ATP-INDEPENDENT BIOLUMINESCENT REPORTER VARIANTS TO IMPROVE IN VIVO IMAGING
20220259574 · 2022-08-18
Inventors
Cpc classification
C12Y113/12005
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
C12N9/0069
CHEMISTRY; METALLURGY
International classification
C12N15/63
CHEMISTRY; METALLURGY
Abstract
Provided herein are chemically modified luciferase substrates for spectrally shifted emission and enhanced water solubility. Provided herein are engineered luciferases. Moreover, provided herein are new ATP-independent bioluminescent reporters which have improved biochemical and photophysical properties and are expected to have broad applications. Finally, provided herein are spectral-resolved triple-color bioluminescent systems, suitable for flexible and convenient approaches to monitor multiple biological events in either qualitative or quantitative manners
Claims
1. A bioluminescent protein, comprising a substituted luciferase polypeptide comprising an amino acid sequence having at least 90% homology to SEQ ID NO: 2 with amino acid substitutions at one or more of positions corresponding to positions 4, 18, 19, 27, 28, 67, 71, 85, 90, 112, 119 and 136 of SEQ ID NO: 2.
2. The bioluminescent protein of claim 1, comprising amino acid substitutions at positions corresponding to positions 18, 19, 27 and 28, and further comprising one or more amino acid substitutions at one or more of positions corresponding to positions 4, 67, 71, 85, 90, 112, 119 and 136 of SEQ ID NO: 2.
3. The bioluminescent protein of claim 1, comprising an amino acid sequence having at least 95% homology to SEQ ID NO: 2 with amino acid substitutions at least eight positions selected from positions corresponding to positions 4, 18, 19, 27, 28, 67, 71, 85, 90, 112, 119 and 136 of SEQ ID NO: 2.
4. The bioluminescent protein of claim 1, wherein the luciferase polypeptide is substituted at positions corresponding to positions 4, 18, 19, 27, 28, 67, 71, 85, 90, 112, 119 and 136 of SEQ ID NO: 2.
5. The bioluminescent protein of claim 1, wherein the luciferase polypeptide comprises SEQ ID NO: 3.
6. The bioluminescent protein of claim 1, further comprising a fluorescent protein connected to the substituted luciferase polypeptide.
7. The bioluminescent protein of claim 6, wherein the fluorescent protein is connected to the substituted luciferase polypeptide so as to allow bioluminescence resonant energy transfer (BRET) between the substituted luciferase polypeptide and the fluorescent protein.
8. The bioluminescent protein of claim 6, wherein the substituted luciferase polypeptide comprises an amino acid sequence having at least 90% homology to SEQ ID NO: 5.
9. The bioluminescent protein of claim 6, wherein the substituted luciferase polypeptide comprises the amino acid sequence of SEQ ID NO: 5.
10. A bioluminescent protein comprising an amino acid sequence selected from the group consisting of an amino acid sequence having at least 90% homology to SEQ ID NO: 6; an amino acid sequence having at least 90% homology to SEQ ID NO: 8; an amino acid sequence having at least 90% homology to SEQ ID NO: 10; and an amino acid sequence having at least 90% homology to SEQ ID NO: 12.
11.-13. (canceled)
14. A nucleic acid encoding the bioluminescent protein of claim 1.
15. A vector encoding the nucleic acid of claim 14.
16. An expression vector encoding the nucleic acid of claim 14 functionally connected to a promoter.
17. A cell line containing the expression vector of claim 16 and expressing the bioluminescent protein.
18. A non-human cell transfected with the expression vector of claim 16 and expressing the bioluminescent protein.
19. A combination comprising a bioluminescent protein of claim 1 and a luciferin.
20. The combination of claim 19, wherein the luciferin comprises a luciferin selected from pyCTZ, 6pyDTZ, and 8pyDTZ.
21. A method of producing luminescence, comprising reacting a luciferin with the bioluminescent protein of claim 1.
22. The method of claim 21, wherein the bioluminescent protein further comprises a fluorescent protein connected to the substituted luciferase polypeptide so as to allow BRET activity between the substituted luciferase polypeptide and the fluorescent protein.
23.-57. (canceled)
Description
BRIEF DESCRIPTION OF THE FIGURES
[0022] The presently disclosed subject matter can be better understood by referring to the following figures. The components in the figures are not necessarily to scale, emphasis instead being placed upon illustrating the principles of the presently disclosed subject matter (often schematically). In the figures, like reference numerals designate corresponding parts throughout the different views. A further understanding of the presently disclosed subject matter can be obtained by reference to an embodiment set forth in the illustrations of the accompanying drawings. Although the illustrated embodiment is merely exemplary of systems for carrying out the presently disclosed subject matter, both the organization and method of operation of the presently disclosed subject matter, in general, together with further objectives and advantages thereof, can be more easily understood by reference to the drawings and the following description. The drawings are not intended to limit the scope of this presently disclosed subject matter, which is set forth with particularity in the claims as appended or as subsequently amended, but merely to clarify and exemplify the presently disclosed subject matter.
[0023] Like numbers refer to like elements throughout. In the figures, the thickness of certain lines, layers, components, elements or features can be exaggerated for clarity. Where used, broken lines illustrate optional features or operations unless specified otherwise. For a more complete understanding of the presently disclosed subject matter, reference is now made to the below drawings.
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
DETAILED DESCRIPTION
[0046] The presently disclosed subject matter now will be described more fully hereinafter, in which some, but not all embodiments of the presently disclosed subject matter are described. Indeed, the presently disclosed subject matter can be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements.
I. General Considerations
[0047] Provided herein are chemically modified luciferase substrates, namely coelenterazine (CTZ) and diphenylterazine (DTZ), for spectrally shifted emission and enhanced water solubility. Concurrently, teLuc was engineered into a LumiLuc luciferase, which is highly active toward the new modified substrates for intense blue, teal, and yellow emission. Moreover, provided herein is a new reporter, LumiScarlet, with significant emission longer than 600 nm. The disclosed multipronged approach yielded a new family of ATP-independent bioluminescent reporters, which have improved biochemical and photophysical properties and are expected to have broad applications.
[0048] To elaborate, a series of pyridyl CTZ and DTZ analogs, or luciferin compounds, with diverse emission profiles were prepared. The water solubility of these synthetic analogs generally increased by about 10-fold from their ancestors. Surprisingly, these substrate analogs can not only be paired with the new luciferases engineered herein, but also existing ATP-independent reporters, such as RLuc and aequorin.
[0049] Such luciferin compounds, as described further herein, can include the following structure:
##STR00001##
wherein R6 is selected from
##STR00002##
wherein R8 is selected from
##STR00003##
and wherein R2 is selected from
##STR00004##
[0050] More particularly, the luciferin compounds include:
##STR00005## ##STR00006##
[0051] Methods of making luciferin compounds are provided herein, and comprise making one or more pyridyl isomer substitutions at a C-2, C-6 and C-8 position of an imidazopyrazinone core according to the following chemical synthetic route:
##STR00007##
wherein step (a) comprises Suzuki coupling, comprising Pd(PPh.sub.3).sub.4, Na.sub.2CO.sub.3, R.sub.8—B(OH).sub.2, and/or EtOH; step (b) comprises Negishi coupling, comprising PhCH.sub.2MgCl, ZnCl.sub.2, (PPh.sub.3).sub.2PdCl.sub.2, and/or THF; step (c) comprises Suzuki coupling, comprising XPhos-Pd-G2, Na.sub.2CO.sub.3, R.sub.6—B(OH).sub.2, and/or EtOH; and step (d) comprises acid-catalyzed ring closing, comprising corresponding a-ketoacetal, HCl, and/or dioxane.
[0052] Disclosed herein are luciferin compounds consisting of pyOMeCTZ, pyDTZ and AkaLumine, which comprise the following chemical structures:
##STR00008##
[0053] Moreover, the LumiLuc luciferase provided herein can in some embodiments comprise a substituted teLuc luciferase, including up to twelve substitutions, as discussed further hereinbelow. In some aspects, a fluorescent protein can be connected to the substituted luciferase polypeptides so as to allow bioluminescence resonant energy transfer (BRET) between the substituted luciferase polypeptide and the fluorescent protein.
[0054] Engineered luciferases provided herein, also referred to as bioluminescent proteins, include LumiLuc (SEQ ID NO. 3), LumiScarlet (SEQ ID NOs. 4 and 5), OpyLuc (SEQ ID NO. 6), teScarlet (SEQ ID NOs. 7 and 8), LumiCameleon1 (SEQ ID NOs. 9 and 10), and LumiCameleon2 (SEQ ID NOs. 11 and 12). Additional luciferases are also provided as follows: NanoLuc (SEQ ID NO. 1), teLuc (SEQ ID NO. 2), RLuc8 (SEQ ID NOs. 13 and 14), Akaluc (SEQ ID NOs. 15 and 16), NanoKAZ (SEQ ID NO. 17), and yeLuc (SEQ ID NO. 18).
[0055] In addition, provided herein are engineered mutually orthogonal luciferase-luciferin pairs for multiplexed cell-based bioluminescence (BL) assays. Disclosed triple-color BL systems feature the selectivity of synthetic substrates and production of well separated emission spectra from about 400 nm to about 650 nm. The disclosed spectral-resolved triple-color BL systems provide flexible and convenient approaches to monitor multiple biological events in either qualitative or quantitative manners.
[0056] New bioluminescent Ca.sup.2+ biosensors were also developed based on the modified luciferase compounds disclosed herein. These bioluminescent Ca.sup.2+ biosensors showed large bioluminescence increase in response to Ca.sup.2+, making them well suited for in vivo and in vitro applications.
[0057] The disclosed luciferase-luciferin pairs can also be used for in vivo monitoring of tumor models. For example, bioluminescence can be monitored in a tumor model by administering to that model, or otherwise establishing in the model, a luciferase expressing cell (e.g. a tumor cell expressing LumiLuc, teLuc, RLuc8 and OpyLuc), and administering to the model a luciferin (e.g. pyCTZ, pyOHCTZ, pyOMeCTZ, pyOEtCTZ, pyiPrCTZ, 2pyDTZ, 6pyDTZ, 6opyDTZ or 8pyDTZ). Using these luciferase-luciferin pairs as reporter systems the bioluminescence can be used as a tool to monitor the tumor.
[0058] The present disclosure provides for the use of the new luciferase-luciferin pairs for assays of cell signaling pathways. By way of example and not limitation, the disclosed luciferase-luciferin pairs can allow for the monitoring of particular cell signaling pathways, which can be implemented to for candidate compound and drug screening applications.
II. Definitions
[0059] While the following terms are believed to be well understood by one of ordinary skill in the art, the following definitions are set forth to facilitate explanation of the presently disclosed subject matter.
[0060] All technical and scientific terms used herein, unless otherwise defined below, are intended to have the same meaning as commonly understood by one of ordinary skill in the art. Mention of techniques employed herein are intended to refer to the techniques as commonly understood in the art, including variations on those techniques or substitutions of equivalent techniques that would be apparent to one of skill in the art. Thus, unless defined otherwise, all technical and scientific terms and any acronyms used herein have the same meanings as commonly understood by one of ordinary skill in the art in the field of the presently disclosed subject matter. Although any compositions, methods, kits, and means for communicating information similar or equivalent to those described herein can be used to practice the presently disclosed subject matter, particular compositions, methods, kits, and means for communicating information are described herein. It is understood that the particular compositions, methods, kits, and means for communicating information described herein are exemplary only and the presently disclosed subject matter is not intended to be limited to just those embodiments.
[0061] Following long-standing patent law convention, the terms “a”, “an”, and “the” refer to “one or more” when used in this application, including the claims. Thus, in some embodiments the phrase “a peptide” refers to one or more peptides.
[0062] The term “about”, as used herein to refer to a measurable value such as an amount of weight, time, dose, etc., is meant to encompass in some embodiments variations of ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, in some embodiments ±0.1%, and in some embodiments ±0.01% from the specified amount, as such variations are appropriate to perform the disclosed methods.
[0063] As used herein, the term “and/or” when used in the context of a list of entities, refers to the entities being present singly or in any and every possible combination and subcombination. Thus, for example, the phrase “A, B, C, and/or D” includes A, B, C, and D individually, but also includes any and all combinations and subcombinations of A, B, C, and D. It is further understood that for each instance wherein multiple possible options are listed for a given element (i.e., for all “Markush Groups” and similar listings of optional components for any element), in some embodiments the optional components can be present singly or in any combination or subcombination of the optional components. It is implicit in these forms of lists that each and every combination and subcombination is envisioned and that each such combination or subcombination has not been listed simply merely for convenience. Additionally, it is further understood that all recitations of “or” are to be interpreted as “and/or” unless the context clearly requires that listed components be considered only in the alternative (e.g., if the components would be mutually exclusive in a given context and/or could not be employed in combination with each other).
[0064] As used herein, the term “subject” refers to an individual (e.g., human, animal, or other organism) to be treated by the methods or compositions of the present invention. Subjects include, but are not limited to, mammals (e.g., murines, simians, equines, bovines, porcines, canines, felines, and the like), and includes humans. In the context of the invention, the term “subject” generally refers to an individual who will receive or who has received treatment for a condition characterized by the presence of bacteria (e.g., Bacillus anthracis (e.g., in any stage of its growth cycle), or in anticipation of possible exposure to bacteria. As used herein, the terms “subject” and “patient” are used interchangeably, unless otherwise noted.
[0065] As used herein, the terms “effective amount” and “therapeutically effective amount” are used interchangeably and refer to the amount that provides a therapeutic effect, e.g., an amount of a composition that is effective to treat or prevent pathological conditions, including signs and/or symptoms of disease, associated with a pathogenic organism infection (e.g., spore germination, bacterial growth, toxin production, etc.) in a subject.
[0066] As used herein, the term “adjuvant” as used herein refers to an agent which enhances the pharmaceutical effect of another agent.
[0067] The expression “amino acid” as used herein is meant to include both natural and synthetic amino acids, and both
[0068] The term “amino acid” is used interchangeably with “amino acid residue”, and can refer to a free amino acid and to an amino acid residue of a peptide. It will be apparent from the context in which the term is used whether it refers to a free amino acid or a residue of a peptide.
[0069] The term “antibody”, as used herein, refers to an immunoglobulin molecule which is able to specifically bind to a specific epitope on an antigen. Antibodies can be derived from natural sources or from recombinant sources and can be intact immunoglobulins or immunoreactive portions of intact immunoglobulins (for example, a fragment or derivative of an antibody that includes an antigen-binding site or a paratope). Antibodies are typically tetramers of immunoglobulin molecules. The antibodies in the present invention can exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab).sub.2, as well as single chain antibodies and humanized antibodies (see e.g., Harlow & Lane (1999) Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., United States of America; Harlow & Lane (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., United States of America; Houston et al. (1988) Proc Natl Acad Sci U S A 85:5879-5883; Bird et al. (1988) Science 242:423-426; each of which is incorporated herein by reference in its entirety).
[0070] The term “synthetic antibody” as used herein refers to an antibody which is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage or a host cell. The term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence technology which is available and well known in the art.
[0071] As used herein, the term “antisense oligonucleotide” means a nucleic acid polymer, at least a portion of which is complementary to a nucleic acid which is present in a normal cell or in an affected cell. The antisense oligonucleotides of the invention include, but are not limited to, phosphorothioate oligonucleotides and other modifications of oligonucleotides. Methods for synthesizing oligonucleotides, phosphorothioate oligonucleotides, and otherwise modified oligonucleotides are well known in the art (see e.g., U.S. Pat. No. 5,034,506 to Summerton and Weller; Nielsen et al. (1991) Science 254:1497-1500). The term “antisense” refers particularly to the nucleic acid sequence of the non-coding strand of a double stranded DNA molecule encoding a protein, or to a sequence which is substantially homologous to the non-coding strand. As defined herein, an antisense sequence is complementary to the sequence of a double stranded DNA molecule encoding a protein. It is not necessary that the antisense sequence be complementary solely to the coding portion of the coding strand of the DNA molecule. The antisense sequence can be complementary to regulatory sequences specified on the coding strand of a DNA molecule encoding a protein, which regulatory sequences control expression of the coding sequences.
