive elements that can be measured)) may indicate cancer. For example, when measuring mRNA, increases in the amount of RNA (e.g., increased expression of a genetic biomarker) may indicate cancer. In some cases, changes in DNA and RNA may correlate.

    [0404] In some embodiments, methods provided herein to detect aneuploidy can be combined with methods to detect the presence of one or more protein biomarkers (e.g., peptides) in one or more proteins selected from the group consisting of: AFP, CA19-9, CEA, HGF, OPN, CA-125, CA15-3, MPO, prolactin (PRL) and/or TIMP-1 to determine the presence of cancer (e.g., ovarian or endometrial). In some embodiments, a protein biomarker can be any appropriate peptide biomarker. In some embodiments, a peptide biomarker can be a peptide biomarker associated with cancer. For example, a peptide biomarker can be a peptide having elevated levels in a cancer (e.g., as compared to a reference level of the peptide).

    [0405] Exemplary and non-limiting threshold levels for certain protein biomarkers include: CA19-9 (>92 U/ml), CEA (>7,507 pg/ml), CA125 (>577 U/ml), AFP (>21,321 pg/ml), Prolactin (>145,345 pg/ml), HGF (>899 pg/ml), OPN (>157,772 pg/ml), TIMP-1 (>176,989 pg/ml), Follistatin (>1,970 pg/ml), and CA15-3 (>98 U/ml). In some embodiments, threshold levels for protein biomarkers can be higher (e.g., about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, or higher) than the exemplary threshold levels described herein. In some embodiments, threshold levels for protein biomarkers can be lower (e.g., about 10%, about 20%, about 30%, about 40%, about 50%, or lower) than the exemplary threshold levels described herein.

    [0406] In some embodiments, a threshold level of CA19-9 can be at least about 92 U/mL (e.g., about 92 U/mL). In some embodiments, a threshold level of CA19-9 can be 92 U/mL. In some embodiments, a threshold level of CEA can be at least about 7,507 pg/ml (e.g., about 7,507 pg/ml). In some embodiments, a threshold level of CEA can be 7.5 ng/mL. In some embodiments, a threshold level of HGF can be at least about 899 pg/ml (e.g., about 899 pg/ml). In some embodiments, a threshold level of HGF can be 0.92 ng/mL. In some embodiments, a threshold level of OPN can be at least about 157,772 pg/ml (e.g., about 157,772 pg/ml). In some embodiments, a threshold level of OPN can be 158 ng/mL. In some embodiments, a threshold level of CA125 can be at least about 577 U/ml (e.g., about 577 U/ml). In some embodiments, a threshold level of CA125 can be 577 U/mL. In some embodiments, a threshold level of AFP can be at least about 21,321 pg/ml (e.g., about 21,321 pg/ml). In some embodiments, a threshold level of AFP can be 21,321 pg/ml. In some embodiments, a threshold level of prolactin can be at least about 145,345 pg/ml (e.g., about 145,345 pg/ml). In some embodiments, a threshold level of prolactin can be 145,345 pg/ml. In some embodiments, a threshold level of TIMP-1 can be at least about 176,989 pg/ml (e.g., about 176,989 pg/ml). In some embodiments, a threshold level of TIMP-1 can be 176,989 pg/ml. In some embodiments, a threshold level of follistatin can be at least about 1,970 pg/ml (e.g., about 1,970 pg/ml). In some embodiments, a threshold level of CA15-3 can be at least about 98 U/ml (e.g., about 98 U/ml). In some embodiments, a threshold level of CA15-3 can be 98 U/ml. In some embodiments, a threshold level of CA19-9, CEA, and/or OPN can be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more greater than the threshold levels listed above (e.g., greater than a threshold level of 92 U/mL for CA-19-9, 7,507 pg/ml for CEA, 899 pg/ml for HGF, 157,772 pg/ml for OPN, 577 U/ml for CA125, 21,321 pg/ml for AFP, 145,345 pg/ml for prolactin, 176,989 pg/ml for TIMP-1, 1,970 pg/ml for follistatin, and/or 98 U/ml for CA15-3).

    [0407] In some embodiments, a threshold level of protein biomarker can be greater than the levels that are typically tested for diagnostic or clinical purposes. For example, the threshold level of CA19-9 can be greater than about 37 U/ml (e.g., greater than about 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or more U/mL). Additionally or alternatively, the threshold level of CEA can be greater than about 2.5 ug/L (e.g., greater than about 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5 or more ug/L). Additionally or alternatively, the threshold level of CA125 can be greater than about 35 U/mL (e.g., greater than about 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550 or more U/mL). Additionally or alternatively, the threshold level of AFP can be greater than about 21 ng/mL (e.g., greater than about 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400 or more ng/L). Additionally or alternatively, the threshold level of TIMP-1 can be greater than about 2300 ng/mL (e.g., greater than about 2,500, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 15,000, 20,000, 25,000, 30,000, 35,000, 40,000 or more ng/L). Additionally or alternatively, the threshold level of follistatin can be greater than about 2 ug/mL (e.g., greater than about 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5 or more ug/L). Additionally or alternatively, the threshold level of CA15-3 can be greater than about 30 U/mL (e.g., greater than about 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or more U/mL). In some embodiments, detecting one or more protein biomarkers at threshold levels that are higher than are typically tested for during traditional diagnostic or clinical assays can improve the sensitivity of cancer detection.

    [0408] Examples of peptide biomarkers include, without limitation, AFP, Angiopoietin-2, AXL, CA125, CA 15-3, CA19-9, CD44, CEA, CYFRA 21-1, DKK1, Endoglin, FGF2, Follistatin, Galectin-3, G-CSF, GDF15, HE4, HGF, IL-6, IL-8, Kallikrein-6, Leptin, LRG-1, Mesothelin, Midkine, Myeloperoxidase, NSE, OPG OPN, PAR, Prolactin, sEGFR, sFas, SHBG sHER2/sEGFR2/sErbB2, sPECAM-1, TGFa, Thrombospondin-2, TIMP-1, TIMP-2, and Vitronectin. For example, a peptide biomarker can include one or more of OPN, IL-6, CEA, CA125, HGF, Myeloperoxidase, CA19-9, Midkine and/or TIMP-1. In some embodiments, combining the detection of aneuploidy with the detection of one or more protein biomarkers (e.g., peptides) increases the specificity and/or sensitivity of detecting cancer.

    [0409] In some embodiments, the presence of a genetic and/or protein biomarker may be detected in any of a variety of biological samples isolated or obtained from a subject (e.g., a human subject) including, but not limited to blood, plasma, serum, urine, cerebrospinal fluid, saliva, sputum, broncho-alveolar lavage, bile, lymphatic fluid, cyst fluid, stool, ascites, and combinations thereof. Any protein biomarker known in the art may be detected when a threshold value is obtained above which normal, healthy human subjects do not fall, but human subjects with cancer do fall. Any appropriate method can be used to detect the level of one or more protein biomarkers as described herein. In some embodiments, the level of one or more protein biomarkers is compared to a predetermined threshold. In some embodiments, the predetermined threshold is a general or global threshold. In some embodiments, the predetermined threshold is a threshold that is relevant to a particular protein biomarker. In some embodiments, the level of the one or more protein biomarkers is compared to an absolute amount of a reference protein biomarker. In some embodiments, the level of the one or more protein biomarkers is relative to an amount of a reference protein biomarker. In some embodiments, the level of the one or more protein biomarkers is an elevated level. In some embodiments, the level of the one or more protein biomarkers is above a predetermined threshold. In some embodiments, the level of the one or more protein biomarkers is within a predetermined threshold range. In some embodiments, the level of the one or more protein biomarkers is or approximates a predetermined threshold. In some embodiments, the level of the one or more protein biomarkers is below a predetermined threshold. In some embodiments, the level of the one or more protein biomarkers from a biological sample is lower than a particular threshold. In some embodiments, the level of the one or more protein biomarkers from a biological sample is depressed compared to a predetermined threshold.

    [0410] In some embodiments, methods and materials described herein can be used for detecting one or more polymorphisms (e.g., somatic mutations) in a genome of a mammal. For example, a plurality of amplicons obtained from a sample obtained from a first mammal (e.g., a test mammal or a mammal suspected of harboring one or more polymorphisms) can be sequenced, a plurality of amplicons obtained from a sample obtained from a second mammal (e.g., a reference mammal) can be sequenced, variant sequencing reads from the sample obtained from the first mammal can be grouped into clusters of genomic intervals, reference sequencing reads from the sample obtained from the second mammal can be grouped into clusters of genomic intervals, a chromosome arm having a sum of the variant sequencing reads and the reference sequencing reads on both alleles that is greater than about 3 (e.g., greater than about 4, greater than about 5, greater than about 6, greater than about 7, greater than about 8, greater than about 9, greater than about 10, greater than about 12, greater than about 15, greater than about 18, greater than about 20, greater than about 22, greater than about 25, or greater than about 30) can be selected, a variant-allele frequency (VAF) of the selected chromosome arm can be determined, and the presence or absence of one or more polymorphisms on the selected chromosome arm can be identified. A VAF of the selected chromosome arm can be determined using any appropriate technique. For example, a VAF of the selected chromosome arm can be the number of variant sequencing reads/total number of sequencing reads. The presence of one or more polymorphisms in the genome of the mammal can be identified in the genome of the mammal when the VAF is between about 0.2 and about 0.8 (e.g., between about 0.3 and about 0.8, between about 0.4 and about 0.8, between about 0.5 and about 0.8, between about 0.6 and about 0.8, between about 0.2 and about 0.7, between about 0.2 and about 0.6, between about 0.2 and about 0.5, or between about 0.2 and about 0.4), and the absence of one or more polymorphisms in the genome of the mammal can be identified in the genome of the mammal when the VAF is within a predetermined significance threshold. For example, without limitation, the presence of one or more polymorphisms in the genome of the mammal can be identified in the genome of the mammal when the VAF is between about 0.4 and 0.6.

    [0411] In some embodiments, methods and materials described herein can be used for sample identification. The repetitive elements amplified by the methods described herein include common polymorphisms that can be used to establish or refute sample identify among samples (e.g., plasma, tumor, and blood). For example, the genotype at each polymorphic location can be identified and compared across samples. Overall similarities between samples at polymorphic locations can be used to determine sample identity.

    [0412] In some cases the diseases associated with one or more chromosomal anomalies as described herein (e.g., based at least in part on the presence of one or more chromosomal anomalies, such as, without limitation, an aneuploidy) are also associated with increased mutation rates (e.g., increased mutation rates can be associated with stage of disease) when compared to a control (e.g., non-disease sample). In such cases, the materials and methods described herein can be used to (a) identify the presence of one or more chromosomal anomalies (e.g., aneuploidy) and (b) identify the stage (e.g., cancer stages I, II, III, and IV) of the disease based on a determination of the mutation rate (e.g., number of mutations) compared to a control.

    [0413] The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.

    EXAMPLES

    Example 1: Detection of Aneuploidy in Patients with Cancer

    [0414] This example describes a novel adaptation of amplicon-based aneuploidy detection. An approach called WALDO for Within-Sample-AneupLoidy-DetectiOn, which employs supervised machine learning to detect changes in chromosome arms, improved aneuploidy detection sensitivity compared to previous methods. It is shown here that using WALDO to analyze amplicons of short interspersed nucleotide elements (SINEs) from a DNA sample increases sensitivity of aneuploidy detection. In addition, the 1,000,000 SINE amplicons with an average length of about 100 bp reduce the input requirement for cell free DNA input while also increasing sensitivity of detection.

    Materials and Methods

    Primers

    [0415] To generate a list of candidate primers, the frequency of all possible 6-mers (4{circumflex over ( )}6=4096) within the RepeatMasker track of hg19 were calculated. Next, the frequency of all possible 4-mers (4{circumflex over ( )}4=256) within 75 bp upstream or downstream from the 6-mers were calculated. Joining the 6-mers with the 4-mers generated 2,097,152 candidate pairs. These pairs were selected for further assessment based on the number of unique genomic loci expected from their PCR-mediated amplification, the average size between the 6-mer and its corresponding 4-mers, and the distribution of these sizes, aiming for a unimodal distribution. This filtering criteria generated 16 potential k-mer pairs, leading to the design of 16 primer pairs that incorporated these k-mer pairs at their 3-ends. A k-mer is understood in the art to refer to a subsequence of length k which is contained within a sequence.

    [0416] In total, 16 primers were initially designed and tested (Table 2). One primer (SEQ ID NO: 1) consistently had fewer primer dimers and was selected for use in testing a cohort. A primer pair having SEQ ID NO: 1 as one of the primers uniquely amplified 745,184 amplicons, which amplicons had an average amplicon size of ˜88 bp (FIG. 1A). The amplicons sizes shown in FIG. 1A include 45 bp of primers. For example, when not including the primers, the amplicons have an average size of ˜43 base pairs (FIG. 1B).

    TABLE-US-00002 TABLE 2 SEQ Primer ID Primer Pair NO: Name Sequence 1 1 FP1_n16 cgacgtaaaacgacggccagt NNNNNNNNNNNNNNNNGGTGA AACCCCGTCTCTACA 2 2 FP2_n16 cgacgtaaaacgacggccagt NNNNNNNNNNNNNNNNGGTGA AACCCCGTCTCTAC 3 3 FP3_n16 cgacgtaaaacgacggccagt NNNNNNNNNNNNNNNNGGTGA AACCCCGTCTCTACT 4 4 FP4_n16 cgacgtaaaacgacggccagt NNNNNNNNNNNNNNNNCATGC CTGTAGTCCCAGCTACT 5 5 FP5_n16 cgacgtaaaacgacggccagt NNNNNNNNNNNNNNNNATAGT GAAACCCCATCTCTACAAAA 6 6 FP6_n16 cgacgtaaaacgacggccagl NNNNNNNNNNNNNNNNGGTGA AACCCCATCTCTACAA 7 7 FP7_n16 cgacgtaaaacgacggccagt NNNNNNNNNNNNNNNNATAGT GAAACCCCATCTCTACAAA 8 8 FP8_n16 cgacglaaaacgacggccagt NNNNNNNNNNNNNNNNGAGGT GGGAGGATTGCTT 9 9 FP9_n16 cgacgtaaaacgacggccagt NNNNNNNNNNNNNNNNACCAG CCTGGGCAACATA 1 10 RP1_z4 cacacaggaaacagctatgac catgCCTCCTAAGTAGCTGGG ACTACAG 2 11 RP2_z4 cacacaggaaacagclatgac catgCCTCCTAAGTAGCTGGG ACTACAG 3 12 RP3_z4 cacacaggaaacagctatgac catgCCTCCTAAGTAGCTGGG ACTACAG 4 14 RP4_z4 cacacaggaaacagctatgac catgTGCAGTGGCACGATCAT AGCTCACTGCAGCCTTGA 5 15 RP5_z4 cacacaggaaacagctatgac catgCTCCCGAGTAGCTGGGA CT 6 16 RP6_z4 cacacaggaaacagctatgac catgCTCCCGAGTAGCTGGGA CTAC 7 17 RP7_z4 cacacaggaaacagctatgac catgCCCGAGTAGCTGGGACT ACA 8 18 RP8_z4 cacacaggaaacagctatgac catgAGGCTGGAGTGCAGTGG 9 19 RP9_z4 cacacaggaaacagctatgac catgCCACCATGCCTGGCTAA

    Sequencing Library Preparation

    [0417] The first primer having SEQ ID NO: 1 included from the 5′ to 3′ end: a universal primer sequence (UPS), a unique identifier DNA sequence (UID), and an amplification sequence. Polymerase chain reaction (PCR) was performed in 25 uL reactions containing 7.25 uL of water, 0.125 uL of each primer, 12.5 uL of NEBNext Ultra II Q5 Master Mix (New England Biolabs cat #M0544S), and 5 uL of DNA. The cycling conditions were: one cycle of 98° C. for 120 s, then 15 cycles of 98° C. for 10 s, 57° C. for 120 s, and 72° C. for 120 s. For experiments with plasma, the amount of DNA in 5 uL was 0.14 ng. A second round of PCR was then performed to add dual indexes (barcodes) to each PCR prior to sequencing. The forward and reverse primers used for the second round of PCR are listed in Table 2. The initial amplification primers were not removed and the amplification product from the first reaction was diluted 1:20. The dilution was used directly for a second round of amplification using primers that annealed to the UPS site introduced by the first round primers and that additionally contained the 5′ grafting sequences necessary for hybridization to the Illumina flow cell.

    [0418] Flndexes (e.g., sequences used to differentiate between samples) were introduced to each sample using the second reverse primer to later allow multiplexed sequencing. The second round of PCR was performed in 25 uL reactions containing 7.25 uL of water, 0.125 uL of each primer, 12.5 uL of NEBNext Ultra II Q5 Master Mix (New England Biolabs cat #M0544S), and 5 uL of DNA containing 5% of the PCR product from the first round. The cycling conditions were: one cycle of 98° C. for 120 s, then 15 cycles of 98° C. for 10 s, 65° C. for 15 s, and 72° C. for 120 s. Amplification products were run on agarose gels to check for amplification. Amplification products were purified with AMPure XP beads at 1.2× and were quantified by spectrophotometry, real time PCR, an Agilent 2100 Bioanalyzer or an automated electrophoresis using an Aiglent TapeStation. All oligonucleotides were purchased from Integrated DNA Technologies (Coralville, Iowa).

    Sequencing and Sequencing Analysis

    [0419] Bowtie2 was used to align reads of the amplicons generated with each of the 7 primer pairs to the human reference genome assembly GRC37 (Langmead et al. 2012). With primer pair 1 (the primer having SEQ ID NO: 1 and the primer having SEQ ID NO: 10), an average of 51.1% of the total reads could be uniquely aligned and the average amplicon size was 88 bp (FIG. 1A). The amplicons sizes shown in FIG. 1A include 45 bp of primers. For example, when not including the primers, the amplicons have an average size of ˜43 base pairs (FIG. 1B). Primer pair 1 was theoretically able to amplify up to 745,184 repetitive elements that can be uniquely aligned, but the average sample contained an average of 350,000 repetitive elements, see FIG. 1C. Without wishing to be bound by theory, there were several potential reasons for the discrepancy between the potential number and the actual observed number of amplicons in plasma samples. (1) Polymorphisms within the sequences may have caused misalignment and result in “missing amplicons.” (2) Polymorphisms within the primers may not have amplified. (3) Each amplicon may have had a different PCR efficiency with low efficiency amplicons outcompeted during PCR. (4) Smaller DNA fragments may have been preferentially amplified and long amplicons (>100 bp) may not have been amplified. (5) Long amplicons may have been absent in cell free DNA due to the small sizes of the DNA fragments in cell free DNA. (6) The amount of sequencing used for these samples may not have been high enough to observe every amplicon especially those with low PCR efficiencies. (7) Finally, some repetitive elements may not have been present in every individual. Within the amplicons generated by the primer pair of SEQ ID NO: 1 and SEQ ID NO: 10, 52,762 polymorphisms were identified. The average number of heterozygous sites in the test cohort of 1348 normal plasmas and 883 plasmas from cancer patient individuals was 2,200. These sites could be used to measure allelic imbalance, genetically identify samples, and determine whether samples had been accidentally mixed together. Using the same SNPs, synthetic experiments were used to estimate that sample mixing could be detected when the amount of sample one DNA was >4% of the amount of sample two DNA in a given mixture.

    Statistical Analysis

    [0420] Read-depth-based analytical methods have been widely applied to whole-genome sequencing (WGS) protocols. Under the assumption that reads are uniformly and independently distributed, regions of normal copy number are expected to follow a Poisson or normal distribution (Zhao et al 2013 and Pirooznia et al 2015). Amplicon-based protocols achieve high coverage depth at relatively low cost, and they are an attractive alternative to WGS, but aligned reads from amplicon sequencing such as those resulting from the above described assay have properties different from those resulting from WGS and WES. Because these reads are limited to a relatively small number of discrete loci, they are discontinuous. The reads are also not randomly distributed, which makes it difficult to use the statistical models of read depth coverage designed for WGS and WES. The Within-Sample AneupLoidy DetectiOn (WALDO), is an algorithm specifically designed for amplicon-based aneuploidy detection (see, e.g., Douville et al. PNAS 201 115(8):1871-1876). WALDO was applied to sequencing reads that mapped to the above described genomic loci (e.g., SINE). The genome-wide aneuploidy score was used to identify whether a sample had the presence of aneuploidy.

    Statistical Principles Underlying WALDO

    [0421] Unlike most conventional approaches for assessing copy number changes, WALDO does not compare normalized read counts from each chromosome arm in a test sample to the fraction of reads in each chromosome arm in other samples. Such conventional comparisons are subject to batch effects and other artifacts associated with variables that are difficult to control. To evaluate whole genome sequencing data, aneuploidy was detected by comparing the read counts within 5344 genomic intervals each containing 500-kb of sequence. The read counts within the 500-kb genomic intervals within a sample were only compared to the read counts of other genomic intervals within the same sample—hence the “Within-Sample” designation in WALDO. The previously described WALDO protocol was tailored in this Example, which resulted in several analytical changes (see FIG. 2). The modifications included a new normalization step, a new way to call small copy number changes of indeterminate length, and an improved way to detect genome-wide aneuploidy, as described below. These analytical improvements coupled with the increased genomic density of amplicons achieved with the SEQ ID NO: 1 and SEQ ID NO: 10 primer pair enabled greater sensitivity as well as the detection of focal amplifications and deletions less than 1 Mb in size.

    [0422] In euploid samples, the number reads within each 500-kb genomic interval should track with the number of reads in certain other genomic regions. Genomic intervals that track together do so because the amplicons within them amplify to similar extents. Here, such genomic regions that track together are called “clusters”. It is possible identify clusters from sequencing data on euploid samples. In a test sample, it is determined whether the number of reads in each genomic interval in each pre-defined cluster is within the expected bound of the other clusters from that same sample. If the reads within a genomic interval are outside the statistically expected bound, and there are many such outsiders on the same chromosome arm, then that chromosome arm is classified as aneuploid. The statistical basis of this test is described elsewhere (e.g., Douville et al. PNAS 201 115(8):1871-1876). In brief, while the number of reads is not randomly distributed across the genome, the distribution of scaled reads within each cluster is approximately Normal. A convenient property of Normal distributions is that the sum of multiple Normal distributions is also a Normal distribution. It is thus possible to compute the theoretical mean and variance of the summed reads on each chromosome arm simply by summing the means and variances of all the clusters represented on that chromosome arm.

    [0423] WALDO also employs several other innovations that make it applicable to the analysis of PCR-generated amplicons from clinical samples. One of these innovations is controlling amplification bias stemming from the strong dependence of the data on the size of the initial template. Another is the use of a machine learning algorithm (e.g., a Support Vector Machine (SVM)) to enable the detection of aneuploidy in samples containing low neoplastic fractions.

