Fructose-4-epimerase and method of preparing tagatose using the same

11459594 · 2022-10-04

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are a fructose-4-epimerase variant having tagatose conversion activity, and a method of producing tagatose using the same.

Claims

1. A fructose-4-epimerase variant comprising substitution of another amino acid for a threonine (T) residue at position 124 from the N-terminus of fructose-4-epimerase including an amino acid sequence of SEQ ID NO: 1, wherein the variant includes an amino acid sequence having at least 60% sequence identity to the amino acid sequence of SEQ ID NO: 1.

2. The fructose-4-epimerase variant of claim 1, wherein the another amino acid is a polar amino acid or a nonpolar amino acid, except threonine (T).

3. The fructose-4-epimerase variant of claim 1, wherein the variant has further substitution of another amino acid for an amino acid at position 390.

4. The fructose-4-epimerase variant of claim 3, wherein the substituted amino acid at position 390 is a nonpolar amino acid, an acidic amino acid, or a basic amino acid.

5. The fructose-4-epimerase variant of claim 1, wherein the variant has further substitution of another amino acid for an amino acid at position 97.

6. The fructose-4-epimerase variant of claim 5, wherein the another amino acid is tyrosine (Y).

7. The fructose-4-epimerase variant of claim 5, wherein the variant has further substitution of another amino acid for any one of amino acids at positions 33, 80, 102, 137, 210, and 318.

8. The fructose-4-epimerase variant of claim 7, wherein the another amino acid is selected from the group consisting of a polar amino acid, a nonpolar amino acid, an acidic amino acid, and a basic amino acid.

9. The fructose-4-epimerase variant of claim 1, wherein the variant has further substitution of another amino acid for an amino acid at position 97 and substitution of another amino acid for an amino acid at position 367.

10. The fructose-4-epimerase variant of claim 9, wherein the another amino acid at position 97 is tyrosine (Y) and another amino acid at position 367 is valine (V).

11. The fructose-4-epimerase variant of claim 9, wherein the variant has further substitution of another amino acid for any one of amino acids at positions 102, 137, 210, 239, and 318.

12. The fructose-4-epimerase variant of claim 11, wherein the another amino acid is selected from the group consisting of a nonpolar amino acid, a polar amino acid, and a basic amino acid.

13. The fructose-4-epimerase variant of claim 9, wherein the variant has further substitution of another amino acid for an amino acid at position 33.

14. The fructose-4-epimerase variant of claim 13, wherein the another amino acid is arginine (R).

15. The fructose-4-epimerase variant of claim 13, wherein the variant has further substitution of another amino acid for any one of amino acids at positions 80, 102, 210, and 318.

16. The fructose-4-epimerase variant of claim 15, wherein the another amino acid is selected from the group consisting of a basic amino acid, a nonpolar amino acid, and a polar amino acid.

17. The fructose-4-epimerase variant of claim 9, wherein the variant has further substitution of another amino acid for an amino acid at position 80.

18. The fructose-4-epimerase variant of claim 17, wherein the another amino acid is arginine (R).

19. The fructose-4-epimerase variant of claim 17, wherein the variant has further substitution of another amino acid for any one of amino acids at positions 102, 137, and 210.

20. The fructose-4-epimerase variant of claim 19, wherein the another amino acid is a nonpolar amino acid or a polar amino acid.

21. The fructose-4-epimerase variant of claim 9, wherein the variant has further substitution of another amino acid for an amino acid at position 210 and substitution of another amino acid for an amino acid at position 318.

22. The fructose-4-epimerase variant of claim 21, wherein the another amino acid at position 210 is serine (S) and another amino acid at position 318 is glycine (G).

23. A polynucleotide encoding the fructose-4-epimerase variant of claim 1.

24. A vector comprising the polynucleotide of claim 23.

25. A microorganism comprising the fructose-4-epimerase variant of claim 1; a polynucleotide encoding the fructose-4-epimerase variant; or a vector including the polynucleotide.

26. A composition for producing tagatose, the composition comprising the fructose-4-epimerase variant of claim 1; a microorganism expressing the fructose-4-epimerase variant; or a culture of the microorganism.

27. The composition for producing tagatose of claim 26, the composition further comprising fructose.

28. A method of producing tagatose, the method comprising the step of converting fructose into tagatose by contacting fructose with the fructose-4-epimerase variant of claim 1; the microorganism including the fructose-4-epimerase variant; or the culture thereof.

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1 shows HPLC chromatography results showing that tagatose-bisphosphate aldolase (KO_F4E) prepared in one embodiment of the present disclosure has fructose-4-epimerase activity;

(2) FIG. 2 shows results of measuring thermal stability of variants at 60° C. over time, wherein the variants have variation of threonine at position 124 prepared in one embodiment of the present disclosure;

(3) FIG. 3 shows results of measuring degree of activity over time under a temperature condition of 60° C., wherein the activity is fructose-4-epimerization activity of variants prepared in one embodiment of the present disclosure; and

(4) FIG. 4 shows results of measuring thermal stability at 60° C. over time, wherein the thermal stability is thermal stability of variants prepared in one embodiment of the present disclosure.

BEST MODE

(5) The present disclosure will be described in detail as follows. Meanwhile, each description and embodiment disclosed in this disclosure may also be applied to other descriptions and embodiments. That is, all combinations of various elements disclosed in this disclosure fall within the scope of the present disclosure. Further, the scope of the present disclosure is not limited by the specific description described below.

(6) To achieve the objects, one aspect of the present disclosure provides a fructose-4-epimerase variant including one or more amino acid substitutions in an amino acid sequence of fructose-4-epimerase.

(7) To achieve the objects, another aspect of the present disclosure provides a fructose-4-epimerase variant including one or more amino acid substitutions in an amino acid sequence of SEQ ID NO: 1.

(8) As used herein, the term “fructose-4-epimerase” is an enzyme having fructose-4-epimerization activity to convert fructose into tagatose by epimerization at C4 position of fructose. With respect to the objects of the present disclosure, fructose-4-epimerase may include any enzyme without limitation, as long as it is able to produce tagatose using fructose as a substrate, and it may be used interchangeably with ‘D-fructose C4-epimerase’. For example, the fructose-4-epimerase may include tagatose bisphosphate aldolase or tagatose-bisphosphate aldolase class II accessory protein belonging to EC 4.1.2.40 in a known database KEGG (Kyoto Encyclopedia of Genes and Genomes), as long as it has activity to convert fructose as a substrate into tagatose. The tagatose-bisphosphate aldolase is known as an enzyme that produces glycerone phosphate and D-glyceraldehyde 3-phosphate from D-tagatose 1,6-bisphosphate as a substrate, as in the following [Reaction Scheme 1].
D-tagatose1,6-bisphosphate<=>glycerone phosphate+D-glyceraldehyde3-phosphate  [Reaction Scheme 1]

(9) For example, the fructose-4-epimerase may include tagatose-6-phosphate kinase (EC 2.7.1.144), as long as it has activity to convert fructose as a substrate into tagatose. The tagatose-6-phosphate kinase is known as an enzyme that produces ADP and D-tagatose 1,6-bisphosphate from ATP and D-tagatose 6-phosphate as a substrate, as in the following [Reaction Scheme 2].
ATP+D-tagatose 6-phosphate<=>ADP+D-tagatose 1,6-bisphosphate  [Reaction Scheme 2]

(10) The activity of fructose-4-epimerase may have a conversion rate of tagatose from fructose as a substrate (conversion rate=tagatose weight/initial fructose weight*100) of 0.01% or more, specifically 0.1% or more, and more specifically 0.3% or more. Much more specifically, the conversion rate may be in the range of 0.01% to 100% or in the range of 0.1% to 50%.

(11) The fructose-4-epimerase, tagatose-bisphosphate aldolase, or tagatose-6-phosphate kinase of the present disclosure may be an enzyme derived from a heat-resistant microorganism or a variant thereof, for example, an enzyme derived from Kosmotoga olearia, Thermanaerothrix daxensis, Rhodothermus profundi, Rhodothermus marinus, Limnochorda pilosa, Caldithrix abyssi, Caldilinea aerophila, Thermoanaerobacter thermohydrosulfuricus, Acidobacteriales bacterium, Caldicellulosiruptor kronotskyensis, Thermoanaerobacterium thermosaccharolyticum, or Pseudoalteromonas sp. H103, or a variant thereof, but is not limited thereto, specifically, an enzyme derived from Kosmotoga olearia (SEQ ID NO: 1), Thermoanaerobacterium thermosaccharolyticum (SEQ ID NO: 3), Pseudoalteromonas sp. H103 (SEQ ID NO: 5), Thermanaerothrix daxensis (SEQ ID NO: 7), Acidobacteriales bacterium (SEQ ID NO: 9), Rhodothermus profundi (SEQ ID NO: 11), Rhodothermus marinus (SEQ ID NO: 13), Limnochorda pilosa (SEQ ID NO: 15), Caldithrix abyssi (SEQ ID NO: 17), Caldicellulosiruptor kronotskyensis (SEQ ID NO: 19), Caldilinea aerophila (SEQ ID NO: 21), or Thermoanaerobacter thermohydrosulfuricus (SEQ ID NO: 23), or a variant thereof, but is not limited thereto.