[0072] As used herein, the term “biologically active fragments” or “bioactive fragment” of a polypeptide encompasses natural or synthetic portions of the full-length protein that are capable of specific binding to their natural ligand or of performing the function of the protein.
[0073] “Complementary” refers to the broad concept of sequence complementarity between regions of two nucleic acid strands or between two regions of the same nucleic acid strand. It is known that an adenine residue of a first nucleic acid region is capable of forming specific hydrogen bonds (“base pairing”) with a residue of a second nucleic acid region which is antiparallel to the first region if the residue is thymine or uracil. As used herein, the terms “complementary” or “complementarity” are used in reference to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules. For example, for the sequence “A-G-T”, is complementary to the sequence “T-C-A.”
[0074] The term “complex”, as used herein in reference to proteins, refers to binding or interaction of two or more proteins. Complex formation or interaction can include such things as binding, changes in tertiary structure, and modification of one protein by another, such as phosphorylation.
[0075] A “compound”, as used herein, refers to any type of substance or agent that is commonly considered a chemical, drug, or a candidate for use as a drug, as well as combinations and mixtures of the above. The term compound further encompasses molecules such as peptides and nucleic acids.
[0076] As used herein, a “derivative” of a compound refers to a chemical compound that can be produced from another compound of similar structure in one or more steps, as in replacement of H by an alkyl, acyl, or amino group. Similarly, a “derivative” of a peptide (or of a polypeptide) is a compound that can be produced from or has a biological activity similar to a peptide (or a polypeptide) but that differs in the primary amino acid sequence of the peptide (or the polypeptide) to some degree. By way of example and not limitation, a derivative of a subject peptide of the presently disclosed subject matter is a peptide that has a similar although not identical primary amino acid sequence as the subject peptide (for example, has one or more amino acid substitutions) and/or that has one or more other modifications (e.g., N-terminal, C-terminal, and/or internal modifications) as compared to the subject peptide. Thus, the term “derivative” compasses the term “modified peptide” and vice versa, in the context of peptides. In some embodiments, a derivative of a peptide is a C-terminal amidated peptide.
[0077] As used herein, a “detectable marker” or a “reporter molecule” is an atom or a molecule that permits the specific detection of a compound comprising the marker in the presence of similar compounds without a marker. Detectable markers or reporter molecules include, e.g., radioactive isotopes, antigenic determinants, enzymes, nucleic acids available for hybridization, chromophores, fluorophores, chemiluminescent molecules, electrochemically detectable molecules, and molecules that provide for altered fluorescence-polarization or altered light-scattering.
[0078] A “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate.
[0079] In contrast, a “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
[0080] “Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
[0081] Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA can include introns.
[0082] As used herein, an “essentially pure” preparation of a particular protein or peptide is a preparation wherein at least about 95%, and preferably at least about 99%, by weight, of the protein or peptide in the preparation is the particular protein or peptide.
[0083] A “fragment” or “segment” is a portion of an amino acid sequence, comprising at least one amino acid of the amino acid sequence, or a portion of a nucleic acid sequence comprising at least one nucleotide. The terms “fragment” and “segment” are used interchangeably herein.
[0084] As used herein, a “functional” biological molecule is a biological molecule in a form in which it exhibits a property or activity by which it is characterized. A functional enzyme, for example, is one which exhibits the characteristic catalytic activity by which the enzyme is characterized.
[0085] The terms “formula” and “structure” are used interchangeably herein.
[0086] The term “identity” as used herein relates to the similarity between two or more sequences. Identity is measured by dividing the number of identical residues by the total number of residues and multiplying the product by 100 to achieve a percentage. Thus, two copies of exactly the same sequence have 100% identity, whereas two sequences that have amino acid deletions, additions, or substitutions relative to one another have a lower degree of identity. Those skilled in the art will recognize that several computer programs, such as those that employ algorithms such as BLAST (Basic Local Alignment Search Tool, Altschul et al. (1993) J Mol Biol 215:403-410) are available for determining sequence identity.
[0087] In some embodiments, “identity” can be expressed as a “percent identity”. As used herein, the phrase “percent identity” in the context of two nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that have in some embodiments 60%, in some embodiments 70%, in some embodiments 75%, in some embodiments 80%, in some embodiments 85%, in some embodiments 90%, in some embodiments 92%, in some embodiments 94%, in some embodiments 95%, in some embodiments 96%, in some embodiments 97%, in some embodiments 98%, in some embodiments 99%, and in some embodiments 100% nucleotide or amino acid residue identity, respectively, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. The percent identity exists in some embodiments over a region of the sequences that is at least about 50 residues in length, in some embodiments over a region of at least about 100 residues, and in some embodiments, the percent identity exists over at least about 150 residues. In some embodiments, the percent identity exists over the entire length of the sequences.
[0088] For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
[0089] Optimal alignment of sequences for comparison can be conducted, for example, by the local homology algorithm disclosed in Smith & Waterman (1981) 2 Adv Appl Math 482-489; by the homology alignment algorithm disclosed in Needleman & Wunsch (1970) 48 J Mol Biol 443-453; by the search for similarity method disclosed in Pearson & Lipman (1988) Proc Natl Acad Sci U S A 85:2444-2448; by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the GCG® WISCONSIN PACKAGE®, available from Accelrys, Inc., San Diego, Calif., United States of America), or by visual inspection. See generally, Altschul et al. (1990) 215 J Mol Biol 403-410; Ausubel et al. (2002) Short Protocols in Molecular Biology, Fifth ed. Wiley, New York, N.Y., United States of America; and Ausubel et al. (2003) Current Protocols in Molecular Biology, John Wylie & Sons, Inc, New York, N.Y., United States of America.
[0090] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al. (1990) 215 J Mol Biol 403-410. Software for performing BLAST analysis is publicly available through the website of the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold. See generally, Altschul et al. (1990) 215 J Mol Biol 403-410. These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative scoring residue alignments, or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix. See Henikoff & Henikoff (1992) 89 Proc Natl Acad Sci U S A 10915-10919.
[0091] In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see e.g., Karlin & Altschul (1993) 90 Proc Natl Acad Sci U S A 5873-5877). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is in some embodiments less than about 0.1, in some embodiments less than about 0.01, and in some embodiments less than about 0.001.
[0092] The term “inhibit”, as used herein, refers to the ability of a compound or any agent to reduce or impede a described function or pathway. For example, inhibition can be by at least 10%, by at least 25%, by at least 50%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 97%, by at least 99%, or more.
[0093] As used herein, an “instructional material” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the peptide of the invention in the kit for effecting alleviation of the various diseases or disorders recited herein. Optionally, or alternately, the instructional material can describe one or more methods of alleviating the diseases or disorders in a cell or a tissue of a mammal. The instructional material of the kit of the invention can, for example, be affixed to a container which contains the identified compound invention or be shipped together with a container which contains the identified compound. Alternatively, the instructional material can be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.
[0094] An “isolated” compound/moiety is a compound/moeity that has been removed from components naturally associated with the compound/moiety. For example, an “isolated nucleic acid” refers to a nucleic acid segment or fragment which has been separated from sequences which flank it in a naturally occurring state, e.g., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment, e.g., the sequences adjacent to the fragment in a genome in which it naturally occurs. The term also applies to nucleic acids which have been substantially purified from other components which naturally accompany the nucleic acid, e.g., RNA or DNA or proteins, which naturally accompany it in the cell. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., as a cDNA or a genomic or cDNA fragment produced by PCR or restriction enzyme digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence.
[0095] The term “modulate”, as used herein, refers to changing the level of an activity, function, or process. The term “modulate” encompasses both inhibiting and stimulating an activity, function, or process.
[0096] The term “oligonucleotide” typically refers to short polynucleotides, generally no greater than about 50 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which “U” replaces “T.”
[0097] As used herein, the term “purified” and like terms relate to an enrichment of a molecule or compound relative to other components normally associated with the molecule or compound in a native environment. The term “purified” does not necessarily indicate that complete purity of the particular molecule has been achieved during the process. A “highly purified” compound as used herein refers to a compound that is greater than 90% pure.
[0098] As used herein, the term “pharmaceutically acceptable carrier” includes any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents. The term also encompasses any of the agents approved by a regulatory agency of the US Federal government or listed in the US Pharmacopeia for use in an animal. In some embodiments, a pharmaceutically acceptable carrier is pharmaceutically acceptable for use in a human.
[0099] The term “polypeptide” refers to a polymer composed of amino acid residues, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof linked via peptide bonds, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof. Synthetic polypeptides can be synthesized, for example, using an automated polypeptide synthesizer.
[0100] The term “protein” typically refers to large polypeptides (e.g., a polypeptide of in some embodiments at least 50 amino acids, in some embodiments at least 75 amino acids, in some embodiments at least 100 amino acids, in some embodiments at least 200 amino acids, in some embodiments at least 300 amino acids, in some embodiments at least 500 amino acids, and in some embodiments more than 500 amino acids).
[0101] A peptide encompasses a sequence of 2 or more amino acids wherein the amino acids are naturally occurring or synthetic (non-naturally occurring) amino acids.
[0102] The term “linked” or like terms refers to a connection between two entities. The linkage can comprise a covalent, ionic, or hydrogen bond or other interaction that binds two compounds or substances to one another.
[0103] As used herein the term “peptidomimetic” refers to a chemical compound having a structure that is different from the general structure of an existing peptide, but that functions in a manner similar to the existing peptide, e.g., by mimicking the biological activity of that peptide. The term “modified peptide” encompasses a peptidomimetic. Peptidomimetics typically comprise naturally-occurring amino acids and/or unnatural amino acids, but can also comprise modifications to the peptide backbone. For example, a peptidomimetic can include one or more of the following modifications:
[0104] 1. Peptides wherein one or more of the peptidyl —C(O)NR— linkages (bonds) have been replaced by a non-peptidyl linkage such as a —CH.sub.2-carbamate linkage (—CH.sub.2OC(O)NR—), a phosphonate linkage, a —CH.sub.2-sulfonamide (—CH.sub.2—S(O).sub.2NR—) linkage, a urea (—NHC(O)NH—) linkage, a —CH.sub.2-secondary amine linkage, an azapeptide bond (CO substituted by NH), or an ester bond (e.g., depsipeptides, wherein one or more of the amide (—CONHR—) bonds are replaced by ester (COOR) bonds) or with an alkylated peptidyl linkage (—C(O)NR—) wherein R is C.sub.1-C.sub.6 alkyl;
[0105] 2. Peptides wherein the N-terminus is derivatized to a —NRR1 group, to a —NRC(O)R group, to a —NRC(O)OR group, to a —NRS(O).sub.2R group, to a —NHC(O)NHR group where R and R1 are hydrogen or C.sub.1-C.sub.6 alkyl with the proviso that R and R1 are not both hydrogen;
[0106] 3. Peptides wherein the C terminus is derivatized to —C(O)R2 where R2 is selected from the group consisting of C.sub.1-C.sub.6 alkoxy, and —NR3R4 where R3 and R4 are independently selected from the group consisting of hydrogen and C.sub.1-C.sub.4 alkyl;
[0107] 4. Modification of a sequence of naturally-occurring amino acids with the insertion or substitution of a non-peptide moiety, e.g., a retroinverso fragment.
[0108] The term “permeability”, as used herein, refers to transit of fluid, cell, or debris between or through cells and tissues.
[0109] A “sample”, as used herein, refers preferably to a biological sample from a subject, including, but not limited to, normal tissue samples, diseased tissue samples, biopsies, blood, saliva, feces, semen, tears, and urine. A sample can also be any other source of material obtained from a subject which contains cells, tissues, or fluid of interest. A sample can also be obtained from cell or tissue culture.
[0110] By the term “specifically binds”, as used herein, is meant a compound which recognizes and binds a specific protein, but does not substantially recognize or bind other molecules in a sample, or it means binding between two or more proteins as in part of a cellular regulatory process, where said proteins do not substantially recognize or bind other proteins in a sample.
[0111] The term “standard”, as used herein, refers to something used for comparison. For example, it can be a known standard agent or compound which is administered or added to a control sample and used for comparing results when measuring said compound in a test sample. Standard can also refer to an “internal standard”, such as an agent or compound which is added at known amounts to a sample and is useful in determining such things as purification or recovery rates when a sample is processed or subjected to purification or extraction procedures before a marker of interest is measured.
[0112] The term “symptom”, as used herein, refers to any morbid phenomenon or departure from the normal in structure, function, or sensation, experienced by the patient and indicative of disease. In contrast, a sign is objective evidence of disease. For example, a bloody nose is a sign. It is evident to the patient, doctor, nurse and other observers.
[0113] As used herein, the term “treating” includes prophylaxis of the specific disorder or condition, or alleviation of the symptoms associated with a specific disorder or condition and/or preventing or eliminating said symptoms. A “prophylactic” treatment is a treatment administered to a subject who does not exhibit signs of a disease or exhibits only early signs of the disease for the purpose of decreasing the risk of developing pathology associated with the disease.
[0114] A “therapeutic” treatment is a treatment administered to a subject who exhibits signs of pathology for the purpose of diminishing or eliminating those signs.
[0115] As used herein an “amino acid modification” refers in some embodiments to a substitution, addition, or deletion of an amino acid, and includes substitution with, or addition of, any of the 20 amino acids commonly found in human proteins, as well as unusual or non-naturally occurring amino acids such as but not limited to
[0116] Modifications (which do not normally alter primary sequence) include in vivo, or in vitro chemical derivatization of polypeptides, e.g., acetylation, or carboxylation. Also included are modifications of glycosylation, e.g., those made by modifying the glycosylation patterns of a polypeptide during its synthesis and processing or in further processing steps; e.g., by exposing the polypeptide to enzymes which affect glycosylation, e.g., mammalian glycosylating or deglycosylating enzymes. Also embraced are sequences which have phosphorylated amino acid residues, e.g., phosphotyrosine, phosphoserine, or phosphothreonine.
[0117] Also included are polypeptides which have been modified using ordinary molecular biological techniques so as to improve their resistance to proteolytic degradation or to optimize solubility properties or to render them more suitable as a therapeutic agent. Analogs of such polypeptides include those containing residues other than naturally occurring L-amino acids, e.g.,
[0118] Substitutions can be designed based on, for example, the model of Dayhoff et al. (in Atlas of Protein Sequence and Structure 1978, National Biomedical Research Foundation, Washington D.C., United States of America).
[0119] In some embodiments, an amino acid substitution is a conservative amino acid substitution. As used herein, the term “conservative amino acid substitution” is defined in some embodiments as exchanges within one of the following five groups:
[0120] I. Small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro, Gly;
[0121] II. Polar, charged residues and their amides: Asp, Asn, Glu, Gln, His, Arg, Lys;
[0122] III. Large, aliphatic, nonpolar residues: Met Leu, Ile, Val, Cys
[0123] IV. Large, aromatic residues: Phe, Tyr, Trp
[0124] Conservative substitutions are likely to be phenotypically silent. Typically seen as conservative substitutions are the replacements, one for another, among the aliphatic amino acids Ala, Val, Leu, and Ile; interchange of the hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and Glu, substitution between the amide residues Asn and Gln, exchange of the basic residues Lys and Arg and replacements among the aromatic residues Phe, Tyr. Guidance concerning which amino acid changes are likely to be phenotypically silent are found in Bowie et al. (1990) Science 247:1306-1310.
[0125] For example, the hydropathic index of amino acids may be considered (Kyte & Doolittle (1982) J Mol Biol 157:105-132). The relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules. Each amino acid has been assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics (Kyte & Doolittle (1982) J Mol Biol 157:105-132), these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (−0.4); threonine (−0.7); serine (−0.8); tryptophan (−0.9); tyrosine (−1.3); proline (−1.6); histidine (−3.2); glutamate (−3.5); glutamine (−3.5); aspartate (−3.5); asparagine (−3.5); lysine (−3.9); and arginine (−4.5). In making conservative substitutions, the use of amino acids whose hydropathic indices are within +/−2 is preferred, within +/−1 are more preferred, and within +/−0.5 are even more preferred.