    Normalization

    [0424] The improved WALDO methods described in this Example include a new method of normalization that reduced the amount of variability between samples. In this normalization, a principal component analysis (PCA) was first performed on sequencing data from the controls. PCA reduced the number of 500 kb genomic intervals from n=5,344 to a more manageable number of dimensions. Using the PCA coordinates of the controls, a modeled was created to predict whether a particular 500 kb interval will be amplified more or less efficiently in future samples based on their PCA coordinates.


    Correction Factor for 500 kb Interval.sub.i=β.sub.oi+β.sub.1i*PCA.sub.1β.sub.2i*PCA.sub.2+β.sub.3i*PCA.sub.3+β.sub.4i*PCA.sub.4+β.sub.5i*PCA.sub.5

    [0425] For each test sample, the sample was projected into PCA space and the correction factor was calculated for each 500 kb interval as function of its PCA coordinates. After applying the correction factor to each 500 kb genomic interval, the test sample was matched to 7 control samples based on the closest Euclidean distance of the 500 kb intervals.

    Generation of Synthetic Aneuploidy Samples.

    [0426] Data was selected from 84 presumably euploid plasma samples, each containing at least 10 million reads, and each derived from the DNA of normal WBCs. Synthetic aneuploid samples were created by adding (or subtracting) reads from several chromosome arms to the reads from these normal DNA samples. The reads were added or subtracted from 1, 10, 15, or 20 chromosome arms to each sample. The additions and subtractions were designed to represent neoplastic cell fractions ranging from 0.5% to 1.5% and resulted in synthetic samples containing exactly ten million reads. The reads from each chromosome arm were added or subtracted uniformly. For example, when modeling five chromosome arms that were lost, each was lost to the identical degree and we did not incorporate tumor heterogeneity into the model. Furthermore, synthetic samples were not created containing more than three of any chromosome arm; e.g. 4 copies of chromosome 3p. This simplified approach did not comprehensively cover all biologically plausible aneuploidy events. However, limiting the possible combinations of altered arms made sample generation computationally tractable, and the resulting support vector machine worked well in practice. The synthetically generated samples in which reads from only a single chromosome arm were added or subtracted enabled us to estimate the performance of WALDO when only a single chromosome arm of interest was gained or lost. The pseudocode to generate synthetic samples is shown in FIG. 5.

    Determination of Genome Wide Aneuploidy

    [0427] A two-class support vector machine (SVM) was trained to discriminate between euploid samples and aneuploid samples. The training set contained a negative class of 1348 presumably euploid plasma samples from normal individuals containing at least 2.5M reads and 635 aneuploid samples. The aneuploid class contained a mixture of synthetic and actual aneuploid samples. SVM training was done with the e1071 package in R, using radial basis kernel and default parameters. Each sample had 39 Z-score features, representing chromosome arm gains and losses. During training, the positive class was randomly sampled so that the positive class was 10% the size of the negative class. The positive class was randomly sampled at a ratio of two real samples to one synthetic sample. Ten iterations of this procedure were performed. The final genome wide aneuploidy score was the average of the raw svm score across the 10 iterations.

    Results

    [0428] The performance of this assay was assessed on a cohort of 1348 euploid plasma samples and 883 plasma samples from cancer patients (Table 3). The samples from cancer patients included Breast, Colorectum, Esophagus, Liver, Lung, Ovary, Pancreas, and Stomach cancers (FIG. 3). Using a cutoff of that resulted in 99% specificity defined in our cohort of 1348 euploid samples, it was found that 49% plasmas from cancer samples had aneuploidy.

    Sample Exclusion Criteria

    [0429] To ensure that all samples included in the results section of paper were of high quality, several exclusion criteria were developed. First, samples with fewer than 2.5M reads were excluded. Second, samples with sufficient evidence of contamination were excluded. To be labeled as contaminated, the sample had to have at least 10 significant allelic imbalanced chromosome arms (z score>=2.5) and fewer than ten significant chromosome arms gains or losses (z>=2.5 or z<=−2.5). Allelic imbalance is determined from SNPs, while gains or losses were assessed through WALDO. As determined through mixing experiments, a relatively large number of allelic imbalanced chromosome arms in the absence of a large number of gains or losses indicated contamination of the sample with DNA from another individual. Third, in plasma analyses, samples in which more than 8.5% of the amplicons were larger than 94 bps (50 base pairs between the forward and reverse primers) were excluded. Such samples were likely to be contaminated with leukocyte DNA. Fourth, samples outside the dynamic range of the assay, as defined by the equation below, were excluded.

    [00004] QC Dynamic Range Metric = .Math. i 2 q , 3 q , 4 q , 5 q , 6 q , 8 q , 13 q Reads on chr i .Math. j = 1 39 Reads on chr j

    [0430] The distribution of this metric has long tails. The values of >0.2450 and 0.2320 were selected as a dynamic range that we could evaluate cutoffs. Fifth, plasma samples with known aneuploidy in the leukocytes of the same patients; such patients were assumed to have Clonal Hematopoiesis of Indeterminate Potential (CHIP) or congenital disorders.

    Detection of Cancer Using a Multi-Analyte Test

    [0431] Whether aneuploidy could be integrated as an additional biomarker into the published framework, as well as the predictive ability of a logistic regression model with aneuploidy and protein markers against the original logistic regression model that uses somatic mutations and protein markers, was compared.

    [0432] Here, 1348 plasma samples from healthy people and 883 cancer patients were analyzed. Of the 1348 healthy samples, only 248 overlapped with the original study. All 883 cancer samples were included in the original study. The sample demographic information was provided in Table 3.

    [0433] Using the original 812 healthy samples (Cohen et al.) and the 883 cancer samples, a logistic regression model was trained and then used to assess performance using ten rounds of tenfold cross validation. A full list of samples and their biomarker values was provided in Table 3. Because 564 of the original healthy samples were not analyzed for aneuploidy, the list of scores from the 1348 normal samples was randomly sampled and assigned each missing sample an aneuploidy value. Ten rounds of analysis were performed and each new round, the collection of 1348 normal scores again randomly sampled to assign the 564 samples a new score.

    [0434] To account for variations in the lower limits of detection across different experiments, the 90.sup.th percentile feature value was used in the healthy training samples. Any feature value below this threshold and set all values to the 90.sup.th percentile threshold. This transformation was done for all training and testing samples. This procedure was done for aneuploidy scores, somatic mutation scores, and protein concentrations. The 90.sup.th percentile thresholds and final feature coefficients from the logistic regression model were listed in Table 4.

    TABLE-US-00003 TABLE 4 Logistic regression coefficients and thresholds. 90th Percentile Values Coefficients Intercept −11.8552 Aneuploidy 0.116389196 8.014704 Omega 1.145773698 2.343129 AFP 2866.68 9.26E−06 CA.125 6.9024 0.085206 CA19.9 22.6652 0.019665 CEA 2063.1449 0.00037 HGF 264.6446 0.004534 OPN 53651.1756 2.19E−05 Prolactin 21304.0703 4.84E−05 TIMP.1 85363.9233 1.18E−05
    Comparison of Aneuploidy Sensitivity Detection with Other Cancer Biomarkers

    [0435] The aneuploidy results were benchmarked against a driver gene mutation panel and collection of 7 proteins markers (AFP, CA-125, CA15-3, CA19-9, CEA, HGF, OPN, TIMP1) that were recently published as key biomarkers for cancer detection in plasma samples (FIG. 4) (Cohen et. al 2018, Science 359(6378): 926-930). Aneuploidy outperformed all protein markers. Aneuploidy was also able to detect 42% of the samples that were missed by mutations and 34% of the samples that were missed by the mutation panel as well as the proteins. Due to the high specificity of this aneuploidy assay and the utility of each additional cancer biomarker, it will be understood that these components can be combined into a multi-analyte test for cancer detection.

    Example 2: Detection of Aneuploidy with Low Input DNA from Trisomy 21 Samples

    [0436] Reliably detecting aneuploidy in only a few picograms (pg) of DNA is necessary for preimplantation diagnostics as well as forensic applications. In preimplantation diagnosis, a few cells picked from a blastocyst are used to assess copy number variations. For example, preimplantation diagnosis includes identifying a mammals as having aneuploidy related to Down Syndrome. To test the limit of detection with respect to input DNA for the methods featured in this disclosure, samples with aneuploidy associated with trisomy 21 were analyzed at input DNA concentrations ranging from 3-225 pg. The relationship of reads to DNA was based on negative controls (water wells with no DNA) and the known concentration of the euploid control (FIG. 6). Trisomy 21 aneuploidy was detected in every sample tested, even those with 3 pg of input DNA, representing half of a diploid cell. No chromosome arms other than chromosome 21 were found to be aneuploid in the Trisomy 21 samples. No chromosome arms, including chromosome 21, were found to be aneuploid in the euploid controls used in these experiments.

    Example 3: Detection of Aneuploidy with Low Input DNA from Biobank Samples

    [0437] Samples from biobanks with low input DNA were assessed for either aneuploidy or identification purposes. The methods as described herein were applied to 793 plasma DNA samples, which had been stored in PCR plates for as long as 10 years. For each of the wells in the PCR plates, all of the DNA volume had been used for other experiments. Five microliters of water was added to the dried (empty) wells and then subjected to the methods as described herein. In 728 samples, more than 2.5 million aligned reads were sequenced, which is a number sufficient to reliably assess aneuploidy. In 768 of these samples, more than 1 million aligned reads were sequenced, a number sufficient to confirm the identity of the plasma DNA to other samples from the same donor.

    Example 4: Detection of Leukocyte DNA Contamination in Plasma Sample

    [0438] Plasma cfDNA is often contaminated with DNA that has leaked out of leukocytes, either through phlebotomy or preparation of plasma. This contaminating leukocyte DNA can reduce the sensitivity of aneuploidy testing from plasma samples because leukocytes are not derived from either fetal cells (in NIPT) or cancer cells (in liquid biopsies). Leukocyte genomic DNA (gDNA) has an average fragment size of >1000 bp while cell-free plasma DNA has an average size of <160 bp. Given that small fragments are amplified more efficiently during a PCR reaction, detection of contaminating leukocyte gDNA is difficult because the shorter cfDNA is preferentially amplified. Application of the methods described herein enabled the detection of contaminating leukocyte gDNA by virtue of the amplicons generated with primers SEQ ID NO: 1 and SEQ ID NO: 10. Using these methods, 1241 amplicons were identified that are typically present in gDNA but not cfDNA. Sequencing reads of these amplicons thereby indicated leukocyte contamination in plasma samples. Through mixing of leukocyte DNA with cell-free plasma DNA and using the methods described herein, samples containing >4% of leukocyte DNA could be detected, as shown in Table 5.

    TABLE-US-00004 TABLE 5 Prediction of gDNA contamination in plasma. Reads Fraction of Ratio of that map Reads that Fraction of Total to 1241 map to 1241 reads to Reads amplicons amplicons cfDNA gDNA control 1420121 1302 0.000916823 13.6900667 euploid cell free 9810368 657 6.697E−05 1 DNA 54% gDNA 16666542 31138 0.001868294 27.8974908 37% gDNA 13990980 19264 0.001376887 20.5597705 26% gDNA 10760112 10907 0.001013651 15.135907 19% gDNA 10976478 8769 0.00079889 11.929081 10% gDNA 9408703 3415 0.000362962 5.41977026 5.5% gDNA 9904155 2058 0.000207792 3.10275776 5.0% gDNA 9083013 1987 0.00021876 3.2665391 4.5% gDNA 8470920 1790 0.000211311 3.15531251 4% gDNA 8852813 2336 0.000263871 3.9401384

    Example 5: Copy Number Analysis of Indeterminate Length

    [0439] Copy number variants of indeterminate length were detected. First, the log ratio of the observed test sample and WALDO predicted values from every 500 kb interval across each chromosomal arm were calculated. Using the log ratio, a circular binary segmentation algorithm was applied to find copy number variants throughout each chromosome arm. Any copy number variant ≤5 Mb in size was flagged. Before calculating the statistical significance across each chromosome arm, these flagged CNVs were removed. In general, small CNVs can be used to assess microdeletions or microamplifications, such as those occurring in DiGeorge Syndrome (chromosome 22q11.2 or in breast cancers (chromosome 17q12).

    Example 6: Sensitivity of Cancer Detection with Multi-Analyte Tests

    [0440] This Example describes the sensitivity of cancer detection with different multi-analyte tests.

    [0441] Three different multi-analyte tests were used to evaluate the sensitivity of detecting eight cancers: breast, ovary, liver, lung, pancreas, esophagus, stomach, and colorectum, in the plasma sample from patients. The three tests were: (1) a three component test using aneuploidy status, somatic mutation analysis and protein biomarker evaluation; (2) a two component test using aneuploidy status and somatic mutation analysis; and (3) a two component test using aneuploidy status and protein biomarker evaluation. The eight protein biomarkers tested and somatic mutations tested were as described in Cohen et al., Science 359, pp. 926-930, the entire contents of which are hereby incorporated by reference.

    [0442] As shown in FIGS. 7A-7B, the median sensitivity of detection of ovary, liver, lung, pancreas, esophagus, stomach, and colorectum cancer with the three component multi-analyte test was 80%, with a range of sensitivity of detection of 77% to 97%. The sensitivity of detection of breast cancer with the three component multi-analyte test was 38%. The sensitivities were calculated using a threshold at 99% specificity.

    [0443] FIG. 8 further demonstrates true positive fraction (measure of sensitivity) of cancer detection using the following tests: (1) aneuploidy status; somatic mutation; and protein biomarker; (2) aneuploidy status and protein biomarker; (3) somatic mutation and protein biomarker; (4) aneuploidy status and somatic mutation; (5) aneuploidy status; and (6) somatic mutation. The specificity of detection was maintained at 99%.

    [0444] As shown in FIG. 8, the three component multi-analyte test (aneuploidy status, somatic mutation analysis and protein biomarker evaluation) detected cancer at a sensitivity of 73% and with a specificity of 99%. The true positive fraction (a measure of sensitivity) was highest with the three component multi-analyte test as compared to the other tests.

    [0445] As shown in FIG. 9, a multi-analyte test (aneuploidy status and protein biomarker evaluation) detected cancer at a greater sensitivity than aneuploidy alone when looking at samples based cancer stage.

    [0446] Thus, the data disclosed in this Example shows that the three component multi-analyte test with aneuploidy status, somatic mutation analysis and protein biomarker evaluation can increase the sensitivity of detecting cancer while maintaining a high specificity of cancer detection.

    Example 7: Determining Somatic/Germline Status

    [0447] The materials and methods described herein can be used to identify somatic mutations within the sequences of repetitive elements amplified from a sample (e.g., a tumor sample or a non-tumor sample (i.e., a normal sample)). For example, when two samples, a non-tumor sample and a tumor sample, are available from the same patient, mutations that are in one sample but not the other can be discerned. For each sample, the number of somatic mutations can be counted and the spectrum of single base substitutions (SBS) (e.g., A->T, A->C, etc.) determined. When the samples are also analyzed by exomic sequencing, a correlation between the number of SBSs in the repetitive elements amplified herein and the number of SBS in the exomes can be determined. Thus, the materials and methods as described herein can be used identify somatic mutations within a sample.

    Example 8: Sample Identification

    [0448] The materials and methods described herein can be used to identify and/or distinguish samples (e.g., distinguish between a sample from one subject from a sample from a second subject). In such cases, samples are identified based on the common polymorphisms present in the repetitive elements amplified by materials and methods described herein. Samples are then distinguished from other samples by comparing the sequence at common polymorphisms between samples. Determining the genotype of each polymorphism for each of the amplicons assigns a genotype to the sample. Genotypes can be compared across samples in order to identify samples (e.g., distinguish tumor sample from non-tumor sample or a sample from one subject from a sample from a different subject). Samples can be considered to be from different samples if concordance (e.g., percent similarity between the genoytpes) was <0.99 and at least 5,000 amplicons had adequate coverage.

    Example 9: Detecting Aneuploidy in Different Stages and Different Types of Cancer

    [0449] A set of experiments was performed to assess detection of aneuploidy in different stages and different types of cancer. In these experiments, plasma from subjects having different stages of breast, colorectum, esophagus, liver, lung, ovary, pancreas and stomach cancers were isolated according to the methods described herein. FIG. 10 shows aneuploidy (at 99% specificity) for Stage I (n=109), Stage II (n=276), and Stage III (173). FIG. 11 shows aneuploidy (at 99% specificity) for the same cancers in FIG. 7 displayed by cancer type (FIG. 11) rather than cancer stage (FIG. 10).

    [0450] Using the Real Seq method, aneuploidy was detected more commonly than mutations in plasma samples from cancer patients. Aneuploidy was detected more commonly than mutations in plasma samples from cancer patients (49% and 34% of 883 samples, respectively; P<10-20, one sided binomial test, FIG. 19A). With respect to tissue type, aneuploidy was detected more commonly than mutations in samples from patients with cancers of the esophagus, colorectum, pancreas, lung, stomach, and breast, (all P-values<0.01), less commonly in ovary (P=0.048), and equally commonly in liver cancer (FIG. 19A). With respect to stage, aneuploidy was detected more commonly than mutations in all stages especially stages I and II (FIG. 19B, P-values<10-9).

    Example 10: Detecting Cancer in Samples Using Aneuploidy and Protein Biomarkers

    [0451] A set of experiments was performed to assess sensitivity of cancer detection when combining aneuploidy detection with protein biomarker detection as described herein. In these experiments, plasma from the same cohort as in example 8 (e.g., different stages of breast, colorectum, esophagus, liver, lung, ovary, pancreas and stomach cancer) were assayed for aneuploidy and protein biomarkers. FIG. 12 shows sensitivity of detection in the different stages of cancer (Stage I (n=109), Stage II (n=276), and Stage III (n=173).

    Example 11: Comparison of Real Seq to Other Next Generation Sequencing Technologies

    [0452] A set of experiments was performed to assess performance of Real Seq compared to other next generation sequencing technologies.

    [0453] In the most common form of NIPT, detection of a gain or loss of a chromosome (e.g., chromosome 21 in Down Syndrome) is the goal. Whole genome sequencing (WGS), FAST-SeqS, and RealSeqS were used to assess performance on samples for DNA admixtures typically encountered in non-invasive prenatal testing (NIPT), i.e., when the fraction of fetal DNA was 5%. For this purpose, actual data obtained with the three methods was used, but then a defined number of reads from various chromosome regions from the same samples were added to simulate what would happen if there was aneuploidy in these regions. The pseudocode used to generate these in silico simulated samples is described FIG. 13 and FIG. 14. The performance was calculated using a frequently used z-score that compares the observed fraction of reads on a particular chromosome arm to the average fraction of reads from a normal panel divided by the standard deviation in the normal panel. The results in total reads needed for all three approaches is reported, assuming single-end 100 bp reads and accounting for differences in alignment rates and filtering criteria typically used.

    [0454] As shown in FIG. 15A, RealSeqS consistently achieved higher sensitivity at lower amounts of sequencing. For example, RealSeqS had 99% sensitivity (at 99% specificity) for monosomies and trisomies at a 5% cell fraction, while WGS and FAST-SeqS had 94% and 81% sensitivity, respectively (FIG. 15A).

    [0455] Another important aspect of assays for copy number variation is the detection of relatively small regions which are deleted or amplified. For example, the DiGeorge Syndrome deletions are often as small as 1.5 Mb. For data simulating a 5% deletion-containing cell fraction, RealSeqS had 75.0% sensitivity for the 1.5 Mb DiGeorge deletion (at 99% Specificity) while WGS and FAST-SeqS had 19.0% and 29.0% sensitivity, respectively (FIG. 15B; and FIGS. 16A-16B).

    [0456] The detection of amplifications, such as those on ERBB2 in breast cancer, are important for deciding whether patients should be treated with trastuzumab or other targeted therapies. Following the same protocol as described above in this Example, in silico simulated samples with focal amplifications of the ˜42 Kb ERBB2 gene (20 copies) were generated for WGS, FAST-SeqS, and RealSeqS. RealSeqS detected amplifications in the in silico simulated samples with significantly less sequencing compared to WGS or Fast-SeqS. For a 1% cell fraction, RealSeqS had a 91.0% sensitivity while WGS had 50.0% (FIG. 15C; and FIGS. 17A-17B).

    [0457] This data shows that the Real SEQ technique can detect small regions that are amplified or deleted and the method has a higher sensitivity at lower amounts of sequencing.

    Example 12: Detection of Aneuploidy in Samples with Small Concentration of Tumor-Derived DNA

    [0458] A set of experiments was performed to assess detection of aneuploidy using the Real SEQ method in samples with varying concentrations of tumor-derived DNA. In assessing 302 samples in which the mutant allele fraction had been determined by the analysis of mutations that were present in the plasma (Cohen et al., Science 359; 926-930), aneuploidy was detected in 92% of 65 samples that had mutant allele fraction ≥2%, 71% of 65 samples with mutant allele fractions of 0.5% to 2%, and in 49% of 172 samples with mutant allele frequencies ranging from 0.01% to 0.5% (FIG. 18). The differences in aneuploidy among these three classes of samples was significant (P<10-3, one sided binomial test).

    [0459] The data shows that the Real Seq method can detect aneuploidy, e.g., even at low concentrations of tumor DNA. Therefore, the sensitivity of detecting aneuploidy is related to the concentration of circulating tumor DNA in the sample.