(12) Specifically, the fructose-4-epimerase, tagatose-bisphosphate aldolase, or tagatose-6-phosphate kinase may include an amino acid sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, or 23, or an amino acid sequence having 70% or higher homology or identity, but is not limited thereto. More specifically, the fructose-4-epimerase of the present disclosure may include a polypeptide having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity to the amino acid sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, or 23. Further, it is apparent that an accessory protein having an amino acid sequence having the homology or identity and exhibiting the efficacy corresponding to the above protein is also included in the scope of the present disclosure, although a partial sequence of the amino acid sequence is deleted, modified, substituted, or added.

(13) In the present disclosure, SEQ ID NO: 1 means an amino acid sequence having fructose-4-epimerase activity. The sequence of SEQ ID NO: 1 may be obtained from a known database, GenBank of NCBI or KEGG (Kyoto Encyclopedia of Genes and Genomes). For example, the sequence may be derived from Kosmotoga olearia, more specifically, a polypeptide/protein including the amino acid sequence of SEQ ID NO: 1, but is not limited thereto. Further, a sequence having activity identical to the above amino acid sequence may be included without limitation. Further, the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 70% or higher homology or identity thereto may be included, but is not limited thereto. Specifically, the amino acid sequence may include the amino acid sequence having SEQ ID NO: 1 and an amino acid sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher homology or identity to SEQ ID NO: 1. Further, it is apparent that a protein having an amino acid sequence having the homology or identity and exhibiting the efficacy corresponding to the above protein is also included in the scope of the present disclosure, although a partial sequence of the amino acid sequence is deleted, modified, substituted, or added.

(14) That is, although described as “a protein having an amino acid sequence of a particular SEQ ID NO” in the present disclosure, the protein may have an activity that is identical or similar to that of a protein consisting of an amino acid sequence of the corresponding SEQ ID NO. In such a case, it is obvious that any proteins having an amino acid sequence with deletion, modification, substitution, conservative substitution, or addition in part of the sequence also can be used in the present disclosure. For example, in the case of having the activity that is the same as or corresponding to that of the modified protein, it does not exclude an addition of a sequence upstream or downstream of the amino acid sequence, which does not alter the function of the protein, a mutation that may occur naturally, a silent mutation thereof, or a conservative constitution, and even when the sequence addition or mutation is present, it obviously belongs to the scope of the present disclosure.

(15) As used herein, the term “tagatose” is, a kind of ketohexose which is a monosaccharide, used interchangeably with “D-tagatose”.

(16) As used herein, the term “fructose-4-epimerase variant” means a fructose-4-epimerase variant including one or more amino acid substitutions in the amino acid sequence of the polypeptide having fructose-4-epimerase activity.

(17) The fructose-4-epimerase variant may include one variation, two variations, three variations, four variations, or five variations including substitution of another amino acid for an amino acid at position 124 in the amino acid sequence of SEQ ID NO: 1, but is not limited thereto.

(18) Specifically, provided is a fructose-4-epimerase variant including i) substitution of another amino acid for the amino acid at position 124, ii) substitution of another amino acids for amino acids at positions 124 and 390, iii) substitution of another amino acids for amino acids at positions 124 and 97, iv) substitution of another amino acids for amino acids at positions 124 and 97, and further substitution of another amino acid for any one of amino acids at positions 33, 80, 102, 137, 210, 318, and 367, v) substitution of another amino acids for amino acids at positions 124, 97, and 367, and further substitution of another amino acid for any one of amino acids at positions 33, 80, 102, 137, 210, 239, and 318, vi) substitution of another amino acids for amino acids at positions 124, 97, 367, and 33, and further substitution of another amino acid for any one of amino acids at positions 80, 102, 210, and 318, vii) substitution of another amino acids for amino acids at positions 124, 97, 367, and 80, and further substitution of another amino acid for any one of amino acids at positions 102, 137, and 210, or viii) substitution of another amino acids for amino acids at positions 124, 97, 367, 210, and 318, but is not limited thereto.

(19) As used herein, ‘position N’ may include position N and an amino acid position corresponding to the position N, specifically, an amino acid position corresponding to any amino acid residue in a mature polypeptide disclosed in a particular amino acid sequence. The particular amino acid sequence may be any one of the amino acid sequences of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, and 23.

(20) The amino acid position corresponding to the position N or the amino acid position corresponding to any amino acid residue in the mature polypeptide disclosed in the particular amino acid sequence may be determined using the Needleman-Wunsch algorithm (literature [Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453]), specifically, version 5.0.0 or later, as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, literature [Rice et al., 2000, Trends Genet. 16:276-277]). Parameters used may be gap open penalty of 10, gap extension penalty of 0.5, and EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix.

(21) Identification of the amino acid residue at the amino acid position corresponding to the position N or at the amino acid position corresponding to any amino acid residue in the mature polypeptide disclosed in the particular amino acid sequence may be determined by alignment of multiple polypeptide sequences using several computer programs including, but not limited to, MUSCLE (multiple sequence comparison by log-expectation; version 3.5 or later; literature [Edgar, 2004, Nucleic Acids Research 32: 1792-1797]), MAFFT (version 6.857 or later; literature [Katoh and Kuma, 2002, Nucleic Acids Research 30: 3059-3066]; literature [Katoh et al., 2005, Nucleic Acids Research 33: 511-518]; literature [Katoh and Toh, 2007, Bioinformatics 23: 372-374]; literature [Katoh et al., 2009, Methods in Molecular Biology 537: 39-64]; literature [Katoh and Toh, 2010, Bioinformatics 26: 1899-1900]), and EMBOSS EMMA employing ClustalW (1.83 or later; literature [Thompson et al., 1994, Nucleic Acids Research 22: 4673-4680]), using their respective default parameters.

(22) When the other polypeptide has diverged from the mature polypeptide of the particular amino acid sequence such that traditional sequence-based comparison fails to detect their relationship (literature [Lindahl and Elofsson, 2000, J. Mol. Biol. 295: 613-615]), other pairwise sequence comparison algorithms may be used. Greater sensitivity in sequence-based searching may be attained using search programs that utilize probabilistic representations of polypeptide families (profiles) to search databases. For example, PSI-BLAST program generates profiles through an iterative database search process and is capable of detecting remote homologs (literature [Atschul et al., 1997, Nucleic Acids Res. 25: 3389-3402]). Even greater sensitivity may be achieved if the family or superfamily for the polypeptide has one or more representatives in the protein structure databases. Programs such as GenTHREADER (literature [Jones, 1999, J. Mol. Biol. 287: 797-815]; literature [McGuffin and Jones, 2003, Bioinformatics 19: 874-881]) utilize information from a variety of sources (PSI-BLAST, secondary structure prediction, structural alignment profiles, and solvation potentials) as input to a neural network that predicts the structural folding for a query sequence. Similarly, the method of literature [Gough et al., 2000, J. Mol. Biol. 313: 903-919] may be used to align a sequence of unknown structure with the superfamily models present in the SCOP database. These alignments may in turn be used to generate homology, similarity, or identity models for the polypeptide, and such models may be assessed for accuracy using a variety of tools developed for that purpose.

(23) The ‘another polypeptide’ is not limited, as long as it is an amino acid other than the amino acid corresponding to the position. ‘Amino acids’ are classified into four types of acidic, basic, polar (hydrophilic), and nonpolar (hydrophobic) amino acids according to properties of their side chains.

(24) Specifically, the variant may be a protein having substitution of one or more amino acids selected from the group consisting of nonpolar amino acids including glycine (G), alanine (A), valine (V), leucine (L), isoleucine (I), methionine (M), phenylalanine (F), tryptophan (W), and proline (P); polar amino acids including serine (S), threonine (T), cysteine (C), tyrosine (Y), aspartic acid (D), and glutamine (Q); acidic amino acids including asparagine (N) and glutamic acid (E); and basic amino acids including lysine (K), arginine (R), and histidine (H) for an amino acid at each position of the amino acid sequence of SEQ ID NO: 1, but is not limited thereto.