[0126] Amino acid substitution may also take into account the hydrophilicity of the amino acid residue (e.g., U.S. Pat. No. 4,554,101). Hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0); glutamate (+3.0); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (−0.4); proline (−0.5.+−0.1); alanine (−0.5); histidine (−0.5); cysteine (−1.0); methionine (−1.3); valine (−1.5); leucine (−1.8); isoleucine (−1.8); tyrosine (−2.3); phenylalanine (−2.5); tryptophan (−3.4). Replacement of amino acids with others of similar hydrophilicity is preferred.
[0127] Other considerations include the size of the amino acid side chain. For example, in some embodiments an amino acid with a compact side chain, such as glycine or serine, would not be replaced with an amino acid with a bulky side chain, e.g., tryptophan or tyrosine. The effect of various amino acid residues on protein secondary structure is also a consideration. Through empirical study, the effect of different amino acid residues on the tendency of protein domains to adopt an alpha-helical, beta-sheet, or reverse turn secondary structure has been determined and is known in the art (see e.g., Chou & Fasman (1974) Biochemistry 13:222-245; Chou & Fasman (1978) Ann Rev Biochem 47: 251-276; Chou & Fasman (1979) Biophys J 26:367-384).
[0128] Based on such considerations and extensive empirical study, tables of conservative amino acid substitutions have been constructed and are known in the art. By way of example and not limitation, the following substitutions can be made: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Alternatively, Table 1 lists exemplary conservative amino acid substitutions.
TABLE-US-00001 TABLE 1 Exemplary Conservative Amino Acid Substitutions Amino Acid Possible Substitution(s) Ala (A) Leu, Ile, Val Arg (R) Gln, Asn, Lys Asn (N) His, Asp, Lys, Arg, Gln Asp (D) Asn, Glu Cys (C) Ala, Ser Gln (Q) Glu, Asn Glu (E) Gln, Asp Gly (G) Ala His (H) Asn, Gln, Lys, Arg Ile (I) Val, Met, Ala, Phe, Leu Leu (L) Val, Met, Ala, Phe, Ile Lys (K) Gln, Asn, Arg Met (M) Phe, Ile, Leu Phe (F) Leu, Val, Ile, Ala, Tyr Pro (P) Ala Ser (S) Thr Thr (T) Ser Trp (W) Phe, Tyr Tyr (Y) Trp, Phe, Thr, Ser Val (V) Ile, Leu, Met, Phe, Ala
[0129] As used herein, amino acids are represented by the full name thereof, by the three letter code corresponding thereto, or by the one-letter code corresponding thereto, as indicated in the following table (Table 1A):
TABLE-US-00002 TABLE 1A Functionally 3-Letter 1-Letter Equivalent Full Name Code Code Codons Aspartic Acid Asp D GAC GAU Glutamic Acid Glu E GAA GAG Lysine Lys K AAA AAG Arginine Arg R AGA AGG CGA CGC CGG CGU Histidine His H CAC CAU Tyrosine Tyr Y UAC UAU Cysteine Cys C UGC UGU Asparagine Asn N AAC AAU Glutamine Gln Q CAA CAG Serine Ser S ACG AGU UCA UCC UCG UCU Threonine Thr T ACA ACC ACG ACU Glycine Gly G GGA GGC GGG GGU Alanine Ala A GCA GCC GCG GCU Valine Val V GUA GUC GUG GUU Leucine Leu L UUA UUG CUA CUC CUG CUU Isoleucine Ile I AUA AUC AUU Methionine Met M AUG Proline Pro P CCA CCC CCG CCU Phenylalanine Phe F UUC UUU Tryptophan Trp W UGG
[0130] In some embodiments, another consideration for amino acid substitutions include whether or not the residue is located in the interior of a protein or is solvent exposed. For interior residues, conservative substitutions can include in some embodiments: Asp and Asn; Ser and Thr; Ser and Ala; Thr and Ala; Ala and Gly; Ile and Val; Val and Leu; Leu and Ile; Leu and Met; Phe and Tyr; Tyr and Trp. For solvent exposed residues, conservative substitutions can include in some embodiments: Asp and Asn; Asp and Glu; Glu and Gln; Glu and Ala; Gly and Asn; Ala and Pro; Ala and Gly; Ala and Ser; Ala and Lys; Ser and Thr; Lys and Arg; Val and Leu; Leu and Ile; Ile and Val; Phe and Tyr. Various matrices have been constructed to assist in selection of amino acid substitutions, such as the PAM250 scoring matrix, the Dayhoff matrix, the Grantham matrix, the McLachlan matrix, the Doolittle matrix, the Henikoff matrix, the Miyata matrix, the Fitch matrix, the Jones matrix, the Rao matrix, the Levin matrix, and the Risler matrix (summarized in, for example, Johnson & Overington (1993) J Mol Biol 233:716-738; see also the PROWL resource available at the website of The Rockefeller University, New York, N.Y., United States of America).
[0131] In determining amino acid substitutions, one may also consider the existence of intermolecular or intramolecular bonds, such as formation of ionic bonds (salt bridges) between positively charged residues (e.g., His, Arg, Lys) and negatively charged residues (e.g., Asp, Glu) or disulfide bonds between nearby cysteine residues.
[0132] Methods of substituting any amino acid for any other amino acid in an encoded peptide sequence are well known and a matter of routine experimentation for the skilled artisan, for example by the technique of site-directed mutagenesis or by synthesis and assembly of oligonucleotides encoding an amino acid substitution and splicing into an expression vector construct.
EXAMPLES
[0133] The following Examples provide illustrative embodiments. In light of the present disclosure and the general level of skill in the art, those of skill will appreciate that the following Examples are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently disclosed subject matter.
Materials and Methods for Examples 1-5
[0134] Synthetic DNA oligonucleotides were purchased from Integrated DNA Technologies. Restriction endonucleases were purchased from Thermo Fisher Scientific. Q5 high-fidelity DNA polymerase and Taq DNA polymerase were purchased from NEB. Products of PCR and restriction digestion were purified by gel electrophoresis and Syd Laboratories Gel Extraction columns. Plasmid DNA was purified using Syd Laboratories Miniprep columns. DNA sequences were analyzed by Eurofins. Potassium
Chemical Synthesis of Compounds
5-bromo-3-phenylpyrazin-2-amine (1a)
[0135] ##STR00009##
[0136] To a solution of Pd(PPh.sub.3).sub.4 (460 mg, 0.4 mmol, 0.1 equiv.) in 200 mL EtOH was added 2-Amino-3,5-dibromopyrazine (1010 mg, 4 mmol, 1 equiv.), 1N Na.sub.2CO.sub.3 solution (8 mL, 8 mmol, 2 equiv.) and phenylboronic acid (490 mg, 4 mmol, 1 equiv.). The resultant mixture was stirred at 80° C. under argon for 12 h. The solvent was removed in vacuo and the residue was suspended in 200 mL ddH.sub.2O, which was extracted twice with EtOAc (200 mL). The organic layers were combined and dried over anhydrous Na.sub.2SO.sub.4, filtered and removed in vacuo. The residue was purified by silica column chromatography with elution (DCM:MeOH=100:1) to yield compound 1a (above) as yellow solid (360 mg, 36%). .sup.1H NMR (600 MHz, CDCl.sub.3) δ 8.07 (s, 1H), 7.71 (d, J=7.4 Hz, 2H), 7.50 (t, J=7.4 Hz, 2H), 7.45 (t, J=7.4 Hz, 1H), 4.82 (s, 2H). .sup.13C NMR (151 MHz, DMSO-d.sub.6) δ 152.4, 142.4, 139.3, 135.9, 129.2, 128.8, 128.7, 128.1, 127.9, 123.9. HRMS (ESI-TOF) calcd for C.sub.10H.sub.8BrN.sub.3 [M+H].sup.+: 249.9902, found: m/z 249.9916.
5-bromo-3-(pyridin-4-yl)pyrazin-2-amine (1b)
[0137] ##STR00010##
[0138] The synthesis of 1b (above) followed the same procedure as 1a, whereas 4-pyridylboronic acid (492 mg, 4 mmol, 1 equiv.) was used. Crude 1b was purified by column chromatography with elution (DCM:MeOH=10:1) to yield 1b as yellow solid (301 mg, 30%). .sup.1H NMR (600 MHz, DMSO-d.sub.6) δ 8.69 (d, J=6.0 Hz, 2H), 8.17 (s, 1H), 7.67 (d, J=6.0 Hz, 2H), 6.68 (s, 2H). .sup.13C NMR (151 MHz, DMSO-d.sub.6) δ 152.6, 150.1, 144.1, 143.3, 136.1, 124.0, 122.4. HRMS (ESI-TOF) calcd for C.sub.9H.sub.7BrN.sub.4 [M+H].sup.+: 250.9854, found: m/z 250.9845.
3-benzyl-5-phenylpyrazin-2-amine (2a)
[0139] ##STR00011##
[0140] 2a (above) was prepared following the published synthesis methods.sup.35. .sup.1H NMR (600 MHz, DMSO-d.sub.6) δ 8.41 (s, 1H), 7.89 (d, J=7.4 Hz, 2H), 7.39 (t, J=7.7 Hz, 2H), 7.33 (d, J=7.6 Hz, 2H), 7.27 (q, J=7.7, 7.1 Hz, 3H), 7.18 (t, J=7.3 Hz, 1H), 6.39 (s, 2H), 4.07 (s, 2H). .sup.13C NMR (150 MHz, DMSO-d.sub.6) δ 153.2, 140.5, 139.2, 138.6, 137.6, 137.4, 129.4, 129.1, 128.7, 127.8, 126.6, 125.2, 39.1. HRMS (ESI-TOF) calcd for C.sub.17H.sub.15N.sub.3 [M+H].sup.+: 262.1266, found: m/z 262.1258.
3,5-diphenylpyrazin-2-amine (2b)
[0141] ##STR00012##
[0142] 2b was reported previously.sup.33.
5-phenyl-3-(pyridin-4-yl)pyrazin-2-amine (2c)
[0143] ##STR00013##
[0144] The synthesis and purification of 2c (above) followed the same procedure as 2d, whereas 1b was used as the starting compound and phenylboronic acid (245 mg, 2 mmol, 2 equiv.) was used as boron reagent. Yellow solid (87 mg, 70%). .sup.1H NMR (600 MHz, DMSO-d.sub.6) δ 7.88-7.84 (m, 2H), 7.70 (s, 1H), 7.15 (dt, J=7.8, 1.2 Hz, 2H), 7.12-7.08 (m, 2H), 6.65-6.59 (m, 2H), 6.57-6.51 (m, 1H). .sup.13C NMR (150 MHz, DMSO-d.sub.6) δ 152.3, 150.1, 144.9, 140.0, 139.4, 136.6, 134.7, 128.8, 127.9, 125.0, 122.7. HRMS (ESI-TOF) calcd for C.sub.15H.sub.12N.sub.4 [M+H].sup.+: 249.1062, found: m/z 249.1059.
3-phenyl-5-(pyridin-4-yl)pyrazin-2-amine (2d)
[0145] ##STR00014##
[0146] To a mixture of XPhos Pd G2 (79 mg, 0.1 mmol, 0.2 equiv.) and XPhos (24 mg, 0.05 mmol, 0.1 equiv.) in 5 mL EtOH was added 1a (125 mg, 0.5 mmol, 1 euiqv.), 1N Na.sub.2CO.sub.3 (1 mL, 1 mmol, 2 equiv.) and 4-pyridylboronic acid (246 mg, 2 mmol, 4 equiv.). The resulting mixture was stirred at 80° C. under argon for 12 h. The solvent was then removed in vacuo and the residue was dissolved in 1N HCl (30 mL) and subsequently washed with EtOAc (30 mL). The aqueous layer was collected and the pH was then adjusted to 10 by the addition of 1N NaOH. Product 2d precipitated as yellow solid, which was filtered, washed with EtOAc and dried under reduced pressure overnight. (93 mg, 75%). .sup.1H NMR (600 MHz, DMSO-d.sub.6) δ 8.71 (s, 1H), 8.58 (d, J=6.2 Hz, 2H), 7.94 (d, J=6.2 Hz, 2H), 7.78 (d, J=7.2 Hz, 2H), 7.52 (t, J=7.5 Hz, 2H), 7.46 (t, J=7.3 Hz, 1H), 6.63 (s, 2H). .sup.13C NMR (150 MHz, DMSO-d.sub.6) δ 153.3, 150.1, 144.0, 139.2, 138.6, 137.1, 128.8, 128.2, 119.0. HRMS (ESI-TOF) calcd for C.sub.15H.sub.12N.sub.4 [M+H].sup.+: 249.1062, found: m/z 249.1060.
4-(5-amino-6-benzylpyrazin-2-yl)phenol (2e)
[0147] ##STR00015##
[0148] 2e (above) was prepared following the published synthesis methods.sup.36. .sup.1H NMR (600 MHz, DMSO-d.sub.6) δ 9.49 (s, 1H), 8.29 (s, 1H), 7.72 (d, J=8.6 Hz, 2H), 7.33 (d, J=7.3 Hz, 2H), 7.28 (t, J=7.6 Hz, 2H), 7.18 (t, J=7.3 Hz, 1H), 6.79 (d, J=8.6 Hz, 2H), 6.19 (s, 2H), 4.06 (s, 2H). .sup.13C NMR (150 MHz, DMSO-d.sub.6) δ 157.1, 152.0, 139.7, 139.5, 138.3, 135.9, 135.9, 128.9,128.2,126.2, 126.1, 115.5, 115.4, 38.7. HRMS (ESI-TOF) calcd for C.sub.17H.sub.15N.sub.3O [M+H].sup.+: 278.1215, found: m/z 278.1208.
3-phenyl-5-(pyridin-3-yl)pyrazin-2-amine (2f)
[0149] ##STR00016##
[0150] The synthesis and purification of 2f (above) followed the same procedure as 2d, whereas 3-pyridylboronic acid (246 mg, 2 mmol, 4 equiv.) was used. Yellow solid (95 mg, 77%). .sup.1H NMR (600 MHz, DMSO-d.sub.6) δ 9.19 (s, 1H), 8.64 (s, 1H), 8.54 (d, J=3.9 Hz, 1H), 8.39 (d, J=8.1 Hz, 1H), 7.79 (d, J=7.3 Hz, 2H), 7.53-7.49 (m, 3H), 7.46 (t, J=7.3 Hz, 1H), 6.47 (s, 2H). .sup.13C NMR (151 MHz, DMSO-d.sub.6) δ 152.6, 148.5, 146.3, 138.4, 138.4, 137.3, 137.2, 132.6, 132.3, 132.2, 128.8, 128.6, 128.3. HRMS (ESI-TOF) calcd for C.sub.15H.sub.12N.sub.4 [M+H].sup.+: 249.1062, found: m/z 249.1060.
3-pyridin-4-yl-1,1-diethoxyacetone (4)
[0151] ##STR00017##
[0152] To a solution of 4-methylpyridine (931 mg, 10 mmol, 1 equiv.) in 50 mL anhydrous THF was added potassium tert-butoxide (5.6 g, 50 mmol, 5 equiv.), and the mixture was stirred at room temperature for 10 min. Ethyl diethoxyacetate (3.52 g, 20 mmol, 2 equiv.) in 20 mL THF was then added dropwise over 10 min. The resulting mixture was stirred overnight, and solvent was removed under vacuo. The residue was purified by silica column chromatography with elution (Hexane:EtOAc=1:3 to 100% EtOAc) to yield product as light yellow solid (669 mg, 30%). .sup.1H NMR (600 MHz, DMSO-d.sub.6) δ 8.47 (d, J=5.8 Hz, 2H), 7.18 (d, J=5.8 Hz, 2H), 4.81 (s, 1H), 3.91 (s, 2H), 3.63 (dq, J=9.7, 7.1 Hz, 2H), 3.54 (dq, J=9.7, 7.1 Hz, 2H), 1.15 (t, J=7.1 Hz, 6H). .sup.13C NMR (150 MHz, DMSO-d.sub.6) δ 202.0, 149.3, 143.2, 125.3, 101.6, 62.8, 42.6, 15.1. HRMS (ESI-TOF) calcd for C.sub.12H.sub.75NO.sub.3 [M+H].sup.+: 224.1208, found: m/z 224.1195.
