METHOD FOR CONSTRUCTING PACBIO SEQUENCING LIBRARY

20220298505 · 2022-09-22

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided in the present invention is a method for constructing a PacBio sequencing library, comprising the following steps: (1) obtaining a target double-stranded DNA; (2) adding a thermostable RNA ligase to respectively connect two ends of the double-stranded DNA to form a closed loop to obtain a dumbbell-shaped DNA library; (3) purifying the dumbbell-shaped DNA library; and (4) binding with sequencing primers and adding a DNA polymerase to obtain a PacBio sequencing library.

    Claims

    1. A method of constructing a PacBio sequencing library, comprising the following steps: (1) obtaining a target double-stranded DNA, and optionally further purifying said target double-stranded DNA; (2) adding a thermostable RNA ligase to respectively connect two ends of said double-stranded DNA to form a closed loop to obtain a dumbbell-shaped DNA library; (3) purifying said dumbbell-shaped DNA library; and (4) binding with a sequencing primer and adding a DNA polymerase to obtain a PacBio sequencing library.

    2. The method according to claim 1, wherein said target double-stranded DNA is obtained by a PCR amplification, a multiplex PCR amplification, or a CRISPR/Cas9 cleavage.

    3. The method according to claim 1, wherein the sequences at both ends of said target double-stranded DNA are the same or different.

    4. The method according to claim 1, wherein the 5′ base at the end of the target double-stranded DNA has a phosphate group, and the 3′ base at the end of the target double-stranded DNA has a hydroxyl group.

    5. The method according to claim 1, wherein said target double-stranded DNA has or does not have a Barcode.

    6. The method according to claim 1, wherein in said step (2), said thermostable RNA ligase is incubated at a temperature suitable for said thermostable RNA to remain active, for a sufficient time to respectively connect the two ends of said double-stranded DNA to form a closed loop.

    7. The method according to claim 1, wherein said thermostable RNA ligase is selected from a Thermus bacteriobacteriophage RNA ligase and/or an archaebacterium RNA ligase.

    8. The method according to claim 1, wherein said thermostable RNA ligase is a Methanobacterium thermoautotrophicum RNA ligase 1.

    9. The method according to claim 1, wherein said thermostable RNA ligase is a pre-adenylated thermostable RNA ligase.

    10. The method according to claim 1, wherein said purification in step (1) or (3) is carried out by a magnetic bead or silica gel membrane column.

    11. The method according to claim 1, wherein said circular DNA sequences at both ends of said dumbbell-shaped DNA library are the same or different.

    12. The method according to claim 1, wherein said sequencing primer is inversely complementary to the circular DNA sequence at one end of said dumbbell-shaped DNA library.

    13. The method according to claim 1, wherein the length of said sequencing primer to inversely complementary to the circular DNA sequence at one end of said dumbbell-shaped DNA library is 6-40 nt.

    14. The method according to claim 1, wherein the ends of said target double-stranded DNA are blund ends and/or sticky ends.

    15. A kit used for constructing a PacBio sequencing library by the method according to claim 1.

    16. The kit according to claim 15 , comprising (a) one or more reagents selected from the group consisting of an amplification primer for the target double-stranded DNA or CRISPR/Cas9 reagent, a thermostable RNA ligase, a sequencing primer, and a DNA polymerase; and (b) an instruction.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0028] FIG. 1 is a schematic diagram of the principle of rapidly constructing a PacBio sequencing library, which illustrates the process of rapidly constructing a PacBio sequencing library.

    [0029] FIG. 2 is a DNA gel diagram of the HBB gene mutation sample amplified according to the PCR method in Example 1, which shows the PCR amplification product of the HBB gene.

    [0030] FIG. 3 is the PacBio sequencing result of the HBB gene heterozygous mutation IVS-II-654 (C-T) sample (the antisense strand of the HBB gene is shown in the figure). Sequencing of this sample yielded 896 sequenced molecules covering the HBB gene region, of which 399 sequenced molecules were detected at the arrow position with a G signal and no IVS-II-654 (C-T) type mutation, and the other 497 sequenced molecules were detected at the arrow position with an A signal and an IVS-II-654 (C-T) type mutation, indicating that this sample is IVS-II-654 (C-T) heterozygous mutation sample.