(25) Specifically, the variant may have substitution of a polar amino acid or nonpolar amino acid, except threonine (T), for the threonine (T) residue at position 124 from the N-terminus of the fructose-4-epimerase including the amino acid sequence of SEQ ID NO: 1, wherein the polar amino acid or nonpolar amino acid may be selected from the group consisting of tryptophan (W), cysteine (C), and tyrosine (Y), but is not limited thereto.

(26) The variant having substitution of another amino acid for the threonine (T) residue at position 124 from the N-terminus of the fructose-4-epimerase including the amino acid sequence of SEQ ID NO: 1 may have further substitution of a nonpolar amino acid, acidic amino acid, or basic amino acid, except threonine (T), for the amino acid at position 390, wherein the nonpolar amino acid, acidic amino acid, or basic amino acid may be selected from the group consisting of lysine (K), glycine (G), valine (V), leucine (L), histidine (H), aspartic acid (D), isoleucine (I), and arginine (R), but is not limited thereto.

(27) The variant having substitution of another amino acid for the threonine (T) residue at position 124 from the N-terminus of the fructose-4-epimerase including the amino acid sequence of SEQ ID NO: 1 may have further substitution of a polar amino acid, except asparagine (N), for the amino acid at position 97, wherein the polar amino acid may be tyrosine (Y), but is not limited thereto.

(28) The variant having substitution of a polar amino acid or nonpolar amino acid, except threonine (T), for the threonine (T) residue at position 124 and substitution of a polar amino acid, except asparagine (N), for the amino acid at position 97 from the N-terminus of the fructose-4-epimerase including the amino acid sequence of SEQ ID NO: 1 may have further substitution of another amino acid for any one amino acid at positions 33, 80, 102, 137, 210, and 318, wherein the another amino acid may be selected from the group consisting of glycine (G), alanine (A), arginine (R), valine (V), leucine (L), isoleucine (I), threonine (T), proline (P), serine (S), tryptophan (W), phenylalanine (F), histidine (H), cysteine (C), tyrosine (Y), lysine (K), aspartic acid (D), and glutamic acid (E), but is not limited thereto. Specifically, the variant may have substitution of alanine (A), serine (S), tryptophan (W), glycine (G), phenylalanine (F), or tyrosine (Y) for the amino acid at position 33, substitution of phenylalanine (F), tyrosine (Y), arginine (R), phenylalanine (F), cysteine (C), threonine (T), serine (S), leucine (L), lysine (K), or glutamic acid (E) for the amino acid at position 80, substitution of threonine (T), alanine (A), proline (P), serine (S), leucine (L), isoleucine (I), or tryptophan (W) for the amino acid at position 102, substitution of cysteine (C), glutamic acid (E), glycine (G), arginine (R), or phenylalanine (F) for the amino acid at position 137, substitution of aspartic acid (D), serine (S), lysine (K), valine (V), leucine (L), or glycine (G) for the amino acid at position 210, substitution of histidine (H), glycine (G), isoleucine (I), alanine (A), or cysteine (C) for the amino acid at position 318, but is not limited thereto. The variant having substitution of a polar amino acid or nonpolar amino acid, except threonine (T), for the threonine (T) residue at position 124, substitution of a polar amino acid, except asparagine (N), for the amino acid at position 97, substitution of a polar amino acid, except threonine (T), for the amino acid at position 210, substitution of a basic amino acid, except threonine (T), for the amino acid at position 390 from the N-terminus of the fructose-4-epimerase including the amino acid sequence of SEQ ID NO: 1 may have further substitution of a nonpolar amino acid, except proline (P), for the amino acid at position 318, wherein the nonpolar amino acid may be glycine (G), but is not limited thereto.

(29) The variant having substitution of a polar amino acid or nonpolar amino acid, except threonine (T), for the threonine (T) residue at position 124 from the N-terminus of the fructose-4-epimerase including the amino acid sequence of SEQ ID NO: 1 may have further substitution of a polar amino acid, except asparagine (N), for the amino acid at position 97, and substitution of a nonpolar amino acid, except asparagine (N), for the amino acid at position 367, wherein the polar amino acid may be tyrosine (Y) and the nonpolar amino acid may be valine (V), but is not limited thereto.

(30) The variant having substitution of a polar amino acid or nonpolar amino acid, except threonine (T), for the threonine (T) residue at position 124, substitution of a polar amino acid, except asparagine (N), for the amino acid at position 97, and substitution of a nonpolar amino acid, except asparagine (N), for the amino acid at position 367 from the N-terminus of the fructose-4-epimerase including the amino acid sequence of SEQ ID NO: 1 may have further substitution of a nonpolar amino acid, polar amino acid, or basic amino acid for any one amino acid at positions 102, 137, 210, 239, and 318, wherein the nonpolar amino acid, polar amino acid, or basic amino acid may be selected from the group consisting of leucine (L), cysteine (C), serine (S), lysine (K), and glycine, (G), but is not limited thereto.

(31) Specifically, the amino acid at position 102 may be substituted by leucine (L), the amino acid at position 137 may be substituted by cysteine (C), the amino acid at position 210 may be substituted by serine (S), the amino acid at position 239 may be substituted by lysine (K), or the amino acid at position 318 may be substituted by glycine (G), but is not limited thereto.

(32) The variant having substitution of a polar amino acid or nonpolar amino acid, except threonine (T), for the threonine (T) residue at position 124, substitution of a polar amino acid, except asparagine (N), for the amino acid at position 97, and substitution of a nonpolar amino acid, except asparagine (N), for the amino acid at position 367 from the N-terminus of the fructose-4-epimerase including the amino acid sequence of SEQ ID NO: 1 may have further substitution of a nonpolar amino acid for the amino acid at position 33, wherein the nonpolar amino acid may be arginine (R), but is not limited thereto.

(33) The variant having substitution of a polar amino acid or nonpolar amino acid, except threonine (T), for the threonine (T) residue at position 124, substitution of a polar amino acid, except asparagine (N), for the amino acid at position 97, substitution of a nonpolar amino acid, except asparagine (N), for the amino acid at position 367, and substitution of a nonpolar amino acid for the amino acid at position 33 from the N-terminus of the fructose-4-epimerase including the amino acid sequence of SEQ ID NO: 1 may have further substitution of a basic amino acid, nonpolar amino acid, or polar amino acid for any one amino acid at positions 80, 102, 210, and 318, wherein the basic amino acid, nonpolar amino acid, or polar amino acid may be selected from the group consisting of arginine (R), leucine (L), serine (S), and glycine (G), but is not limited thereto.

(34) Specifically, the amino acid at position 80 may be substituted by arginine (R), the amino acid at position 102 may be substituted by leucine (L), the amino acid at position 210 may be substituted by serine (S), or the amino acid at position 318 may be substituted by glycine (G), but is not limited thereto.

(35) The variant having substitution of a polar amino acid or nonpolar amino acid, except threonine (T), for the threonine (T) residue at position 124, substitution of a polar amino acid, except asparagine (N), for the amino acid at position 97, and substitution of a nonpolar amino acid, except asparagine (N), for the amino acid at position 367 from the N-terminus of the fructose-4-epimerase including the amino acid sequence of SEQ ID NO: 1 may have further substitution of a basic amino acid for the amino acid at position 80, wherein the basic amino acid may be arginine (R), but is not limited thereto.

(36) The variant having substitution of a polar amino acid or nonpolar amino acid, except threonine (T), for the threonine (T) residue at position 124, substitution of a polar amino acid, except asparagine (N), for the amino acid at position 97, substitution of a nonpolar amino acid, except asparagine (N), for the amino acid at position 367, and substitution of a basic amino acid for the amino acid at position 80 from the N-terminus of the fructose-4-epimerase including the amino acid sequence of SEQ ID NO: 1 may have further substitution of a nonpolar amino acid or polar amino acid for any one amino acid at positions 102, 137, and 210, wherein the nonpolar amino acid or polar amino acid may be selected from the group consisting of leucine (L), cysteine (C), and serine (S), but is not limited thereto.

(37) Specifically, the amino acid at position 102 may be substituted by leucine (L), the amino acid at position 137 may be substituted by cysteine (C), or the amino acid at position 210 may be substituted by serine (S), but is not limited thereto. The variant having substitution of a polar amino acid or nonpolar amino acid, except threonine (T), for the threonine (T) residue at position 124, substitution of a polar amino acid, except asparagine (N), for the amino acid at position 97, and substitution of a nonpolar amino acid, except asparagine (N), for the amino acid at position 367 from the N-terminus of the fructose-4-epimerase including the amino acid sequence of SEQ ID NO: 1 may have further substitution of a polar amino acid, except threonine (T), for the amino acid at position 210 and substitution of a nonpolar amino acid, except proline (P), for the amino acid at position 318, wherein the polar amino acid may be serine (S) and the nonpolar amino acid may be glycine (G), but is not limited thereto.