8-benzyl-6-phenyl-2-(pyridin-4-ylmethyl)imidazo[1,2-a]pyrazin-3(7H)-one (3a)
[0153] ##STR00018##
[0154] To a solution of 2a (26 mg, 0.1 mmol, 1 equiv.) and 4 (89 mg, 0.4 mmol 4 equiv) in 5 mL degassed 1,4-dioxane was added 0.8 mL 6N HCl. The resulting mixture was stirred at 80° C. in a seal tube for 12 h. The solvent was then removed in vacuo and the residue was dissolved in 1 mL (ACN:H.sub.2O=1:1) and next purified with preparative RP-HPLC. (acetonitrile/water=1:99 to 90:10, 20 mL/min, UV 254 nm). Product fractions were combined and lyophilized to give 3a (above) as yellow powder (15 mg, 38%), which has to be stored as solid at −80° C. for long-term stability. .sup.1H NMR (600 MHz, Methanol-d.sub.4) δ 8.43 (d, J=6.2 Hz, 2H), 7.74 (s, 1H), 7.65 (d, J=6.8 Hz, 2H), 7.49-7.38 (m, 7H), 7.29 (t, J=7.6 Hz, 2H), 7.23 (t, J=7.4 Hz, 1H), 4.42 (s, 2H), 4.23 (s, 2H). .sup.13C NMR (150 MHz, Methanol-d.sub.4) δ 142.6, 137.9, 131.1, 130.4, 130.0, 129.9, 129.1, 128.5, 128.3, 110.1, 49.7. HRMS (ESI-TOF) calcd for C.sub.25H.sub.20N.sub.4O [M+H].sup.+: 393.1637, found: m/z 393.1630.
6,8-diphenyl-2-(pyridin-4-ylmethyl)imidazo[1,2-a]pyrazin-3(7H)-one (3b)
[0155] ##STR00019##
[0156] The synthesis and purification of 3b (above) followed the same procedure as 3a, whereas 2b (25 mg, 0.1 mmol, 1 equiv.) was used as the starting compound. Orange powder (8 mg, 21%). 1H NMR (600 MHz, Methanol-d.sub.4) δ 8.79 (d, J=6.5 Hz, 2H), 8.50 (s, 1H), 8.15 (d, J=7.2 Hz, 2H), 8.06 (d, J=6.5 Hz, 2H), 8.00 (d, J=7.4 Hz, 2H), 7.69 (t, J=7.4 Hz, 1H), 7.65 (t, J=7.2 Hz, 2H), 7.58 (t, J=7.2 Hz, 2H), 7.56-7.53 (m, 1H), 4.66 (s, 2H). .sup.13C NMR (150 MHz, Methanol-d.sub.4) δ 161.0, 146.2, 142.7, 139.3, 134.7, 133.3, 133.0, 131.3, 131.0, 130.4, 130.3, 128.8, 128.5, 112.2. HRMS (ESI-TOF) calcd for C.sub.24H.sub.18N.sub.4O [M+H].sup.+: 379.1481, found: m/z 379.1480.
2-benzyl-6-phenyl-8-(pyridin-4-yl)imidazo[1,2-a]pyrazin-3(7H)-one (3c)
[0157] ##STR00020##
[0158] To a solution of 2c (25 mg, 0.1 mmol, 1 equiv.) and 1,1-diethoxy-3-phenylpropan-2-one (89 mg, 0.4 mmol, 4 equiv.) in 5 mL degassed 1,4-dioxane was added 0.8 mL 6 N HCl, and the resulting mixture was stirred at 80° C. in a sealed tube for 12 h. The solvent was then removed in vacuo and the residue was dissolved in 1 mL (ACN:H.sub.2O=1:1) and next purified with preparative RP-HPLC. (acetonitrile/water=1:99 to 90:10, 20 mL/min, UV 254 nm). Product fractions were combined and lyophilized to give 3c (above) as brown powder (9 mg, 23%). .sup.1H NMR (600 MHz, Acetonitrile-d.sub.3 and D.sub.2O, ratio=9:1) δ 9.31 (d, J=6.8 Hz, 2H), 8.84 (d, J=6.8 Hz, 2H), 8.54 (s, 1H), 8.09 (d, J=8.0 Hz, 2H), 7.52 (t, J=7.6 Hz, 2H), 7.44 (t, J=7.3 Hz, 1H), 7.35 (d, J=7.7 Hz, 2H), 7.28 (t, J=7.7 Hz, 2H), 7.24-7.21 (m, 1H), 4.19 (s, 2H). .sup.13C NMR (150 MHz, Methanol-d.sub.4) δ 143.0, 140.7, 140.1, 139.5, 137.5, 132.0, 130.2, 129.9, 129.6, 129.4, 127.8, 127.5, 127.4, 126.5, 113.8, 33.6. HRMS (ESI-TOF) calcd for C.sub.24H.sub.18N.sub.4O [M+H].sup.+: 379.1481, found: m/z 379.1477.
2-benzyl-8-phenyl-6-(pyridin-4-yl)imidazo[1,2-a]pyrazin-3(7H)-one (3d)
[0159] ##STR00021##
[0160] The synthesis and purification of 3d (above) followed the same procedure as 3c, whereas 2d (25 mg, 0.1 mmol, 1 equiv.) was used as the starting compound. Yellow powder (6 mg, 16%). .sup.1H NMR (600 MHz, Methanol-d.sub.4) δ 9.52 (s, 1H), 9.01 (d, J=6.8 Hz, 2H), 8.97 (d, J=6.8 Hz, 2H), 8.15-8.11 (m, 2H), 7.71-7.66 (m, 3H), 7.35-7.30 (m, 7.4 Hz, 4H), 7.25 (t, J=7.4 Hz, 1H), 4.36 (s, 2H). .sup.13C NMR (150 MHz, Methanol-d.sub.4) δ 154.5, 148.8, 143.5, 140.4, 138.4, 137.2, 135.0, 133.1, 130.6, 130.4, 130.4, 130.1, 129.8, 129.5, 128.7, 128.3, 125.3, 117.2, 30.5. HRMS (ESI-TOF) calcd for C.sub.24H.sub.18N.sub.4O [M+H].sup.+: 379.1481, found: m/z 379.1476.
8-benzyl-6-(4-hydroxyphenyl)-2-(pyridin-4-ylmethyl)imidazo[1,2-a]pyrazin-3(7H)-one (3e)
[0161] ##STR00022##
[0162] The synthesis and purification of 3e (above) followed the same procedure as 3a, whereas 2e (28 mg, 0.1 mmol, 1 equiv.) was used as the starting compound. Yellow powder (14 mg, 34%). .sup.1H NMR .sup.1H NMR (600 MHz, Methanol-d.sub.4) δ 8.78 (d, J=5.2 Hz, 2H), 8.08 (d, J=5.2 Hz, 2H), 8.01 (s, 1H), 7.72 (d, J=7.7 Hz, 2H), 7.53 (d, J=7.7 Hz, 3H), 7.42 (d, J=7.4 Hz, 2H), 7.31 (t, J=7.4 Hz, 2H), 7.25 (t, J=7.7 Hz, 1H), 4.58 (s, 2H), 4.52 (s, 2H). .sup.13C NMR (150 MHz, Methanol-d.sub.4) δ 161.2, 142.6, 137.1, 130.3, 130.2, 130.1, 129.1, 128.7, 117.3, 111.3. HRMS (ESI-TOF) calcd for C.sub.25H.sub.20N.sub.4O.sub.2 [M+H].sup.+: 409.1586, found: m/z 409.1585.
2-benzyl-8-phenyl-6-(pyridin-3-yl)imidazo[1,2-a]pyrazin-3(7H)-one (3f)
[0163] ##STR00023##
[0164] The synthesis and purification of 3f (above) followed the same procedure as 3c, whereas 2f (25 mg, 0.1 mmol, 1 equiv.) was used as the starting compound. Orange powder (8 mg, 21%). .sup.1H NMR (600 MHz, Methanol-d.sub.4) δ 9.73 (s, 1H), 9.47 (d, J=8.3 Hz, 1H), 9.36 (s, 1H), 8.99 (d, J=5.6 Hz, 1H), 8.32-8.27 (m, 1H), 8.09 (d, J=6.6 Hz, 2H), 7.72-7.66 (m, 3H), 7.32 (7.67-7.30, 4H), 7.25 (t, J=7.0 Hz, 1H), 4.36 (s, 2H). .sup.13C NMR (150 MHz, Methanol-d.sub.4) δ 148.6, 145.3, 142.9, 141.5, 138.3, 137.4, 137.2, 134.8, 133.1, 130.5, 130.4, 130.1, 129.5, 129.1, 128.3, 128.2, 121.6, 114.8, 30.3. HRMS (ESI-TOF) calcd for C.sub.24H.sub.18N.sub.4O [M+H].sup.+: 379.1481, found: m/z 379.1478.
Plasmid and Library Construction
[0165] Polymerase chain reactions (PCRs) with various synthetic oligonucleotide pairs (see Table 5) were used to amplify genetic elements. To create a gene library with randomization at residues 18 and 19, oligo pairs pBAD-F and L18D19NNK-R, L18D19NNK-F and pBAD-R, were used to amplify two individual fragments from pBAD-teLuc; the corresponding products were used for assembly in a subsequent overlap PCR reaction by using oligos pBAD-F and pBAD-R. The assembled full-length fragment was digested with Xho I and Hind III restriction enzymes and ligated into a predigested, compatible pBAD/His B plasmid. Similarly, pBAD-F, 27VSSNNK-R, 27VSSNNK-F, and pBAD-R were used to create a library with randomization at residues 27, 28, and 29. To introduce random mutations across the gene, Taq DNA polymerase was used in all reactions with 0.2 mM MnCl.sub.2 along with unbalanced dNTPs to promote amplification errors. To create mammalian expression plasmids, Hindlll-pyr-F-Koz and pyr-R-XhoI were used to amplify the LumiLuc gene fragment, which was further treated with Hind III and Xho I restriction enzymes and ligated into a predigested, compatible pcDNA3 plasmid. The Akaluc gene was synthesized by Eurofins, and cloned into a pBAD plasmid for bacterial expression and a pcDNA3 plasmid for mammalian expression, by using Aka-F-XhoI and Aka-R-Hindlll or Aka-F-HindIII-Kozak and Aka-R-XhoI oligonucleotides. To build mScarlet-LumiLuc fusion library, mScarlet-F-XhoI and mScar-NNK-pyr-R oligonucleotides were used to amplify mScarlet-I gene, while mScar-NNK-pyr-F and pyr-R-HindIII oligonucleotides were used for LumiLuc cloning, which were subsequently assembled by overlap PCR reaction. The product was digested with Xho I and Hind III restriction enzymes and ligated into a predigested, compatible pBAD/His B plasmid. The LumiScarlet gene was cloned into pcDNA3 for mammalian expression using Hindlll-mScarlet-F-Koz and pyr-R-XhoI oligonucleotides. All ligation products were used to transform Escherichia coli DH10B electrocompetent cells, which were next plated on LB agar plates supplemented with ampicillin (100 μg/mL).
Library Screening
[0166] DH10B cells containing luciferase mutants were plated on LB agar plates supplemented with ampicillin (100 μg/mL) and L-arabinose (0.02%, w/v %) and incubated at 37° C. overnight to form bacterial colonies. Agar plates were left at room temperature for another 6 h, and this was followed by bioluminescence imaging using a luminescence dark box (UVP Bio Spectrum) equipped with a QSI 628 cooled CCD camera (Quantum Scientific Imaging). Digital images were acquired after spraying about 200 μL of 10 μM substrates to each agar plate, and next, images were processed with the Fiji image analysis software to derive bioluminescence intensities of individual colonies. For each round of selection, the brightest 20 colonies from a total of about 10,000 colonies were chosen and inoculated in 5 mL liquid LB broth containing ampicillin (100 μg/mL) and L-arabinose (0.02%, w/v %). After overnight growth at 37° C. and 250 r.p.m., the cultures were moved onto a shaker at room temperature for another 6 h. 500 μL cell cultures were centrifuged and next lysed with 100 μL B-PER (Thermo Fisher Scientific). Next, to 1 μL lysate from each sample was added 100 μL substrate at a final concentration of 20 μM in assay buffer. Bioluminescence activities of individual samples were measured on a Synergy Mx Microplate Reader (BioTek). Kinetics were followed for 0.1 s signal integration every 60 s for a total of 20 min. Top three Mutants showing exceptionally high bioluminescence activities or extended kinetics were chosen for next-round selection, sequencing, and other additional characterization. mScarlet-I and LumiLuc fusion libraries were screened for high BRET efficiency using a 600-700 nm bandpass filter. 20 colonies were picked from each library and inoculated in 5 mL liquid LB broth containing ampicillin (100 μg/mL) and L-arabinose (0.02%, w/v %). The cell lysates were prepared with B-PER and the bioluminescence emission spectra were measured by adding 20 μM 8pyDTZ. The construct showed highest BRET efficiency was designated LumiScarlet.
In Vitro Bioluminescence Characterization
[0167] Luciferases were expressed and purified as previously described..sup.33 A Synergy Mx Microplate Reader (BioTek) was used for all in vitro bioluminescence characterizations. 50 μL of luciferin substrates was injected into the wells of white 96-well plates containing 50 μL of pure enzymes in assay buffer (1 mM CDTA, 0.5% Tergitol NP-40, 0.05% Antifoam 204, 150 mM KCl, 100 mM MES pH 6.0, 1 mM DTT, and 35 mM thiourea). The final concentrations of all enzymes were 20 pM. Measurements were taken every 30 s post injection (0.1 s integration and 10 s shaking during intervals). Akaluc bioluminescence assays were performed at final concentration of 10 nM Akaluc and 100 μM AkaLumine in an assay buffer contained 30 mM MOPS (pH 7.0), 1.5 mM ATP, and 5 mM MgSO.sub.4. To derive values for apparent Michaelis constants (Km), substrate concentrations varied from 0.78 to 50 μM, and peak bioluminescence intensities at individual substrate concentrations were used to fit the Michaelis-Menten equation. To record emission spectra, 50 μL of 20 μM substrates were injected into 50 μL of 2 nM pure enzymes, and the bioluminescence spectra were collected with 0.1 s integration and 1 nm increments from 350 to 750 nm.
Chemiluminescence Measurement
[0168] 0.63 g ammonium bicarbonate was dissolved in 12 mL water and 24 mL acetonitrile containing 30% aqueous hydrogen peroxide, resulting in an active peroxymonocarbonate solution. The solution was left at room temperature for 10 min. Each stock solution containing synthetic analogues (500 μM, 100 μL) was dispensed into wells of a 96-well plate, and chemiluminescence was triggered by addition of 100 μL of the peroxymonocarbonate solution. Light emission was recorded on a Synergy Mx Microplate Reader (BioTek) with 0.1 s integration and 1 nm increments from 350 to 750 nm.
Mammalian Cell Culture, Transfection, and Imaging
[0169] HEK 293T cells were cultured and transfected as previously described..sup.33 The number and density of cells in Dulbecco's phosphate-buffered saline (DPBS) were determined using a hemocytometer. Cells were next diluted in DPBS to gain the desired numbers in each 50 μL solution. To use the luminescence dark box to directly image cells, we added luciferase-expressing HEK 293T cells (5,000 cells per well with ˜70% transfection efficiency) and the corresponding luciferin substrates into wells of a white-wall, 96-well plate. Bioluminescence was imaged using a luminescence dark box immediately after substrate addition. The camera exposure time was set at 2 s. A Chroma Red 600-700 nm filter was used to acquire far-red emission. All images were analyzed using the Fiji image analysis software.
Generation of Luciferase-Expressing Stable Cell Lines
[0170] HeLa cells were cultured at 37° C. with 5% CO.sub.2 in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS). HeLa cells were transfected with pcDNA3-teLuc, pcDNA3-Antares2, pcDNA3-LumiLuc, pcDNA3-LumiScarlet, or pcDNA3-Akaluc as previously described..sup.33 48 h after transfection, cells were passed into fresh DMEM containing 10% FBS and 1 mg/mL G418. The medium was removed and replaced every 3 days. Stable polyclonal cell lines were generated after ˜2 weeks of G418 selection.