    EXAMPLES

    Example 1. Construction of a PacBio Sequencing Library for Detection of HBB Gene Mutations According to the Method of the Disclosure

    Step 1: PCR Amplification of the HBB Gene.

    [0031] 200 μL of human peripheral blood was collected with an EDTA anticoagulant tube. The reaction system was prepared according to the following table (wherein the 16 bases marked with an underline are the Barcode sequence bcl001 provided by the PacBio company. If there are multiple samples, different Barcodes can be used for each sample).

    TABLE-US-00001 2x MightyAmp Buffer Ver.2 25.0 μl Primer HBB-F (10 uM)  1.0 μl 5′phos-GTTTGCTGACACTGATC GCACTCTGATATGTGGAGGGAGGGCTGAGG GTTTG-3' (SEQ ID NO: 1) Primer HBB-R (10uM)  1.0 μl 5'phos-GTTTGCTGACACTGATC GCACTCTGATATGTGGGGTGGGCCTATGACA GGGT-3' (SEQ ID NO: 2) ddH.sub.2O 21.0 μl MightyAmp DNA polymerase (Takara,  1.0 μl Cat#R071Q) human peripheral blood  1.0 μl
    On the PCR instrument, the amplification was performed under the following conditions:

    TABLE-US-00002 Temperature Time Cycles 98° C. 60 sec 1 98° C. 10 sec 28 63° C. 15 sec 68° C. 3 min 68° C. 5 min 1

    [0032] After amplification was completed, Qubit dsDNA BR reagent (ThermoFisher, Cat # Q32850) was used to determine DNA concentration on a Qubit 3 Fluoromter (ThermoFisher, Cat # Q33216), and ddH.sub.2O was used to dilute the amplification product to 100 ng/μl. The PCR amplification product was verified with a DNA agarose gel (FIG. 2).

    Step 2: Construction of the Dumbbell-Shaped DNA Library Using a Thermostable RNA Ligase.

    [0033] The reaction system was prepared as indicated in the following table.

    TABLE-US-00003 PCR products (100 ng/ul) 10.0 μl CircLigase II 10xReaction Buffer 2.0 μl MnCl.sub.2 (50 mM) 1.0 μl Betaine (5M) 4.0 μl ddH.sub.2O 2.0 μl CircLigase II ssDNA Ligase (100 U) (Lucigen, CL9021K) 1.0 μl
    On a PCR instrument, the reaction system was reacted at 60° C. for 1 hour.

    Step 3: Purification of the Dumbbell-Shaped DNA.

    [0034] After step 2 was completed, 0.6× Ampure PB magnetic beads (Pacbio, Cat #100-265-900) were used to purify twice according to the manufacturer's instruction, and finally, 10 μl Elution Buffer was used for DNA elution. The obtained DNA Elution Solution is the target DNA dumbbell-shaped DNA library. The DNA concentration determined on a Qubit 3 Fluoromter (ThermoFisher, Cat # Q33216) using Qubit dsDNA HS reagent (ThermoFisher, Cat # Q32851) was 43.4 ng/μl.

    Step 4: Preparation of a PacBio Sequencing Library.

    1) Annealing a Sequencing Primer to the Dumbbell-Shaped DNA.

    [0035] The reaction system was prepared as indicated in following table.

    TABLE-US-00004 Step 3 dumbbell-shaped DNA library 6.0 μl (83.4 ng/μl) Sequencing Primer (100 uM) 1.0 μl 5-CAGCAAACTGTTT-3 (SEQ ID NO: 3) (underlined and bolded bases were 2′ methoxy modified) TrisHCl (10 mM, pH8.0) 3.0 μl
    On the PCR instrument, the amplification was performed under the following conditions:

    TABLE-US-00005 Temperature Time Cycles 98° C. 60 sec 1 95° C. 3 min 1 70° C. 5 min 1 65° C. 5 min 1 60° C. 5 min 1 55° C. 5 min 1 50° C. 5 min 1 45° C. 5 min 1 40° C. 5 min 1 35° C. 5 min 1 30° C. 5 min 1 25° C. 5 min 1 4° C. Forever 1

    [0036] As the reaction was completed, 1.5× Ampure PB magnetic beads (PacBio, Cat #100-265-900) were used to purify twice according to the manufacturer's instruction and the DNA was finally eluted with 10 ul Elution Buffer.