    OTHER EMBODIMENTS

    [0460] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

    TABLE-US-00005 TABLE 3 AFP + CA-125 Unique Name Repeats Subject ID Sample Natext missing or illegible when filed Cancer Typtext missing or illegible when filed Stage Coverage Aneuploidy (>21321) (577 U/ml) 7666.9_faster1 110962 INDI 250 PLtext missing or illegible when filed Colorectum II 1001795 Negative Negative Negative 7561.9_faster1 10772 INDI 260 PLtext missing or illegible when filed Stomach I 1004248 Negative Negative Negative 7649.7_faster1 110913 INDI 548 PLtext missing or illegible when filed Breast II 1053642 Negative Negative Negative 7678.11_faster1 111047 INDI 927 PLtext missing or illegible when filed Breast II 1091466 Negative Negative Negative 7560.11_faster1 108985 INDI 534 PLtext missing or illegible when filed Stomach III 1112490 Positive Negative Negative 7537.3_faster1 110697 PAPA 1350text missing or illegible when filed Ovary II 1118254 Negative Negative Negative 7662.10_faster1 110925 INDI 354 PLtext missing or illegible when filed Colorectum III 1196533 Negative Negative Negative 7613.11_faster1 109125 INDI 854 PLtext missing or illegible when filed Colorectum II 1213691 Negative Negative Negative 7563.8_faster1 109084 INDI 762 PLtext missing or illegible when filed Esophagus II 1217677 Negative Negative Negative 7537.1_faster1 110621 PANC 675 Ptext missing or illegible when filed Pancreas II 1228946 Positive Negative Negative 7591.11_faster1 109110 INDI 818 PLtext missing or illegible when filed Ovary III 1320220 Positive Negative Negative 7586.5_faster1 109014 INDI 622 PLtext missing or illegible when filed Liver III 1336412 Negative Negative Negative 7561.4_faster1 109075 INDI 743 PLtext missing or illegible when filed Stomach II 1388535 Negative Negative Negative 7589.8_faster1 109143 INDI 896 PLtext missing or illegible when filed Lung I 1412655 Positive Negative Negative 7586.6_faster1 109020 INDI 636 PLtext missing or illegible when filed Liver III 1470803 Positive Negative Negative 7671.10_faster1 110996 INDI 767 PLtext missing or illegible when filed Colorectum II 1492197 Negative Positive Negative 7560.10_faster1 108981 INDI 526 PLtext missing or illegible when filed Esophagus III 1514882 Negative Negative Negative 7740.10_faster1 111066 CRC 478 PLtext missing or illegible when filed Colorectum III 1559066 Negative Negative Negative 7671.12_faster1 110998 INDI 769 PLtext missing or illegible when filed Colorectum II 1562172 Positive Negative Negative 7013.8_faster1 109015 INDI 623 PLtext missing or illegible when filed Breast III 1597394 Positive Negative Negative 7645.6_faster1 110872 INDI 593 PLtext missing or illegible when filed Breast II 1598322 Negative Negative Negative 7014.12_faster1 110796 INDI 244 PLtext missing or illegible when filed Colorectum III 1615175 Negative Negative Negative 7009.10_faster1 10888 INDI 445 PLtext missing or illegible when filed Breast II 1629340 Positive Negative Negative 7541.9_faster1 110631 PANCA 100text missing or illegible when filed Pancreas II 1666957 Negative Negative Negative 7665.5_faster1 110951 INDI 679 PLtext missing or illegible when filed Colorectum II 1693864 Negative Negative Negative 7541.11_faster1 110633 PANCA 100text missing or illegible when filed Pancreas II 1733623 Positive Negative Negative 7567.8_faster1 108991 INDI 545 PLtext missing or illegible when filed Lung I 1734591 Negative Negative Negative 7542.10_faster1 110642 PANCA 102text missing or illegible when filed Pancreas II 1773560 Negative Negative Negative 7678.10_faster1 111046 INDI 926 PLtext missing or illegible when filed Breast II 1778136 Negative Negative Negative 7673.12_faster1 111018 INDI 816 PLtext missing or illegible when filed Colorectum II 1780759 Negative Negative Negative 7666.4_faster1 110968 INDI 903 PLtext missing or illegible when filed Breast I 1795451 Negative Negative Negative 7562.10_faster1 109108 INDI 814 PLtext missing or illegible when filed Stomach I 1843118 Negative Negative Negative 7537.9_faster1 110619 PANC 673 Ptext missing or illegible when filed Pancreas II 1851442 Negative Negative Negative 7594.3_faster1 10859 INDI 389 PLtext missing or illegible when filed Lung III 1900877 Negative Positive Negative 6837.6_faster1 109118 INDI 844 PLtext missing or illegible when filed Stomach I 1953864 Negative Negative Negative 7613.10_faster1 109122 INDI 849 PLtext missing or illegible when filed Colorectum II 1998995 Negative Negative Negative 7589.12_faster1 10856 INDI 384 PLtext missing or illegible when filed Pancreas II 2067166 Negative Negative Negative 7537.12_faster1 110622 PANC 676 text missing or illegible when filed Pancreas II 2084372 Negative Negative Negative 7591.12_faster1 109129 INDI 862 PLtext missing or illegible when filed Pancreas II 2093931 Negative Positive Negative 7012.7_faster1 Yes 109090 INDI 778 PLtext missing or illegible when filed Liver II 2117457 Positive Negative Negative 7667.9_faster1 110975 INDI 286 PLtext missing or illegible when filed Colorectum I 2160308 Negative Negative Negative 7548.9_faster1 10811 INDI 324 PLtext missing or illegible when filed Lung I 2184419 Negative Negative Negative 7665.12_faster1 110957 INDI 898 PLtext missing or illegible when filed Breast I 2253404 Negative Negative Negative 7671.3_faster1 110991 INDI 750 PLtext missing or illegible when filed Colorectum III 2288848 Negative Negative Negative 7536.3_faster1 110687 PAPA 1335text missing or illegible when filed Ovary III 2325428 Positive Negative Negative 6857.4_faster1 109067 INDI 729 PLtext missing or illegible when filed Colorectum II 2350770 Negative Negative Negative 7676.8_faster1 111019 INDI 793 PLtext missing or illegible when filed Breast II 2366123 Negative Negative Negative 7561.7_faster1 109072 INDI 737 PLtext missing or illegible when filed Stomach I 2456741 Negative Negative Negative 7590.9_faster1 109070 INDI 735 PLtext missing or illegible when filed Pancreas II 2464857 Negative Negative Negative 7591.8_faster1 109068 INDI 731 PLtext missing or illegible when filed Pancreas II 2481059 Negative Negative Negative 7643.9_faster1 110852 INDI 610 PLtext missing or illegible when filed Colorectum II 2503195 Negative Negative Negative 7613.6_faster1 10758 INDI 230 PLtext missing or illegible when filed Colorectum I 2539061 Negative Negative Negative 7666.5_faster1 110966 INDI 897 PLtext missing or illegible when filed Breast III 2577755 Positive Negative Negative 7666.8_faster1 110961 INDI 248 PLtext missing or illegible when filed Colorectum II 2641351 Negative Negative Negative 7560.12_faster1 109141 INDI 892 PLtext missing or illegible when filed Stomach I 2671691 Negative Negative Negative 7590.4_faster1 108984 INDI 533 PLtext missing or illegible when filed Pancreas II 2692393 Negative Negative Negative 7639.4_faster1 110820 INDI 431 PLtext missing or illegible when filed Colorectum II 2783016 Negative Negative Negative 7637.3_faster1 110799 INDI 295 PLtext missing or illegible when filed Colorectum II 2793496 Negative Negative Negative 7611.9 _faster1 10724 INDI 192 PLtext missing or illegible when filed Colorectum II 2812098 Negative Negative Negative 7612.3 _faster1 10728 INDI 197 PLtext missing or illegible when filed Colorectum II 2816342 Negative Negative Negative 7645.12_faster1 110878 INDI 606 PLtext missing or illegible when filed Breast II 2818021 Positive Positive Negative 7646.5_faster1 110881 INDI 627 PLtext missing or illegible when filed Breast II 2833357 Negative Negative Negative 7546.10_faster1 10572 INDI 022 PLtext missing or illegible when filed Lung III 2834538 Positive Negative Negative 7613.7_faster1 10760 INDI 233 PLtext missing or illegible when filed Colorectum I 2871111 Positive Negative Negative 7543.11_faster1 110655 PANCA 105text missing or illegible when filed Pancreas II 2959475 Negative Negative Negative 7676.11_faster1 111022 INDI 819 PLtext missing or illegible when filed Breast III 2969142 Positive Negative Negative 7563.6_faster1 109079 INDI 753 PLtext missing or illegible when filed Esophagus III 2987451 Positive Negative Negative 6851.10_faster1 109077 INDI 751 PLtext missing or illegible when filed Colorectum IIII 2991204 Negative Negative Negative 7613.5_faster1 10757 INDI 229 PLtext missing or illegible when filed Colorectum II 3055625 Positive Negative Negative 7672.10_faster1 111001 INDI 725 PLtext missing or illegible when filed Colorectum II 3073272 Negative Negative Negative 7673.10_faster1 111016 INDI 809 PLtext missing or illegible when filed Colorectum IIII 3105813 Negative Negative Negative 7544.3_faster1 110657 PANCA 105text missing or illegible when filed Pancreas II 3128340 Negative Negative Negative 7646.6_faster1 110882 INDI 629 PLtext missing or illegible when filed Breast I 3214436 Negative Negative Negative 7041.3_faster1 109053 INDI 701 PLtext missing or illegible when filed Colorectum II 3276672 Negative Negative Negative 6851.12_faster1 109092 INDI 781 PLtext missing or illegible when filed Colorectum II 3295690 Negative Negative Negative 6837.11_faster1 10739 INDI 210 PLtext missing or illegible when filed Stomach IIII 3317316 Positive Negative Negative 7590.8_faster1 109069 INDI 734 PLtext missing or illegible when filed Pancreas II 3318380 Negative Negative Negative 7638.11_faster1 110817 INDI 427 PLtext missing or illegible when filed Colorectum II 3323134 Negative Negative Negative 7561.5_faster1 109106 INDI 803 PLtext missing or illegible when filed Esophagus II 3348473 Negative Negative Negative 7567.10_faster1 108994 INDI 549 PLtext missing or illegible when filed Lung III 3353566 Negative Negative Negative 7678.7_faster1 111043 INDI 922 PLtext missing or illegible when filed Breast II 3355196 Negative Negative Negative 7740.7_faster1 111063 CRC 475 PLtext missing or illegible when filed Colorectum I 3360401 Negative Negative Negative 7590.3_faster1 10858 INDI 388 PLtext missing or illegible when filed Pancreas II 3361282 Negative Negative Negative 7589.3_faster1 109045 INDI 691 PLtext missing or illegible when filed Lung I 3394538 Negative Negative Negative 7542.12_faster1 110646 PANCA 103text missing or illegible when filed Pancreas II 3397925 Negative Negative Negative 7678.4_faster1 111040 INDI 919 PLtext missing or illegible when filed Breast II 3424684 Negative Negative Negative 7534.12_faster1 110667 PAP 944 PLtext missing or illegible when filed Ovary III 3428688 Negative Negative Negative 7642.12_faster1 110848 INDI 599 PLtext missing or illegible when filed Colorectum II 3480043 Negative Negative Negative 7611.6_faster1 10711 INDI 178 PLtext missing or illegible when filed Colorectum III 3487293 Negative Negative Negative 7541.12_faster1 110634 PANCA 101text missing or illegible when filed Pancreas I 3488313 Negative Negative Negative 7585.5_faster1 10722 INDI 190 PLtext missing or illegible when filed Liver III 3507555 Negative Negative Negative 7639.6_faster1 110822 INDI 434 PLtext missing or illegible when filed Colorectum II 3557770 Negative Negative Negative 7592_combined.7_fasttext missing or illegible when filed Yes 10818 INDI 335 PLtext missing or illegible when filed Lung I 3560831 Positive Negative Negative 7677.4_faster1 111030 INDI 830 PLtext missing or illegible when filed Breast II 3584227 Negative Negative Negative 7566.8_faster1 10730 INDI 199 PLtext missing or illegible when filed Stomach II 3594027 Negative Negative Negative 7739.8_faster1 111054 CRC 462 PLtext missing or illegible when filed Colorectum I 3597935 Negative Negative Negative 7584.8_faster1 10701 INDI 167 PLtext missing or illegible when filed Stomach II 3615650 Negative Negative Negative 7670.10_faster1 110986 INDI 658 PLtext missing or illegible when filed Colorectum I 3655451 Negative Negative Negative 7549.6_faster1 108964 INDI 495 PLtext missing or illegible when filed Lung I 3683648 Negative Negative Negative 7535.5_faster1 110677 PAP 957 PLtext missing or illegible when filed Ovary III 3701875 Negative Negative Negative 7740.6_faster1 111062 CRC 474 PLtext missing or illegible when filed Colorectum III 3704739 Negative Negative Negative 7542.9_faster1 110641 PANCA 102text missing or illegible when filed Pancreas II 3743768 Positive Negative Negative 7589.10_faster1 10786 INDI 278 PLtext missing or illegible when filed Ovary III 3747939 Positive Negative Positive 7640.7_faster1 110833 INDI 477 PLtext missing or illegible when filed Colorectum III 3762894 Negative Positive Negative 6857.9_faster1 Yes 10855 INDI 383 PLtext missing or illegible when filed Lung III 3790321 Negative Negative Negative 7667.10_faster1 110976 INDI 290 PLtext missing or illegible when filed Colorectum I 3795297 Negative Negative Negative 7649.4_faster1 110910 INDI 512 PLtext missing or illegible when filed Breast II 3801892 Negative Negative Negative 7640.8_faster1 110834 INDI 483 PLtext missing or illegible when filed Colorectum II 3821378 Negative Negative Negative 7643.6_faster1 110853 INDI 611 PLtext missing or illegible when filed Colorectum II 3824328 Negative Negative Negative 7543.4_faster1 110648 PANCA 103text missing or illegible when filed Pancreas II 3835324 Negative Negative Negative 7589.6_faster1 10624 INDI 075 PLtext missing or illegible when filed Ovary III 3846965 Positive Negative Negative 7638.12_faster1 110818 INDI 428 PLtext missing or illegible when filed Colorectum III 3869695 Negative Negative Negative 7563.11_faster1 10803 INDI 313 PLtext missing or illegible when filed Esophagus II 3887013 Negative Negative Negative 6839_redo.8_faster1 109001 INDI 574 PLtext missing or illegible when filed Colorectum III 3890070 Negative Negative Negative 7643.10_faster1 110856 INDI 617 PLtext missing or illegible when filed Colorectum III 3901698 Negative Negative Negative 7547.6_faster1 10759 INDI 231 PLtext missing or illegible when filed Lung III 3915987 Positive Negative Negative 7664.12_faster1 110948 INDI 551 PLtext missing or illegible when filed Colorectum II 3925074 Negative Negative Negative 7677.10_faster1 111036 INDI 842 PLtext missing or illegible when filed Breast I 3973438 Negative Positive Negative 7591.4_faster1 109051 INDI 699 PLtext missing or illegible when filed Pancreas II 3993186 Positive Negative Negative 7671.11_faster1 110997 INDI 768 PLtext missing or illegible when filed Colorectum II 4013502 Negative Negative Negative 7591.5_faster1 109055 INDI 703 PLtext missing or illegible when filed Lung I 4019055 Negative Negative Negative 7672.12_faster1 111008 INDI 782 PLtext missing or illegible when filed Colorectum III 4055831 Positive Positive Negative 7586.7_faster1 109024 INDI 645 PLtext missing or illegible when filed Liver III 4073694 Positive Negative Negative 7562.4_faster1 10761 INDI 236 PLtext missing or illegible when filed Stomach II 4149785 Negative Negative Negative 7566.9_faster1 10733 INDI 203 PLtext missing or illegible when filed Stomach II 4178571 Negative Positive Negative 7664.10_faster1 110946 INDI 528 PLtext missing or illegible when filed Colorectum II 4210687 Positive Negative Negative 7676.4_faster1 111025 INDI 825 PLtext missing or illegible when filed Colorectum III 4269747 Positive Negative Negative 7547.11_faster1 10775 INDI 264 PLtext missing or illegible when filed Lung III 4275481 Negative Negative Negative 7638.5_faster1 110811 INDI 314 PLtext missing or illegible when filed Colorectum I 4287508 Negative Negative Negative 7664.9_faster1 110945 INDI 527 PLtext missing or illegible when filed Colorectum III 4309014 Positive Negative Negative 7603.12_faster1 10652 INDI 108 PLtext missing or illegible when filed Colorectum II 4311628 Positive Negative Negative 6835.3_faster1 110675 PAP 955 PLtext missing or illegible when filed Ovary III 4325563 Negative Negative Negative 7677.3_faster1 111029 INDI 823 PLtext missing or illegible when filed Breast II 4334923 Negative Negative Negative 7013.6_faster1 109011 INDI 609 PLtext missing or illegible when filed Colorectum II 4345601 Negative Negative Negative 7305.10_faster1 109137 INDI 880 PLtext missing or illegible when filed Breast II 4389478 Negative Negative Negative 7678.12_faster1 111048 INDI 929 PLtext missing or illegible when filed Stomach II 4398098 Negative Negative Negative 7011.7_faster1 10717 INDI 185 PLtext missing or illegible when filed Stomach II 4409233 Positive Negative Negative 7610.10_faster1 10698 INDI 163 PLtext missing or illegible when filed Colorectum III 4431295 Negative Negative Negative 7637.7_faster1 110803 INDI 302 PLtext missing or illegible when filed Colorectum I 4442068 Negative Negative Negative 7589.7_faster1 109140 INDI 888 PLtext missing or illegible when filed Pancreas II 4482143 Negative Negative Negative 7013.12_faster1 10825 INDI 343 PLtext missing or illegible when filed Colorectum III 4512396 Negative Negative Negative 7536.6_faster1 110690 PAPA 1342text missing or illegible when filed Ovary III 4547749 Positive Negative Negative 7560.7_faster1 10807 INDI 318 PLtext missing or illegible when filed Stomach III 4556278 Positive Negative Negative 7585.10_faster1 10889 INDI 446 PLtext missing or illegible when filed Esophagus II 4580159 Negative Negative Negative 7640.12_faster1 110838 INDI 564 PLtext missing or illegible when filed Colorectum I 4604216 Negative Negative Negative 7543.3_faster1 110647 PANCA 103-text missing or illegible when filed Pancreas II 4606920 Negative Negative Negative 7042.3_faster1 109113 INDI 827 PLtext missing or illegible when filed Colorectum III 4629206 Negative Negative Negative 7645.8_faster1 110874 INDI 597 PLtext missing or illegible when filed Breast II 4629350 Negative Negative Negative 6858.5_faster1 10543 CRC 494 PLtext missing or illegible when filed Colorectum II 4631558 Positive Negative Negative 7663.11_faster1 110937 INDI 484 PLtext missing or illegible when filed Colorectum II 4635397 Negative Negative Negative 7610.12_faster1 10700 INDI 165 PLtext missing or illegible when filed Colorectum I 4671536 Negative Negative Negative 7672.5_faster1 111005 INDI 774 PLtext missing or illegible when filed Colorectum I 4676699 Negative Positive Negative 7549.11_faster1 108973 INDI 513 PLtext missing or illegible when filed Lung I 4706497 Negative Negative Negative 7662.12_faster1 110927 INDI 374 PLtext missing or illegible when filed Colorectum III 4752071 Negative Negative Negative 7666.11_faster1 110964 INDI 253 PLtext missing or illegible when filed Colorectum I 4756889 Negative Negative Negative 7542.4_faster1 110636 PANCA 101text missing or illegible when filed Pancreas II 4841695 Negative Negative Negative 7677.7_faster1 111033 INDI 833 PLtext missing or illegible when filed Breast I 4842387 Negative Negative Negative 7677.8_faster1 111034 INDI 839 PLtext missing or illegible when filed Breast II 4846046 Negative Negative Negative 7672.3_faster1 111003 INDI 772 PLtext missing or illegible when filed Colorectum II 4846546 Negative Negative Negative 7593.8_faster1 10847 INDI 371 PLtext missing or illegible when filed Lung III 4871802 Positive Negative Negative 7560.8_faster1 10808 INDI 319 PLtext missing or illegible when filed Stomach I 4915897 Negative Negative Negative 7535.8_faster1 110678 PAP 959 PLtext missing or illegible when filed Ovary III 4940585 Positive Negative Negative 7562.6_faster1 10765 INDI 241 PLtext missing or illegible when filed Stomach III 4948571 Negative Negative Negative 7662.3_faster1 110928 INDI 889 PLtext missing or illegible when filed Colorectum II 4974578 Negative Negative Negative 7640.6_faster1 110832 INDI 472 PLtext missing or illegible when filed Colorectum II 4977178 Negative Negative Negative 7546.6_faster1 10566 INDI 013 PLtext missing or illegible when filed Lung III 4982928 Negative Negative Negative 7010.8_faster1 10567 INDI 014 PLtext missing or illegible when filed Lung II 4993575 Positive Negative Negative 7041.11_faster1 109085 INDI 764 PLtext missing or illegible when filed Colorectum II 5040751 Positive Negative Negative 7542.7_faster1 110639 PANCA 101text missing or illegible when filed Pancreas III 5064729 Negative Negative Negative 7676.10_faster1 111021 INDI 795 PLtext missing or illegible when filed Breast II 5082422 Negative Positive Negative 7010.11_faster1 108980 INDI 524 PLtext missing or illegible when filed Lung III 5095014 Positive Negative Negative 7593.10_faster1 10849 INDI 373 PLtext missing or illegible when filed Lung I 5110714 Negative Negative Negative 7601.12_faster1 10585 INDI 036 PLtext missing or illegible when filed Colorectum I 5136788 Negative Negative Negative 7611.7_faster1 10712 INDI 179 PLtext missing or illegible when filed Colorectum III 5145980 Negative Negative Negative 7603.5_faster1 10641 INDI 094 PLtext missing or illegible when filed Colorectum I 5157994 Negative Negative Negative 7672.7_faster1 111007 INDI 779 PLtext missing or illegible when filed Colorectum II 5168461 Negative Negative Negative 7563.10_faster1 109089 INDI 776 PLtext missing or illegible when filed Esophagus II 5205936 Negative Negative Negative 7536.10_faster1 110694 PAPA 1347text missing or illegible when filed Ovary I 5206646 Negative Negative Negative 7664.11_faster1 110947 INDI 544 PLtext missing or illegible when filed Colorectum III 5295602 Negative Negative Negative 7534.8_faster1 110673 PAP 951 PLtext missing or illegible when filed Ovary III 5341189 Negative Negative Negative 6836.4_faster1 10579 INDI 029 PLtext missing or illegible when filed Colorectum II 5358468 Negative Negative Negative 7603.10_faster1 10648 INDI 102 PLtext missing or illegible when filed Colorectum III 5389348 Negative Negative Negative 7542.8_faster1 110640 PANCA 101text missing or illegible when filed Pancreas I 5459643 Negative Negative Negative 7676.3_faster1 111023 INDI 821 PLtext missing or illegible when filed Colorectum III 5507106 Positive Negative Negative 7609.5_faster1 10662 INDI 122 PLtext missing or illegible when filed Colorectum II 5524030 Negative Negative Negative 6838_redo.4_faster1 109120 INDI 847 PLtext missing or illegible when filed Liver III 5531516 Negative Negative Negative 7584.9_faster1 10702 INDI 168 PLtext missing or illegible when filed Stomach II 5532836 Negative Negative Negative 7612.5_faster1 10736 INDI 207 PLtext missing or illegible when filed Colorectum II 5541362 Negative Negative Negative 7541.4_faster1 110624 PANC 679 Ptext missing or illegible when filed Pancreas II 5689544 Negative Negative Negative 7613.9_faster1 109121 INDI 848 PLtext missing or illegible when filed Colorectum II 5696303 Negative Negative Negative 7606.6_faster1 Yes 10634 INDI 085 PLtext missing or illegible when filed Stomach I 5707150 Negative Negative Negative 7602.3_faster1 10586 INDI 037 PLtext missing or illegible when filed Colorectum I 5727492 Negative Negative Negative 7042.7_faster1 Yes 10827 INDI 346 PLtext missing or illegible when filed Lung I 5738285 Negative Negative Negative 7041.12_faster1 109091 INDI 780 PLtext missing or illegible when filed Colorectum II 5750070 Negative Negative Negative 7642.5_faster1 110841 INDI 573 PLtext missing or illegible when filed Colorectum I 5761449 Negative Negative Negative 7672.4_faster1 111004 INDI 773 PLtext missing or illegible when filed Colorectum II 5842790 Negative Negative Negative 7535.6_faster1 110669 PAP 946 PLtext missing or illegible when filed Ovary III 5847253 Negative Negative Positive 7662.6_faster1 110921 INDI 325 PLtext missing or illegible when filed Colorectum III 5847693 Negative Negative Negative 7673.8_faster1 111009 INDI 708 PLtext missing or illegible when filed Colorectum III 5876494 Positive Negative Negative 7534.3_faster1 110663 PAP 938 PLtext missing or illegible when filed Ovary III 5879145 Positive Positive Negative 7613.8_faster1 109119 INDI 846 PLtext missing or illegible when filed Colorectum II 5880716 Negative Negative Negative 7759.5_faster1 Yes 10657 INDI 113 PLtext missing or illegible when filed Colorectum II 5880730 Negative Negative Negative 7739.6_faster1 111052 CRC 459 PLtext missing or illegible when filed Colorectum II 5886699 Negative Negative Negative 7637.5_faster1 110801 INDI 298 PLtext missing or illegible when filed Colorectum I 5905840 Negative Negative Negative 7603.6_faster1 10643 INDI 096 PLtext missing or illegible when filed Colorectum I 5947450 Negative Negative Negative 7537.5_faster1 110700 PAPA 1356text missing or illegible when filed Ovary II 5951081 Negative Negative Positive 6857.5_faster1 109112 INDI 826 PLtext missing or illegible when filed Colorectum II 5985530 Negative Negative Negative 7678.9_faster1 111045 INDI 924 PLtext missing or illegible when filed Breast III 6013647 Negative Negative Negative 7541.7_faster1 110629 PANCA 100text missing or illegible when filed Pancreas II 6099173 Negative Negative Negative 7667.4_faster1 110970 INDI 259 PLtext missing or illegible when filed Colorectum II 6123288 Positive Negative Negative 7672.8_faster1 110999 INDI 718 PLtext missing or illegible when filed Colorectum II 6127303 Negative Negative Negative 7535.12_faster1 110686 PAPA 1334text missing or illegible when filed Ovary III 6128628 Positive Negative Negative 7665.9_faster1 110956 INDI 732 PLtext missing or illegible when filed Colorectum III 6144208 Negative Negative Negative 7306.11_faster1 Yes 10810 INDI 323 PLtext missing or illegible when