Xenograft Mouse Model
[0171] HeLa cells stably expressing luciferases were dissociated with trypsin and re-suspended in 10 mL DMEM. Cell numbers were determined using a hemocytometer, and cell viability was determined using a trypan blue exclusion test. 10.sup.4 or 10.sup.5 cells were re-suspended in 100 μL FBS-free DMEM containing 50% Matrigel matrix (Corning). 8-week-old female nude mice were first anesthetized using isoflurane. Cells were subcutaneously injected into the left and right dorsolateral trapezius regions or thoracolumbar regions. Mice were recovered on heat pads for 5 min while cells were allowed to settle. On day 1, 3, 5, 7, 14, and 28 post tumor implants, mice were subsequently imaged using a Caliper IVIS Spectrum (Perkin Elmer) approximately 5 min after intravenous (i.v.) administration of corresponding luciferins (100 μL solution for indicated doses). DTZ was dissolved in a 100 μL solution containing 8% glycerol, 10% ethanol, 10% hydroxypropyl-β-cyclodextrin, and 35% PEG 400 in water. 8pyDTZ and AkaLumine-HCl was dissolved in normal saline. All solutions were passed through 0.22 μm pore filters before administrations. The following conditions were used for image acquisition: open filter for total bioluminescence, exposure time=60 s (Day 1, 3, and 5); 30 s (Day 7); 10 s (Day 14); 3 s (Day 28), binning=small, field of view=21.6×21.6 cm, and f/stop=1. Image analysis was performed using the Living Image 4.3.1 software.
Deep-Tissue Mouse Model
[0172] 10.sup.6 HeLa cells stably expressing either LumiLuc, LumiScarlet or Akaluc were i.v. injected to female nude mice. After 4 h, images were acquired using a Caliper IVIS Spectrum immediately after i.v. delivery 0.2 μmol 8pyDTZ or 1.5 μmol AkaLumine-HCl in 100 μL normal saline. The following conditions were used for image acquisition: open filter for total bioluminescence, exposure time=10 s, binning=small, field of view=21.6×21.6 cm, and f/stop=1.
Fluorescence Imaging of ATP in Mammalian Cells
[0173] HEK293T and HeLa cells were cultured and transfected as aforementioned. Images were acquired on a Leica DMi8 inverted microscope equipped with the SPE confocal module. Cells were cultured in DMEM (no phenol red) with 4.5 g/mL glucose. 405 and 488 nm laser was used to excite PercevalHR, and emission was collected from 510 nm to 600 nm. Intervals between each image were 5 second. 50 μM pyDTZ was added to cells. For the internal calibration purpose, iodoacetic acid (IAA) was added to a final concentration of 5 mM to completely deplete intracellular ATP. pHRFP was also used to monitor the cellular pH change before and after addition of 50μM 8pyDTZ.
Statistical Analysis
[0174] Unpaired two-tailed t-tests were used to determine all p-values. No statistical methods were used to predetermine the sample size. Animals were randomly assigned to receive various treatments. Unless otherwise indicated, data are shown as mean±s.d., and error bars in figures represent s.d.
Example 1
Design and Synthesis of pyridyl CTZ and DTZ Analogs with Enhanced Water Solubility
[0175] Despite that recent studies have synthesized and tested a number of CTZ analogs with NanoLuc,.sup.18, 19 the luciferase has not yet been optimized to pair with these new substrates and the water solubility issue of the substrates has not yet been tackled systematically. Thus, a need remained for CTZ and DTZ analogs with improved water solubility.
[0176] The chemical structures of coelenterazine (CTZ), furimazine (FRZ) and diphenylterazine (DTZ) are provided below.
##STR00024##
[0177] The need was fulfilled, as disclosed herein, by using the concept of bioisostere replacements in medicinal chemistry. Pyridine is considered a biocompatible N-heterocycle substituent for benzene with enhanced water solubility, because pyridine-containing molecules can be readily turned into pyridinium salts. Therefore, a convergent synthetic route was designed to prepare a series of CTZ and DTZ analogs with pyridyl isomer substitutions at the C-2, C-6 and C-8 positions of the imidazopyrazinone core (Scheme 1, below). Briefly, Suzuki or Negishi cross-coupling reactions were first used to regioselectively functionalize 2-amino-3,5-dibromopyrazine with either pyridyl, phenyl, or benzyl functional groups to give monosubstituted products (1a-c), which were subsequently derivatized via Suzuki cross-coupling reactions to afford disubstituted intermediates (2a-f, see structures and synthetic methods above). In the second cross-coupling step, the XPhos-Pd-G2 catalyst was used to enhance reaction yields and minimize the protodeboronation of pyridyl boronic acids..sup.20 An acid-catalyzed ring closing reaction.sup.21 in dioxane was also utilized to derive various pyridyl CTZ and DTZ analogs (3a-f, Table 2) from the disubstituted intermediates and corresponding α-ketoacetals.
##STR00025##
[0178] Scheme 1. Synthesis of pyridyl CTZ and DTZ analogs. (a) Suzuki coupling: Pd(PPh.sub.3).sub.4, Na.sub.2CO.sub.3, R.sub.8—B(OH).sub.2, and EtOH; (b) Negishi coupling: PhCH.sub.2MgCl, ZnCl.sub.2, (PPh.sub.3).sub.2PdCl.sub.2, and THF; (c) Suzuki coupling: XPhos-Pd-G2, Na.sub.2CO.sub.3, R.sub.6—B(OH).sub.2, and EtOH; (d) Acid-catalyzed ring closing: corresponding α-ketoacetal, HCl, and dioxane.
[0179] Turbidimetric solubility assays.sup.22 were used to evaluate water solubility of these CTZ and DTZ analogs (Table 2). Surprisingly, the newly synthesized pyridyl analogs enhanced the solubility by 4- to 14-fold as compared to CTZ and DTZ. The autoluminescence and stability of these new analogs was also evaluated, the results of which indicated that they are comparable or even better than CTZ and FRZ. Moreover, their chemiluminescence was also evaluated, because the wavelength of bioluminescence is often related to the wavelength of substrate chemiluminescence, although the luciferase enzyme provides further electrostatic tuning which can reshape the emission (
[0180] Although each luciferase has different substrate preferences, the compound 3a (pyCTZ) generated strong blue bioluminescence in the presence of each of these tested luciferases. When paired with aequorin, the bioluminescence intensity of pyCTZ was comparable to native CTZ, suggesting that pyCTZ may be directly used to replace CTZ for aequorin-based calcium sensing..sup.24 Furthermore, compared to DTZ, compounds 3c (8pyDTZ), and 3f were able to emit red-shifted chemiluminescence and/or bioluminescence, while 3b and 3d (6pyDTZ) caused hypsochromic shift (Table 2). Molecular mechanisms governing the spectral shift properties of these synthetic substrates remain to be investigated. Because 3c showed the most red-shifted emission and red-shifted photons can penetrate through tissue better,.sup.25 3c (8pyDTZ) was selected as the candidate substrate for further development of an optimized, red-shifted luciferase-luciferin pair.
TABLE-US-00003 TABLE 2 Chemical and photoluminescence properties of synthetic pyridyl CTZ and DTZ analogs. Bio- Chemi- Water luminescence luminescence Solubility Compound R.sub.6 R.sub.8 R.sub.2 .sup.aλ.sub.max (nm) .sup.bλ.sub.max (nm) (μM) 3a
[0181] The chemical structures of pyCTZ (3a in Table 2), 8pyDTZ (3c in Table 2) and 6pyDTZ (3d in Table 2) are provided below, as well as in
##STR00050##
Example 2
Directed Evolution of the TeLuc Luciferase for Improved Brightness
[0182] teLuc was previously optimized for DTZ, a substrate with conjugated disubstitutions on the imidazopyrazinone core. 8pyDTZ exhibits about 30 nm red-shift but the emission of teLuc-8pyDTZ has been greatly attenuated compared to teLuc-DTZ. teLuc was then engineered for increased photon flux in the presence of 8pyDTZ. On the basis of a published apo-nanoKAZ structure.sup.26 and our computational model,.sup.7 random mutations were first introduced to residues 18 and 19 close to a putative substrate-binding pocket (
[0183] The resultant LumiLuc-8pyDTZ pair has an emission peak at 525 nm. Its in vitro maximal photon emission rate (Vmax) is about 60% and about 36% of NanoLuc-FRZ and teLuc-DTZ, respectively. The apparent Michaelis constant (KM) of LumiLuc-8pyDTZ was 4.6 μM, lower than that of teLuc-DTZ or NanoLuc-FRZ (
[0184] LumiLuc has broad substrate specificity. It improved the photon flux of 3a (pyCTZ) and 3d (6pyDTZ) from teLuc by about 120% and about 150%, respectively (
Example 3
LumiLuc-8pyDTZ in Cultured Mammalian Cells
[0185] Next, LumiLuc-8pyDTZ was evaluated in human embryonic kidney (HEK) 293T cells transiently expressing the luciferase (
[0186] ATP-dependent luciferases, such as FLuc and Akaluc consumes one ATP molecule in each catalytic cycle, leading to metabolic disruption..sup.8 Instead, ATP-independent LumiLuc does not use ATP for catalysis. ATP/ADP ratios were monitored in live HEK 293T cells using PercevalHR, a previously reported fluorescent ATP/ADP biosensor..sup.27 No ATP perturbation was observed from 8pyDTZ-treated, LumiLuc-expressing cells.
Example 4
LumiLuc-8pyDTZ to Track Tumor Growth in a Mouse Xenograft Model
[0187] BLI has been a popular imaging modality for various animal models..sup.13, 25 The recently reported Akaluc-AkaLumine and Antares2-DTZ pairs are two benchmark reporters for in vivo BLI..sup.6, 7 A biologically-relevant tumor xenograft mouse model.sup.28 was adapted to compare these bioluminescent reporters. Cervical cancer HeLa cell lines stably expressing individual luciferases were generated, including teLuc, Antares2, LumiLuc, and Akaluc (
[0188] The bioluminescence of Akaluc-AkaLumine eventually surpassed LumiLuc-8pyDTZ from day 14 (
[0189] This data provides for the monitoring of the disclosed luciferase-luciferin pairs for in vivo monitoring of tumor models. For example, bioluminescence can be monitored in a tumor model by establishing a luciferase expressing cell (e.g. a cell expressing LumiLuc, teLuc, RLuc8 and OpyLuc) in the model, e.g. by transfecting cells in the model and/or by administering to that model already transfected cells expressing a luciferase, and administering to the model a luciferin (e.g. pyCTZ, pyOHCTZ, pyOMeCTZ, pyOEtCTZ, pyiPrCTZ, 2pyDTZ, 6pyDTZ, 6opyDTZ or 8pyDTZ). Using these luciferase-luciferin pairs as reporter systems the bioluminescence can be used as a tool to monitor the tumor.
Example 5
Engineering of BRET-Based LumiScarlet and TeScarlet for Deep-Tissue BLI
[0190] mScarlet-I is a recently reported red fluorescent protein with high quantum yield and excellent performance as a Förster resonance energy transfer (FRET) acceptor..sup.29 It was thus hypothesized that LumiLuc could be genetically fused to mScarlet-I for BRET, thereby red-shifting the emission of LumiLuc. Several fusion strategies between LumiLuc and mScarlet-I were explored, libraries were constructed by randomizing the linkers, and mutants with high BRET efficiency were screened (
[0191] High BRET efficiency was achieved with LumiScarlet in the presence of either pyCTZ, or 6pyDTZ, or 8pyDTZ (
TABLE-US-00004 TABLE 3 BRET-based bioluminescent reporters that are based on NanoLuc and its derivatives. Photon > BRET BRET BRET Size λ.sub.max 600 nm Construct Donor Acceptor (kDa) (nm) Luciferin (%) Ref. Lumi Scarlet LumiLuc mScarlet-I 44 527, 8pyDTZ 51 This 600 work LumiLuc mScarlet-I 44 476, 6pyDTZ 38 600 LumiLuc mScarlet-I 44 450, pyCTZ 26 600 Antares NanoLuc CyOFP 70 456, FRZ 23 (.sup.1) 583 Antares2 teLuc CyOFP 70 501, DTZ 33 (.sup.2) 583 ReNL NanoLuc tdTomato 72 459, FRZ 24 (.sup.3) 583
[0192] Next, the newly engineered LumiLuc-8pyDTZ and LumiScarlet-8pyDTZ were compared with Akaluc-AkaLumine for deep-tissue BLI. A million HeLa cells stably expressing corresponding luciferases were injected into each of NU/J mice via tail vein and performed BL imaging 4 h later. Immunodeficient mice were used here to minimize immune responses to HeLa cells, so that signals will be mostly from live cells trapped in the lungs. LumiScarlet gave about 3-fold higher detectable signals than LumiLuc under this condition (
[0193] Of note, some diffuse signals were observed from areas other than the lungs. These signals were not caused by substrate background, as injection of 8pyDTZ into blank mice resulted in only weak background much lower than what was observed in
[0194] LumiScarlet has better mammalian tissue penetration than LumiLuc. Moreover, LumiScarlet-8pyDTZ is a novel, ATP-independent bioluminescent reporter with exceptional deep-tissue BLI performance comparable to ATP-dependent Akaluc-AkaLumine.
[0195] Similar to the BRET-based strategy of creating LumiScarlet, a BRET-based fusion of teLuc and mScarlet-I was engineered. Libraries were constructed to randomize the linker between teLuc and mScarlet-I. A mutant was identified, namely teScarlet (
Discussion of Examples 1-5
[0196] Conventionally, ATP-dependent bioluminescent reporters, such as FLuc and Akaluc, are considered to be more useful for in vivo BLI than ATP-independent marine luciferases, because the emission of ATP-dependent insect luciferases is often at the red end of the visible spectrum where the mammalian tissue is relatively transparent. However, these insect luciferases require ATP and Mg2+ for bioluminescence. The ATP- and Mg2+-dependency is sometimes problematic because ATP and Mg2+ levels may vary under different biological circumstances..sup.30 In particular, ATP-dependent luciferases are inactive in extracellular space and common biological fluids such as blood and urine, where ATP accessibility is limited..sup.8 Moreover, ATP-dependent luciferases consume ATP in bioluminescence reactions and may cause concerns such as metabolic disruption..sup.8 In contrast, most ATP-independent marine luciferases are enzymatically active in extracellular space and common biological fluids; they do not consume ATP for bioluminescence. Furthermore, some marine luciferase derivatives have fast catalytic turnover and thus give high photon flux. It is therefore not surprising that marine luciferase and their derivatives, such as NanoLuc and Gaussia luciferase, have been widely used for in vitro bioluminescence assays. However, currently, the in vivo applications of marine luciferases are hindered by their blue emission and poor substrate water solubility. As disclosed herein, combined chemical synthesis and protein engineering approaches yielded enhanced ATP-independent marine luciferases for in vivo BLI by developing red-shifted colors and water-soluble substrates.
[0197] First, a series of pyridyl CTZ and DTZ analogs with diverse emission profiles were prepared. The water solubility of these synthetic analogs generally increased by about 10-fold from their ancestors. These substrate analogs can not only be paired with the new luciferases engineered here, but also existing ATP-independent reporters, such as RLuc and aequorin.
[0198] Further, a luciferase was engineered for the 8pyDTZ substrate via directed protein evolution. The resultant LumiLuc-8pyDTZ bioluminescent reporter system exhibited reduced KM and red-shifted emission. These factors favored in vivo BLI. As a result, LumiLuc-8pyDTZ showed high sensitivity in a mouse xenograft model. In addition, LumiLuc-8pyDTZ did not perturb the intracellular ATP/ADP level, and 8pyDTZ could be dissolved up to about 2 mM in low-viscosity saline without using irritative and toxic organic cosolvent. Therefore, the efforts disclosed herein enhanced not only the biocompatibility of bioluminescent reporters, but also reproducibility for intravenous injections.