(38) The fructose-4-epimerase variant may include a polypeptide, of which one or more amino acids differ from the recited sequence in conservative substitutions and/or modifications, in addition to substitution of another amino acid for the amino acid at the particular position, while retaining functions or properties of the protein.

(39) As used herein, the term “conservative substitution” means substitution of one amino acid with another amino acid that has similar structural and/or chemical properties. The variant may have, for example, one or more conservative substitutions while retaining one or more biological activities. The conservative substitution has little or no impact on the activity of a resulting polypeptide

(40) Further, variants having variation of one or more amino acids in addition to the amino acids at the above-described particular positions may include deletion or addition of amino acids that have minimal influence on properties and a secondary structure of the polypeptide. For example, a polypeptide may be conjugated to a signal (or leader) sequence at the N-terminus of the protein, which co-translationally or post-translationally directs transfer of the protein. The polypeptide may also be conjugated to other sequence or a linker for identification, purification, or synthesis of the polypeptide.

(41) Further, the variant includes the above-described variations of SEQ ID NO: 1 and/or amino acids having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher homology or identity to SEQ ID NO: 1 other than the variations and positions of SEQ ID NO: 1. The variations of SEQ ID NO: 1 are as described above, and homology or identity thereto may be homology or identity at positions other than the above-described variations.

(42) With respect to the objects of the present disclosure, the fructose-4-epimerase variant is characterized by having improved conversion activity or stability, as compared with the wild-type.

(43) The term “conversion activity” means conversion into tagatose by epimerizing D-fructose at C4 position. The term “stability” means having thermal stability of an enzyme having high heat resistance. Specifically, the fructose-4-epimerase variant of SEQ ID NO: 1 is characterized in that its activity to convert into tagatose by epimerizing D-fructose at C4 position and/or thermal stability are/is improved, as compared with the wild-type of SEQ ID NO: 1.

(44) For example, the fructose-4-epimerase variant of the present disclosure may be an enzyme having high heat resistance. Specifically, the fructose-4-epimerase variant of the present disclosure may exhibit 50% to 100%, 60% to 100%, 70% to 100%, or 75% to 100% activity of the maximum activity at 50° C. to 70° C. More specifically, the fructose-4-epimerase variant of the present disclosure may exhibit 80% to 100% or 85% to 100% activity of the maximum activity at 55° C. to 60° C., 60° C. to 70° C., 55° C., 60° C., or 70° C.

(45) Another aspect of the present disclosure provides a polynucleotide encoding the fructose-4-epimerase variant, or a vector including the polynucleotide.

(46) As used herein, the term “polynucleotide” refers to a DNA or RAN strand having a predetermined length or more, which is a long chain polymer of nucleotides formed by linking nucleotide monomers via covalent bonds. More specifically, the polynucleotide refers to a polynucleotide fragment encoding the variant protein.

(47) The polynucleotide encoding the fructose-4-epimerase variant of the present disclosure may include any polynucleotide sequence without limitation, as long as it is a polynucleotide sequence encoding the fructose-4-epimerase variant of the present disclosure. For example, the polynucleotide encoding the fructose-4-epimerase variant of the present disclosure may be a polynucleotide sequence encoding the amino acid sequence, but is not limited thereto. In the polynucleotide, various modifications may be made in the coding region provided that they do not change the amino acid sequence of the protein, due to codon degeneracy or in consideration of the codons preferred by the organism in which the protein is to be expressed. Therefore, it is apparent that, due to codon degeneracy, a polynucleotide which may be translated into the polypeptide composed of the amino acid sequence or the polypeptide having homology or identity thereto may also be included.

(48) Further, a probe which may be produced from a known nucleotide sequence, for example, a sequence which hybridizes with a complementary sequence to all or a part of the nucleotide sequence under stringent conditions to encode the fructose-4-epimerase variant may also be included without limitation.

(49) The term “stringent conditions” mean conditions under which specific hybridization between polynucleotides is allowed. Such conditions are described in detail in a literature (e.g., J. Sambrook et al., supra). For example, the stringent conditions may include, for example, conditions under which genes having high homology or identity, 70% or higher, 80% or higher, 85% or higher, specifically 90% or higher, more specifically 95% or higher, much more specifically 97% or higher, particularly specifically 99% or higher homology or identity are hybridized with each other and genes having homology or identity lower than the above homology or identity are not hybridized with each other, or ordinary washing conditions of Southern hybridization, i.e., washing once, specifically, twice or three times at a salt concentration and a temperature corresponding to 60° C., 1×SSC, 0.1% SDS, specifically, 60° C., 0.1×SSC, 0.1% SDS, and more specifically 68° C., 0.1×SSC, 0.1% SDS.

(50) Although a mismatch between nucleotides may occur due to the stringency of hybridization, it is required that the two nucleic acids have a complementary sequence. The term “complementary” is used to describe the relationship between nucleotide bases which may hybridize with each other. For example, with regard to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine.

(51) Accordingly, the present disclosure may include not only the substantially similar nucleic acid sequences but also isolated nucleic acid fragments which are complementary to the entire sequence.

(52) Specifically, the polynucleotide having homology or identity may be detected using hybridization conditions including the hybridization step at a Tm value of 55° C. and the conditions described above. Additionally, the Tm value may be 60° C., 63° C., or 65° C., but is not limited thereto, and may be appropriately controlled by one of ordinary skill in the art according to the purposes.

(53) Appropriate stringency for the hybridization of polynucleotides depends on the length and degree of complementarity of the polynucleotides, and the variables are well-known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

(54) As used herein, the term ‘homology’ or ‘identity’ means the degree of relevance between two given amino acid sequences or nucleotide sequences, and may be expressed as a percentage.

(55) The terms ‘homology’ and ‘identity’ may be often used interchangeably.

(56) The sequence homology or identity of the conserved polynucleotide or polypeptide may be determined by standard alignment algorithms, and may be used with default gap penalties established by the used program. Substantially, homologous or identical sequences may hybridize under moderately or highly stringent conditions such that the full length of the sequence or at least about 50%, 60%, 70%, 80%, or 90% or more of the full-length may hybridize. Also, contemplated are polynucleotides that contain degenerate codons in place of codons in the hybridization.

(57) Whether or not any two polynucleotide or polypeptide sequences have homology, similarity, or identity may be determined using known computer algorithms such as the “FASTA” program, using, for example, the default parameters as in Pearson et al (1988)[Proc. Natl. Acad. Sci. USA 85]: 2444], or determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) (including GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA/.] (1988) SIAM J Applied Math 48: 1073). For example, BLAST of the National Center for Biotechnology Information database, or ClustalW may be used to determine homology, similarity, or identity.

(58) Homology, similarity, or identity of polynucleotides or polypeptides may be determined, for example, by comparing sequence information using a GAP computer program such as Needleman et al. (1970), J Mol Biol. 48: 443, as disclosed in Smith and Waterman, Adv. Appl. Math (1981) 2:482. Briefly, the GAP program defines similarity as the number of aligned symbols (i.e., nucleotides or amino acids), which are similar, divided by the total number of symbols in the shorter of the two sequences. Default parameters for the GAP program may include: (1) a binary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix of Gribskov et al (1986) Nucl. Acids Res. 14: 6745, as disclosed in Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979) (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or gap open penalty of 10, gap extension penalty of 0.5); and (3) no penalty for end gaps. Therefore, as used herein, the term “homology” or “identity” represents relevance between sequences.

(59) As used herein, the term “vector” means a DNA construct that includes a nucleotide sequence of a polynucleotide encoding a target variant protein operably linked to an appropriate regulatory sequence to enable expression of the target variant protein in an appropriate host cell. The regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for the regulation of such transcription, a sequence of an appropriate mRNA ribosome-binding domain, and a sequence regulating termination of transcription and translation. After the vector is transformed into the appropriate host cell, it may replicate or function independently of the host genome, and may be integrated into the genome itself.

(60) The vector used in the present disclosure is not particularly limited, as long as it is able to replicate in the host cell, and any vector known in the art may be used. Examples of commonly used vectors may include a natural or recombinant plasmid, cosmid, virus, and bacteriophage. For instance, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. may be used as a phage vector or cosmid vector. As a plasmid vector, pBR type, pUC type, pBluescriptll type, pGEM type, pTZ type, pCL type, pET type, etc. may be used. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vector, etc. may be used.