    2) Sequencing Polymerase Binding Reaction.

    [0037] The reaction system was prepared according to the following table, in which the reagents were obtained from Sequel II Binding and Internal Control 1.0 Kit (PacBio, Cat #101-731-100):

    TABLE-US-00006 Sequel Binding Buffer 40 μl DTT 20 μl Sequel dNTP 20 μl Step 1) annealed product 6 μl Sequel II Polymerase 1.0 6 μl Total reaction volume 92 μl

    [0038] The reaction system was reacted at 30° C. for 1 hour on the PCR instrument, and then placed at 4° C. to form a PacBio sequencing library.

    3) Purifying the PacBio Sequencing Library.

    [0039] 92 μl Ampure PB magnetic beads (PacBio, Cat #100-265-900) were added to the product of 2). Then, the PacBio sequencing library was purified according to the instructions of the PacBio SMRT 8.0, and finally was eluted by 101.1 μl Complex Dilution Buffer.

    4) Sequencing the PacBio Library.

    [0040] 98.5 μl of the purified library in step 3) was added to 3.8 μl of Diluted Internal Control from Sequel II Binding and Internal Control 1.0 Kit (PacBio, Cat #101-731-100), 11.5 μl DTT and 1.2 μl Sequel Additive. After mixing evenly, the product was tested on Sequel II platform using SMRT Cell 8M sequencing chip (PacBio, Cat #101-389-001) and the sequencing reagent (PacBio, Cat #101-768-000), with CCS mode for 15 hours.

    Step 5: Analysis of Sequencing Results.

    [0041] Representative sequencing results are presented in FIG. 3. The sample detected by The disclosure is a heterozygous mutation of HBB gene IVS-II-654 (C-T), which is consistent with the Sanger sequencing result.

    [0042] It should be noted that although the above examples elucidate some features of The disclosure, they are not intend to limit the disclosure. Those skilled in the art know there can be various modifications and changes. The reaction reagents, reaction conditions and others involved in PacBio sequencing library construction can be adjusted and changed according to specific needs. Therefore, for those skilled in the art, without departing from the concept and principle of The disclosure, several simple substitutions can be made, and these should all be included within the protection scope of The disclosure.

    REFERENCES

    [0043] [1]Roberts R J, et al. The advantages of SMRT sequencing. Genome Biol. 2013 Jul. 3; 14(7):405. Erratum in: Genome Biol. 2017 Aug. 16; 18(1):156. doi: 10.1186/gb-2013-14-6-405. [0044] [2] Jain M, et al. Nanopore sequencing and assembly of a human genome with ultra-long reads. Nat Biotechnol. 2018 April; 36(4):338-345. doi: 10.1038/nbt.4060. [0045] [3] Thompson J F, et al. Single molecule sequencing with a HeliScope genetic analysis system. Curr Protoc Mol Biol. 2010 October; Chapter 7:Unit7.10. [0046] [4] Blondal T, et al. Isolation and characterization of a thermostable RNA ligase 1 from a Thermus scotoductus bacteriophage TS2126 with good single-stranded DNA ligation properties. Nucleic Acids Res. 2005 Jan. 7; 33(1):135-42. doi: 10.1093/nar/gki149. [0047] [5] Blondal T, et al. Discovery and characterization of a thermostable bacteriophage RNA ligase homologous to T4 RNA ligase 1. Nucleic Acids Res. 2003 Dec. 15; 31(24):7247-54. doi:10.1093/nar/gkg914. [0048] [6] Torchia C, et al. Archaeal RNA ligase is a homodimeric protein that catalyzes intramolecular ligation of single-stranded RNA and DNA. Nucleic Acids Res. 2008 November; 36(19): 6218-6227. doi:10.1093/nar/gkn602.

    [0049] [7] Altan-Bonnet G, et al. Bubble Dynamics in Double-Stranded DNA. Phys Rev Lett. 2003 Apr. 4; 90(13): 138101. doi: 10.1103/PhysRevLett.90.138101.