[0199] Furthermore, a BRET-based LumiScarlet reporter was developed for further red-shifted emission. The emission of LumiLuc-8pyDTZ overlaps well with the excitation of mScarlet-I, an excellent red-emitting resonance energy transfer acceptor. LumiScarlet-8pyDTZ exhibited high brightness, significant emission longer than 600 nm, and excellent tissue penetration. LumiScarlet-8pyDTZ was comparable to NIR-emitting Akaluc-AkaLumine in a mouse model for deep-tissue BLI. Moreover, because LumiScarlet is enzymatically active in blood, it will be an excellent reporter for monitoring targets of interest in the blood of in vivo models.
[0200] LumiLuc is a luciferase with broad substrate specificity. When it was paired with different substrates, intense blue, teal, and yellow bioluminescence was generated. Subsequently, different emission profiles from LumiScarlet were gained in the presence of different substrates. The use of LumiScarlet-8pyDTZ for deep-tissue imaging was also demonstrated. In addition, because the two emission peaks of LumiScarlet-pyCTZ or LumiScarlet-6pyDTZ are more separated than LumiScarlet-8pyDTZ, LumiScarlet-pyCTZ and LumiScarlet-6pyDTZ will be useful for studying protein-protein interactions or constructing BRET-based biosensors.
[0201] In summary, disclosed herein are several engineered luciferase-luciferin pairs that emit photons spanning an appreciable range in the visible spectrum. The discoveries disclosed herein greatly enhance the biocompatibility and sensitivity of ATP-independent bioluminescent reporters for in vivo BLI. Future studies are likely to continuously increase the water-solubility of CTZ and DTZ analogs and red-shift the emission of marine luciferases. Subsequently, it is expected that a large array of bioluminescent biosensors will be developed on the basis of these bright, ATP-independent bioluminescent reporters..sup.31 The new reporters and biosensors will further ease non-invasive imaging of freely moving animals, leading to new biological insights.
Materials and Methods for Examples 6-9
Materials and General Methods
[0202] Synthetic DNA oligonucleotides were purchased from Integrated DNA Technologies. Restriction endonucleases were purchased from Thermo Fisher Scientific. Q5 high-fidelity DNA polymerase and Taq DNA polymerase were purchased from NEB. Products of PCR and restriction digestion were purified by gel electrophoresis and Syd Laboratories Gel Extraction columns. Plasmid DNA was purified using Syd Laboratories Miniprep columns. DNA sequences were analyzed by Eurofins. AkaLumine-HCl was purchased from Aobious. All other chemicals were purchased from Sigma-Aldrich, Fisher Scientific, or VWR and used without further purification. Bruker Avance DRX 600 and Varian NMRS 600 at the UVA Biomolecular Magnetic Resonance Facility was used to record all NMR spectra. Chemical shift (δ) is given in parts per million relative to .sup.1H (7.24 p.p.m.) and .sup.13C (77.23 p.p.m.) for CDCl.sub.3; .sup.1H (2.50 p.p.m.) and .sup.13C (39.5 p.p.m.) for DMSO-d.sub.6; .sup.1H (3.31 p.p.m.) and .sup.13C (49.15 p.p.m.) for methanol-d.sub.4. Splitting patterns are reported as s (singlet), bs (broad singlet), d (doublet), t (triplet), dd (doublet of doublets), and m (multiplet). Coupling constant (J) is given in Hz. High resolution ESI-MS was run on an Agilent 6545 Q-TOF LC/MS system by direct infusion. A Waters Delta Prep ZQ 2000 LC-MS Purification System equipped with a)(Bridge BEH Amide OBD Prep Column (130 Å, 5 μm, 30 mm×150 mm) was used for preparative reverse-phase HPLC purifications. Images were analyzed using the Fiji image analysis software. Microsoft Excel and GraphPad Prism were used to analyze data and prepare figures.
Chemical Synthesis
3-benzyl-5-(4-methoxyphenyl)pyrazin-2-amine (2)
[0203] ##STR00051##
[0204] 1 was prepared following the published synthesis methods.sup.64. To a solution of Pd(PPh.sub.3).sub.4 (230 mg, 0.2 mmol, 0.1 equiv.) in 50 mL EtOH was added 1 (528 mg, 2 mmol, 1 equiv.), 1N Na.sub.2CO.sub.3 solution (4 mL, 4 mmol, 2 equiv.) and 4-Methoxylphenylboronic acid (304 mg, 2 mmol, 1 equiv.). The resultant mixture was stirred at 80° C. under argon for 12 h. The solvent was removed in vacuo and the residue was suspended in 100 mL ddH.sub.2O, which was extracted twice with EtOAc (100 mL). The organic layers were combined and dried over anhydrous Na.sub.2SO.sub.4, filtered and removed in vacuo. The residue was purified by silica column chromatography with elution (Ethyl acatate:Hexane=1:1) to yield compound 2 as yellow solid (413 mg, 71%). .sup.1H NMR (600 MHz, DMSO-d.sub.6) δ 8.33 (s, 1H), 7.82 (d, J=8.8 Hz, 2H), 7.32 (d, J=6.7 Hz, 2H), 7.26 (t, J=7.6 Hz, 2H), 7.17 (t, J=7.4 Hz, 1H), 6.95 (d, J=8.8 Hz, 2H), 6.26 (s, 2H), 4.05 (s, 2H), 3.76 (s, 3H). .sup.13C NMR (150 MHz, DMSO-d.sub.6) 158.9, 152.2, 139.8, 139.0, 138.2, 136.2, 128.9, 128.2, 126.1, 126.1, 114.1, 55.1, 38.6. HRMS (ESI-TOF) calcd for C.sub.18H.sub.17N.sub.3O [M+H].sup.+: 292.1372, found: m/z 292.1369.
8-benzyl-6-(4-methoxyphenyl)-2-(pyridin-4-ylmethyl)imidazo[1,2-a]pyrazin-3(7H)-one (pyOMeCTZ)
[0205] ##STR00052##
[0206] To a solution of 2 (29 mg, 0.1 mmol, 1 equiv.) and 3-pyridin-4-yl-1,1-diethoxyacetone (45 mg, 0.2 mmol, 2 equiv) in 2 mL degassed 1,4-dioxane was added 1 mL 6N HCl. The resulting mixture was stirred at 80° C. in a seal tube for 12 h. The solvent was then removed in vacuo and the residue was dissolved in 1 mL (ACN:H.sub.2O=1:1) and next purified with preparative RP-HPLC. (acetonitrile/water=1:99 to 90:10, 20 mL/min, UV 254 nm). Product fractions were combined and lyophilized to give pyOMeCTZ as yellow powder (10 mg, 24%), which has to be stored as solid at −80° C. for long-term stability. .sup.1H NMR (600 MHz, Methanol-d.sub.4) δ 8.82 (d, J=6.4 Hz, 2H), 8.27 (s, 1H), 8.09 (d, J=6.2 Hz, 2H), 7.73 (d, J=8.7 Hz, 2H), 7.43 (d, J=7.5 Hz, 2H), 7.32 (t, J=7.6 Hz, 2H), 7.26 (t, J=7.2 Hz, 1H), 7.10 (d, J=8.7 Hz, 2H), 4.66 (s, 2H), 4.61 (s, 2H), 3.87 (s, 3H). .sup.13C NMR (150 MHz, Methanol-d.sub.4) δ 142.7, 137.0, 130.2, 130.1, 129.1, 128.7, 126.5, 115.9, 56.2. HRMS (ESI-TOF) calcd for C.sub.26H.sub.22N.sub.4P.sub.2 [M+H].sup.+: 423.1743, found: m/z 423.1740.
2-benzyl-6-phenyl-8-(pyridin-4-yl)imidazo[1,2-a]pyrazin-3(7H)-one (pyDTZ)
[0207] ##STR00053##
[0208] To a solution of 5-phenyl-3-(pyridin-4-yl)pyrazin-2-amine (25 mg, 0.1 mmol, 1 equiv.) and 1,1-diethoxy-3-phenylpropan-2-one (89 mg, 0.4 mmol, 4 equiv.) in 5 mL degassed 1,4-dioxane was added 0.8 mL 6 N HCl, and the resulting mixture was stirred at 80° C. in a sealed tube for 12 h. The solvent was then removed in vacuo and the residue was dissolved in 1 mL (ACN:H.sub.2O=1:1) and next purified with preparative RP-HPLC. (acetonitrile/water=1:99 to 90:10, 20 mL/min, UV 254 nm). Product fractions were combined and lyophilized to give pyDTZ as brown powder (8 mg, 22%). .sup.1H NMR (600 MHz, Acetonitrile-d.sub.3 and D.sub.2O, ratio=9:1) δ 9.31 (d, J=6.8 Hz, 2H), 8.84 (d, J=6.8 Hz, 2H), 8.54 (s, 1H), 8.09 (d, J=8.0 Hz, 2H), 7.52 (t, J=7.6 Hz, 2H), 7.44 (t, J=7.3 Hz, 1H), 7.35 (d, J=7.7 Hz, 2H), 7.28 (t, J=7.7 Hz, 2H), 7.24-7.21 (m, 1H), 4.19 (s, 2H). .sup.13C NMR (150 MHz, Methanol-d.sub.4) δ 143.0, 140.7, 140.1, 139.5, 137.5, 132.0, 130.2, 129.9, 129.6, 129.4, 127.8, 127.5, 127.4, 126.5, 113.8, 33.6. HRMS (ESI-TOF) calcd for C.sub.24H.sub.18N.sub.4O [M+H].sup.+: 379.1481, found: m/z 379.1477.
Plasmid Construction
[0209] Polymerase chain reactions with various synthetic oligonucleotide pairs (see Table 4) were used to amplify genetic elements. Generating gene libraries with randomizations were previously described. Abovementioned screening approach was applied to the selection process of random mutagenesis by Error prone-PCR. Oligonucleotides pBAD-F and pBAD-R were used to create a library with randomization by using Taq DNA polymerase, 0.2 mM MnCl.sub.2, and unbalanced dNTPs to promote amplification errors. The PCR product was digested with Xho I and Hind III restriction enzymes and ligated into a predigested, compatible pBAD/His B plasmid. To create mammalian expression plasmids containing NFκB response element, NFkB_SacI_F and NFkB_BgIII_R were used to amplify the fragment from pHAGE NFkB-TA-LUC-UBC-GFP-W plasmid (Addgene:49343), which was further treated with Sac I and BgI II restriction enzymes and ligated into a predigested, compatible SRE reporter vector_559 plasmid (Addgene:82686). For Antioxidant response element, the DNA fragment was synthesized by IDT and ligated into Sac I and BgI II predigested SRE reporter vector_559 plasmid. The OpyLuc, RLuc8, and Akaluc gene were cloned into corresponding plasmids containing desired response element by using opyluc_AscI_Kozak_F/opyluc_FseI_R, Rluc_AscI_Kozak_F/Rluc_FseI_R, or Akaluc_AscI_Kozak_F/Akaluc_FseI_R oligonucleotide pairs with Asc I and Fse I double digestion. All ligation products were used to transform Escherichia coli DH1OB electrocompetent cells, which were next plated on LB agar plates supplemented with ampicillin (100 μg/mL).
TABLE-US-00005 TABLE 4 Oligonucleotides used in this study. SEQ ID Oligo name NO. Nucleotide sequence (5′>3′) pBAD-F 19 ATGCCATAGCATTTTTATCC pBAD-R 20 GATTTAATCTGTATCAGG NFkB_SacI_F 21 TACCGAGCTCATCCAGTTTGGACTAGTGG NFkB_BgIII_R 22 AGCCCAGATCTCCTCTAGAGTCTAGATCTGG opyluc_AscI_ 23 AAAGCCACCGGCGCGCCGCCGCCACCATGGT Kozak_F CTTCACTCTCGAAGATTTTGT opyluc_FseI_R 24 TCGAAGCGGCCGGCCTTACGCCAGAATGCGT TCATGCA Akaluc_AscI_ 25 AAAGCCACCGGCGCGCCGCCGCCACCATGGA Kozak_F AGATGCCAAAAACATTAAGA Akaluc_FseI_R 26 TCGAAGCGGCCGGCCTTACACGGCGATCTTG CCGTCCTTCTT Rluc_ 27 AAAGCCACCGGCGCGCCGCCGCCACCATGGC AscI_Kozak_F TTCCAAGGTGTACGACC Rluc_FseI_R 28 TCGAAGCGGCCGGCCTTACTGCTCGTTCTTC AGCACGCGCT
Preparation of Mammalian Cell Culture and Cell Lysate
[0210] HEK 293T cells were cultured and transfected as previously described..sup.63 The number and density of cells in Dulbecco's phosphate-buffered saline (DPBS) were determined using a hemocytometer. Cells were next diluted in DPBS to gain the desired numbers in each 50 μL solution. Cell lysates were obtained by incubating desired number of cell in a CelLytic M solution for 15 minutes and centrifuged.
Library Screening
[0211] DH10B cells containing luciferase mutants were plated on LB agar plates supplemented with ampicillin (100 μg/mL) and 1-arabinose (0.02%, w/v %) and incubated at 37° C. overnight to form bacterial colonies. Agar plates were left at room temperature for another 6 h, and this was followed by bioluminescence imaging using a luminescence dark box (UVP Bio Spectrum) equipped with a QSI 628 cooled CCD camera (Quantum Scientific Imaging). Digital images were acquired after spraying about 200 μL of 50 μM pyDTZ to each agar plate, and next, images were processed with the Fiji image analysis software to derive bioluminescence intensities of individual colonies. For each round of selection, colonies showed bright bioluminescence were chosen and inoculated in 1 mL liquid LB broth containing ampicillin (100 μg/mL) and L-arabinose (0.02%, w/v %) in 96-well deep plates. After overnight growth at 37° C. and 250 r.p.m., the cultures were moved onto a shaker at room temperature for another 6 h. The 96-well plates were centrifuged and the pellet in each well was lysed with 200 μL B-PER. After 30-minute incubation, the 96-well plates were centrifuged again. Next, 2 μL lysate from each sample was transferred to the wells of new white 96-well plates where 100 μL of 20 μM pyDTZ in assay buffer was added to each well. Bioluminescence activities of individual samples were measured on a microplate reader. Kinetics were followed for 0.1 s signal integration every 30 s for a total of 10 min. Meanwhile, 2 μL lysate from each sample was added 100 μL of 20 μM pyOMeCTZ in assay buffer. The selectivity was determined by the specific activity toward pyDTZ/activity toward pyOMeCTZ. Top three mutants showing exceptionally high bioluminescence selectivity of pyDTZ over pyOMeCTZ were chosen for next-round selection, sequencing, and other additional characterization.
In Vitro Bioluminescence Characterization
[0212] Luciferases were expressed and purified as previously described..sup.53 A microplate reader was used for all in vitro bioluminescence characterizations. To record bioluminescence emission spectra, 50 μL of luciferin substrates was injected into the wells of white 96-well plates containing 50 μL of pure enzymes in PBS (1.5 mM ATP and 5 mM MgSO.sub.4 were supplemented for Akaluc). Kinetic measurements were taken every 30 s post injection with 0.1 s integration and 10 s shaking during intervals. To derive values for apparent Michaelis constants (Km), substrate concentrations varied from 0.78 to 50 μM, and 10-min integrated bioluminescence at individual substrate concentrations were used to fit the Michaelis-Menten equation.
Bioluminescence Imaging with Luminescence Dark Box
[0213] UVP Bio Spectrum luminescence dark box was used for all bioluminescence imaging. To record bioluminescence imaging with pure enzymes, 50 μL of 60 μM substrates were injected into corresponding 50 μL pure enzymes (final concentration: 10 nM for RLuc8 and OpyLuc; 100 nM for Akaluc), and the bioluminescence imaging was collected with 10 s exposure time. A filter wheel equipped with a Chroma Blue 360-500 nm, a Chroma Green 495-580 nm, and a Chroma Red 600-700 nm filter was used to acquire emission in each channel. To use the luminescence dark box to directly image cells, we added luciferase-expressing HEK 293T cells (5,000 cells per well for RLuc8 and OpyLuc; 30,000 cells per well for Akaluc) and the indicated luciferin substrates solution were injected into wells of a white 96-well plate. Final concentration of each substrate were 25 μM for pyOMeCTZ, 10 μM for pyDTZ, and 100 μM for AkaLumine-HCl. Bioluminescence was imaged in the luminescence dark box immediately after substrate addition. The camera exposure time was set at 30 s. All images were analyzed using the Fiji image analysis software.