(61) For example, a polynucleotide encoding a target variant protein in the chromosome may be replaced by a mutated polynucleotide using a vector for intracellular chromosomal insertion. The chromosomal insertion of the polynucleotide may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker to confirm the chromosomal insertion may be further included. The selection marker is to select cells transformed with the vector, that is, to confirm insertion of the desired nucleotide molecule, and the selection marker may include markers providing selectable phenotypes, such as drug resistance, auxotrophy, resistance to cytotoxic agents, or expression of surface-modified proteins. Since only cells expressing the selection marker are able to survive or to show different phenotypes under the environment treated with a selective agent, the transformed cells may be selected. As still another aspect of the present disclosure, the present disclosure provides a microorganism producing tagatose, the microorganism including the variant protein or the polynucleotide encoding the variant protein. Specifically, the microorganism including the variant protein and/or the polynucleotide encoding the variant protein may be a microorganism prepared by transforming with the vector including the polynucleotide encoding the variant protein, but is not limited thereto.

(62) As used herein, the term “transformation” means introduction of a vector including a polynucleotide encoding a target protein into a host cell in such a way that the protein encoded by the polynucleotide is expressed in the host cell. As long as the transformed polynucleotide may be expressed in the host cell, it may be integrated into and placed in the chromosome of the host cell, or it may exist extrachromosomally, or irrespective thereof. Further, the polynucleotide includes DNA and RNA encoding the target protein. The polynucleotide may be introduced in any form, as long as it may be introduced into the host cell and expressed therein. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a gene construct including all elements required for its autonomous expression. Commonly, the expression cassette includes a promoter operably linked to the polynucleotide, transcriptional termination signals, ribosome binding sites, and translation termination signals. The expression cassette may be in the form of a self-replicable expression vector. Also, the polynucleotide as it is may be introduced into the host cell and operably linked to sequences required for expression in the host cell, but is not limited thereto.

(63) As used herein, the term “operably linked” means a functional linkage between a promoter sequence which initiates and mediates transcription of the polynucleotide encoding the target variant protein of the present disclosure and the polynucleotide sequence.

(64) Still another aspect of the present disclosure provides a microorganism including the fructose-4-epimerase variant, the polynucleotide encoding fructose-4-epimerase variant, or the vector including the polynucleotide.

(65) The microorganism may be a microorganism producing the fructose-4-epimerase variant or tagatose.

(66) As used herein, the term “microorganism including the fructose-4-epimerase variant” may refer to a recombinant microorganism to express the fructose-4-epimerase variant of the present disclosure. For example, the microorganism refers to a host cell or a microorganism which is able to express the variant by including the polynucleotide encoding the fructose-4-epimerase variant or by transforming with the vector including the polynucleotide encoding the fructose-4-epimerase variant. With respect to the objects of the present disclosure, the microorganism is specifically a microorganism expressing the fructose-4-epimerase variant including one or more amino acid substitutions in the amino acid sequence of SEQ ID NO: 1, and the microorganism may be a microorganism expressing the variant protein having the fructose-4-epimerase activity, wherein the amino acid substitution is substitution of one or more amino acids at one or more positions from the N-terminus, but is not limited thereto.

(67) The fructose-4-epimerase variant of the present disclosure may be obtained by transforming a microorganism such as E. coli with DNA expressing the enzyme of the present disclosure or the variant thereof, culturing the microorganism to obtain a culture, disrupting the culture, and then performing purification using a column, etc. The microorganism for transformation may include Corynebacterium glutamicum, Aspergillus oryzae, or Bacillus subtilis, in addition to Escherichia coli, but is not limited thereto.

(68) The microorganism of the present disclosure may include either a prokaryotic microorganism or a eukaryotic microorganism, as long as it is a microorganism capable of producing the fructose-4-epimerase of the present disclosure by including the nucleic acid of the present disclosure or the recombinant vector of the present disclosure. For example, the microorganism may include microorganism strains belonging to the genus Escherichia, the genus Erwinia, the genus Serratia, the genus Providencia, the genus Corynebacterium, and the genus Brevibacterium, but is not limited thereto.

(69) The microorganism of the present disclosure may include any microorganism capable of expressing the fructose-4-epimerase of the present disclosure by various known methods, in addition to introduction of the nucleic acid or the vector.

(70) The culture of the microorganism of the present disclosure may be produced by culturing, in a medium, the microorganism capable of expressing the fructose-4-epimerase of the present disclosure.

(71) In the method, the “culturing” means that the microorganism is allowed to grow under appropriately controlled environmental conditions. The step of culturing the microorganism may be, but is not particularly limited to, carried out by a known batch culture method, continuous culture method, or fed batch culture method. With regard to the culture conditions, a proper pH (e.g., pH 5 to 9, specifically pH 6 to 8, and most specifically pH 6.8) may be adjusted using a basic compound (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (e.g., phosphoric acid or sulfuric acid), but is not particularly limited thereto. Oxygen or an oxygen-containing gas mixture may be injected into the culture to maintain aerobic conditions. The culture temperature may be maintained from 20° C. to 45° C., and specifically, from 25° C. to 40° C. for about 10 hours to about 160 hours, but is not limited thereto.

(72) Furthermore, the culture medium to be used may include, as carbon sources, sugars and carbohydrates (e.g., glucose, sucrose, lactose, fructose, maltose, molasse, starch, and cellulose), oil and fat (e.g., soybean oil, sunflower seed oil, peanut oil, and coconut oil), fatty acids (e.g., palmitic acid, stearic acid, and linoleic acid), alcohols (e.g., glycerol and ethanol), and organic acids (e.g., acetic acid) individually or in combination, but is not limited thereto. As nitrogen sources, nitrogen-containing organic compounds (e.g., peptone, yeast extract, meat broth, malt extract, corn steep liquor, soybean meal, and urea), or inorganic compounds (e.g., ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate) may be used individually or in combination, but are not limited thereto. As phosphorus sources, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, and corresponding sodium salts thereof may be used individually or in combination, but are not limited thereto. Further, the medium may include essential growth-stimulating substances including other metal salts (e.g., magnesium sulfate or iron sulfate), amino acids, and vitamins.

(73) Still another aspect of the present disclosure provides a composition for producing tagatose, the composition including the fructose-4-epimerase variant; the microorganism expressing the same; or the culture of the microorganism.

(74) The composition for producing tagatose of the present disclosure may further include fructose.

(75) In addition, the composition for producing tagatose of the present disclosure may further include any appropriate excipient commonly used in the corresponding composition for producing tagatose. The excipient may include, for example, a preservative, a wetting agent, a dispersing agent, a suspending agent, a buffer, a stabilizer, an isotonic agent, etc., but is not limited thereto.

(76) The composition for producing tagatose of the present disclosure may further include a metal ion or a metal salt. In a specific embodiment, a metal of the metal ion or the metal salt may be a metal containing a divalent cation. Specifically, the metal of the present disclosure may be nickel (Ni), iron (Fe), cobalt (Co), magnesium (Mg), or manganese (Mn). More specifically, the metal salt may be MgSO.sub.4, FeSO.sub.4, NiSO.sub.4, NiCl.sub.2, MgCl.sub.2, CoSO.sub.4, MnCl.sub.2, or MnSO.sub.4.

(77) Still another aspect of the present disclosure provides a method of producing tagatose, the method including the step of converting fructose into tagatose by contacting fructose with the fructose-4-epimerase variant; the microorganism including the fructose-4-epimerase variant; or the culture thereof, specifically, a method of producing tagatose from fructose using the fructose-4-epimerase variant as a fructose-4-epimerase.

(78) For example, the contacting of the present disclosure may be performed under a condition of pH 5.0 to pH 9.0, a temperature condition of 30° C. to 80° C., and/or for 0.5 hr to 48 hr.

(79) Specifically, the contacting of the present disclosure may be performed under a condition of pH 6.0 to pH 9.0 or pH 7.0 to pH 9.0. Further, the contacting of the present disclosure may be performed under a temperature condition of 35° C. to 80° C., 40° C. to 80° C., 45° C. to 80° C., 50° C. to 80° C., 55° C. to 80° C., 60° C. to 80° C., 30° C. to 70° C., 35° C. to 70° C., 40° C. to 70° C., 45° C. to 70° C., 50° C. to 70° C., 55° C. to 70° C., 60° C. to 70° C., 30° C. to 65° C., 35° C. to 65° C., 40° C. to 65° C., 45° C. to 65° C., 50° C. to 65° C., 55° C. to 65° C., 30° C. to 60° C., 35° C. to 60° C., 40° C. to 60° C., 45° C. to 60° C., 50° C. to 60° C. or 55° C. to 60° C. Further, the contacting of the present disclosure may be performed for 0.5 hr to 36 hr, 0.5 hr to 24 hr, 0.5 hr to 12 hr, 0.5 hr to 6 hr, 1 hr to 48 hr, 1 hr to 36 hr, 1 hr to 24 hr, 1 hr to 12 hr, 1 hr to 6 hr, 3 hr to 48 hr, 3 hr to 36 hr, 3 hr to 24 hr, 3 hr to 12 hr, 3 hr to 6 hr, 6 hr to 48 hr, 6 hr to 36 hr, 6 hr to 24 hr, 6 hr to 12 hr, 12 hr to 48 hr, 12 hr to 36 hr, 12 hr to 24 hr, 18 hr to 48 hr, 18 hr to 36 hr, or 18 hr to 30 hr.