filed Breast I 6160359 Negative Negative Negative 7536.4_faster1 110688 PAPA 1336text missing or illegible when filed Ovary I 6166344 Negative Negative Negative 7742.8_faster1 111084 CRC 508 PLtext missing or illegible when filed Colorectum I 6174674 Negative Negative Negative 7546.5_faster1 10564 INDI 011 PLtext missing or illegible when filed Lung I 6198380 Negative Negative Negative 7663.7_faster1 110933 INDI 386 PLtext missing or illegible when filed Colorectum III 6229120 Negative Negative Negative 7671.5_faster1 110990 INDI 747 PLtext missing or illegible when filed Colorectum III 6268955 Negative Negative Negative 7662.11_faster1 110926 INDI 3S6 PLtext missing or illegible when filed Colorectum I 6313478 Negative Negative Negative 7566.6_faster1 10679 INDI 140 PLtext missing or illegible when filed Stomach III 6315974 Negative Negative Negative 7013.5_faster1 109010 INDI 602 PLtext missing or illegible when filed Colorectum II 6319245 Positive Negative Negative 7010.9_faster1 10790 INDI 285 PLtext missing or illegible when filed Lung II 6332234 Positive Negative Negative 7642.8_faster1 110844 INDI 584 PLtext missing or illegible when filed Colorectum II 6358208 Negative Negative Negative 7759.4_faster1 Yes 10655 INDI 111 PLtext missing or illegible when filed Stomach II 6406233 Negative Negative Negative 7544.7_faster1 110661 PANCA 106text missing or illegible when filed Pancreas II 6418433 Negative Negative Negative 7546.7_faster1 10568 INDI 015 PLtext missing or illegible when filed Lung I 6421654 Positive Negative Negative 6836.5_faster1 10584 INDI 035 PLtext missing or illegible when filed Colorectum II 6441354 Negative Negative Negative 7673.7_faster1 111014 INDI 806 PLtext missing or illegible when filed Colorectum II 6483291 Negative Negative Negative 7642.9_faster1 110845 INDI 587 PLtext missing or illegible when filed Colorectum II 6510398 Negative Negative Negative 7562.7_faster1 109102 INDI 799 PLtext missing or illegible when filed Stomach II 6515486 Negative Negative Negative 7612.11_faster1 10749 INDI 221 PLtext missing or illegible when filed Colorectum III 6591134 Negative Negative Negative 7670.12_faster1 110988 INDI 749 PLtext missing or illegible when filed Colorectum III 6600357 Negative Negative Negative 6835.9_faster1 110643 PANCA 102text missing or illegible when filed Pancreas III 6600637 Negative Negative Negative 7590.10_faster1 109071 INDI 736 PLtext missing or illegible when filed Lung III 6627333 Negative Negative Negative 7548.4_faster1 10781 INDI 273 PLtext missing or illegible when filed Lung I 6643421 Negative Negative Negative 7742.9_faster1 111085 CRC 509 PLtext missing or illegible when filed Colorectum I 6656386 Negative Negative Negative 7009.5_faster1 10613 INDI 064 PLtext missing or illegible when filed Breast II 6670500 Negative Negative Negative 7673.11_faster1 111017 INDI 815 PLtext missing or illegible when filed Colorectum II 6700399 Negative Negative Negative 7611.5_faster1 10708 INDI 175 PLtext missing or illegible when filed Colorectum III 6720895 Negative Negative Negative 6838_redo.11_faster1 10823 INDI 341 PLtext missing or illegible when filed Liver II 6731601 Positive Negative Negative 7565.10_faster1 10672 INDI 132 PLtext missing or illegible when filed Esophagus III 6748979 Negative Negative Negative 7593.3_faster1 10834 INDI 357 PLtext missing or illegible when filed Lung I 6771463 Negative Negative Negative 7673.6_faster1 111013 INDI 805 PLtext missing or illegible when filed Colorectum II 6780095 Negative Negative Negative 7011.9_faster1 10729 INDI 198 PLtext missing or illegible when filed Stomach III 6793614 Positive Negative Negative 7603.7_faster1 10645 INDI 098 PLtext missing or illegible when filed Colorectum II 6797379 Negative Negative Negative 7642.10_faster1 110846 INDI 594 PLtext missing or illegible when filed Colorectum III 6797686 Negative Negative Negative 6851.3_faster1 10766 INDI 245 PLtext missing or illegible when filed Colorectum III 6799700 Positive Negative Negative 7534.6_faster1 110681 PAP 974 PLtext missing or illegible when filed Ovary I 6896369 Negative Negative Negative 7586.4_faster1 109006 INDI 586 PLtext missing or illegible when filed Liver III 6916059 Negative Negative Negative 7663.3_faster1 110929 INDI 376 PLtext missing or illegible when filed Colorectum I 6954053 Negative Negative Negative 7544.5_faster1 110659 PANCA 105text missing or illegible when filed Pancreas II 7045546 Negative Negative Negative 6851.4_faster1 10770 INDI 255 PLtext missing or illegible when filed Colorectum II 7093072 Negative Negative Negative 7307.12_faster1 109035 INDI 672 PLtext missing or illegible when filed Breast II 7145901 Negative Negative Negative 7667.3_faster1 110969 INDI 256 PLtext missing or illegible when filed Colorectum III 7157328 Positive Negative Negative 7757.10_faster1 Yes 10608 INDI 059 PLtext missing or illegible when filed Breast II 7168762 Negative Negative Negative 7536.12_faster1 110696 PAPA 1349text missing or illegible when filed Ovary III 7185446 Positive Negative Positive 6836.11_faster1 10573 INDI 023 PLtext missing or illegible when filed Lung II 7249605 Positive Negative Negative 7535.7_faster1 110670 PAP 947 PLtext missing or illegible when filed Ovary III 7250255 Negative Negative Negative 7640.3_faster1 110829 INDI 463 PLtext missing or illegible when filed Colorectum II 7284271 Positive Negative Negative 7541.5_faster1 110625 PANC 680 PLtext missing or illegible when filed Pancreas II 7288598 Negative Negative Negative 7609.12_faster1 10686 INDI 148 PLtext missing or illegible when filed Colorectum II 7304513 Positive Negative Negative 7640.5_faster1 110831 INDI 468 PLtext missing or illegible when filed Colorectum II 7330421 Negative Negative Negative 7014.3_faster1 10826 INDI 344 PLtext missing or illegible when filed Colorectum II 7374671 Negative Negative Negative 7543.8_faster1 110652 PANCA 104text missing or illegible when filed Pancreas II 7374965 Positive Negative Negative 7639.11_faster1 110827 INDI 452 PLtext missing or illegible when filed Colorectum II 7402986 Positive Negative Negative 6837.4_faster1 10878 INDI 415 PLtext missing or illegible when filed Lung II 7421121 Positive Negative Negative 7665.8_faster1 110954 INDI 685 PLtext missing or illegible when filed Colorectum III 7485730 Negative Negative Negative 7759.7_faster1 Yes 10660 INDI 120 PLtext missing or illegible when filed Stomach III 7527786 Negative Negative Negative 7535.11_faster1 110685 PAPA 1333text missing or illegible when filed Ovary III 7562225 Positive Negative Negative 7639.12_faster1 110828 INDI 456 PLtext missing or illegible when filed Colorectum II 7585556 Negative Negative Negative 7671.6_faster1 110992 INDI 758 PLtext missing or illegible when filed Colorectum II 7592504 Negative Negative Negative 7664.6_faster1 110942 INDI 521 PLtext missing or illegible when filed Colorectum II 7619123 Negative Negative Negative 7739.10_faster1 111056 CRC 464 PLtext missing or illegible when filed Colorectum III 7661499 Negative Negative Negative 7308.4_faster1 109061 INDI 715 PLtext missing or illegible when filed Breast III 7674698 Positive Negative Negative 7645.11_faster1 110877 INDI 604 PLtext missing or illegible when filed Breast II 7683175 Negative Negative Negative 7541.8_faster1 110630 PANCA 100text missing or illegible when filed Pancreas II 7733461 Negative Negative Negative 7758.5_faster1 Yes 10631 INDI 082 PLtext missing or illegible when filed Stomach II 7735285 Negative Negative Negative 7541.6_faster1 110626 PANC 757 Ptext missing or illegible when filed Pancreas II 7765953 Negative Negative Negative 6835.7_faster1 110698 PAPA 1354text missing or illegible when filed Ovary I 7771957 Positive Negative Negative 7593.6_faster1 10841 INDI 364 PLtext missing or illegible when filed Lung I 7821491 Negative Negative Negative 7676.12_faster1 111024 INDI 822 PLtext missing or illegible when filed Colorectum II 7842252 Negative Negative Negative 7667.6_faster1 110972 INDI 271 PLtext missing or illegible when filed Colorectum III 7853461 Negative Positive Negative 7643.8_faster1 110855 INDI 615 PLtext missing or illegible when filed Colorectum II 7866361 Negative Negative Negative 7544.8_faster1 10556 INDI 001 PLtext missing or illegible when filed Lung II 7887098 Negative Negative Negative 7548.8_faster1 10795 INDI 292 PLtext missing or illegible when filed Lung III 7923986 Negative Negative Negative 7670.6_faster1 110982 INDI 650 PLtext missing or illegible when filed Colorectum III 7954809 Negative Negative Negative 7601.7_faster1 108954 INDI 480 PLtext missing or illegible when filed Breast III 7955468 Negative Negative Negative 7606.8_faster1 Yes 10764 INDI 239 PLtext missing or illegible when filed Lung III 7977349 Negative Negative Negative 7014.11_faster1 10623 INDI 074 PLtext missing or illegible when filed Pancreas II 7990226 Negative Negative Negative 7670.9_faster1 110985 INDI 655 PLtext missing or illegible when filed Colorectum II 8062805 Negative Negative Negative 7664.4_faster1 110940 INDI 508 PLtext missing or illegible when filed Colorectum III 8148475 Negative Negative Negative 7759.3_faster1 Yes 10654 INDI 110 PLtext missing or illegible when filed Stomach I 8193900 Negative Negative Negative 6836.8_faster1 10562 INDI 009 PLtext missing or illegible when filed Lung II 8217852 Positive Negative Negative 7564.4_faster1 10718 INDI 186 PLtext missing or illegible when filed Stomach II 8224625 Positive Negative Negative 6850.10_faster1 108996 INDI 555 PLtext missing or illegible when filed Colorectum II 8231841 Negative Negative Negative 7307.9_faster1 108962 INDI 493 PLtext missing or illegible when filed Breast II 8263363 Negative Negative Negative 7014.4_faster1 10842 INDI 365 PLtext missing or illegible when filed Colorectum II 8272863 Positive Negative Negative 7676.5_faster1 111026 INDI 829 PLtext missing or illegible when filed Colorectum III 8309300 Positive Negative Negative 7673.3_faster1 111010 INDI 783 PLtext missing or illegible when filed Colorectum III 8375574 Negative Negative Negative 7639.9_faster1 110825 INDI 438 PLtext missing or illegible when filed Colorectum II 8414491 Negative Negative Negative 7308.8_faster1 109095 INDI 787 PLtext missing or illegible when filed Breast II 8446437 Negative Negative Negative 6851.5_faster1 10796 INDI 293 PLtext missing or illegible when filed Colorectum II 8469925 Negative Negative Negative 7756.3_faster1 Yes 10536 CRC 470 PLtext missing or illegible when filed Colorectum II 8479440 Negative Negative Negative 7637.8_faster1 110804 INDI 303 PLtext missing or illegible when filed Colorectum I 8479921 Negative Negative Negative 7643.7_faster1 110854 INDI 612 PLtext missing or illegible when filed Colorectum II 8511230 Positive Negative Negative 6835.11_faster1 10619 INDI 070 PLtext missing or illegible when filed Breast III 8512193 Positive Negative Negative 7304.12_faster1 Yes 109027 INDI 659 PLtext missing or illegible when filed Breast II 8533292 Negative Negative Negative 7308.7_faster1 109065 INDI 722 PLtext missing or illegible when filed Breast I 8569420 Negative Negative Negative 7542.11_faster1 110644 PANCA 102text missing or illegible when filed Pancreas III 8585600 Negative Negative Negative 6836.12_faster1 10748 INDI 220 PLtext missing or illegible when filed Lung I 8603684 Positive Negative Negative 7547.12_faster1 10777 INDI 266 PLtext missing or illegible when filed Lung I 8648492 Negative Negative Negative 7590.11_faster1 109050 INDI 698 PLtext missing or illegible when filed Ovary III 8685561 Negative Negative Negative 7612.9_faster1 10745 INDI 216 PLtext missing or illegible when filed Colorectum III 8704765 Negative Negative Negative 7663.6_faster1 110932 INDI 385 PLtext missing or illegible when filed Colorectum I 8710642 Negative Negative Negative 7546.4_faster1 10563 INDI 010 PLtext missing or illegible when filed Lung II 8717278 Negative Negative Negative 7607.8_faster1 Yes 108934 INDI 454 PLtext missing or illegible when filed Breast III 8718537 Negative Negative Negative 7308.10_faster1 109097 INDI 790 PLtext missing or illegible when filed Breast II 8724316 Negative Negative Negative 7547.5_faster1 10755 INDI 227 PLtext missing or illegible when filed Lung II 8748209 Negative Negative Negative 7677.12_faster1 111037 INDI 915 PLtext missing or illegible when filed Breast II 8772028 Negative Negative Negative 7534.9_faster1 110665 PAP 940 PLtext missing or illegible when filed Ovary III 8792693 Positive Negative Negative 7561.6_faster1 108974 INDI 514 PLtext missing or illegible when filed Stomach I 8794282 Negative Negative Negative 7012.8_faster1 10630 INDI 081 PLtext missing or illegible when filed Colorectum II 8817504 Positive Negative Negative 7306.10_faster1 Yes 10756 INDI 228 PLtext missing or illegible when filed Breast II 8829767 Positive Negative Negative 7662.7_faster1 110922 INDI 328 PLtext missing or illegible when filed Colorectum I 8840984 Negative Negative Negative 7610.4_faster1 10689 INDI 152 PLtext missing or illegible when filed Colorectum I 8956285 Negative Negative Negative 7548.12_faster1 10877 INDI 414 PLtext missing or illegible when filed Lung II 8958632 Negative Negative Negative 7592_combined.6_fasttext missing or illegible when filed Yes 10870 INDI 405 PLtext missing or illegible when filed Lung I 8959025 Negative Negative Negative 7638.6_faster1 110812 INDI 418 PLtext missing or illegible when filed Colorectum I 8981237 Negative Negative Negative 7594.10_faster1 109147 INDI 909 PLtext missing or illegible when filed Esophagus II 9046563 Negative Negative Negative 7041.10_faster1 109078 INDI 752 PLtext missing or illegible when filed Colorectum III 9074211 Negative Negative Negative 7609.11_faster1 10684 INDI 146 PLtext missing or illegible when filed Colorectum II 9111916 Negative Negative Negative 6857.8_faster1 10789 INDI 284 PLtext missing or illegible when filed Colorectum II 9113264 Positive Negative Negative 7543.9_faster1 110653 PANCA 104text missing or illegible when filed Pancreas II 9121697 Negative Negative Negative 6838_redo.10_faster1 10885 INDI 441 PLtext missing or illegible when filed Esophagus II 9134834 Negative Negative Negative 7739.3_faster1 111049 CRC 455 PLtext missing or illegible when filed Colorectum I 9143292 Negative Negative Negative 6858.8_faster1 10546 CRC 502 PLtext missing or illegible when filed Colorectum I 9149440 Negative Negative Negative 7303.4_faster1 Yes 10616 INDI 067 PLtext missing or illegible when filed Breast III 9228387 Negative Negative Negative 7043.10_faster1 10548 CRC 506 PLtext missing or illegible when filed Colorectum III 9248101 Negative Negative Negative 7548.6_faster1 10792 INDI 288 PLtext missing or illegible when filed Lung III 9282231 Positive Negative Negative 7305.11_faster1 109138 INDI 882 PLtext missing or illegible when filed Breast II 9338220 Positive Negative Negative 7308.3_faster1 109060 INDI 713 PLtext missing or illegible when filed Breast II 9357095 Negative Negative Negative 7757.7_faster1 Yes 10591 INDI 043 PLtext missing or illegible when filed Colorectum II 9366800 Negative Negative Negative 7611.10_faster1 10725 INDI 194 PLtext missing or illegible when filed Colorectum II 9392094 Negative Positive Negative 7608.4_faster1 Yes 109040 INDI 684 PLtext missing or illegible when filed Liver III 9409297 Negative Negative Negative 7757.12_faster1 Yes 10614 INDI 065 PLtext missing or illegible when filed Breast II 9414696 Negative Negative Negative 7606.9_faster1 Yes 10767 INDI 246 PLtext missing or illegible when filed Lung II 9434379 Negative Negative Negative 7603.8_faster1 10646 INDI 100 PLtext missing or illegible when filed Colorectum III 9451781 Negative Positive Negative 7608.10_faster1 Yes 109116 INDI 841 PLtext missing or illegible when filed Colorectum III 9466736 Positive Negative Negative 7041.4_faster1 109057 INDI 709 PLtext missing or illegible when filed Colorectum II 9517584 Positive Negative Negative 7592_combined.12_fastext missing or illegible when filed Yes 10833 INDI 355 PLtext missing or illegible when filed Lung I 9526010 Negative Negative Negative 7640.10_faster1 110836 INDI 560 PLtext missing or illegible when filed Colorectum I 9530486 Negative Positive Negative 7601.6_faster1 108953 INDI 479 PLtext missing or illegible when filed Breast III 9541909 Negative Negative Negative 7606.10_faster1 Yes 10774 INDI 262 PLtext missing or illegible when filed Breast III 9555061 Negative Negative Negative 7305.3_faster1 Yes 109030 INDI 664 PLtext missing or illegible when filed Breast I 9557747 Negative Negative Negative 7303.10_faster1 10887 INDI 443 PLtext missing or illegible when filed Breast II 9563313 Negative Negative Negative 7042.9_faster1 Yes 10865 INDI 395 PLtext missing or illegible when filed Lung I 9572740 Positive Negative Negative 7592_combined.5_fasttext missing or illegible when filed Yes 10816 INDI 333 PLtext missing or illegible when filed Lung II 9598766 Positive Negative Negative 7536.8_faster1 110692 PAPA 1345text missing or illegible when filed Ovary III 9607992 Positive Negative Negative 7543.7_faster1 110651 PANCA 104text missing or illegible when filed Pancreas II 9631283 Negative Negative Negative 7671.8_faster1 110994 INDI 763 PLtext missing or illegible when filed Colorectum I 9670355 Negative Negative Negative 7646.10_faster1 110886 INDI 641 PLtext missing or illegible when filed Breast III 9693253 Negative Negative Negative 7589.5_faster1 109047 INDI 694 PLtext missing or illegible when filed Lung I 9721620 Negative Negative Negative 7642.4_faster1 110840 INDI 572 PLtext missing or illegible when filed Colorectum II 9722277 Positive Negative Negative 7306.8_faster1 10604 INDI 056 PLtext missing or illegible when filed Breast II 9734458 Negative Negative Negative 7563.12_faster1 10715 INDI 183 PLtext missing or illegible when filed Stomach I 9735365 Positive Negative Negative 7672.11_faster1 111002 INDI 726 PLtext missing or illegible when filed Colorectum I 9752953 Negative Negative Negative 7760.10_faster1 Yes 10695 INDI 160 PLtext missing or illegible when filed Colorectum II 9782990 Negative Negative Negative 7663.8_faster1 110934 INDI 396 PLtext missing or illegible when filed Colorectum I 9785678 Negative Negative Negative 7011.3_faster1 109009 INDI 595 PLtext missing or illegible when filed Esophagus II 9794909 Positive Negative Negative 7303.3_faster1 Yes 10612 INDI 063 PLtext missing or illegible when filed Breast III 9856414 Negative Negative Negative 7637.11_faster1 110807 INDI 306 PLtext missing or illegible when filed Colorectum III 9948291 Positive Negative Negative 7665.7_faster1 110953 INDI 683 PLtext missing or illegible when filed Colorectum II 9971674 Negative Negative Negative 7606.11_faster1 Yes 10788 INDI 283 PLtext missing or illegible when filed Lung I 9981617 Negative Negative Negative 7676.6_faster1 111027 INDI 835 PLtext missing or illegible when filed Colorectum III 10028345 Negative Negative Negative 6857.10_faster1 Yes 10864 INDI 394 PLtext missing or illegible when filed Lung II 10043000 Negative Negative Negative 7646.12_faster1 110888 INDI 656 PLtext missing or illegible when filed Breast III 10052211 Negative Negative Negative 7644.4_faster1 110865 INDI 628 PLtext missing or illegible when filed Colorectum II 10122473 Negative Negative Negative 7012.6_faster1 109021 INDI 639 PLtext missing or illegible when filed Liver II 10166996 Negative Negative Negative 7759.12_faster1 Yes 10671 INDI 131 PLtext missing or illegible when filed Stomach II 10187523 Negative Negative Negative 7758.8_faster1 Yes 10636 INDI 087 PLtext missing or illegible when filed Stomach I 10207839 Negative Negative Negative 7642.3_faster1 110839 INDI 570 PLtext missing or illegible when filed Colorectum II 10224108 Negative Negative Negative 7757.8_faster1 Yes 10595 INDI 047 PLtext missing or illegible when filed Colorectum II 10273757 Negative Negative Negative 7637.4_faster1 110800 INDI 296 PLtext missing or illegible when filed Colorectum II 10302905 Negative Negative Negative 7607.7_faster1 Yes 10854 INDI 382 PLtext missing or illegible when filed Breast II 10327454 Negative Negative Negative 6837.12_faster1 10650 INDI 104 PLtext missing or illegible when filed Stomach III 10345980 Negative Negative Negative 6851.6_faster1 108975 INDI 516 PLtext missing or illegible when filed Pancreas II 10382498 Negative Negative Negative 7041.8_faster1 109016 INDI 624 PLtext missing or illegible when filed Colorectum II 10523846 Positive Negative Negative 6838_redo.8_faster1 10744 INDI 215 PLtext missing or illegible when filed Liver II 10635260 Negative Negative Negative 7666.12_faster1 110965 INDI 258 PLtext missing or illegible when filed Colorectum I 10661884 Negative Negative Negative 7590.5_faster1 108987 INDI 537 PLtext missing or illegible when filed Ovary I 10688024 Negative Negative Negative 7755.12_faster1 Yes 10577 INDI 027 PLtext missing or illegible when filed Colorectum II 10705925 Positive Negative Negative 7608.9_faster1 Yes 109066 INDI 723 PLtext missing or illegible when filed Ovary III 10787127 Negative Negative Negative 7670.3_faster1 110979 INDI 644 PLtext missing or illegible when filed Colorectum I 10792862 Negative Negative Negative 7644.3_faster1 110864 INDI 621 PLtext missing or illegible when filed Colorectum II 10808736 Negative Negative Negative 7667.11_faster1 110978 INDI 742 PLtext missing or illegible when filed Breast II 10866829 Positive Negative Negative 7544.10_faster1 10558 INDI 003 PLtext missing or illegible when filed Lung III 10894563 Negative Negative Negative 7663.12_faster1 110938 INDI 501 PLtext missing or illegible when filed Colorectum III 10895229 Negative Negative Negative 7593.4_faster1 10835 INDI 358 PLtext missing or illegible when filed Lung II 10897648 Negative Negative Negative 7304.10_faster1 Yes 109003 INDI 579 PLtext missing or illegible when filed Breast I 10914894 Positive Negative Negative 7638.9_faster1 110815 INDI 422 PLtext missing or illegible when filed Colorectum II 10943979 Negative Negative Negative 7740.5_faster1 111061 CRC 473 PLtext missing or illegible when filed Colorectum II 10946083 Positive Negative Negative 7608.7_faster1 Yes 109052 INDI 700 PLtext missing or illegible when filed Lung III 10952423 Negative Negative Negative 6857.6_faster1 109115 INDI 838 PLtext missing or illegible when filed Colorectum III 10963339 Negative Negative Negative 7307.11_faster1 108990 INDI 540 PLtext missing or illegible when filed Breast II 10967901 Negative Negative Negative 7758.9_faster1 Yes 10637 INDI 089 PLtext missing or illegible when filed Colorectum II 10985306 Negative Negative Negative 7759.9_faster1 Yes 10668 INDI 128 PLtext missing or illegible when filed Colorectum III 11005383 Negative Negative Negative 7537.10_faster1 110620 PANC 674text missing or illegible when filed Pancreas II 11007356 Negative Negative Negative 7739.9_faster1 111055 CRC 463 PLtext missing or illegible when filed Colorectum I 11037586 Negative Negative Negative 7646.9_faster1 110885 INDI 638 PLtext missing or illegible when filed Breast I 11134045 Negative Negative Negative 7609.10_faster1 10683 INDI 145 PLtext missing or illegible when filed Colorectum II 11146634 Negative Negative Negative 7756.11_faster1 Yes 10576 INDI 026 PLtext missing or illegible when filed Lung I 11148157 Negative Negative Negative 7607.12_faster1 Yes 108971 INDI 507 PLtext missing or illegible when filed Lung II 11155220 Negative Negative Negative 7758.4_faster1 Yes 10625 INDI 076 PLtext missing or illegible when filed Esophagus II 11178927 Negative Negative Negative 6850.8_faster1 108982 INDI 529 PLtext missing or illegible when filed Colorectum I 11205319 Negative Negative Negative 7756.5_faster1 Yes 10554 CRC 531 PLtext missing or illegible when filed Colorectum III 11205988 Negative Negative Negative 7759.8_faster1 Yes 10667 INDI 127 PLtext missing or illegible when filed Colorectum II 11226932 Negative Negative Negative 7547.10_faster1 10771 INDI 257 PLtext missing or illegible when filed Lung III 11239146 Positive Negative Negative 7758.6_faster1 Yes 10633 INDI 084 PLtext missing or illegible when filed Stomach II 11265793 Negative Negative Negative 6858.10_faster1 10551 CRC 521 PLtext missing or illegible when filed Colorectum III 11273801 Negative Negative Negative 7541.10_faster1 110632 PANCA 100text missing or illegible when filed Pancreas II 11278288 Negative Negative Negative 7662.4_faster1 110919 INDI 321 PLtext missing or illegible when filed Colorectum III 11281006 Negative Negative Negative 7561.3_faster1 108993 INDI 547 PLtext missing or illegible when filed Stomach III 11284513 Negative Negative Negative 7607.10_faster1 Yes 108959 INDI 490 PLtext missing or illegible when filed Breast III 11318226 Negative Negative Negative 7306.12_faster1 Yes 10815 INDI 332 PLtext missing or illegible when filed Breast I 11332438 Negative Negative Negative 7304.11_faster1 Yes 109013 INDI 619 PLtext missing or illegible when filed Breast II 11334967 Negative Negative Negative 6850.12_faster1 109038 INDI 678 PLtext missing or illegible when filed Colorectum III 11356102 Positive Negative Negative 7590.6_faster1 109041 INDI 686 PLtext missing or illegible when filed Pancreas II 11430231 