Transfection and Activation of Signaling Pathways in HEK293T Cell Line
[0214] HEK293T cells were transfected at about 70% confluency by using plasmid DNA:PEI=3:9 mixture. Plasmids used in this study included SRE-RLuc8, ARE-OpyLuc, and NF-κB-Akaluc, NF-KB-RLuc8, SRE-OpyLuc, ARE-Akaluc and CMV-Akaluc. 3 h after transfection, the medium was removed and replaced by fresh medium. The cells were allowed to recover for another 3 h. 20% fetal bovine serum (FBS), 50 μM tert-butylhydroquinone (tBHQ), or 10 ng/mL tumor necrosis factor alpha (TNFα) were used to activate serum response element (SRE), antioxidant response element (ARE), or nuclear factor kappa B (NF-κB) responsive element. Bioluminescence signals were acquired 16 h post induction. An un-transfected sample was used for background subtraction and an un-induced sample was used as a negative control.
Example 6
Design of Triple Luciferase System and the Directed Evolution of Luciferase to Improve Substrate Selectivity for Synthetic PyDTZ
[0215] To choose bioluminescent reporters that can generate different colors of emission, available luciferase-luciferin pairs that have been reported previously in literature were first screened..sup.54 RLuc8 (nucleotide and polypeptide sequences provided herein as SEQ ID NOs.13 and 14, respectively) is able to produce intense bioluminescence in a violet wavelength range (λ.sub.max: ˜405 nm) when methoxy-eCoelenterazine (me-eCTZ) was used as the substrate..sup.55 Renilla luciferase (RLuc) is also known to be not tolerant to C-8 chemical modifications..sup.56 It was reasoned that the blue-shifted emission might be due to dihedral angle twist caused by the C-6 methoxyl substitution. Therefore, a me-eCTZ analog, pyOMeCTZ (
[0216] According to our result, teLuc is tolerant to a variety of C-8 chemical modifications, including both electronic and steric derivatives..sup.53 Herein, pyDTZ (
[0217] To address this issue, it was noticed that teLuc exhibited a substrate preference to pyDTZ over pyOMeCTZ by about 50-fold activity, suggesting that it might be feasible to engineer a mutant via directed evolution to more selectively access pyDTZ rather than pyOMeCTZ. Instead of screening the library for only enhanced bioluminescence output, a method was designed where the BL activity of the mutants to both of pyDTZ (positive screening) and pyOMeCTZ (negative screening) were screened in parallel. The “hit” mutants showing not only high specific activity in positive screening but also low activity in negative screening were selected for the next round selection (
[0218] Collectively, provided herein are three luciferase-luciferin pairs (RLuc8-pyOMeCTZ; λ.sub.max: 416 nm, OpyLuc-pyDTZ; λ.sub.max: 520 nm, and Akaluc-AkaLumine; λ.sub.max: 650 nm) that can access its specific luciferin and produce distinct colors of emission across the visible spectrum (
Example 7
Triple Luciferase System Produces Orthogonal BL Signals in Purified Enzyme and in Transfected HEK293T Cells
[0219] To validate that the emission of these three luciferase-luciferin pairs are indeed spectrally separated, and can be resolved by filters, recombinant luciferases were first purified from E. coli and the respective BL signals were imaged with/without 360-500 nm, 495-580 nm, or 600-700 nm bandpass filters (
[0220] To demonstrate that the disclosed triple luciferase system is a practical tool to monitor gene expression levels in live mammalian cells, the photon flux of each luciferase was first evaluated in the presence of a series of substrate concentrations. It would have been ideal to explore an optimal concentration for each luciferin (pyOMeCTZ, pyDTZ, and AkaLumine) that can provide a similar level of photon flux from individual luciferase-luciferin pair. Unfortunately, the photon flux of Akaluc-AkaLumine at saturated concentration is about 10-fold lower than that of RLuc8-pyOMeCTZ and OpyLuc-pyDTZ pairs, possibly due to its nature BL mechanism of ATP-dependency and two-step reaction. In order to at least keep the photon flux of RLuc8-pyOMeCTZ and OpyLuc-pyDTZ pairs at the same level, a condition containing 25 μM pyOMeCTZ, 10 μM pyDTZ, and 100 μM AkaLumine-HCl was selected as the “Optimal Mix” for live cell imaging. By comparing Optimal Mix and only its respective substrate, only OpyLuc exhibited slightly unspecific inhibition by Optimal Mix while RLuc8 and Akaluc remained unaffected.
[0221] Next, the performance of each luciferase was examined for in cellulo imaging in the presence of chosen luciferin concentration. The indicated luciferin substrate solution was injected into luciferase-expressing HEK 293T cells in a 96-well plate. As expected, pyDTZ initiated the BL emission only in the presence of OpyLuc. The excellent substrate selectivity was also observed in both Akaluc for AkaLumine and RLuc8 for pyOMeCTZ (
[0222] While reporter assays are typically performed in lysates from cultured cells, the disclosed triple luciferase system was also evaluated in lysates. The results indicated that RLuc8-pyOMeCTZ and OpyLuc-pyDTZ pairs showed about 2 to 3-fold higher BL signals in lysates while Akaluc-AkaLumine exhibited decreased signal even after supplementing with additional ATP. Therefore, using lysates in not required in the disclosed triple luciferase system because all three luciferins described here are cell-permeable and work well with intact mammalian cells. This feature is beneficial to expand the real-time measurement of BL assays without lysing cultured cells.
Example 8
Monitor Serum Response, Antioxidant, and NF-κB Promoter Activities in HEK293T Cells by Triple Luciferase System
[0223] Subsequently, the disclosed triple luciferase system was used to monitor three signaling pathway activations in HEK293T cells where each of the luciferase expression was under control by a growth factor-regulated promoter element (serum response element, SRE),.sup.58 a Nrf2-antioxidant response element (ARE),.sup.59 or a transcription factor—nuclear factor kappa B (NF-κB) responsive promoter element (Table 5)..sup.60 A reporter system was designed based on SRE promoter driving the expression of RLuc8, ARE promoter driving the expression of OpyLuc, and NF-κB promoter driving the expression of Akaluc. The response element promoters can be specifically activated by its respective stimuli—fetal bovine serum (FBS), tert-butylhydroquinone (tBHQ), and tumor necrosis factor alpha (TNFα) (
TABLE-US-00006 TABLE 5 Oligonucleotides used in this study. SEQ ID Oligo name NO. Nucleotide sequence (5′->3′) L18D19NNK-F 29 CAGACAGCCGGCTACAACNNKNNKCAAGTC CTTGAACAGGGAGGTGTG L18D19NNK-R 30 CACACCTCCCTGTTCAAG GACTTGMNNMNNGTTGTAGCCGGCTGTCTG 27VSSNNK-F 31 CAAGTCCTTGAACAGGGAGGTNNKNNKNNK TTGTTTCAGAATCTCGGGGTG 27VSSNNK-R 32 CACCCCGAGATTCTGAAACAAMNNMNNMNN ACCTCCCTGTTCAAGGACTTG pBAD-F 33 ATGCCATAGCATTTTTATCC pBAD-R 34 GATTTAATCTGTATCAGG HindIII-pyr-F- 35 AATAAAGCTTGCCGCCACCATGGTCTTCAC Koz TCTCGGGGATTTT pyr-R-XhoI 36 TAATTCTCGAGTTACGCCAGAATGCGTTCA TGCAG Aka-F-HindIII- 37 ATTATAAAGCTTGCCGCCACCATGGAAGAT Kozak GCCAAAAACATTAAGA Aka-R-XhoI 38 TTATTCTCGAGTTACACGGCGATCTTGCCG TCCTTCTT Aka-F-XhoI 39 ATAACTCGAGCATGGAAGATGCCAAAAACA TTAAGA Aka-R-HindIII 40 TTGCCAAGCTTACACGGCGATCTTGCCGTC CTTCTT HindIII- 41 ATTATAAAGCTTGCCGCCACCATGGTGAGC mScarlet-F-Koz AAGGGCGAGGCAGT mScarlet-F-XhoI 42 ATAACTCGAGCATGGTGAGCAAGGGCGAGG CAGTG pyr-R-HindIII 43 TTGCCAAGCTTACGCCAGAATGCGTTCATG CA mScar-NNK-pyr- 44 GAGGGCCGCCACTCCACCGGANNKACTCTC F GGGGATTTTGTTGGG mScar-NNK-pyr- 45 CCCAACAAAATCCCCGAGAGTMNNTCCGGT R GGAGTGGCGGCCCTC
[0224] The basal promoter activities of all SRE, ARE, and NF-κB response elements were low (
[0225] Herein, the ability of the disclose triple luciferase system to monitor the simultaneous activation of two or all three labeled pathways was demonstrated. The ability to qualitatively detect three signaling activation states after treating with stimuli mixtures was demonstrated (
[0226] Next, the promoters were switched over to drive the downstream luciferase expression by using an alternative combination (NF-κB-RLuc8, SRE-OpyLuc, and ARE-Akaluc). After inducing with all stimuli (TNFα, FBS, and tBHQ), the signals from RLuc8 and OpyLuc were obvious as expected, while the signal from Akaluc was overwritten by the broad emission tailing of OpyLuc (
[0227] These data support the use of the new luciferase-luciferin pairs for assays of cell signaling pathways. Particularly, the data summarized in
Example 9
Akaluc-AkaLumine Pair is More Suitable as an Internal Control
[0228] As mentioned above, it is recommended to normalize the BL assay results by an internal control for cell number, and transfection efficiency normalizations. Another set of plasmids containing NF-κB-RLuc8, SRE-OpyLuc, and a control of the constitutively active cytomegalovirus (CMV) promoter (CMV-Akaluc) was prepared. The cells were transfected with all three plasmids and incubated with two stimuli (TNFα and FBS) for 16 h. In this case, the BL signal was selectively triggered from individual luciferase by adding its respective luciferin to intact cells (
Example 10
Analysis of Bioluminescent Ca.SUP.2+ .Biosensors
[0229] Ca.sup.2+ is one of the most important signaling cations in biological systems. Bioluminescent Ca.sup.2+ biosensors are expected to have broad applications in non-invasive imaging and drug screening. Recent studies have reported a few bioluminescent Ca.sup.2+ biosensors based on NanoLuc..sup.65-68 To address the limitations of these existing sensors, such as small dynamic range, low brightness, and/or relatively blue emission, Ca.sup.2+ biosensors based on the disclosed brighter and redder luciferase-luciferin pairs were developed. Moreover, in contrast to existing approaches, multiple Ca.sup.2+ binding elements were introduced to modulate bioluminescence through two different mechanisms. In particular, a calcium sensory element (e.g., a modified Troponin C) was sandwiched between a LumiLuc and Scarlet-I BRET pair. After testing several linker lengths, a prototypic biosensor was derived, whose bioluminescence at wavelengths longer than 600 nm increases by about 4-fold in response to Ca.sup.2+. Further, calmodulin and M13 were inserted between the residue 133 and 134 of Lumiluc to modulate its intensity, resulting in LumiCameleon1 (
Discussion of Examples 6-10
[0230] Herein, substrate selectivity was utilized to engineer a mutually orthogonal luciferase-luciferin pair for multiplexed cell-based BL assay. In combination with RLuc8 and Akaluc, this triple-color BL system features the selectivity of synthetic substrates and production of well separated emission spectra from 400 nm to 650 nm. Several advantages of previous bioluminescence technology (Table 6) were combined to develop a spectral-resolved triple-color BL system, which provides flexible and convenient approaches to monitor multiple biological events in either qualitative or quantitative manners.
[0231] New bioluminescent Ca.sup.2+ biosensors were also developed based on the modified luciferase compounds disclosed herein. These bioluminescent Ca.sup.2+ biosensors showed large bioluminescence increase in response to Ca.sup.2+, making them well suited for in vivo and in vitro applications.
TABLE-US-00007 TABLE 6 Qualitative comparison of this study and commercial luciferase reporter systems Pierce Orthogonal Promega Cypridina- Triple Dual- Promega Firefly Luciferase Luciferase Chroma- Luciferase Assay Assay Glo Dual Assay (this work) Number of 2 1 2 3 Substrates Types of 2 (Rluc, 1 (2 2 (VLuc, 3 Enzymes FLuc) CBLucs) Red FLuc) Gene low >99% low low Identity Orthogonal Yes No Yes Yes Signals Simultaneous No Yes Yes Yes Detection of 2 Signals Simultaneous No No No Yes Detection of 3 Signals Data No Yes No Yes/No Calculations Required Luminometer No Yes Yes Yes/No Filters Required Single No (CTZ, Yes Yes Yes (pyDTZ, Reagent D-luciferin) (D-luciferin) (Vargulin, pyOMeCTZ, Solution D-luciferin) Akalumine- HCl) Emission Yes No Yes Yes Signals Well- Separated Cell Lysis Yes Yes Yes Yes/No Required
[0232] By using this triple luciferase system, it was demonstrated that the activations of cell signaling can be detected simultaneously or separately from live cells in a single experiment where each individual BL signal can be distinguished from the other two luciferase-luciferin pairs. It is expected that there is also an ability to combine newly discovered luciferase-luciferin pairs.sup.61 to independently activate even more innate processes in the same sample to study the cross-talks of cellular signaling pathways. Moreover, multiplexed BL assay is compatible with modern genetically encoded fluorescent biosensors to further investigate complexed biological events via functional imaging..sup.62 The development of a such versatile tool ensures an accurate and precise analysis of signaling pathways which will extend to study other physiologically transcriptional activation and is critical to improve the design and screening of new drugs, as well as the diagnosis and treatment of disease.
REFERENCES
[0233] All references listed in the instant disclosure, including but not limited to all patents, patent applications and publications thereof, scientific journal articles, and database entries (including but not limited to UniProt, EMBL, and GENBANK® biosequence database entries and including all annotations available therein) are incorporated herein by reference in their entireties to the extent that they supplement, explain, provide a background for, and/or teach methodology, techniques, and/or compositions employed herein. The discussion of the references is intended merely to summarize the assertions made by their authors. No admission is made that any reference (or a portion of any reference) is relevant prior art. Applicants reserve the right to challenge the accuracy and pertinence of any cited reference.
[0234] 1. Rodriguez, E. A., Campbell, R. E., Lin, J. Y., Lin, M. Z., Miyawaki, A., Palmer, A. E., Shu, X., Zhang, J., and Tsien, R. Y. (2017) The Growing and Glowing Toolbox of Fluorescent and Photoactive Proteins, Trends Biochem. Sci. 42, 111-129.
[0235] 2. Sadikot, R. T., and Blackwell, T. S. (2005) Bioluminescence imaging, Proc. Am. Thorac. Soc. 2, 537-540, 511-532.
[0236] 3. Mezzanotte, L., van 't Root, M., Karatas, H., Goun, E. A., and Lowik, C. (2017) In Vivo Molecular Bioluminescence Imaging: New Tools and Applications, Trends Biotechnol. 35, 640-652.
[0237] 4. Yao, Z., Zhang, B. S., and Prescher, J. A. (2018) Advances in bioluminescence imaging: new probes from old recipes, Curr. Opin. Chem. Biol. 45, 148-156.
[0238] 5. Adams, S. T., Jr., and Miller, S. C. (2014) Beyond D-luciferin: expanding the scope of bioluminescence imaging in vivo, Curr. Opin. Chem. Biol. 21c, 112-120.
[0239] 6. Iwano, S., Sugiyama, M., Hama, H., Watakabe, A., Hasegawa, N., Kuchimaru, T., Tanaka, K. Z., Takahashi, M., Ishida, Y., Hata, J., Shimozono, S., Namiki, K., Fukano, T., Kiyama, M., Okano, H., Kizaka-Kondoh, S., McHugh, T. J., Yamamori, T., Hioki, H., Maki, S., and Miyawaki, A. (2018) Single-cell bioluminescence imaging of deep tissue in freely moving animals, Science 359, 935-939.
