MEDIUM COMPOSITION FOR ENHANCING WNT PROTEIN ACTIVITY
20220275344 · 2022-09-01
Assignee
- INDUSTRAY-ACADEMIC COOPERATION FOUNDATION, YONSEI UNIVERSITY (Seoul, KR)
- INTERPARK BIO CONVERGENCE CORP. (Seoul, KR)
Inventors
- Jinu Lee (Incheon, KR)
- Chul Hoon Kim (Gyeonggi-do, KR)
- Soon Sung Kwon (Seoul, KR)
- Joo Hye Yeo (Seoul, KR)
Cpc classification
C12N2501/999
CHEMISTRY; METALLURGY
C12N2501/00
CHEMISTRY; METALLURGY
C12N2501/155
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure relates to a serum-free medium composition for enhancing Wnt protein activity and culturing an organoid and a method for culturing an organoid using the same.
Claims
1. A medium composition for culturing a cell, a cell aggregate, a tissue fragment or an organ analog, comprising a basal medium, Wnt protein or a cell expressing the same, afamin or a cell expressing the same, and albumin as active ingredients.
2. The medium composition according to claim 1, wherein the Wnt protein is Wnt3a protein.
3. The medium composition according to claim 1, wherein the albumin is comprised at a concentration of 0.1-20 mg/mL.
4. The medium composition according to claim 1, wherein the organ analog is an organoid.
5. The medium composition according to claim 1, wherein the medium composition is a serum-free medium composition.
6. The medium composition according to claim 1, wherein the basal medium is one or more selected from a group consisting of Dulbecco's modified Eagle's medium (DMEM), minimal essential medium (MEM), basal medium Eagle (BME), RPMI 1640, F-10, F-12, DMEM-F12, α-minimal essential medium (α-MEM), Glasgow's minimal essential medium (G-MEM), Iscove's modified Dulbecco's medium (IMDM), MacCoy's 5A medium, AmnioMax, AminoMaxII complete medium, Chang's medium and MesemCult-XF medium.
7. The medium composition according to claim 1, wherein the medium composition further comprises one or more selected from a group consisting of epidermal growth factor (EGF), noggin, thiazovivin, CHIR99021 and a pharmaceutically acceptable salt of CHIR99021.
8. A method for obtaining an organoid, comprising a step of culturing a stem cell, a population of stem cells, a cell differentiated from a stem cell, or an isolated tissue fragment in the medium composition according to claim 1.
9. The method for obtaining an organoid according to claim 8, wherein the medium composition further comprises one or more selected from a group consisting of epidermal growth factor (EGF), noggin, thiazovivin, CHIR99021 and a pharmaceutically acceptable salt of CHIR99021.
10. A composition for enhancing Wnt protein activity in a biological sample, comprising afamin or a cell expressing the same and albumin as active ingredients.
11. A composition for stabilizing Wnt protein in a biological sample, comprising afamin or a cell expressing the same and albumin as active ingredients.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0044]
[0045]
[0046]
[0047]
[0048] Wnt3a protein by western blot after incubating the medium at 37° C. for 0, 24 or 48 hours (left, black curve) and the result of measuring the change in the activity of Wnt protein with time (right, red curve) are shown.
[0049]
BEST MODE
[0050] Hereinafter, the present disclosure is described in detail through examples. However, the following examples merely illustrate the present disclosure and the present disclosure is not limited by the examples.
EXAMPLE 1
Construction of Plasmid for Production of Human Afamin (hAfamin)-Expressing Cells
[0051] A plasmid was constructed for production of hAfam in-expressing cells.
[0052] First, pLVX-EIBIa was prepared by replacing the puromycin acetyltransferase gene of pLVX-EF1a-IRES-Puro (Clontech) with the blasticidin S deaminase gene. Then, a human afamin-coding sequence (human afamin CDS) obtained by PCR was inserted into the plasmid.