Negative Negative Negative 7306.6_faster1 10607 INDI 058 PLtext missing or illegible when filed Breast I 11455317 Negative Negative Negative 7643.12_faster1 110858 INDI 620 PLtext missing or illegible when filed Colorectum II 11474235 Negative Negative Negative 7665.10_faster1 110955 INDI 692 PLtext missing or illegible when filed Colorectum III 11477099 Negative Negative Negative 7760.3_faster1 Yes 10673 INDI 133 PLtext missing or illegible when filed Stomach I 11499086 Negative Positive Negative 7756.9_faster1 Yes 10574 INDI 024 PLtext missing or illegible when filed Lung II 11518949 Negative Negative Negative 7304.5_faster1 Yes 108949 INDI 474 PLtext missing or illegible when filed Breast II 11532501 Negative Negative Negative 7534.7_faster1 110664 PAP 939 PLtext missing or illegible when filed Ovary III 11546417 Positive Negative Negative 6837.8_faster1 10632 INDI 083 PLtext missing or illegible when filed Stomach II 11547580 Negative Negative Negative 7304.3_faster1 Yes 108939 INDI 460 PLtext missing or illegible when filed Breast III 11621552 Negative Negative Negative 7014.10_faster1 109043 INDI 688 PLtext missing or illegible when filed Colorectum II 11688516 Negative Negative Negative 7643.5_faster1 110851 INDI 608 PLtext missing or illegible when filed Colorectum II 11689087 Positive Negative Negative 7607.4_faster1 Yes 10688 INDI 151 PLtext missing or illegible when filed Stomach II 11728749 Positive Negative Negative 7593.7_faster1 10846 INDI 369 PLtext missing or illegible when filed Lung I 11728834 Negative Negative Negative 7303.8_faster1 Yes 10798 INDI 300 PLtext missing or illegible when filed Breast III 11740790 Negative Negative Negative 7756.6_faster1 Yes 10557 INDI 002 PLtext missing or illegible when filed Lung II 11741917 Negative Negative Negative 7757.3_faster1 Yes 10580 INDI 030 PLtext missing or illegible when filed Colorectum II 11752353 Negative Negative Negative 7546.3_faster1 10561 INDI 007 PLtext missing or illegible when filed Lung II 11877295 Negative Negative Negative 7610.6_faster1 10692 INDI 156 PLtext missing or illegible when filed Colorectum III 11879034 Positive Negative Negative 7670.5_faster1 110981 INDI 649 PLtext missing or illegible when filed Colorectum III 11893568 Negative Negative Negative 7646.3_faster1 110880 INDI 613 PLtext missing or illegible when filed Breast II 11896835 Negative Negative Negative 7677.11_faster1 111038 PANCA 115text missing or illegible when filed Pancreas I 11899685 Negative Negative Negative 7760.8_faster1 Yes 10681 INDI 143 PLtext missing or illegible when filed Colorectum II 11955147 Negative Negative Negative 6839_redo.7_faster1 109000 INDI 567 PLtext missing or illegible when filed Colorectum II 11976877 Positive Negative Negative 7756.4_faster1 Yes 10541 CRC 486 PLtext missing or illegible when filed Colorectum I 12013803 Positive Negative Negative 7307.7_faster1 Yes 108957 INDI 487 PLtext missing or illegible when filed Breast II 12026717 Negative Negative Negative 7303.9_faster1 Yes 10806 INDI 317 PLtext missing or illegible when filed Breast II 12074956 Negative Negative Negative 7543.5_faster1 110649 PANCA 103text missing or illegible when filed Pancreas II 12078995 Negative Negative Negative 7549.7_faster1 108965 INDI 497 PLtext missing or illegible when filed Lung II 12080651 Negative Negative Negative 7012.11_faster1 108940 INDI 461 PLtext missing or illegible when filed Colorectum III 12087006 Positive Negative Negative 7760.6_faster1 Yes 10677 INDI 137 PLtext missing or illegible when filed Stomach II 12102716 Negative Negative Negative 7304.7_faster1 Yes 108997 INDI 559 PLtext missing or illegible when filed Breast III 12106034 Negative Negative Negative 7758.10_faster1 Yes 10639 INDI 092 PLtext missing or illegible when filed Stomach II 12202185 Negative Negative Negative 7673.4_faster1 111011 INDI 785 PLtext missing or illegible when filed Colorectum I 12202785 Negative Negative Negative 7756.10_faster1 Yes 10575 INDI 025 PLtext missing or illegible when filed Lung I 12225917 Negative Negative Negative 7758.12_faster1 Yes 10651 INDI 107 PLtext missing or illegible when filed Colorectum II 12270627 Negative Negative Negative 7760.4_faster1 Yes 10674 INDI 134 PLtext missing or illegible when filed Stomach III 12288756 Positive Negative Negative 7758.3_faster1 Yes 10615 INDI 066 PLtext missing or illegible when filed Breast III 12290640 Negative Negative Negative 6850.4_faster1 109059 INDI 711 PLtext missing or illegible when filed Breast III 12330713 Negative Negative Negative 7607.5_faster1 Yes 10812 INDI 326 PLtext missing or illegible when filed Lung I 12357550 Positive Negative Negative 7759.11_faster1 Yes 10670 INDI 130 PLtext missing or illegible when filed Stomach II 12357763 Negative Negative Negative 6836.9_faster1 10565 INDI 012 PLtext missing or illegible when filed Lung I 12388482 Negative Negative Negative 7307.5_faster1 Yes 10838 INDI 361 PLtext missing or illegible when filed Breast III 12406295 Negative Negative Negative 7011.4_faster1 109127 INDI 859 PLtext missing or illegible when filed Esophagus II 12414216 Positive Positive Negative 7042.11_faster1 10934 CRC 465 PLtext missing or illegible when filed Colorectum II 12423748 Negative Negative Negative 7536.7_faster1 110691 PAPA 1343text missing or illegible when filed Ovary III 12457913 Positive Negative Negative 7758.11_faster1 Yes 10647 INDI 101 PLtext missing or illegible when filed Colorectum III 12471222 Negative Negative Negative 7043.8_faster1 10542 CRC 489 PLtext missing or illegible when filed Colorectum II 12501319 Negative Negative Negative 7305.12_faster1 109139 INDI 887 PLtext missing or illegible when filed Breast III 12506601 Negative Negative Negative 7649.10_faster1 110916 INDI 704 PLtext missing or illegible when filed Breast II 12508209 Negative Negative Negative 7596.8_faster1 10609 INDI 060 PLtext missing or illegible when filed Breast II 12527347 Negative Negative Negative 7742.4_faster1 111080 CRC 501 PLtext missing or illegible when filed Colorectum I 12534877 Negative Negative Negative 7591.9_faster1 109101 INDI 798 PLtext missing or illegible when filed Ovary II 12542225 Positive Negative Negative 7304.9_faster1 Yes 108999 INDI 565 PLtext missing or illegible when filed Breast III 12568286 Positive Negative Negative 7760.9_faster1 Yes 10690 INDI 153 PLtext missing or illegible when filed Stomach II 12571286 Negative Negative Negative 6839_redo.4_faster1 109103 INDI 800 PLtext missing or illegible when filed Liver II 12571619 Negative Negative Negative 7305.4_faster1 Yes 109032 INDI 668 PLtext missing or illegible when filed Breast III 12597944 Negative Negative Negative 7760.7_faster1 Yes 10680 INDI 141 PLtext missing or illegible when filed Stomach III 12602463 Negative Negative Negative 7596.9_faster1 10610 INDI 061 PLtext missing or illegible when filed Breast II 12603504 Negative Negative Negative 7043.12_faster1 10552 CRC 524 PLtext missing or illegible when filed Colorectum II 12612680 Negative Negative Negative 7644.7_faster1 110868 INDI 633 PLtext missing or illegible when filed Colorectum II 12637868 Negative Negative Negative 7757.9_faster1 Yes 10598 INDI 050 PLtext missing or illegible when filed Breast II 12708371 Negative Negative Negative 7042.5_faster1 109105 INDI 802 PLtext missing or illegible when filed Pancreas II 12736111 Negative Negative Negative 7543.12_faster1 110656 PANCA 105text missing or illegible when filed Pancreas II 12750761 Negative Negative Negative 6839_redo.3_faster1 109094 INDI 786 PLtext missing or illegible when filed Liver I 12774784 Positive Negative Negative 7547.9_faster1 10768 INDI 247 PLtext missing or illegible when filed Lung I 12774797 Positive Negative Negative 7606.5_faster1 Yes 10587 INDI 038 PLtext missing or illegible when filed Colorectum II 12779723 Negative Negative Negative 7665.4_faster1 110950 INDI 677 PLtext missing or illegible when filed Colorectum II 12822270 Negative Negative Negative 7663.4_faster1 110930 INDI 378 PLtext missing or illegible when filed Colorectum I 12844324 Negative Negative Negative 7306.5_faster1 10600 INDI 052 PLtext missing or illegible when filed Breast II 12876008 Negative Negative Negative 7742.3_faster1 111079 CRC 500 PLtext missing or illegible when filed Colorectum I 12878766 Negative Negative Negative 7307.3_faster1 Yes 10829 INDI 348 PLtext missing or illegible when filed Breast II 12894091 Negative Negative Negative 7011.8_faster1 10666 INDI 126 PLtext missing or illegible when filed Stomach III 12932905 Positive Negative Negative 7757.5_faster1 Yes 10582 INDI 032 PLtext missing or illegible when filed Colorectum III 12935921 Negative Negative Negative 7739.5_faster1 111051 CRC 457 PLtext missing or illegible when filed I Colorectum II 12949574 Negative Negative Negative 7307.8_faster1 108958 INDI 489 PLtext missing or illegible when filed Breast II 13000860 Negative Negative Negative 7308.6_faster1 109064 INDI 721 PLtext missing or illegible when filed Breast II 13019464 Negative Negative Negative 7563.7_faster1 109080 INDI 755 PLtext missing or illegible when filed Esophagus III 13023659 Negative Negative Negative 6839_redo.10_faster1 109012 INDI 614 PLtext missing or illegible when filed Colorectum II 13025861 Negative Negative Negative 7649.8_faster1 110914 INDI 673 PLtext missing or illegible when filed Breast II 13086229 Negative Negative Negative 7638.8_faster1 110814 INDI 421 PLtext missing or illegible when filed Colorectum II 13095095 Negative Negative Negative 7306.7_faster1 10603 INDI 055 PLtext missing or illegible when filed Breast II 13118272 Negative Negative Negative 6835.10_faster1 110645 PANCA 103text missing or illegible when filed Pancreas II 13135905 Negative Negative Negative 7549.4_faster1 108960 INDI 491 PLtext missing or illegible when filed Lung I 13143161 Negative Negative Negative 7756.8_faster1 Yes 10571 INDI 018 PLtext missing or illegible when filed Lung III 13162781 Negative Negative Negative 7663.9_faster1 110935 INDI 398 PLtext missing or illegible when filed Colorectum II 13172563 Negative Negative Negative 7670.7_faster1 110983 INDI 651 PLtext missing or illegible when filed Colorectum III 13201680 Negative Negative Negative 7306.9_faster1 10605 INDI 057 PLtext missing or illegible when filed Breast III 13242175 Negative Negative Negative 7304.6_faster1 Yes 109002 INDI 577 PLtext missing or illegible when filed Breast I 13313274 Negative Negative Negative 7042.8_faster1 Yes 10832 INDI 353 PLtext missing or illegible when filed Lung II 13337284 Positive Negative Negative 7011.11_faster1 108943 INDI 465 PLtext missing or illegible when filed Esophagus II 13379186 Negative Negative Negative 6836.6_faster1 10664 INDI 124 PLtext missing or illegible when filed Colorectum II 13390707 Negative Negative Negative 7305.8_faster1 109135 INDI 876 PLtext missing or illegible when filed Breast II 13403320 Negative Negative Negative 7304.8_faster1 Yes 108998 INDI 561 PLtext missing or illegible when filed Breast III 13464530 Negative Negative Negative 7666.6_faster1 110959 INDI 234 PLtext missing or illegible when filed Colorectum I 13511305 Negative Negative Negative 7308.9_faster1 109096 INDI 789 PLtext missing or illegible when filed Breast II 13516563 Negative Negative Negative 7666.10_faster1 110963 INDI 251 PLtext missing or illegible when filed Colorectum II 13571140 Negative Negative Negative 7666.7_faster1 110960 INDI 243 PLtext missing or illegible when filed Colorectum I 13578246 Positive Negative Negative 7043.4_faster1 10537 CRC 471 PLtext missing or illegible when filed Colorectum III 13587546 Positive Negative Negative 6839_redo.9_faster1 109008 INDI 591 PLtext missing or illegible when filed Colorectum II 13660283 Negative Negative Negative 7670.11_faster1 110987 INDI 660 PLtext missing or illegible when filed Colorectum II 13703592 Negative Negative Negative 7607.6_faster1 Yes 10844 INDI 367 PLtext missing or illegible when filed Liver I 13774303 Positive Negative Negative 6850.5_faster1 10813 INDI 327 PLtext missing or illegible when filed Colorectum II 13817537 Negative Negative Negative 7594.11_faster1 109148 INDI 911 PLtext missing or illegible when filed Esophagus II 13867646 Negative Negative Negative 7305.9_faster1 109136 INDI 877 PLtext missing or illegible when filed Breast I 13951918 Negative Negative Negative 7667.8_faster1 110974 INDI 281 PLtext missing or illegible when filed Colorectum I 13953579 Negative Negative Negative 7303.6_faster1 10620 INDI 071 PLtext missing or illegible when filed Breast II 13959147 Negative Negative Negative 7610.8_faster1 10694 INDI 159 PLtext missing or illegible when filed Colorectum II 13985715 Negative Negative Negative 7740.12_faster1 111068 CRC 483 PLtext missing or illegible when filed Colorectum I 14034018 Negative Negative Negative 7757.4_faster1 Yes 10581 INDI 031 PLtext missing or illegible when filed Colorectum II 14048988 Negative Negative Negative 7596.3_faster1 10597 INDI 049 PLtext missing or illegible when filed Breast III 14117560 Negative Negative Negative 7757.11_faster1 Yes 10611 INDI 062 PLtext missing or illegible when filed Breast II 14121104 Negative Negative Negative 7760.5_faster1 Yes 10676 INDI 136 PLtext missing or illegible when filed Colorectum II 14149268 Negative Negative Negative 7537.7_faster1 109153 LCR 814 PLtext missing or illegible when filed Pancreas II 14181633 Negative Negative Negative 7667.5_faster1 110971 INDI 268 PLtext missing or illegible when filed Colorectum III 14199962 Positive Negative Negative 7610.7_faster1 10693 INDI 158 PLtext missing or illegible when filed Colorectum I 14204452 Negative Negative Negative 7638.7_faster1 110813 INDI 419 PLtext missing or illegible when filed Colorectum I 14241999 Negative Negative Negative 7757.6_faster1 Yes 10590 INDI 042 PLtext missing or illegible when filed Colorectum I 14247573 Negative Negative Negative 7612.8_faster1 10742 INDI 213 PLtext missing or illegible when filed Colorectum III 14302511 Negative Negative Negative 7740.3_faster1 111059 CRC 469 PLtext missing or illegible when filed Colorectum II 14346493 Negative Negative Negative 7643.3_faster1 110849 INDI 600 PLtext missing or illegible when filed Colorectum II 14392099 Negative Negative Negative 7565.5_faster1 10659 INDI 119 PLtext missing or illegible when filed Esophagus I 14393602 Positive Negative Negative 7305.7_faster1 Yes 109134 INDI 875 PLtext missing or illegible when filed Breast II 14409097 Negative Negative Negative 7667.7_faster1 110973 INDI 279 PLtext missing or illegible when filed Colorectum II 14426072 Positive Negative Negative 7592_combined.4_fasttext missing or illegible when filed Yes 10814 INDI 331 PLtext missing or illegible when filed Lung III 14455257 Positive Negative Negative 7307.6_faster1 Yes 10860 INDI 390 PLtext missing or illegible when filed Breast II 14465100 Negative Negative Negative 7534.10_faster1 110666 PAP 941 PLtext missing or illegible when filed Ovary III 14471184 Negative Negative Negative 7606.4_faster1 Yes 10569 INDI 016 PLtext missing or illegible when filed Lung III 14478527 Negative Negative Negative 7585.3_faster1 10710 INDI 177 PLtext missing or illegible when filed Liver III 14516564 Negative Negative Negative 7543.10_faster1 110654 PANCA 105text missing or illegible when filed Pancreas II 14534837 Negative Negative Negative 7303.5_faster1 10618 INDI 069 PLtext missing or illegible when filed Breast II 14572791 Negative Negative Negative 6835.6_faster1 110682 PAPA 1330text missing or illegible when filed Ovary III 14623813 Positive Negative Negative 7759.6_faster1 Yes 10658 INDI 116 PLtext missing or illegible when filed Stomach I 14651561 Negative Positive Negative 7638.10_faster1 110816 INDI 423 PLtext missing or illegible when filed Colorectum II 14681242 Negative Negative Negative 7610.5_faster1 10691 INDI 155 PLtext missing or illegible when filed Colorectum II 14715914 Negative Negative Negative 6851.11_faster1 109086 INDI 770 PLtext missing or illegible when filed Colorectum II 14739471 Negative Negative Negative 7549.5_faster1 108961 INDI 492 PLtext missing or illegible when filed Lung I 14747011 Negative Negative Negative 6839_redo.6_faster1 10883 INDI 439 PLtext missing or illegible when filed Colorectum III 14782970 Positive Negative Negative 7602.4_faster1 10588 INDI 039 PLtext missing or illegible when filed Colorectum III 14879768 Negative Negative Negative 7608.12_faster1 Yes 109133 INDI 872 PLtext missing or illegible when filed Breast III 14923030 Negative Negative Negative 7678.5_faster1 111041 INDI 920 PLtext missing or illegible when filed Ovary III 14942044 Negative Negative Negative 7305.5_faster1 Yes 109081 INDI 756 PLtext missing or illegible when filed Breast II 14975145 Negative Positive Negative 7535.9_faster1 110683 PAPA 1331text missing or illegible when filed Ovary III 15069331 Positive Negative Negative 7742.5_faster1 111081 CRC 503 PLtext missing or illegible when filed Colorectum I 15091681 Positive Negative Negative 7639.3_faster1 110819 INDI 429 PLtext missing or illegible when filed Colorectum II 15107456 Negative Negative Negative 7606.12_faster1 Yes 10791 INDI 287 PLtext missing or illegible when filed Breast III 15110509 Positive Negative Negative 7606.3_faster1 Yes 109150 INDI 928 PLtext missing or illegible when filed Stomach II 15199986 Negative Negative Negative 7565.3_faster1 10656 INDI 112 PLtext missing or illegible when filed Esophagus II 15242109 Negative Negative Negative 7645.4_faster1 110870 INDI 588 PLtext missing or illegible when filed Breast III 15244435 Negative Negative Negative 7043.5_faster1 10538 CRC 479 PLtext missing or illegible when filed Colorectum II 15245644 Negative Negative Negative 7014.9 _faster1 108977 INDI 518 PLtext missing or illegible when filed Colorectum III 15270476 Positive Negative Negative 7041.7_faster1 109023 INDI 643 PLtext missing or illegible when filed Colorectum II 15328844 Negative Negative Negative 7560.6_faster1 108988 INDI 538 PLtext missing or illegible when filed Lung III 15413435 Negative Negative Negative 7308.12_faster1 109114 INDI 828 PLtext missing or illegible when filed Breast II 15523762 Positive Negative Negative 7586.10_faster1 109083 INDI 760 PLtext missing or illegible when filed Liver III 15527805 Positive Negative Negative 7307.10_faster1 108976 INDI 517 PLtext missing or illegible when filed Breast III 15624023 Negative Negative Negative 7607.9_faster1 Yes 108956 INDI 485 PLtext missing or illegible when filed Esophagus III 15637371 Negative Negative Negative 7664.5_faster1 110941 INDI 515 PLtext missing or illegible when filed Colorectum III 15688198 Negative Negative Negative 7534.5_faster1 110680 PAP 962 PLtext missing or illegible when filed Ovary III 15695598 Negative Negative Negative 7611.8_faster1 10713 INDI 180 PLtext missing or illegible when filed Colorectum III 15784294 Negative Negative Negative 6858.3_faster1 10533 CRC 460 PLtext missing or illegible when filed Colorectum II 15786364 Negative Negative Negative 7566.10_faster1 10735 INDI 206 PLtext missing or illegible when filed Stomach III 15861333 Positive Negative Negative 7642.7_faster1 110843 INDI 583 PLtext missing or illegible when filed Colorectum II 15884110 Negative Negative Negative 7665.6_faster1 110952 INDI 682 PLtext missing or illegible when filed Colorectum III 15898942 Negative Negative Negative 7544.4_faster1 110658 PANCA 105text missing or illegible when filed Pancreas II 15938986 Negative Negative Negative 6858.7_faster1 10545 CRC 499 PLtext missing or illegible when filed Colorectum I 15947500 Negative Negative Negative 7601.5_faster1 108952 INDI 478 PLtext missing or illegible when filed Breast II 15952190 Negative Negative Negative 7603.4_faster1 10640 INDI 093 PLtext missing or illegible when filed Colorectum I 15978437 Negative Negative Negative 7677.9_faster1 111035 INDI 840 PLtext missing or illegible when filed Breast II 16140068 Negative Negative Negative 7562.3_faster1 109099 INDI 792 PLtext missing or illegible when filed Stomach I 16179994 Negative Negative Negative 7639.7_faster1 110823 INDI 436 PLtext missing or illegible when filed Colorectum III 16208714 Negative Negative Negative 7544.11_faster1 10559 INDI 004 PLtext missing or illegible when filed Lung I 16262105 Negative Negative Negative 6838_redo.3_faster1 109005 INDI 585 PLtext missing or illegible when filed Esophagus III 16300134 Positive Negative Negative 7561.12_faster1 109117 INDI 843 PLtext missing or illegible when filed Esophagus I 16335896 Negative Negative Negative 7670.8_faster1 110984 INDI 654 PLtext missing or illegible when filed Colorectum II 16345406 Negative Negative Negative 7664.3_faster1 110939 INDI 506 PLtext missing or illegible when filed Colorectum I 16419133 Negative Negative Negative 7009.11_faster1 10578 INDI 028 PLtext missing or illegible when filed Colorectum II 16523538 Positive Negative Negative 7638.4_faster1 110810 INDI 311 PLtext missing or illegible when filed Colorectum III 16541062 Negative Negative Negative 7304.4_faster1 Yes 108948 INDI 473 PLtext missing or illegible when filed Breast III 16558913 Positive Negative Negative 7305.6_faster1 Yes 109082 INDI 757 PLtext missing or illegible when filed Breast II 16672564 Negative Negative Negative 7548.7_faster1 10794 INDI 291 PLtext missing or illegible when filed Lung I 16675122 Negative Negative Negative 7549.9_faster1 108969 INDI 503 PLtext missing or illegible when filed Lung I 16752817 Negative Negative Negative 7544.6_faster1 110660 PANCA 106text missing or illegible when filed Pancreas II 16838030 Positive Negative Negative 7535.3_faster1 110676 PAP 956 PLtext missing or illegible when filed Ovary III 16844133 Positive Positive Negative 7643.4_faster1 110850 INDI 605 PLtext missing or illegible when filed Colorectum II 16865887 Negative Negative Negative 7672.9_faster1 111000 INDI 724 PLtext missing or illegible when filed Colorectum II 17102657 Negative Negative Negative 7756.7_faster1 Yes 10570 INDI 017 PLtext missing or illegible when filed Lung I 17102879 Negative Negative Negative 7642.11_faster1 110847 INDI 598 PLtext missing or illegible when filed Colorectum II 17127403 Negative Negative Negative 7307.4_faster1 Yes 10831 INDI 352 PLtext missing or illegible when filed Breast III 17185278 Negative Negative Negative 7758.7_faster1 Yes 10635 INDI 086 PLtext missing or illegible when filed Stomach I 17283778 Negative Negative Negative 6858.9_faster1 10550 CRC 520 PLtext missing or illegible when filed Colorectum III 17374052 Negative Negative Negative 7607.3_faster1 10793 INDI 289 PLtext missing or illegible when filed Breast II 17378202 Positive Negative Negative 7663.5_faster1 110931 INDI 379 PLtext missing or illegible when filed Colorectum III 17447719 Negative Negative Negative 7584.4 _faster1 10627 INDI 078 PLtext missing or illegible when filed Liver II 17497723 Negative Negative Negative 6858.4_faster1 10539 CRC 480 PLtext missing or illegible when filed Colorectum III 17512125 Negative Negative Negative 7306.3_faster1 10596 INDI 048 PLtext missing or illegible when filed Breast II 17518393 Negative Negative Negative 7041.5_faster1 109019 INDI 635 PLtext missing or illegible when filed Colorectum II 17523673 Negative Positive Negative 7608.5_faster1 Yes 109049 INDI 696 PLtext missing or illegible when filed Lung II 17541286 Negative Negative Negative 7740.9_faster1 111065 CRC 477 PLtext missing or illegible when filed Colorectum II 17644267 Negative Negative Negative 7043.6_faster1 10540 CRC 481 PLtext missing or illegible when filed Colorectum II 17728894 Negative Negative Negative 7608.3_faster1 Yes 108972 INDI 511 PLtext missing or illegible when filed Colorectum III 17764622 Negative Negative Negative 7602.5_faster1 10589 INDI 040 PLtext missing or illegible when filed Colorectum I 17912621 Negative Negative Negative 7560.4_faster1 108983 INDI 532 PLtext missing or illegible when filed Lung I 17926546 Negative Negative Negative 7637.12_faster1 110808 INDI 307 PLtext missing or illegible when filed Colorectum III 18031641 Negative Negative Negative 6850.9_faster1 108989 INDI 539 PLtext missing or illegible when filed Colorectum II 18211342 Negative Negative Negative 6858.11_faster1 10553 CRC 526 PLtext missing or illegible when filed Colorectum III 18336045 Negative Negative Negative 7613.12_faster1 109126 INDI 855 PLtext missing or illegible when filed Colorectum II 18343702 Negative Negative Negative 7542.3_faster1 110635 PANCA 101text missing or illegible when filed Pancreas II 18351665 Negative Negative Negative 7011.6_faster1 109031 INDI 665 PLtext missing or illegible when filed Esophagus III 18412737 Positive Positive Negative 7536.11_faster1 110695 PAPA 1348text missing or illegible when filed Ovary III 18417631 Positive Negative Negative 7543.6_faster1 110650 PANCA 104text missing or illegible when filed Pancreas II 18443523 Negative Negative Negative 7303.7_faster1 Yes 109130 INDI 865 PLtext missing or illegible when filed Breast III 18466940 Negative Negative Negative 7610.11_faster1 10699 INDI 164 PLtext missing or illegible when filed Colorectum I 18473786 Negative Negative Negative 7590.7_faster1 109048 INDI 695 PLtext missing or illegible when filed Pancreas II 18525122 Positive Negative