[0240] 7. Yeh, H. W., Karmach, O., Ji, A., Carter, D., Martins-Green, M. M., and Ai, H. W. (2017) Red-shifted luciferase-luciferin pairs for enhanced bioluminescence imaging, Nat. Methods 14, 971-974.
[0241] 8. Yeh, H. W., Wu, T., Chen, M., and Ai, H. (2019) Identification of Factors Complicating Bioluminescence Imaging, Biochemistry minor revision as of Feb. 1, 2019, reprint from BioRxiv: https://doi.org/10.1101/511501.
[0242] 9. Saito, R., Kuchimaru, T., Higashi, S., Lu, S. W., Kiyama, M., Iwano, S., Obata, R., Hirano, T., Kizaka-Kondoh, S., and Maki, S. A. (2018) Synthesis and luminescence properties of near-infrared N-heterocyclic luciferin analogues for in vivo optical imaging, B Chem Soc Jpn. doi:10.1246/bcsj.20180350.
[0243] 10. Haddock, S. H., Moline, M. A., and Case, J. F. (2010) Bioluminescence in the sea, Ann Rev Mar Sci 2, 443-493.
[0244] 11. Inouye, S., and Sasaki, S. (2007) Overexpression, purification and characterization of the catalytic component of Oplophorus luciferase in the deep-sea shrimp, Oplophorus gracilirostris, Protein Expr. Purif. 56, 261-268.
[0245] 12. Hall, M. P., Unch, J., Binkowski, B. F., Valley, M. P., Butler, B. L., Wood, M. G., Otto, P., Zimmerman, K., Vidugiris, G., Machleidt, T., Robers, M. B., Benink, H. A., Eggers, C. T., Slater, M. R., Meisenheimer, P. L., Klaubert, D. H., Fan, F., Encell, L. P., and Wood, K. V. (2012) Engineered luciferase reporter from a deep sea shrimp utilizing a novel imidazopyrazinone substrate, ACS Chem. Biol. 7, 1848-1857.
[0246] 13. Weissleder, R., and Ntziachristos, V. (2003) Shedding light onto live molecular targets, Nat. Med. 9, 123-128.
[0247] 14. Chu, J., Oh, Y, Sens, A., Ataie, N., Dana, H., Macklin, J. J., Laviv, T., Welf, E. S., Dean, K. M., Zhang, F., Kim, B. B., Tang, C. T., Hu, M., Baird, M. A., Davidson, M. W., Kay, M. A., Fiolka, R., Yasuda, R., Kim, D. S., Ng, H. L., and Lin, M. Z. (2016) A bright cyan-excitable orange fluorescent protein facilitates dual-emission microscopy and enhances bioluminescence imaging in vivo, Nat. Biotechnol. 34, 760-767.
[0248] 15. Suzuki, K., Kimura, T., Shinoda, H., Bai, G., Daniels, M. J., Arai, Y, Nakano, M., and Nagai, T. (2016) Five colour variants of bright luminescent protein for real-time multicolour bioimaging, Nat. Commun. 7, 13718.
[0249] 16. Teranishi, K., and Shimomura, O. (1997) Solubilizing coelenterazine in water with hydroxypropyl-beta-cyclodextrin, Biosci. Biotechnol. Biochem. 61, 1219-1220.
[0250] 17. Morse, D., and Tannous, B. A. (2012) A water-soluble coelenterazine for sensitive in vivo imaging of coelenterate luciferases, Mol. Ther. 20, 692-693.
[0251] 18. Shakhmin, A., Hall, M. P., Machleidt, T., Walker, J. R., Wood, K. V, and Kirkland, T. A. (2017) Coelenterazine analogues emit red-shifted bioluminescence with NanoLuc, Org Biomol Chem. 15, 8559-8567.
[0252] 19. Shakhmin, A., Hall, M. P., Walker, J. R., Machleidt, T., Binkowski, B. F., Wood, K. V, and Kirkland, T. A. (2016) Three Efficient Methods for Preparation of Coelenterazine Analogues, Chem-Eur J 22, 10369-10375.
[0253] 20. Jedinak, L., Zatopkova, R., Zemankova, H., Sustkova, A., and Cankar, P. (2017) The Suzuki-Miyaura Cross-Coupling Reaction of Halogenated Aminopyrazoles: Method Development, Scope, and Mechanism of Dehalogenation Side Reaction, J. Org. Chem. 82, 157-169.
[0254] 21. Adamczyk, M., Akireddy, S. R., Johnson, D. D., Mattingly, P. G., Pan, Y, and Reddy, R. E. (2003) Synthesis of 3,7-dihydroimidazo[1,2a]pyrazine-3-ones and their chemiluminescent properties, Tetrahedron 59, 8129-8142.
[0255] 22. Kerns, E. H., Di, L., and Carter, G. T. (2008) In vitro solubility assays in drug discovery, Curr. Drug Metab. 9, 879-885.
[0256] 23. Yeh, H. W., and Ai, H. W. (2019) Development and Applications of Bioluminescent and Chemiluminescent Reporters and Biosensors, Annu. Rev. Anal. Chem. 12, DOI: 10.1146/annurev-anchem-061318-115027.
[0257] 24. Rogers, K. L., Picaud, S., Roncali, E., Boisgard, R., Colasante, C., Stinnakre, J., Tavitian, B., and Brulet, P. (2007) Non-invasive in vivo imaging of calcium signaling in mice, PLoS One 2, e974.
[0258] 25. Zinn, K. R., Chaudhuri, T. R., Szafran, A. A., O′Quinn, D., Weaver, C., Dugger, K., Lamar, D., Kesterson, R. A., Wang, X., and Frank, S. J. (2008) Noninvasive bioluminescence imaging in small animals, ILAR J. 49, 103-115.
[0259] 26. Inouye, S., Sato, J., Sahara-Miura, Y, Yoshida, S., and Hosoya, T. (2014) Luminescence enhancement of the catalytic 19 kDa protein (KAZ) of Oplophorus luciferase by three amino acid substitutions, Biochem. Biophys. Res. Commun. 445, 157-162.
[0260] 27. Tantama, M., Martinez-Francois, J. R., Mongeon, R., and Yellen, G. (2013) Imaging energy status in live cells with a fluorescent biosensor of the intracellular ATP-to-ADP ratio, Nat. Commun. 4, 2550.
[0261] 28. Morton, C. L., and Houghton, P. J. (2007) Establishment of human tumor xenografts in immunodeficient mice, Nat. Protoc. 2, 247-250.
[0262] 29. Bindels, D. S., Haarbosch, L., van Weeren, L., Postma, M., Wiese, K. E., Mastop, M., Aumonier, S., Gotthard, G., Royant, A., Hink, M. A., and Gadella, T. W., Jr. (2017) mScarlet: a bright monomeric red fluorescent protein for cellular imaging, Nat. Methods 14, 53-56.
[0263] 30. Salin, K., Auer, S. K., Rey, B., Selman, C., and Metcalfe, N. B. (2015) Variation in the link between oxygen consumption and ATP production, and its relevance for animal performance, P Roy Soc B-Biol Sci 282, 14-22.
[0264] 31. Greenwald, E. C., Mehta, S., and Zhang, J. (2018) Genetically Encoded Fluorescent Biosensors Illuminate the Spatiotemporal Regulation of Signaling Networks, Chemical reviews 118, 11707-11794.
[0265] 32. Chu, J., Oh, Y., Sens, A., Ataie, N., Dana, H., Macklin, J. J., Laviv, T., Welf, E. S., Dean, K. M., Zhang, F., Kim, B. B., Tang, C. T., Hu, M., Baird, M. A., Davidson, M. W., Kay, M. A., Fiolka, R., Yasuda, R., Kim, D. S., Ng, H. L., and Lin, M. Z. (2016) A bright cyan-excitable orange fluorescent protein facilitates dual-emission microscopy and enhances bioluminescence imaging in vivo, Nat. Biotechnol. 34, 760-767.
[0266] 33. Yeh, H. W., Karmach, O., Ji, A., Carter, D., Martins-Green, M. M., and Ai, H. W. (2017) Red-shifted luciferase-luciferin pairs for enhanced bioluminescence imaging, Nat. Methods 14, 971-974.
[0267] 34. Suzuki, K., Kimura, T., Shinoda, H., Bai, G., Daniels, M. J., Arai, Y., Nakano, M., and Nagai, T. (2016) Five colour variants of bright luminescent protein for real-time multicolour bioimaging, Nat. Commun. 7, 13718.
[0268] 35. Jiang, T. Y., Yang, X. Y., Zhou, Y. B., Yampolsky, I., Du, L. P., and Li, M. Y. (2017) New bioluminescent coelenterazine derivatives with various C-6 substitutions, Org. Biomol. Chem. 15, 7008-7018.
[0269] 36. Adamczyk, M., Akireddy, S. R., Johnson, D. D., Mattingly, P. G., Pan, Y., and Reddy, R. E. (2003) Synthesis of 3,7-dihydroimidazo[1,2a]pyrazine-3-ones and their chemiluminescent properties, Tetrahedron 59, 8129-8142.
[0270] 37. Suzuki, K.; Nagai, T. Curr Opin Biotech 2017, 48, 135-141.
[0271] 38. Yeh, H.-W.; Ai, H.-W. Annual Review of Analytical Chemistry 2019. https://doi.org/10.1146/annurev-anchem-061318-115027
[0272] 39. Naylor, L. H. Biochem Pharmacol 1999, 58, 749-757.
[0273] 40. Miraglia, L. J.; King, F. J.; Damoiseaux, R. Comb Chem High Throughput Screen 2011, 14, 648-657.
[0274] 41. Ohmiya, Y. Comb Chem High Throughput Screen 2015, 18, 937-945.
[0275] 42. Michelini, E.; Cevenini, L.; Mezzanotte, L.; Coppa, A.; Roda, A. Anal Bioanal Chem 2010, 398, 227-238.
[0276] 43. Thorne, N.; Inglese, J.; Auldl, D. S. Chemistry & Biology 2010, 17, 646-657.
[0277] 44. Michelini, E.; Cevenini, L.; Mezzanotte, L.; Ablamsky, D.; Southworth, T.; Branchini, B.; Roda, A. Anal Chem 2008, 80, 260-267.
[0278] 45. Rathbun, C. M.; Porterfield, W. B.; Jones, K. A.; Sagoe, M. J.; Reyes, M. R.; Hua, C. T.; Prescher, J. A. ACS Cent Sci 2017, 3, 1254-1261.
[0279] 46. Jones, K. A.; Porterfield, W. B.; Rathbun, C. M.; McCutcheon, D. C.; Paley, M. A.; Prescher, J. A. Journal of the American Chemical Society 2017. 139, 2351-2358.
[0280] 47. Heise, K.; Oppermann, H.; Meixensberger, J.; Gebhardt, R.; Gaunitz, F. Assay Drug Dev Techn 2013, 11, 244-252.
[0281] 48. Mezzanotte, L.; Que, I.; Kaijzel, E.; Branchini, B.; Roda, A.; Lowik, C. Plos One 2011, 6, e19277.
[0282] 49. Yasunaga, M.; Nakajima, Y.; Ohmiya, Y. Anal Bioanal Chem 2014, 406, 5735-5742.
[0283] 50. Mezzanotte, L.; An, N.; Mol, I. M.; Lowik, C. W.; Kaijzel, E. L. Plos One 2014, 9, e85550.
[0284] 51. Nakajima, Y.; Kimura, T.; Sugata, K.; Enomoto, T.; Asakawa, A.; Kubota, H.; Ikeda, M.; Ohmiya, Y. Biotechniques 2005, 38, 891-894.
[0285] 52. Branchini, B. R.; Southworth, T. L.; Fontaine, D. M.; Kohrt, D.; Florentine, C. M.; Grossel, M. J. Sci Rep-Uk 2018, 8.
[0286] 53. Yeh, H. W.; Karmach, O.; Ji, A.; Carter, D.; Martins-Green, M. M.; Ai, H. W. Nat Methods 2017, 14, 971-974.
[0287] 54. Loening, A. M.; Wu, A. M.; Gambhir, S. S. Nat Methods 2007, 4, 641-643.
[0288] 55. Rumyantsev, K. A.; Turoverov, K. K.; Verkhusha, V. V. Sci Rep-Uk 2016, 6, 36588.
[0289] 56. Wu, C.; Nakamura, H.; Murai, A.; Shimomura, O. Tetrahedron Lett 2001, 42, 2997-3000.
[0290] 57. Iwano, S.; Sugiyama, M.; Hama, H.; Watakabe, A.; Hasegawa, N.; Kuchimaru, T.; Tanaka, K. Z.; Takahashi, M.; Ishida, Y.; Hata, J.; Shimozono, S.; Namiki, K.; Fukano, T.; Kiyama, M.; Okano, H.; Kizaka-Kondoh, S.; McHugh, T. J.; Yamamori, T.; Hioki, H.; Maki, S., et al. Science 2018, 359, 935-939.
[0291] 58. Hill, C. S.; Treisman, R. Embo J 1995, 14, 5037-5047.
[0292] 59. Nguyen, T.; Nioi, P.; Pickett, C. B. J Biol Chem 2009, 284, 13291-13295.
[0293] 60. Badr, C. E.; Niers, J. M.; Tjon-Kon-Fat, L. A.; Noske, D. P.; Wurdinger, T.; Tannous, B. A. Molecular Imaging 2009, 8, 278-290.
[0294] 61. Kotlobay, A. A.; Sarkisyan, K. S.; Mokrushina, Y. A.; Marcet-Houben, M.; Serebrovskaya, E. O.; Markina, N. M.; Gonzalez Somermeyer, L.; Gorokhovatsky, A. Y.; Vvedensky, A.; Purtov, K. V.; Petushkov, V. N.; Rodionova, N. S.; Chepurnyh, T. V.; Fakhranurova, L. I.; Guglya, E. B.; Ziganshin, R.; Tsarkova, A. S.; Kaskova, Z. M.; Shender, V.; Abakumov, M., et al. Proceedings of the National Academy of Sciences of the United States of America 2018, 115, 12728-12732.
[0295] 62. Greenwald, E. C.; Mehta, S.; Zhang, J. Chemical reviews 2018, 118, 11707-11794.
[0296] 63. Yeh, H. W., Karmach, O., Ji, A., Carter, D., Martins-Green, M. M., and Ai, H. W. (2017) Red-shifted luciferase-luciferin pairs for enhanced bioluminescence imaging, Nat Methods 14, 971-974.
[0297] 64. Adamczyk, M., Akireddy, S. R., Johnson, D. D., Mattingly, P. G., Pan, Y., and Reddy, R. E. (2003) Synthesis of 3,7-dihydroimidazo[1,2a]pyrazine-3-ones and their chemiluminescent properties, Tetrahedron 59, 8129-8142.
[0298] 65. Suzuki, K.; Kimura, T.; Shinoda, H.; Bai, G.; Daniels, M. J.; Arai, Y.; Nakano, M.; Nagai, T. Five colour variants of bright luminescent protein for real-time multicolour bioimaging. Nat. Commun. 2016, 7, 13718.
[0299] 66. Qian, Y.; Rancic, V.; Wu, J.; Ballanyi, K.; Campbell, R. E. A Bioluminescent Ca(2+) Indicator Based on a Topological Variant of GCaMP6s. ChemBioChem 2018.
[0300] 67. Inagaki, S.; Tsutsui, H.; Suzuki, K.; Agetsuma, M.; Arai, Y.; Jinno, Y.; Bai, G.; Daniels, M. J.; Okamura, Y.; Matsuda, T. et al. Genetically encoded bioluminescent voltage indicator for multi-purpose use in wide range of bioimaging. Scientific reports 2017, 7, 42398.
[0301] 68. Oh, Y.; Park, Y.; Cho, J. H.; Wu, H.; Paulk, N. K.; Liu, L. X.; Kim, N.; Kay, M. A.; Wu, J. C.; Lin, M. Z. An orange calcium-modulated bioluminescent indicator for non-invasive activity imaging. Nat Chem Biol 2019, 15 (5), 433.
[0302] It will be understood that various details of the presently disclosed subject matter can be changed without departing from the scope of the presently disclosed subject matter. Furthermore, the foregoing description is for the purpose of illustration only, and not for the purpose of limitation.