(80) Further, the contacting of the present disclosure may be performed in the presence of a metal ion or a metal salt. The applicable metal ion or metal salt is the same as described above.

(81) The production method of the present disclosure may further include the step of separating and/or purifying the produced tagatose. The separation and/or purification may be performed using a method commonly used in the art. Non-limiting examples may include dialysis, precipitation, adsorption, electrophoresis, ion exchange chromatography, fractional crystallization, etc. The purification may be performed only by a single method or by two or more methods in combination.

(82) In addition, the production method of the present disclosure may further include the step of performing decolorization and/or deionization, before or after the separation and/or purification step(s). By performing the decolorization and/or deionization, it is possible to obtain tagatose with higher quality.

(83) For another example, the production method of the present disclosure may further include the step of performing crystallization of tagatose, after the step of converting into tagatose of the present disclosure, performing the separation and/or purification, or performing the decolorization and/or deionization. The crystallization may be performed by a crystallization method commonly used. For example, the crystallization may be performed by cooling crystallization.

(84) Further, the production method of the present disclosure may further include the step of concentrating tagatose, before the step of performing crystallization. The concentrating may increase the crystallization efficiency.

(85) For another example, the production method of the present disclosure may further include the step of contacting unreacted fructose with the enzyme of the present disclosure, the microorganism expressing the enzyme, or the culture of the microorganism after the step of separation and/or purification, or the step of reusing a crystal-separated mother solution in the step of separation and/or purification after the step of performing the crystallization of the present disclosure, or a combination thereof. The additional steps are economically advantageous in that tagatose may be obtained with higher yield and the amount of fructose to be discarded may be reduced.

MODE FOR INVENTION

(86) Hereinafter, the present disclosure will be described in more detail with reference to Examples. However, these Examples are for the purpose of illustrating the present disclosure, and the scope of the present disclosure is not intended to be limited by these Examples. It will be apparent to those skilled in the art to which the present disclosure pertains.

Example 1. Preparation of Recombinant Expression Vectors and Transformants, Each Including Wild-Type Fructose-4-Epimerase Gene or Improved Fructose-4-Epimerase Gene

Example 1-1. Preparation of Recombinant Expression Vectors and Transformants, Each Including Fructose-4-Epimerase Wild-Type Gene

(87) To prepare fructose-4-epimerase, Kosmotoga olearia-derived amino acid sequence (SEQ ID NO: 1) and genetic information were obtained to prepare a vector expressible in E. coli and a transformed microorganism (transformant). It was confirmed that the sequence may be used as a fructose-4-epimerase to convert fructose into tagatose (FIG. 1).

(88) In detail, a nucleotide sequence of fructose-4-epimerase was selected from nucleotide sequences of Kosmotoga olearia, which is registered in KEGG (Kyoto Encyclopedia of Genes and Genomes). Based on the information of the amino acid sequence (SEQ ID NO: 1) and nucleotide sequence (SEQ ID NO: 2) of Kosmotoga olearia, it was inserted into pBT7-C-His which is a vector expressible in E. coli to synthesize and prepare a recombinant expression vector pBT7-C-His-KO, performed by Bioneer Corp.

Example 1-2. Preparation of Improved Fructose-4-Epimerase Library and Screening of Activity-Improved Variant

(89) Random mutation was performed using Kosmotoga olearia-derived fructose-4-epimerase gene as a template to construct a fructose-4-epimerase variant library. In detail, random mutation was induced using a diversify random mutagenesis kit (ClonTech) to generate 2 to 3 variations per 1000 base pairs in the fructose-4-epimerase gene. PCR reaction conditions are shown in the following Tables 1 and 2. The gene library encoding the fructose-4-epimerase variant was constructed and inserted into E. coli BL21(DE3).

(90) TABLE-US-00001 TABLE 1 Composition of reaction Addition amount solution (μl) PCR Grade Water 36 10X TITANIUM Taq Buffer 5 MnSO4 (8 mM) 4 dGTP (2 mM) 1 50X Diversify dNTP Mix 1 Primer mix 1 Template DNA 1 TITANIUM Taq Polym. 1

(91) TABLE-US-00002 TABLE 2 Step Temperature (° C.) Time (sec) Cycle Initial Denaturation 94 30 1 Denaturation 94 30 25 Annealing/Extension 68 60 Final Extension 68 60 1 soak 4 —

(92) E. coli BL21(DE3) having the pBT7-C-His plasmid harboring the fructose-4-epimerase variant gene was seeded in a deep well rack containing 0.2 mL of an LB liquid medium supplemented with an ampicillin antibiotic, and seed-cultured in a shaking incubator at 37° C. for 16 hours or longer. The culture broth obtained from the seed culture was seeded in a culture deep well rack containing a liquid medium containing LB and lactose which is a protein expression regulator, followed by main culture. The seed culture and main culture were performed under conditions of a shaking speed of 180 rpm and 37° C. Next, the culture broth was centrifuged at 4,000 rpm and 4° C. for 20 minutes, and then the microorganism was recovered and subjected to an activity test.

(93) For high-speed screening of a large amount of the activity-improved variant enzyme from the prepared random mutation library, a colorimetric method capable of specifically quantifying D-fructose was used. In detail, a 70% folin-ciocalteu reagent (SIGMA-ALDRICH) and a substrate reaction solution were mixed at a ratio of 15:1, and allowed to react at 80° C. for 5 minutes. OD values were measured at 900 nm to select variants having the activity (conversion of D-fructose into D-tagatose) by comparing the relative activity thereof with that of the wild-type enzyme (SEQ ID NO: 1). Among them, 30 colonies having the highest activity were selected, and sequenced to examine their base sequences. As a result, variations at positions 33, 80, 97, 102, 124, 137, 210, 239, 318, 367, and 390 were found. Through random mutation screening, T124W and N97Y which are variants having the most excellent activity were obtained.

Example 2. Preparation of Variant Enzymes and Comparative Evaluation of Activity

(94) To evaluate the relative fructose-4-epimerization activity of the excellent variants obtained in Example 1-2, the variant microorganisms were seeded in a culture tube containing 5 mL of an LB liquid medium supplemented with an ampicillin antibiotic, and seed-cultured in a shaking incubator at 37° C. until absorbance at 600 nm reached 2.0. The culture broth obtained from the seed culture was seeded in a culture flask containing a liquid medium containing LB and lactose which is a protein expression regulator, followed by main culture. The seed culture and main culture were performed under conditions of a shaking speed of 180 rpm and 37° C.

(95) Next, the culture broth was centrifuged at 8,000 rpm 4° C. for 20 minutes, and then the microorganism was recovered. The recovered microorganism was washed with a 50 mM Tris-HCl (pH 8.0) buffer solution twice, and resuspended in a 50 mM NaH.sub.2PO.sub.4 (pH 8.0) buffer solution containing 10 mM imidazole and 300 mM NaCl. The resuspended microorganism was disrupted using a sonicator, and centrifuged at 13,000 rpm and 4° C. for 20 minutes to collect only the supernatant. The supernatant was purified using His-taq affinity chromatography, and a 50 mM NaH.sub.2PO.sub.4 (pH 8.0) buffer solution containing 20 mM imidazole and 300 mM NaCl was applied in a 10-fold volume of a filler to remove non-specific binding proteins. Subsequently, 50 mM NaH.sub.2PO.sub.4 (pH 8.0) buffer solution containing 250 mM imidazole and 300 mM NaCl was further applied to perform elution and purification. Then, dialysis was performed using a 50 mM Tris-HCl (pH 8.0) buffer solution, and the respective purified enzymes were obtained for characterization of the enzymes.

(96) To measure the fructose-4-epimerization activity of the obtained purified enzymes, 50 mM Tris-HCl (pH 8.0), 3 mM MnSO.sub.4, and each 10 mg/mL of the enzymes was added to 30% by weight of fructose, and allowed to react at 60° C. for up to 2 hours. As a result, it was confirmed that the conversion activity of the wild-type (KO) was 8.6%, and the conversion activity of the variant enzyme N97Y was 21.5%, the conversion activity of the variant enzyme T124W was 25.3%. In other words, it was found that the activity of the variant enzymes was increased, as compared with that of the wild-type.