Negative 7742.6_faster1 111082 CRC 50text missing or illegible when filed  PLtext missing or illegible when filed Colorectum III 18541814 Negative Negative Negative 7594.8_faster1 109145 INDI 907 PLtext missing or illegible when filed Esophagus II 18542868 Negative Negative Negative 7586.9_faster1 109033 INDI 669 PLtext missing or illegible when filed Liver III 18602855 Negative Negative Negative 7585.7_faster1 10737 INDI 208 PLtext missing or illegible when filed Liver II 18613650 Positive Negative Negative 7010.4_faster1 10644 INDI 097 PLtext missing or illegible when filed Colorectum III 18645760 Negative Negative Negative 7563.3_faster1 109124 INDI 853 PLtext missing or illegible when filed Esophagus II 18770983 Negative Negative Negative 7591.7_faster1 109076 INDI 745 PLtext missing or illegible when filed Pancreas II 18782675 Negative Negative Negative 7739.12_faster1 111058 CRC 467 PLtext missing or illegible when filed Colorectum III 18793851 Positive Negative Negative 7639.8_faster1 110824 INDI 437 PLtext missing or illegible when filed Colorectum I 18869016 Negative Negative Negative 7564.5_faster1 10719 INDI 187 PLtext missing or illegible when filed Stomach I 18873266 Negative Negative Negative 7308.5_faster1 109062 INDI 717 PLtext missing or illegible when filed Breast I 18970952 Negative Negative Negative 7664.7_faster1 110943 INDI 523 PLtext missing or illegible when filed Colorectum I 18978926 Negative Negative Negative 6850.6_faster1 108966 INDI 498 PLtext missing or illegible when filed Colorectum II 18997615 Positive Negative Negative 7534.4_faster1 110672 PAP 950 PLtext missing or illegible when filed Ovary III 19030714 Positive Negative Positive 7637.6_faster1 110802 INDI 299 PLtext missing or illegible when filed Colorectum I 19165467 Negative Negative Negative 7591.6_faster1 109056 INDI 706 PLtext missing or illegible when filed Lung I 19176306 Negative Negative Negative 7613.3_faster1 10751 INDI 223 PLtext missing or illegible when filed Colorectum I 19229885 Negative Negative Negative 7742.11_faster1 111087 CRC 511 PLtext missing or illegible when filed Colorectum II 19303564 Negative Negative Negative 7611.4_faster1 10704 INDI 170 PLtext missing or illegible when filed Colorectum I 19410722 Negative Negative Negative 7306.4_faster1 10599 INDI 051 PLtext missing or illegible when filed Breast III 19496002 Negative Negative Negative 7561.11_faster1 10778 INDI 267 PLtext missing or illegible when filed Esophagus II 19771902 Negative Negative Negative 7536.5_faster1 110689 PAPA 1339text missing or illegible when filed Ovary I 19787879 Positive Negative Positive 7640.9_faster1 110835 INDI 558 PLtext missing or illegible when filed Colorectum I 19824684 Negative Negative Negative 7739.7_faster1 111053 CRC 461 PLtext missing or illegible when filed Colorectum I 19956732 Negative Negative Negative 7665.11_faster1 110958 INDI 899 PLtext missing or illegible when filed Breast I 19981298 Negative Negative Negative 6851.8_faster1 109058 INDI 710 PLtext missing or illegible when filed Colorectum III 20001862 Negative Negative Negative 7592_combined.9_fasttext missing or illegible when filed Yes 10824 INDI 342 PLtext missing or illegible when filed Lung III 20199922 Negative Negative Negative 6850.11_faster1 109037 INDI 675 PLtext missing or illegible when filed Colorectum III 20230333 Positive Negative Negative 7646.7_faster1 110883 INDI 630 PLtext missing or illegible when filed Breast I 20320861 Negative Negative Negative 7596.5_faster1 10601 INDI 053 PLtext missing or illegible when filed Breast II 20810618 Positive Negative Negative 7611.11_faster1 10726 INDI 195 PLtext missing or illegible when filed Colorectum III 20853590 Negative Negative Negative 6850.7_faster1 108968 INDI 502 PLtext missing or illegible when filed Colorectum III 20932649 Negative Negative Negative 7013.4_faster1 109004 INDI 581 PLtext missing or illegible when filed Colorectum II 20977458 Positive Negative Negative 7639.5_faster1 110821 INDI 433 PLtext missing or illegible when filed Colorectum II 21461355 Negative Negative Negative 7585.3_faster1 108955 INDI 482 PLtext missing or illegible when filed Liver II 21477232 Negative Negative Negative 6839_redo.5_faster1 109109 INDI 817 PLtext missing or illegible when filed Liver III 21545705 Negative Negative Negative 7602.9_faster1 10593 INDI 045 PLtext missing or illegible when filed Colorectum III 21580012 Negative Negative Negative 7676.9_faster1 111020 INDI 794 PLtext missing or illegible when filed Breast II 21787265 Negative Negative Negative 7671.7_faster1 110993 INDI 761 PLtext missing or illegible when filed Colorectum II 21899955 Negative Negative Negative 7649.9_faster1 110915 INDI 697 PLtext missing or illegible when filed Breast II 21937982 Negative Negative Negative 7662.9_faster1 110924 INDI 338 PLtext missing or illegible when filed Colorectum II 21995745 Negative Negative Negative 7012.12_faster1 108944 INDI 466 PLtext missing or illegible when filed Colorectum II 22048167 Positive Negative Negative 7549.3_faster1 10879 INDI 417 PLtext missing or illegible when filed Lung I 22199612 Negative Negative Negative 7561.10_faster1 109111 INDI 824 PLtext missing or illegible when filed Esophagus II 22217017 Negative Negative Negative 7671.4_faster1 110989 INDI 746 PLtext missing or illegible when filed Colorectum III 22277590 Negative Negative Negative 7549.8_faster1 108967 INDI 499 PLtext missing or illegible when filed Lung I 22290340 Negative Negative Negative 7043.9_faster1 10547 CRC 504 PLtext missing or illegible when filed Colorectum III 22408133 Positive Negative Negative 7670.4_faster1 110980 INDI 648 PLtext missing or illegible when filed Colorectum III 22510880 Positive Negative Negative 7043.11_faster1 10549 CRC 512 PLtext missing or illegible when filed Colorectum II 22667843 Negative Negative Negative 6835.5_faster1 110679 PAP 961 PLtext missing or illegible when filed Ovary III 22676074 Negative Negative Negative 7649.12_faster1 110918 INDI 714 PLtext missing or illegible when filed Breast III 22684049 Positive Negative Negative 7662.5_faster1 110920 INDI 322 PLtext missing or illegible when filed Colorectum III 22726250 Positive Negative Negative 6858.6_faster1 10544 CRC 497 PLtext missing or illegible when filed Colorectum III 22727295 Negative Negative Negative 7014.6_faster1 10852 INDI 380 PLtext missing or illegible when filed Colorectum II 23010226 Negative Negative Negative 7010.7_faster1 10740 INDI 211 PLtext missing or illegible when filed Colorectum II 23031581 Negative Negative Negative 7009.3_faster1 110627 PANC 762 PLtext missing or illegible when filed Pancreas II 23155883 Negative Negative Negative 7012.5_faster1 108942 INDI 464 PLtext missing or illegible when filed Liver III 23250231 Positive Negative Positive 7013.11_faster1 10822 INDI 340 PLtext missing or illegible when filed Colorectum III 23297382 Negative Negative Negative 7637.9_faster1 110805 INDI 304 PLtext missing or illegible when filed Colorectum I 23389735 Negative Positive Negative 7594.12_faster1 109149 INDI 913 PLtext missing or illegible when filed Esophagus III 23543415 Negative Negative Negative 7612.7_faster1 10741 INDI 212 PLtext missing or illegible when filed Colorectum III 23614346 Positive Negative Negative 7010.10_faster1 108970 INDI 505 PLtext missing or illegible when filed Lung II 23634307 Negative Negative Negative 7606.7_faster1 Yes 10628 INDI 079 PLtext missing or illegible when filed Liver II 23851041 Negative Negative Negative 7013.7_faster1 109017 INDI 625 PLtext missing or illegible when filed Colorectum II 23884864 Negative Negative Negative 6837.5_faster1 108963 INDI 494 PLtext missing or illegible when filed Lung III 23965761 Negative Negative Negative 7544.12_faster1 10560 INDI 005 PLtext missing or illegible when filed Lung I 23999311 Positive Negative Negative 7542.6_faster1 110638 PANCA 101text missing or illegible when filed Pancreas II 24010534 Negative Negative Negative 7594.7_faster1 109144 INDI 905 PLtext missing or illegible when filed Esophagus II 24032028 Negative Negative Negative 7562.8_faster1 109104 INDI 801 PLtext missing or illegible when filed Stomach I 24096871 Negative Negative Negative 7645.9_faster1 110875 INDI 601 PLtext missing or illegible when filed Breast III 24221059 Positive Negative Negative 7009.12_faster1 10583 INDI 034 PLtext missing or illegible when filed Colorectum III 24367937 Negative Negative Negative 7014.7_faster1 10866 INDI 397 PLtext missing or illegible when filed Colorectum III 24491709 Negative Negative Negative 7639.10_faster1 110826 INDI 444 PLtext missing or illegible when filed Colorectum II 24690075 Negative Negative Negative 7589.4_faster1 109046 INDI 693 PLtext missing or illegible when filed Lung III 24743114 Positive Negative Negative 7602.8_faster1 10592 INDI 044 PLtext missing or illegible when filed Colorectum II 25416842 Negative Negative Negative 7662.8_faster1 110923 INDI 329 PLtext missing or illegible when filed Colorectum IIII 25554567 Positive Negative Negative 7637.10_faster1 110806 INDI 305 PLtext missing or illegible when filed Colorectum II 25620843 Positive Negative Negative 7013.10_faster1 10809 INDI 320 PLtext missing or illegible when filed Colorectum II 25848426 Negative Negative Negative 6835.4_faster1 110671 PAP 949 PLtext missing or illegible when filed Ovary IIII 26009990 Negative Negative Negative 7610.3_faster1 10687 INDI 150 PLtext missing or illegible when filed Colorectum II 26190880 Positive Negative Negative 7663.10_faster1 110936 INDI 400 PLtext missing or illegible when filed Colorectum II 26205126 Positive Negative Negative 7013.3_faster1 108946 INDI 470 PLtext missing or illegible when filed Colorectum III 26290647 Positive Negative Negative 7678.3_faster1 111039 INDI 917 PLtext missing or illegible when filed Liver III 26418631 Positive Negative Negative 7740.8_faster1 111064 CRC 476 PLtext missing or illegible when filed Colorectum II 26527000 Positive Negative Negative 7665.3_faster1 110949 INDI 670 PLtext missing or illegible when filed Colorectum III 26759855 Positive Negative Negative 6857.11_faster1 110662 PANCA 115text missing or illegible when filed Pancreas II 26760223 Negative Negative Negative 6839_redo.11_faster1 109018 INDI 626 PLtext missing or illegible when filed Colorectum II 26767307 Negative Negative Negative 7673.5_faster1 111012 INDI 788 PLtext missing or illegible when filed Colorectum II 27075277 Negative Negative Negative 6837.10_faster1 10665 INDI 125 PLtext missing or illegible when filed Esophagus II 27099980 Positive Positive Negative 7535.10_faster1 110684 PAPA 1332text missing or illegible when filed Ovary I 27521236 Negative Negative Negative 7011.10_faster1 108936 INDI 457 PLtext missing or illegible when filed Esophagus II 27665822 Positive Negative Negative 7677.5_faster1 111031 INDI 831 PLtext missing or illegible when filed Breast I 27831412 Negative Negative Negative 7537.4_faster1 110699 PAPA 135text missing or illegible when filed Ovary III 27866616 Positive Negative Negative 7638.3_faster1 110809 INDI 309 PLtext missing or illegible when filed Colorectum II 27979944 Negative Negative Negative 6838_redo.9_faster1 10747 INDI 219 PLtext missing or illegible when filed Liver III 28101753 Positive Negative Negative 7566.3_faster1 10675 INDI 135 PLtext missing or illegible when filed Stomach III 28195882 Negative Negative Negative 7640.4_faster1 110830 INDI 467 PLtext missing or illegible when filed Colorectum II 28285870 Positive Negative Negative 7561.8_faster1 109093 INDI 784 PLtext missing or illegible when filed Stomach I 28355787 Negative Negative Negative 7602.10_faster1 10994 INDI 046 PLtext missing or illegible when filed Colorectum II 28577142 Negative Negative Negative 7041.6_faster1 109022 INDI 640 PLtext missing or illegible when filed Colorectum II 28800336 Positive Positive Negative 7567.5_faster1 10884 INDI 440 PLtext missing or illegible when filed Esophagus II 29087757 Negative Negative Negative 6851.9_faster1 109025 INDI 647 PLtext missing or illegible when filed Colorectum III 29099826 Positive Negative Negative 7644.5_faster1 110866 INDI 631 PLtext missing or illegible when filed Colorectum II 29183100 Negative Negative Negative 7042.10_faster1 10532 CRC 458 PLtext missing or illegible when filed Colorectum II 29493266 Negative Negative Negative 7609.6_faster1 10663 INDI 123 PLtext missing or illegible when filed Colorectum II 29592186 Negative Negative Negative 7593.5_faster1 10837 INDI 360 PLtext missing or illegible when filed Lung II 29802114 Negative Negative Negative 7011.5_faster1 109029 INDI 663 PLtext missing or illegible when filed Esophagus II 30466055 Positive Negative Negative 7677.6_faster1 111032 INDI 832 PLtext missing or illegible when filed Breast II 31310565 Negative Negative Negative 7041.9_faster1 109026 INDI 657 PLtext missing or illegible when filed Colorectum II 31653547 Positive Negative Negative 6857.3_faster1 109063 INDI 720 PLtext missing or illegible when filed Colorectum III 31915897 Negative Negative Negative 7010.6_faster1 10723 INDI 191 PLtext missing or illegible when filed Colorectum I 32107486 Negative Negative Negative 7542.5_faster1 110637 PANCA 101text missing or illegible when filed Pancreas III 32393583 Positive Negative Negative 7592_combined.8_fasttext missing or illegible when filed Yes 10819 INDI 336 PLtext missing or illegible when filed Lung III 32529369 Negative Negative Negative 7586.8_faster1 109028 INDI 661 PLtext missing or illegible when filed Liver III 32614452 Negative Negative Negative 7560.3_faster1 108979 INDI 522 PLtext missing or illegible when filed Lung I 32694027 Negative Negative Negative 7667.12_faster1 110977 INDI 716 PLtext missing or illegible when filed Colorectum III 32862529 Negative Negative Negative 6851.7_faster1 109054 INDI 702 PLtext missing or illegible when filed Lung II 33124065 Negative Negative Negative 7673.9_faster1 111015 INDI 808 PLtext missing or illegible when filed Colorectum III 33215174 Negative Negative Negative 7640.11_faster1 110837 INDI 562 PLtext missing or illegible when filed Colorectum I 33273561 Positive Negative Negative 7566.12_faster1 10642 INDI 095 PLtext missing or illegible when filed Stomach II 33345327 Positive Negative Negative 6838_redo.7_faster1 10714 INDI 182 PLtext missing or illegible when filed Liver III 33731393 Negative Negative Negative 7563.9_faster1 109131 INDI 867 PLtext missing or illegible when filed Esophagus II 33771332 Positive Negative Negative 7664.8_faster1 110944 INDI 525 PLtext missing or illegible when filed Colorectum I 33945588 Negative Negative Negative 7589.11_faster1 10843 INDI 366 PLtext missing or illegible when filed Pancreas II 33972894 Negative Negative Negative 7759.10_faster1 Yes 10669 INDI 129 PLtext missing or illegible when filed Liver II 34138426 Negative Negative Negative 7564.3_faster1 10716 INDI 184 PLtext missing or illegible when filed Esophagus II 34571164 Positive Negative Negative 7560.5_faster1 108986 INDI 535 PLtext missing or illegible when filed Lung I 35034507 Negative Negative Negative 7646.4_faster1 110879 INDI 607 PLtext missing or illegible when filed Breast II 35885421 Negative Negative Negative 7592_combined.3_fasttext missing or illegible when filed Yes 10868 INDI 403 PLtext missing or illegible when filed Lung III 35927206 Negative Negative Negative 7742.12_faster1 111088 CRC 513 PLtext missing or illegible when filed Colorectum II 36090588 Negative Negative Negative 7594.9_faster1 109146 INDI 908 PLtext missing or illegible when filed Esophagus II 36616898 Negative Negative Negative 7548.3_faster1 10779 INDI 269 PLtext missing or illegible when filed Lung III 36802049 Negative Negative Negative 7649.11_faster1 110917 INDI 712 PLtext missing or illegible when filed Breast I 37318457 Negative Negative Negative 7585.6_faster1 10734 INDI 205 PLtext missing or illegible when filed Liver III 37490440 Positive Positive Negative 7042.12_faster1 10535 CRC 468 PLtext missing or illegible when filed Colorectum III 38370073 Negative Negative Negative 7014.5_faster1 10851 INDI 377 PLtext missing or illegible when filed Colorectum II 38574612 Negative Negative Negative 7566.5_faster1 10678 INDI 139 PLtext missing or illegible when filed Stomach III 38605637 Positive Negative Negative 7567.3_faster1 10649 INDI 103 PLtext missing or illegible when filed Stomach II 39168812 Negative Negative Negative 7562.12_faster1 109123 INDI 850 PLtext missing or illegible when filed Esophagus II 39489197 Positive Negative Negative 7740.4_faster1 111060 CRC 472 PLtext missing or illegible when filed Colorectum II 39783916 Negative Negative Negative 7676.7_faster1 111028 INDI 837 PLtext missing or illegible when filed Colorectum II 41486671 Negative Negative Negative 7563.5_faster1 10697 INDI 162 PLtext missing or illegible when filed Stomach III 41846036 Negative Negative Negative 6837.3_faster1 10769 INDI 252 PLtext missing or illegible when filed Lung II 41868738 Negative Negative Negative 7589.9_faster1 109142 INDI 893 PLtext missing or illegible when filed Pancreas II 42034627 Negative Negative Negative 7596.6_faster1 10602 INDI 054 PLtext missing or illegible when filed Breast II 43241792 Negative Negative Negative 7584.3_faster1 10626 INDI 077 PLtext missing or illegible when filed Liver II 43439264 Positive Negative Negative 7612.12_faster1 10750 INDI 222 PLtext missing or illegible when filed Colorectum II 44049554 Positive Negative Negative 7541.3_faster1 110623 PANC 677text missing or illegible when filed Pancreas II 44382768 Negative Negative Negative 7672.6_faster1 111006 INDI 777 PLtext missing or illegible when filed Colorectum II 44818555 Negative Negative Negative 7671.9_faster1 110995 INDI 765 PLtext missing or illegible when filed Colorectum I 45084409 Negative Negative Negative 7012.10_faster1 10801 INDI 310 PLtext missing or illegible when filed Colorectum II 45238888 Negative Negative Negative 7642.6_faster1 110842 INDI 582 PLtext missing or illegible when filed Colorectum II 45318338 Negative Negative Negative 7739.4_faster1 111050 CRC 456 PLtext missing or illegible when filed Colorectum I 45555883 Negative Negative Negative 7645.3_faster1 110869 INDI 578 PLtext missing or illegible when filed Breast I 46297286 Negative Negative Negative 7643.11_faster1 110857 INDI 618 PLtext missing or illegible when filed Colorectum III 46621165 Negative Positive Negative 7593.9_faster1 10848 INDI 372 PLtext missing or illegible when filed Lung II 47063234 Negative Negative Negative 7678.S_faster1 111044 INDI 923 PLtext missing or illegible when filed Esophagus I 48092734 Negative Positive Negative 7609.3_faster1 10653 INDI 109 PLtext missing or illegible when filed Colorectum III 48226837 Positive Negative Negative 7537.6_faster1 Yes 109152 LCR 812 PLtext missing or illegible when filed Pancreas II 51896117 Positive Negative Negative 7547.4_faster1 10752 INDI 224 PLtext missing or illegible when filed Lung III 51931089 Positive Negative Negative 7603.3_faster1 Yes 10638 INDI 090 PLtext missing or illegible when filed Colorectum II 52478584 Positive Negative Negative 7567.4_faster1 108951 INDI 476 PLtext missing or illegible when filed Esophagus II 52566550 Negative Negative Negative 7590.12_faster1 109073 INDI 740 PLtext missing or illegible when filed Pancreas II 53237733 Negative Negative Negative 7644.6_faster1 110867 INDI 632 PLtext missing or illegible when filed Colorectum II 55764474 Negative Negative Negative 7009.4_faster1 110628 PANC 765text missing or illegible when filed Pancreas II 56998190 Negative Negative Negative 7591.3_faster1 109074 INDI 741 PLtext missing or illegible when filed Pancreas III 57886079 Negative Negative Negative 7666.3_faster1 110967 INDI 902 PLtext missing or illegible when filed Breast III 59817502 Positive Negative Negative 7613.4_faster1 10753 INDI 225 PLtext missing or illegible when filed Colorectum I 68078206 Positive Negative Negative CA19-9 CEA HGF OPN TIMP-1 CA 15-3 + (U/ml) + (pg/ml) (pg/ml) + (pg/ml) + (pg/ml) + Unique Name (>98 U/ml) >92 >7507 >899 >157772 >176989 Mut+ 7666.9_faster1 Negative Negative Negative Negative Negative Negative Positive 7561.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7649.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7678.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7560.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7537.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7662.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7613.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7563.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7537.1_faster1 Negative Positive Positive Negative Negative Negative Positive 7591.11_faster1 Positive Negative Negative Negative Negative Negative Positive 7586.5_faster1 Negative Negative Positive Positive Positive Positive Positive 7561.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7589.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7586.6_faster1 Negative Negative Negative Negative Negative Negative Positive 7671.10_faster1 Negative Negative Positive Negative Negative Negative Negative 7560.10_faster1 Negative Negative Positive Negative Negative Negative Negative 7740.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7671.12_faster1 Negative Negative Negative Negative Negative Negative Positive 7013.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7645.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7014.12_faster1 Negative Negative Negative Negative Negative Negative Positive 7009.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7541.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7665.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7541.11_faster1 Negative Positive Positive Negative Negative Negative Positive 7567.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7542.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7678.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7673.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7666.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7562.10_faster1 Negative Positive Negative Negative Negative Negative Negative 7537.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7594.3_faster1 Negative Negative Negative Negative Negative Negative Positive 6837.6_faster1 Negative Negative Negative Negative Negative Negative Positive 7613.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7589.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7537.12_faster1 Negative Positive Negative Negative Positive Negative Negative 7591.12_faster1 Negative Negative Negative Positive Negative Negative Negative 7012.7_faster1 Negative Negative Negative Negative Negative Negative Positive 7667.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7548.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7665.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7671.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7536.3_faster1 Negative Negative Negative Negative Negative Negative Positive 6857.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7676.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7561.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7590.9_faster1 Negative Negative Negative Negative Negative Negative Positive 7591.8_faster1 Negative Positive Negative Negative Negative Negative Negative 7643.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7613.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7666.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7666.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7560.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7590.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7639.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7637.3_faster1 Negative Negative Positive Negative Negative Negative Negative 7611.9 _faster1 Negative Negative Negative Positive Negative Negative Positive 7612.3 _faster1 Negative Negative Negative Positive Negative Negative Negative 7645.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7646.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7546.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7613.7_faster1 Negative Negative Negative Negative Negative Negative Positive 7543.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7676.11_faster1 Negative Negative Negative Negative Negative Negative Positive 7563.6_faster1 Negative Negative Negative Positive Negative Negative Positive 6851.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7613.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7672.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7673.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7544.3_faster1 Negative Positive Negative Negative Negative Negative Negative 7646.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7041.3_faster1 Negative Negative Negative Negative Negative Negative Positive 6851.12_faster1 Negative Negative Negative Negative Negative Negative Positive 6837.11_faster1 Negative Negative Negative Negative Negative Negative Positive 7590.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7638.11_faster1 Negative Negative Positive Negative Negative Positive Negative 7561.5_faster1 Negative Negative Negative Negative Positive Negative Negative 7567.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7678.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7740.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7590.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7589.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7542.12_faster1 Negative Positive Negative Negative Negative Negative Negative 7678.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7534.12_faster1 Negative Positive Negative Negative Negative Negative Positive 7642.12_faster1 Negative Negative Positive Negative Negative Negative Negative 7611.6_faster1 Negative Negative Negative Positive Negative Negative Negative 7541.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7585.5_faster1 Negative Negative Negative Positive Negative Positive Negative 7639.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7592_combined.7_fasttext missing or illegible when filed Negative Negative Negative Negative Negative Negative Negative 7677.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7566.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7739.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7584.8_faster1 Negative Negative Negative Positive Negative Negative Negative 7670.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7549.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7535.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7740.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7542.9_faster1 Negative Negative Negative Negative Negative Positive Negative 7589.10_faster1 Positive Negative Negative Negative Negative Negative Positive 7640.7_faster1 Negative Negative Negative Negative Negative Negative Negative 6857.9_faster1 Negative Negative Negative Negative Negative Negative Positive 7667.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7649.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7640.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7643.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7543.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7589.6_faster1 Negative Negative Negative Negative Negative Negative Positive 7638.12_faster1 Negative Negative Positive Negative Negative Positive Negative 7563.11_faster1 Negative Negative Negative Positive Negative Negative Negative 6839_redo.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7643.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7547.6_faster1 Negative Negative Positive Negative Negative Negative Positive 7664.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7677.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7591.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7671.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7591.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7672.12_faster1 Negative Negative Positive Negative Negative Negative Positive 7586.7_faster1 Negative Negative Negative Negative Positive Negative Positive 7562.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7566.9_faster1 Negative Positive Negative Negative Negative Negative Positive 7664.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7676.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7547.11_faster1 Positive Negative Negative Negative Negative Negative Negative 7638.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7664.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7603.12_faster1 Negative Negative Negative Negative Negative Negative Positive 6835.3_faster1 Negative Negative Negative Negative Negative Negative Positive 7677.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7013.6_faster1 Negative Negative Negative Negative Negative Negative Positive 7305.10_faster1 Negative Negative Negative Positive Negative Negative Negative 7678.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7011.7_faster1 Negative Negative Positive Positive Negative Negative Positive 7610.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7637.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7589.7_faster1 Negative Positive Negative Negative Negative Negative Negative 7013.12_faster1 Negative Negative Negative Negative Negative Negative Positive 7536.6_faster1 Negative Negative Negative Negative Negative Negative Positive 7560.7_faster1 Negative Positive Positive Negative Negative Negative Positive 7585.10_faster1 Negative Negative Negative Positive Positive Negative Positive 7640.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7543.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7042.3_faster1 Negative Negative Negative Negative Negative Negative Positive 7645.8_faster1 Negative Negative Negative Negative Negative Negative Negative 6858.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7663.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7610.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7672.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7549.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7662.12_faster1 Negative Negative Positive Negative Negative Negative Negative 7666.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7542.4_faster1 Negative Positive Negative Negative Negative Negative Negative 7677.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7677.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7672.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7593.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7560.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7535.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7562.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7662.3_faster1 Negative Negative Negative Negative Negative Negative Positive 7640.6_faster1 Negative Negative Positive Negative Negative Negative Negative 7546.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7010.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7041.11_faster1 Negative Negative Negative Negative Positive Negative Positive 7542.7_faster1 Negative Positive Negative Negative Negative Negative Negative 7676.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7010.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7593.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7601.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7611.7_faster1 Negative Negative Negative Positive Positive Negative Negative 7603.5_faster1 Negative Negative Negative Negative Positive Positive Negative 7672.7_faster1 Negative Negative Negative Negative Negative Negative Positive 7563.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7536.10_faster1 Negative Positive Negative Negative Negative Negative Positive 7664.11_faster1 Negative Negative Negative Negative Negative Negative Positive 7534.8_faster1 Negative Negative Negative Negative Negative Negative Negative 6836.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7603.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7542.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7676.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7609.5_faster1 Negative Negative Negative Positive Negative Negative Negative 6838_redo.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7584.9_faster1 Negative Positive Negative Positive Negative Positive Negative 7612.5_faster1 Negative Negative Positive Negative Negative Negative Negative 7541.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7613.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7606.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7602.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7042.7_faster1 Negative Negative Negative Negative Negative Negative Positive 7041.12_faster1 Negative Negative Negative Negative Negative Negative Positive 7642.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7672.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7535.6_faster1 Negative Positive Negative Negative Negative Negative Positive 7662.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7673.8_faster1 Negative Negative Positive Negative Negative Negative Positive 7534.3_faster1 Negative Negative Negative Negative Negative Negative Positive 7613.8_faster1 Negative Negative Positive Negative Negative Negative Negative 7759.5_faster1 Negative Positive Positive Negative Negative Negative Negative 7739.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7637.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7603.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7537.5_faster1 Negative Negative Negative Positive Negative Negative Negative 6857.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7678.9_faster1 Negative Negative Negative Negative Negative Negative Positive 7541.7_faster1 Negative Positive Negative Negative Negative Negative Negative 7667.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7672.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7535.12_faster1 Negative Negative Negative Negative Negative Positive Positive 7665.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7306.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7536.4_faster1 Negative Negative Negative Negative Negative Positive Positive 7742.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7546.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7663.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7671.5_faster1 Negative Negative Negative Negative Negative Positive Negative 7662.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7566.6_faster1 Negative Negative Negative Positive Positive Negative Negative 7013.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7010.9_faster1 Negative Negative Positive Negative Negative Negative Positive 7642.8_faster1 Negative Negative Negative Negative Positive Negative Negative 7759.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7544.7_faster1 Negative Positive Negative Negative Negative Negative Negative 7546.7_faster1 Negative Negative Negative Negative Negative Negative Negative 6836.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7673.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7642.9_faster1 Negative Negative Negative Negative Positive Negative Negative 7562.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7612.11_faster1 Negative Negative Positive Negative Negative Negative Positive 7670.12_faster1 Negative Negative Negative Negative Negative Negative Negative 6835.9_faster1 Negative Positive Negative Negative Negative Negative Positive 7590.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7548.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7742.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7009.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7673.11_faster1 Negative Negative Positive Negative Negative Negative Positive 7611.5_faster1 Negative Negative Negative Positive Positive Negative Positive 6838_redo.11_faster1 Negative Positive Negative Negative Positive Negative Positive 7565.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7593.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7673.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7011.9_faster1 Negative Negative Positive Negative Negative Negative Positive 7603.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7642.10_faster1 Negative Negative Negative Negative Negative Negative Positive 6851.3_faster1 Negative Negative Negative Negative Negative Negative Positive 7534.6_faster1 Negative Negative Negative Negative Negative Negative Positive 7586.4_faster1 Negative Negative Negative Positive Positive Negative Negative 7663.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7544.5_faster1 Negative Positive Negative Negative Negative Negative Negative 6851.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7307.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7667.3_faster1 Negative Negative Negative Negative Negative Negative Positive 7757.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7536.12_faster1 Positive Negative Negative Negative Negative Positive Positive 6836.11_faster1 Negative Negative Negative Negative Negative Negative Positive 7535.7_faster1 Negative Negative Negative Negative Negative Negative Positive 7640.3_faster1 Negative Negative Positive Negative Negative Negative Positive 7541.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7609.12_faster1 Negative Negative Negative Positive Positive Positive Negative 7640.5_faster1 Negative Negative Positive Negative Negative Negative Negative 7014.3_faster1 Negative Negative Positive Negative Negative Negative Positive 7543.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7639.11_faster1 Negative Negative Negative Positive Negative Negative Positive 6837.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7665.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7759.7_faster1 Negative Negative Negative Positive Negative Negative Negative 7535.11_faster1 Positive Positive Negative Negative Negative Negative Negative 7639.12_faster1 Negative Positive Negative Negative Positive Negative Negative 7671.6_faster1 Negative Negative Negative Negative Negative Positive Negative 7664.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7739.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7308.4_faster1 Negative Negative Negative Negative Positive Negative Positive 7645.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7541.8_faster1 Negative Positive Negative Negative Negative Negative Positive 7758.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7541.6_faster1 Negative Positive Negative Negative Negative Negative Negative 6835.7_faster1 Negative Negative Negative Negative Negative Negative Positive 7593.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7676.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7667.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7643.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7544.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7548.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7670.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7601.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7606.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7014.11_faster1 Negative Positive Negative Negative Negative Negative Positive 7670.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7664.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7759.3_faster1 Negative Negative Negative Negative Negative Negative Negative 6836.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7564.4_faster1 Negative Negative Positive Positive Positive Negative Positive 6850.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7307.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7014.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7676.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7673.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7639.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7308.8_faster1 Negative Negative Negative Negative Negative Negative Negative 6851.5_faster1 Negative Negative Positive Negative Negative Negative Positive 7756.3_faster1 Negative Negative Negative Negative Negative Negative Positive 7637.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7643.7_faster1 Negative Negative Negative Negative Negative Negative Negative 6835.11_faster1 Negative Negative Negative Negative Negative Negative Positive 7304.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7308.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7542.11_faster1 Negative Negative Negative Negative Negative Negative Negative 6836.12_faster1 Negative Negative Negative Negative Negative Negative Positive 7547.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7590.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7612.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7663.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7546.4_faster1 Negative Positive Negative Negative Negative Negative Negative 7607.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7308.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7547.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7677.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7534.9_faster1 Positive Negative Negative Negative Negative Negative Positive 7561.6_faster1 Negative Negative Negative Negative Negative Negative Positive 7012.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7306.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7662.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7610.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7548.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7592_combined.6_fasttext missing or illegible when filed Negative Negative Negative Negative Negative Negative Negative 7638.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7594.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7041.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7609.11_faster1 Negative Negative Negative Negative Negative Negative Negative 6857.8_faster1 Negative Negative Positive Negative Negative Negative Positive 7543.9_faster1 Negative Negative Negative Negative Negative Negative Negative 6838_redo.10_faster1 Negative Negative Negative Positive Negative Positive Negative 7739.3_faster1 Negative Negative Negative Negative Negative Negative Positive 6858.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7303.4_faster1 Negative Negative Negative Positive Negative Negative Negative 7043.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7548.6_faster1 Positive Negative Negative Negative Negative Negative Positive 7305.11_faster1 Negative Negative Negative Positive Negative Negative Negative 7308.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7757.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7611.10_faster1 Negative Negative Negative Positive Negative Negative Negative 7608.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7757.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7606.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7603.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7608.10_faster1 Negative Negative Positive Negative Negative Negative Positive 7041.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7592_combined.12_fastext missing or illegible when filed Negative Negative Negative Negative Negative Negative Positive 7640.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7601.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7606.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7305.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7303.10_faster1 Negative Negative Negative Negative Positive Negative Negative 7042.9_faster1 Negative Negative Negative Negative Negative Negative Positive 7592_combined.5_fasttext missing or illegible when filed Negative Negative Negative Negative Negative Negative Positive 7536.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7543.7_faster1 Negative Positive Negative Negative Negative Negative Negative 7671.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7646.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7589.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7642.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7306.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7563.12_faster1 Negative Negative Negative Positive Negative Negative Negative 7672.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7760.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7663.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7011.3_faster1 Negative Negative Negative Negative Negative Positive Positive 7303.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7637.11_faster1 Negative Negative Positive Negative Negative Positive Positive 7665.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7606.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7676.6_faster1 Negative Negative Negative Negative Negative Negative Negative 6857.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7646.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7644.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7012.6_faster1 Negative Positive Negative Positive Negative Negative Positive 7759.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7758.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7642.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7757.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7637.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7607.7_faster1 Negative Negative Negative Negative Negative Negative Positive 6837.12_faster1 Negative Negative Positive Negative Negative Negative Positive 6851.6_faster1 Negative Positive Negative Negative Negative Negative Positive 7041.8_faster1 Negative Negative Negative Negative Negative Negative Positive 6838_redo.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7666.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7590.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7755.12_faster1 Negative Negative Negative Negative Negative Negative Positive 7608.9_faster1 Positive Negative Negative Negative Negative Negative Positive 7670.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7644.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7667.11_faster1 Negative Negative Negative Negative Negative Negative Positive 7544.10_faster1 Negative Positive Positive Negative Negative Negative Positive 7663.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7593.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7304.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7638.9_faster1 Negative Negative Negative Negative Negative Positive Negative 7740.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7608.7_faster1 Negative Negative Positive Negative Negative Negative Positive 6857.6_faster1 Negative Negative Negative Negative Negative Negative Positive 7307.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7758.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7759.9_faster1 Negative Positive Positive Negative Negative Negative Positive 7537.10_faster1 Negative Positive Positive Negative Negative Negative Negative 7739.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7646.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7609.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7756.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7607.12_faster1 Negative Negative Negative Negative Negative Negative Positive 7758.4_faster1 Negative Negative Negative Negative Negative Negative Negative 6850.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7756.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7759.8_faster1 Negative Negative Negative Positive Negative Negative Negative 7547.10_faster1 Negative Negative Positive Negative Negative Negative Negative 7758.6_faster1 Negative Negative Negative Negative Negative Negative Negative 6858.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7541.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7662.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7561.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7607.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7306.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7304.11_faster1 Negative Negative Negative Negative Negative Negative Negative 6850.12_faster1 Negative Negative Positive Negative Negative Negative Positive 7590.6_faster1 Negative Positive Negative Negative Negative Negative Negative 7306.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7643.12_faster1 Negative Negative Negative Negative Positive Positive Negative 7665.10_faster1 Negative Negative Positive Negative Negative Negative Negative 7760.3_faster1 Negative Negative Negative Positive Negative Negative Negative 7756.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7304.5_faster1 Negative Negative Negative Negative Positive Negative Negative 7534.7_faster1 Negative Negative Negative Negative Negative Positive Positive 6837.8_faster1 Negative Negative Negative Negative Positive Negative Negative 7304.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7014.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7643.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7607.4_faster1 Negative Negative Positive Positive Negative Negative Positive 7593.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7303.8_faster1 Negative Negative Negative Positive Negative Negative Negative 7756.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7757.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7546.3_faster1 Negative Negative Positive Negative Negative Negative Negative 7610.6_faster1 Negative Positive Positive Positive Negative Negative Positive 7670.5_faster1 Negative Negative Positive Negative Negative Negative Negative 7646.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7677.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7760.8_faster1 Negative Negative Negative Negative Negative Negative Negative 6839_redo.7_faster1 Negative Negative Positive Negative Positive Positive Positive 7756.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7307.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7303.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7543.5_faster1 Negative Positive Negative Negative Negative Negative Negative 7549.