Example 3. Preparation of Variant Enzymes and Selection of Activity-Improved Variant Enzymes

(97) To examine the activity of the enzyme, in which a nonpolar or polar side chain other than threonine was substituted for threonine (T) at position 124 among target positions designed in Example 1-2, a single-site saturation mutagenesis library having substitution of tryptophan (W), cysteine (C), or tyrosine (Y) for threonine (T) at position 124 was constructed to prepare variant enzymes, and unit activity for the fructose-4-epimerization conversion was measured.

Example 3-1. Saturation Mutagenesis

(98) The recombinant expression vector pBT7-C-His-KO which was prepared for expressing the wild-type enzyme gene in E. coli BL21(DE3) (expressing the recombinant enzyme having 6×His-tag at the C-terminus of the wild-type) was used as a template for saturation mutagenesis for variant library construction. In view of mutation frequency variation and variant yield, etc., inversed PCR-based saturation mutagenesis was used (2014. Anal. Biochem. 449:90-98), and in order to minimize screening scales of the constructed variant library (minimize the number of codons introduced for saturation mutagenesis), a mixed primer NDT/VMA/ATG/TGG (2012. Biotechniques 52:149-158) in which stop codons were excluded and rare codons for E. coli were minimized was designed and used. In detail, a primer having a total length of 33 bp was constructed using 15 bp residing at the front side, 3 bp to be substituted, and 15 bp residing at the rear side of each site. PCR was performed by repeating cycles consisting of denaturing at 94° C. for 2 minutes, denaturing at 94° C. from 30 seconds, annealing at 60° C. for 30 seconds, and extending at 72° C. for 10 minutes, followed by elongation at 72° C. for 60 minutes. After construction of a saturation mutagenesis library for the selected amino acid sites, variants for each library were randomly selected (<11 variations). Base sequences were analyzed to evaluate amino acid mutation frequency. Based on the analysis results, scales of screening each library were set with sequence coverage of 90% or more (2003. Nucleic Acids Res. 15; 31:e30).

Example 3-2. Preparation of Activity-Improved Variant Enzymes

(99) In order to evaluate relative activity of fructose-4-epimerization for a variant enzyme at a single site with improved unit activity and a variant enzyme at multiple sites with combination thereof, the saturation mutagenesis library gene prepared in 3-1 was transformed into E. coli BL21(DE3), and each transformed microorganism was seeded in a culture tube containing 5 mL of LB liquid medium containing an ampicillin antibiotic, and seed-cultured in a shaking incubator at 37° C. until absorbance at 600 nm reached 2.0. The culture broth obtained from the seed culture was seeded in a culture flask containing a liquid medium containing LB and lactose which is a protein expression regulator, followed by main culture. The seed culture and main culture were performed under conditions of a shaking speed of 180 rpm and 37° C. Next, the culture broth was centrifuged at 8,000 rpm and 4° C. for 20 minutes, and then the microorganism was recovered. The recovered microorganism was washed with a 50 mM Tris-HCl (pH 8.0) buffer solution twice, and resuspended in a 50 mM NaH.sub.2PO.sub.4 (pH 8.0) buffer solution containing 10 mM imidazole and 300 mM NaCl. The resuspended microorganism was disrupted using a sonicator, and centrifuged at 13,000 rpm and 4° C. for 20 minutes to collect only the supernatant. The supernatant was purified using His-taq affinity chromatography, and a 50 mM NaH.sub.2PO.sub.4 (pH 8.0) buffer solution containing 20 mM imidazole and 300 mM NaCl was applied in a 10-fold volume of a filler to remove non-specific binding proteins. Subsequently, 50 mM NaH.sub.2PO.sub.4 (pH 8.0) buffer solution containing 250 mM imidazole and 300 mM NaCl was further applied to perform elution and purification. Then, dialysis was performed using a 50 mM Tris-HCl (pH 8.0) buffer solution, and the respective purified enzymes were obtained for characterization of the enzymes.

Example 3-3. Comparative Evaluation of Characteristics of Variant Enzymes

(100) To measure the fructose-4-epimerization activity of the recombinant variant enzymes obtained in Example 3-2, 50 mM Tris-HCl (pH 8.0), 3 mM MnSO.sub.4, and each 10 mg/mL of the enzymes was added to 30% by weight of fructose, and allowed to react at 60° C. for 2 hours. Furthermore, to measure thermal stability of the obtained recombinant variant enzymes, each enzyme purified at a concentration of 10 mg/mL was added and left at 60° C. for at least 19 hours and up to 90 hours, and then left on ice for 5 minutes. Each of the enzyme solutions sampled at each time point, 50 mM Tris-HCl (pH 8.0), and 3 mM MnSO.sub.4 were added to 30% by weight of fructose, and an enzymatic reaction was allowed to measure residual activity of the enzymes.

(101) As a result, all the prepared variants showed high conversion rates of up to 2.9 times that of the wild-type. Detailed results are shown in the following Table 3. Furthermore, the results of examining thermal stability showed that the fructose-4-epimerase variants showed reduction in the residual activity at 60° C. over time, but the thermal stability was more excellent than that of the wild-type, as shown in FIG. 2.

(102) TABLE-US-00003 TABLE 3 Variation site T124W T124C T124Y KO Relative activity (%) 294 245 251 100

Example 4. Preparation of Recombinant Variant Enzymes and Evaluation of Activity-Improved Variant Enzymes

Example 4-1. Site-Directed Mutagenesis

(103) The variant T124W selected in Example 1-2 was used to substitute tyrosine for asparagine at position 97 of Kosmotoga olearia-derived fructose-4-epimerase using particular primers by site-directed mutagenesis.

(104) An N-terminal primer (SEQ ID NO: 25: GACCATCTTGGCCCATACCCCTGGAAGGGTCAG) and a C-terminal primer (SEQ ID NO: 26: CTGACCCTTCCAGGGGTATGGGCCAAGATGGTC) which are oligonucleotides of two complementary base sequences having mutations were used as primers. A plasmid having a new variation was amplified and synthesized in a tube using DNA in the form of plasmid as a template, and the original template DNA was digested with a restriction enzyme Dpn I, and removed. In other words, the variant DNA selected in Example 1-2, which was used as the template, was DNA isolated from E. coli, which is digested with Dpn I recognizing and cleaving Gm6 ATC, but the variant DNA synthesized in the tube is not cleaved thereby. This was transformed into E. coli DH5alpha to obtain a variant strain. Sequencing analysis of the variant gene was performed to confirm that the variation properly occurred. In other words, T124W N97Y variant having the amino acid sequence variation was prepared. This variant was transformed into an expression strain E. coli BL21(DE3) to prepare a recombinant strain.

Example 4-2. Preparation of Activity-Improved Variant Enzymes and Comparative Evaluation of Activity

(105) The variant microorganism prepared in Example 4-1 was seeded in a culture tube containing 5 mL of LB liquid medium containing an ampicillin antibiotic, and seed-cultured in a shaking incubator at 37° C. until absorbance at 600 nm reached 2.0. The culture broth obtained from the seed culture was seeded in a culture flask containing a liquid medium containing LB and lactose which is a protein expression regulator, followed by main culture. The seed culture and main culture were performed under conditions of a shaking speed of 180 rpm and 37° C. Next, the culture broth was centrifuged at 8,000 rpm and 4° C. for 20 minutes, and then the microorganism was recovered. The recovered microorganism was washed with a 50 mM Tris-HCl (pH 8.0) buffer solution twice, and resuspended in a 50 mM NaH.sub.2PO.sub.4 (pH 8.0) buffer solution containing 10 mM imidazole and 300 mM NaCl.

(106) The resuspended microorganism was disrupted using a sonicator, and centrifuged at 13,000 rpm and 4° C. for 20 minutes to collect only the supernatant. The supernatant was purified using His-taq affinity chromatography, and a 50 mM NaH.sub.2PO.sub.4 (pH 8.0) buffer solution containing 20 mM imidazole and 300 mM NaCl was applied in a 10-fold volume of a filler to remove non-specific binding proteins.

(107) Subsequently, 50 mM NaH.sub.2PO.sub.4 (pH 8.0) buffer solution containing 250 mM imidazole and 300 mM NaCl was further applied to perform elution and purification. Then, dialysis was performed using a 50 mM Tris-HCl (pH 8.0) buffer solution, and the purified enzymes were obtained for characterization of the enzymes.

(108) To measure the fructose-4-epimerization activity of the obtained recombinant variant enzymes, 50 mM Tris-HCl (pH 8.0), 3 mM MnSO.sub.4, and each 2 mg/mL of the enzymes were added to 30% by weight of fructose, and allowed to react at 60° C. for 2 hours.

(109) As a result, all of the prepared variants showed high conversion rates of up to 4 times that of the wild-type. The detailed results are shown in the following Table 4.

(110) TABLE-US-00004 TABLE 4 0 30 60 120 WT 0.3 2.1 3.5 5.2 T124W 0.3 7.0 11.3 16.9 T124W_N97Y 0.5 12.0 17.2 22.2

Example 4-3. Preparation and Selection of Additional Recombinant Variant Enzymes

(111) To examine enzyme activity when various variations were added based on the variation at position 124, the following additional experiment was performed. In detail, 124W variant prepared in Example 1-2 and T124W N97Y variant prepared in Example 4-1 (substitution of tryptophan (W) for threonine (T) at position 124, and substitution of tyrosine (Y) for asparagine (N) at position 97, respectively) were used to construct a single-site saturation mutagenesis library based on 9 active sites selected through the random mutation library screening in Example 1-2 (at positions 33, 80, 102, 137, 210, 239, 318, 367, and 390). The variation sites and amino acids having improved unit activity were selected by screening. 63 kinds of variant enzymes with additional variation sites were obtained, as in Table 5. The kind of variation at each site is as in Table 6.

(112) TABLE-US-00005 TABLE 5 Variation site 124 97 239 367 390 33 80 102 137 210 318 Existing sequence T N N N T E I Q D T P M1  W K M2  W G M3  W V M4  W L M5  W H M6  W D M7  W I M8  W R M9  W Y A M10 W Y S M11 W Y W M12 W Y G M13 W Y F M14 W Y Y M15 W Y W M16 W Y Y M17 W Y R M18 W Y F M19 W Y C M20 W Y T M21 W Y S M22 W Y L M23 W Y K M24 W Y E M25 W Y T M26 W Y A M27 W Y S M28 W Y P M29 W Y W M30 W Y L M31 W Y I M32 W Y C M33 W Y E M34 W Y G M35 W Y R M36 W Y F M37 W Y D M38 W Y S M39 W Y K M40 W Y L M41 W Y V M42 W Y G M43 W Y H M44 W Y G M45 W Y I M46 W Y A M47 W Y C M48 W Y V M49 W Y V W M50 W Y V R M51 W Y V L M52 W Y V C M53 W Y V S M54 W Y V G M55 W Y K V M56 W Y V W R M57 W Y V W L M58 W Y V W S M59 W Y V W G M60 W Y V R L M61 W Y V R C M62 W Y V R S M63 W Y V S G

(113) TABLE-US-00006 TABLE 6 Variation site E33 A S W G F Y I80 W Y R F C T S L K E Q102 T A S P W L I D137 C E G R F T210 D S K L V G N239 K P318 H G I A C N367 V T390 K G V L H D I R

Example 5. Comparative Evaluation of Characteristics of Variant Enzymes

Example 5-1. Evaluation of Activity

(114) To measure the fructose-4-epimerization activity of the recombinant variant enzymes obtained in Example 5, 50 mM Tris-HCl (pH 8.0), 3 mM MnSO.sub.4, and each 2 mg/mL of the enzymes were added to 30% by weight of fructose, and allowed to react at 60° C. for 2 hours.

(115) As a result, all of the variants showed increased fructose-4-epimerization activity, as compared with the conversion activity of the wild-type (KO). The detailed results are shown in the following Tables 7 to 9.

(116) TABLE-US-00007 TABLE 7 Variation site Relative activity (%) KO (WILD) 100 T124W 412 T124W + T390K 604 T124W + T390G 460 T124W + T390V 496 T124W + T390L 452 T124W + T390H 504 T124W + T390D 352 T124W + T390I 432 T124W + T390R 668

(117) TABLE-US-00008 TABLE 8 Variation site Additional variation Relative activity (%) KO (WILD) 100 T124WN97Y 624 T124WN97Y E33A 797 T124WN97Y E33S 788 T124WN97Y E33W 828 T124WN97Y E33G 779 T124WN97Y E33F 889 T124WN97Y E33Y 810 T124WN97Y I80W 876 T124WN97Y I80Y 736 T124WN97Y I80R 951 T124WN97Y I80F 211 T124WN97Y I80C 205 T124WN97Y I80T 246 T124WN97Y I80S 864 T124WN97Y I80L 876 T124WN97Y I80K 857 T124WN97Y I80E 867 T124WN97Y Q102T 198 T124WN97Y Q102A 572 T124WN97Y Q102S 698 T124WN97Y Q102P 638 T124WN97Y Q102W 620 T124WN97Y Q102L 733 T124WN97Y Q102I 803 T124WN97Y D137C 745 T124WN97Y D137E 618 T124WN97Y D137G 555 T124WN97Y D137R 551 T124WN97Y D137F 580 T124WN97Y T210D 347 T124WN97Y T210S 421 T124WN97Y T210K 370 T124WN97Y T210L 417 T124WN97Y T210V 806 T124WN97Y T210G 870 T124WN97Y P318H 337 T124WN97Y P318G 635 T124WN97Y P318I 479 T124WN97Y P318A 571 T124WN97Y P318C 854

(118) TABLE-US-00009 TABLE 9 Variation site Additional variation Relative activity (%) KO (WILD) 100 T124WN97YN367V 260.4 T124WN97YN367V E33W 305.2 T124WN97YN367V I80R 312.8 T124WN97YN367V Q102L 418.4 T124WN97YN367V D137C 335.2 T124WN97YN367V T210S 373.2 T124WN97YN367V P318G 322.0 T124WN97YN367VE33W I80R 267.6 T124WN97YN367VE33W Q102L 269.8 T124WN97YN367VE33W T210S 271.3 T124WN97YN367VE33W P318G 274.5 T124WN97YN367VI80R Q102L 272.7 T124WN97YN367VI80R D137C 266.5 T124WN97YN367VI80R T210S 260.3 T124WN97YN367VT210S P318G 269.5

(119) These results indicate that the variants of the present disclosure have increased fructose-4-epimerization activity, as compared with the wild-type.

Example 5-2. Comparative Evaluation of Activity According to Number of Variations

(120) To compare the increase in the conversion rate according to the number of variations from the results of measuring the fructose-4-epimerization activity of the recombinant variant enzymes obtained in Example 5-1, 50 mM Tris-HCl (pH 8.0), 3 mM MnSO.sub.4, and each 2 mg/mL of the enzymes were added to 30% by weight of fructose, and allowed to react at 50° C. or 60° C. for 2 hours.

(121) As a result, all the variants of the present disclosure have increased fructose-4-epimerization activity, as compared with the wild-type (FIG. 3).

Example 5-3. Comparative Evaluation of Thermal Stability

(122) To measure thermal stability of the obtained recombinant variant enzymes, each of the enzymes purified at a concentration of 5 mg/mL was added and left at 60° C. for at least 19 hours and up to 90 hours, and then left on ice for 5 minutes. Each of the enzyme solutions sampled at each time point, 50 mM Tris-HCl (pH 8.0), and 3 mM MnSO.sub.4 were added to 30% by weight of fructose, and an enzymatic reaction was allowed to measure the residual activity of the enzymes.

(123) The results of examining thermal stability showed that the fructose-4-epimerase variants showed reduction in the residual activity at 60° C. over time, but the thermal stability was more excellent than that of the wild-type, as shown in FIG. 4.

(124) The present inventors transformed into E. coli BL21(DE3) strain to prepare transformants (transformed microorganisms) designated as E. coli BL21(DE3)/CJ_KO_F4E_M3(T124W) and E. coli BL21(DE3)/CJ_KO_F4E_M8(T124W+N97Y), respectively and deposited the transformants on Sep. 19, 2018 at the Korean Culture Center of Microorganisms (KCCM) which is an international Depositary Authority under the provisions of the Budapest Treaty with Accession. Nos. KCCM12322P (E. coli BL21(DE3)/CJ_KO_F4E_M3) and KCCM12327P (E. coli BL21(DE3)/CJ_KO_F4E_M8), respectively.

(125) Based on the above description, it will be understood by those skilled in the art that the present disclosure may be implemented in a different specific form without changing the technical spirit or essential characteristics thereof. Therefore, it should be understood that the above embodiment is not limitative, but illustrative in all aspects. The scope of the invention is defined by the appended claims rather than by the description preceding them, and therefore all changes and modifications that fall within metes and bounds of the claims, or equivalents of such metes and bounds are therefore intended to be embraced by the claims.