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7012.11_faster1 Negative Negative Negative Negative Negative Negative Positive 7760.6_faster1 Negative Negative Positive Positive Positive Negative Negative 7304.7_faster1 Negative Negative Negative Negative Negative Negative Positive 7758.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7673.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7756.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7758.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7760.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7758.3_faster1 Negative Negative Negative Negative Negative Negative Negative 6850.4_faster1 Negative Negative Positive Negative Negative Negative Positive 7607.5_faster1 Negative Negative Positive Negative Negative Negative Negative 7759.11_faster1 Negative Negative Negative Negative Positive Negative Negative 6836.9_faster1 Negative Negative Negative Negative Negative Negative Positive 7307.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7011.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7042.11_faster1 Negative Negative Negative Negative Negative Negative Positive 7536.7_faster1 Positive Negative Negative Negative Negative Negative Positive 7758.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7043.8_faster1 Negative Negative Positive Negative Negative Negative Positive 7305.12_faster1 Negative Positive Negative Negative Positive Negative Negative 7649.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7596.8_faster1 Negative Negative Negative Positive Negative Negative Negative 7742.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7591.9_faster1 Negative Negative Negative Negative Negative Negative Positive 7304.9_faster1 Negative Negative Negative Positive Negative Negative Negative 7760.9_faster1 Negative Negative Negative Positive Negative Negative Negative 6839_redo.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7305.4_faster1 Negative Negative Positive Negative Negative Negative Negative 7760.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7596.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7043.12_faster1 Negative Negative Negative Negative Negative Negative Positive 7644.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7757.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7042.5_faster1 Negative Positive Negative Negative Negative Negative Positive 7543.12_faster1 Negative Negative Negative Negative Negative Negative Negative 6839_redo.3_faster1 Negative Negative Negative Negative Negative Negative Positive 7547.9_faster1 Negative Negative Negative Negative Negative Negative Positive 7606.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7665.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7663.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7306.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7742.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7307.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7011.8_faster1 Negative Negative Negative Positive Negative Negative Positive 7757.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7739.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7307.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7308.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7563.7_faster1 Negative Negative Negative Negative Negative Negative Negative 6839_redo.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7649.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7638.8_faster1 Negative Negative Negative Negative Positive Negative Negative 7306.7_faster1 Negative Negative Negative Negative Negative Negative Negative 6835.10_faster1 Negative Negative Negative Negative Negative Positive Positive 7549.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7756.8_faster1 Negative Negative Positive Negative Negative Negative Negative 7663.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7670.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7306.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7304.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7042.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7011.11_faster1 Negative Negative Negative Negative Negative Negative Positive 6836.6_faster1 Negative Negative Negative Positive Positive Positive Positive 7305.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7304.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7666.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7308.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7666.10_faster1 Negative Negative Positive Negative Negative Negative Positive 7666.7_faster1 Negative Negative Negative Negative Negative Negative Positive 7043.4_faster1 Negative Negative Negative Negative Negative Negative Positive 6839_redo.9_faster1 Negative Negative Negative Positive Negative Positive Positive 7670.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7607.6_faster1 Negative Negative Negative Negative Negative Negative Positive 6850.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7594.11_faster1 Negative Negative Negative Negative Negative Positive Negative 7305.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7667.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7303.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7610.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7740.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7757.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7596.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7757.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7760.5_faster1 Negative Negative Negative Positive Negative Negative Negative 7537.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7667.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7610.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7638.7_faster1 Negative Negative Negative Negative Positive Positive Negative 7757.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7612.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7740.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7643.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7565.5_faster1 Positive Positive Negative Positive Positive Negative Positive 7305.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7667.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7592_combined.4_fasttext missing or illegible when filed Negative Negative Negative Negative Negative Negative Positive 7307.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7534.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7606.4_faster1 Negative Negative Positive Negative Negative Negative Positive 7585.3_faster1 Negative Negative Negative Positive Negative Negative Positive 7543.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7303.5_faster1 Negative Negative Negative Negative Positive Negative Negative 6835.6_faster1 Positive Negative Negative Negative Negative Negative Positive 7759.6_faster1 Negative Negative Negative Negative Negative Negative Positive 7638.10_faster1 Negative Negative Negative Negative Positive Negative Negative 7610.5_faster1 Negative Negative Negative Negative Negative Negative Negative 6851.11_faster1 Negative Negative Negative Negative Negative Negative Positive 7549.5_faster1 Negative Negative Negative Negative Negative Negative Negative 6839_redo.6_faster1 Negative Negative Negative Negative Positive Negative Positive 7602.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7608.12_faster1 Negative Negative Negative Negative Negative Negative Positive 7678.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7305.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7535.9_faster1 Positive Negative Negative Negative Negative Negative Positive 7742.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7639.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7606.12_faster1 Negative Negative Positive Negative Negative Negative Positive 7606.3_faster1 Negative Negative Negative Negative Positive Negative Positive 7565.3_faster1 Negative Negative Negative Negative Positive Positive Negative 7645.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7043.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7014.9 _faster1 Negative Negative Negative Negative Negative Negative Positive 7041.7_faster1 Negative Negative Negative Negative Negative Negative Positive 7560.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7308.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7586.10_faster1 Negative Negative Negative Positive Positive Negative Negative 7307.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7607.9_faster1 Negative Negative Negative Negative Negative Negative Positive 7664.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7534.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7611.8_faster1 Negative Negative Negative Negative Negative Negative Positive 6858.3_faster1 Negative Negative Negative Negative Negative Negative Positive 7566.10_faster1 Negative Negative Negative Positive Negative Negative Negative 7642.7_faster1 Negative Negative Negative Positive Negative Negative Negative 7665.6_faster1 Negative Negative Negative Negative Negative Negative Positive 7544.4_faster1 Negative Negative Negative Negative Negative Negative Negative 6858.7_faster1 Negative Negative Negative Negative Negative Negative Positive 7601.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7603.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7677.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7562.3_faster1 Positive Negative Negative Negative Negative Negative Negative 7639.7_faster1 Negative Negative Negative Negative Positive Negative Negative 7544.11_faster1 Negative Positive Negative Negative Negative Negative Negative 6838_redo.3_faster1 Negative Negative Negative Positive Negative Negative Positive 7561.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7670.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7664.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7009.11_faster1 Negative Negative Negative Negative Negative Negative Positive 7638.4_faster1 Negative Negative Positive Positive Negative Negative Negative 7304.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7305.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7548.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7549.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7544.6_faster1 Negative Positive Negative Negative Negative Positive Positive 7535.3_faster1 Negative Negative Negative Negative Negative Negative Positive 7643.4_faster1 Negative Negative Negative Positive Negative Negative Negative 7672.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7756.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7642.11_faster1 Negative Negative Negative Negative Positive Negative Negative 7307.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7758.7_faster1 Negative Negative Negative Positive Positive Negative Negative 6858.9_faster1 Negative Negative Negative Negative Negative Negative Positive 7607.3_faster1 Negative Negative Negative Negative Negative Negative Positive 7663.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7584.4 _faster1 Negative Negative Negative Negative Negative Negative Positive 6858.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7306.3_faster1 Negative Negative Positive Negative Negative Negative Negative 7041.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7608.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7740.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7043.6_faster1 Negative Positive Negative Negative Negative Negative Positive 7608.3_faster1 Negative Negative Negative Negative Negative Negative Positive 7602.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7560.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7637.12_faster1 Negative Negative Negative Negative Negative Positive Negative 6850.9_faster1 Negative Negative Negative Negative Negative Negative Positive 6858.11_faster1 Negative Negative Negative Negative Negative Negative Positive 7613.12_faster1 Negative Negative Negative Positive Positive Negative Negative 7542.3_faster1 Negative Positive Negative Negative Negative Positive Positive 7011.6_faster1 Negative Positive Positive Positive Negative Negative Positive 7536.11_faster1 Positive Negative Negative Negative Negative Negative Positive 7543.6_faster1 Negative Negative Negative Negative Negative Negative Positive 7303.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7610.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7590.7_faster1 Positive Negative Negative Negative Negative Negative Negative 7742.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7594.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7586.9_faster1 Negative Negative Negative Negative Negative Negative Positive 7585.7_faster1 Negative Negative Negative Positive Positive Negative Positive 7010.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7563.3_faster1 Negative Negative Negative Negative Negative Positive Positive 7591.7_faster1 Negative Positive Negative Negative Negative Negative Negative 7739.12_faster1 Negative Negative Positive Negative Negative Negative Negative 7639.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7564.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7308.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7664.7_faster1 Negative Negative Negative Negative Negative Negative Negative 6850.6_faster1 Negative Negative Negative Negative Negative Negative Positive 7534.4_faster1 Positive Negative Negative Negative Positive Negative Positive 7637.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7591.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7613.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7742.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7611.4_faster1 Negative Negative Negative Positive Positive Negative Negative 7306.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7561.11_faster1 Negative Negative Negative Negative Negative Negative Positive 7536.5_faster1 Negative Positive Negative Negative Negative Negative Positive 7640.9_faster1 Negative Negative Negative Negative Negative Negative Positive 7739.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7665.11_faster1 Negative Negative Negative Negative Negative Negative Negative 6851.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7592_combined.9_fasttext missing or illegible when filed Positive Negative Negative Negative Negative Negative Negative 6850.11_faster1 Negative Negative Negative Negative Negative Negative Positive 7646.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7596.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7611.11_faster1 Negative Negative Negative Positive Negative Negative Negative 6850.7_faster1 Negative Negative Negative Negative Negative Negative Positive 7013.4_faster1 Negative Negative Negative Negative Negative Positive Positive 7639.5_faster1 Negative Negative Negative Negative Negative Positive Positive 7585.3_faster1 Negative Negative Negative Negative Negative Negative Positive 6839_redo.5_faster1 Negative Negative Negative Negative Positive Negative Positive 7602.9_faster1 Negative Negative Positive Negative Positive Negative Negative 7676.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7671.7_faster1 Negative Negative Negative Negative Positive Positive Negative 7649.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7662.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7012.12_faster1 Negative Negative Negative Negative Negative Positive Positive 7549.3_faster1 Negative Negative Negative Negative Negative Negative Positive 7561.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7671.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7549.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7043.9_faster1 Negative Negative Positive Negative Negative Negative Positive 7670.4_faster1 Negative Positive Positive Negative Negative Positive Positive 7043.11_faster1 Negative Negative Positive Negative Negative Negative Positive 6835.5_faster1 Negative Positive Negative Negative Positive Negative Positive 7649.12_faster1 Negative Negative Negative Negative Negative Negative Positive 7662.5_faster1 Negative Negative Negative Negative Negative Negative Negative 6858.6_faster1 Negative Negative Positive Negative Negative Negative Positive 7014.6_faster1 Negative Negative Negative Negative Positive Negative Positive 7010.7_faster1 Negative Negative Negative Negative Negative Negative Positive 7009.3_faster1 Negative Positive Positive Negative Negative Negative Positive 7012.5_faster1 Positive Positive Positive Positive Positive Positive Positive 7013.11_faster1 Negative Negative Negative Negative Negative Negative Positive 7637.9_faster1 Negative Negative Negative Negative Negative Positive Negative 7594.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7612.7_faster1 Negative Negative Negative Negative Negative Negative Positive 7010.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7606.7_faster1 Negative Negative Negative Positive Positive Negative Positive 7013.7_faster1 Negative Negative Negative Negative Negative Negative Positive 6837.5_faster1 Negative Negative Positive Negative Negative Negative Positive 7544.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7542.6_faster1 Negative Negative Positive Negative Negative Positive Positive 7594.7_faster1 Negative Negative Negative Negative Negative Positive Positive 7562.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7645.9_faster1 Positive Positive Negative Negative Negative Negative Positive 7009.12_faster1 Negative Negative Negative Negative Negative Positive Positive 7014.7_faster1 Negative Negative Positive Negative Negative Negative Positive 7639.10_faster1 Negative Negative Positive Negative Negative Negative Negative 7589.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7602.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7662.8_faster1 Negative Negative Negative Positive Negative Negative Positive 7637.10_faster1 Negative Negative Positive Positive Negative Negative Positive 7013.10_faster1 Negative Negative Positive Negative Negative Negative Positive 6835.4_faster1 Negative Negative Negative Positive Negative Negative Positive 7610.3 _faster1 Negative Positive Positive Positive Negative Negative Positive 7663.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7013.3_faster1 Negative Negative Negative Negative Negative Positive Positive 7678.3_faster1 Negative Negative Negative Negative Negative Negative Positive 7740.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7665.3_faster1 Negative Positive Positive Negative Negative Negative Positive 6857.11_faster1 Negative Negative Positive Positive Positive Positive Positive 6839_redo.11_faster1 Negative Positive Positive Negative Negative Negative Positive 7673.5_faster1 Negative Negative Positive Negative Negative Negative Negative 6837.10_faster1 Negative Negative Negative Positive Negative Negative Positive 7535.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7011.10_faster1 Negative Negative Negative Positive Positive Positive Positive 7677.5_faster1 Negative Negative Negative Negative Negative Negative Negative 7537.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7638.3_faster1 Negative Negative Negative Negative Negative Negative Negative 6838_redo.9_faster1 Negative Negative Negative Negative Negative Negative Positive 7566.3_faster1 Positive Negative Negative Positive Negative Positive Positive 7640.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7561.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7602.10_faster1 Negative Negative Negative Positive Positive Negative Negative 7041.6_faster1 Negative Negative Negative Negative Negative Negative Positive 7567.5_faster1 Negative Negative Negative Positive Negative Negative Negative 6851.9_faster1 Negative Negative Positive Negative Negative Negative Negative 7644.5_faster1 Negative Negative Positive Negative Negative Negative Negative 7042.10_faster1 Negative Negative Negative Negative Negative Negative Positive 7609.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7593.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7011.5_faster1 Negative Negative Negative Positive Positive Negative Positive 7677.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7041.9_faster1 Negative Positive Positive Negative Negative Negative Positive 6857.3_faster1 Negative Negative Negative Negative Negative Negative Positive 7010.6_faster1 Negative Negative Negative Positive Negative Negative Negative 7542.5_faster1 Negative Positive Negative Negative Negative Positive Negative 7592_combined.8_fasttext missing or illegible when filed Negative Negative Negative Negative Negative Negative Positive 7586.8_faster1 Negative Negative Negative Negative Negative Negative Negative 7560.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7667.12_faster1 Negative Negative Negative Negative Negative Negative Negative 6851.7_faster1 Negative Negative Negative Negative Negative Negative Positive 7673.9_faster1 Negative Negative Negative Negative Negative Negative Negative 7640.11_faster1 Negative Negative Negative Positive Positive Positive Negative 7566.12_faster1 Negative Negative Negative Negative Negative Negative Negative 6838_redo.7_faster1 Negative Negative Negative Positive Positive Negative Positive 7563.9_faster1 Negative Negative Negative Positive Positive Positive Negative 7664.8_faster1 Negative Negative Negative Negative Negative Negative Positive 7589.11_faster1 Negative Positive Negative Negative Negative Negative Negative 7759.10_faster1 Negative Negative Negative Negative Negative Negative Negative 7564.3_faster1 Negative Negative Negative Positive Negative Negative Positive 7560.5_faster1 Negative Negative Positive Negative Negative Negative Negative 7646.4_faster1 Negative Negative Negative Negative Negative Negative Negative 7592_combined.3_fasttext missing or illegible when filed Negative Negative Negative Negative Negative Negative Negative 7742.12_faster1 Negative Negative Negative Negative Negative Negative Positive 7594.9_faster1 Negative Negative Negative Positive Positive Positive Positive 7548.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7649.11_faster1 Negative Negative Negative Negative Negative Negative Negative 7585.6_faster1 Negative Negative Negative Positive Positive Positive Positive 7042.12_faster1 Negative Negative Positive Negative Negative Negative Positive 7014.5_faster1 Negative Negative Negative Negative Negative Negative Positive 7566.5_faster1 Negative Negative Positive Positive Positive Positive Positive 7567.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7562.12_faster1 Positive Negative Negative Negative Negative Negative Positive 7740.4_faster1 Negative Positive Positive Negative Negative Negative Negative 7676.7_faster1 Negative Negative Negative Negative Negative Negative Negative 7563.5_faster1 Negative Negative Negative Negative Positive Positive Negative 6837.3_faster1 Negative Negative Negative Negative Negative Negative Positive 7589.9_faster1 Negative Negative Negative Negative Positive Negative Negative 7596.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7584.3_faster1 Negative Negative Negative Positive Positive Negative Positive 7612.12_faster1 Negative Negative Positive Negative Negative Negative Positive 7541.3_faster1 Negative Positive Negative Negative Negative Negative Positive 7672.6_faster1 Negative Negative Negative Negative Negative Negative Positive 7671.9_faster1 Negative Negative Negative Positive Negative Positive Positive 7012.10_faster1 Negative Negative Negative Positive Negative Positive Positive 7642.6_faster1 Negative Negative Positive Negative Negative Negative Negative 7739.4_faster1 Negative Negative Negative Negative Negative Negative Positive 7645.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7643.11_faster1 Negative Positive Negative Negative Negative Negative Positive 7593.9_faster1 Negative Negative Negative Negative Negative Negative Positive 7678.S_faster1 Negative Negative Negative Negative Negative Negative Negative 7609.3_faster1 Negative Negative Negative Negative Negative Negative Positive 7537.6_faster1 Negative Positive Negative Negative Negative Positive Positive 7547.4_faster1 Negative Negative Negative Positive Positive Negative Positive 7603.3_faster1 Negative Negative Negative Negative Negative Negative Negative 7567.4_faster1 Negative Negative Negative Negative Positive Positive Negative 7590.12_faster1 Negative Negative Negative Negative Negative Negative Negative 7644.6_faster1 Negative Negative Negative Negative Negative Negative Negative 7009.4_faster1 Negative Positive Positive Positive Positive Negative Positive 7591.3_faster1 Negative Positive Negative Negative Positive Negative Positive 7666.3_faster1 Negative Negative Negative Negative Negative Negative Positive 7613.4_faster1 Negative Positive Negative Negative Negative Negative Positive text missing or illegible when filed indicates data missing or illegible when filed