[0053] Amplification was conducted with pfu DNA polymerase (Solgent) using pCR-BluntII-TOPO-Afamin (MHS6278-211689548, Dharmacon) as a template and SEQ ID NOS 2 and 3 as primers. After loading a sample into a PCR machine, PCR was performed under the condition of pause at 70° C., 5 cycles of 2 minutes at 95° C., 20 seconds at 95° C., 20 seconds at 50° C. and 2 minutes at 68° C., and 20 cycles of 20 seconds at 95° C., 20 seconds at 60° C. and 2 minutes at 68° C., followed by 3 minutes at 68° C. and pause at 4° C. During the PCR, the sample was separated based on size on 1% agarose gel, and hAfamin was obtained through gel extraction. A hAfamin fragment was cleaved with Xba1 restriction enzyme, and then pLVX-EIBIa-hAfamin plasmid was constructed by inserting into the Xba1 restriction enzyme site of the pLVXEIBIa plasmid.
[0054] The hAfamin polynucleotide is represented by SEQ ID NO 1, and the primer pair used in the PCR are given in Table 1.
TABLE-US-00001 TABLE 1 SEQ ID NO Primer Sequence 2 XbaI-hAfamin U1 TCTAGA GCCACC ATGG TGAAACTACTAAAACTTACAGG 3 hAfamin-XbaI L1 TATAT TCTAGA T TCAGTTGCCAATTTTTGGAC
EXAMPLE 2
Construction of Lentivirus for Preparation of hAfamin-Expressing Cells
[0055] HEK293T cells were plated on a 6-well plate at a concentration of 4×105 cells/well and then transformed 24 hours later with 2 μg of DNA at a ratio of pLVX-EIBIa-hAfamin:pxPAX2 (Addgene 12260):pMD2.G (Addgene 12259) =4:3:1. Next day, after replacing the medium and incubating for 48 hours, the culture medium was collected. The medium containing lentivirus was filtered through a 0.45-μm filter and then stored at 4° C.
EXAMPLE 3
Preparation of Afamin-Expressing Cells (L-Wnt3a-Afamin, L3a-Afa)
[0056] L-Wnt3a (hereinafter, L3a) cells were acquired from Dr. Hans Clevers (Utrecht University, the Netherlands). The L3a cells are the cells designed to express Wnt3a. After culturing the L3a cells on a 24-well plate to 30% confluency, the cells were infected by mixing with 200 μL of a fresh medium and 200 μL of pLVX-EIBIa-hAfamin virus. After infection for 12 hours, the medium was replaced. 72 hours later, the cells were transferred onto a 60-mm dish and treated with 10 μg/mL blasticidin for 1 week to obtain afam in-expressing cells (L3a-Afa).
EXAMPLE 4
Preparation of Human Albumin
[0057] Human albumin was purchased from Sigma (Catalog Number A9731).
EXAMPLE 5
Preparation of Conditioned Medium
[0058] A conditioned medium containing Wnt3a was obtained by culturing the L3a cells and a conditioned medium containing Wnt3a and afamin was obtained by culturing the L3a-Afa cells. Bovine serum albumin or human albumin was added to each conditioned medium at various concentrations.
[0059] 5-1. Preparation of Conditioned Medium Containing Bovine Serum Albumin (BSA)
[0060] L3a cells and L3a-Afa cells were cultured respectively on a 100-mm dish until 90% confluency. After washing twice with 12 mL of PBS, the medium was replaced with a DMEM/F12 medium supplemented with 0, 0.3, 1, 2, 5, 10 or 20 mg/mL bovine serum albumin (BSA) or DMEM supplemented with 10% FBS. Then, after culturing for 5 days, the conditioned medium was collected and filtered through a 0.45-μm filter after removing the cells by centrifuging at 1,000 rpm for 3 minutes.
[0061] 5-2. Preparation of Conditioned Medium Containing Human Albumin
[0062] In consideration of the fact that impurities included in bovine serum albumin can affect Wnt protein activity, a conditioned medium was prepared using the human albumin prepared in Example 4. Specifically, L3a cells and L3a-Afa cells were cultured respectively on a 100-mm dish until 90% confluency. After washing twice with 12 mL of PBS, the medium was replaced with a DMEM/F12 medium supplemented with 0 or 5 mg/mL human albumin. Then, after culturing for 5 days, the conditioned medium was collected and filtered through a 0.45-μm filter after removing the cells by centrifuging at 1,000 rpm for 3 minutes.
Test Example 1
Investigation of Wnt Protein Activity
[0063] 1-1. Investigation of Wnt Protein Activity for Conditioned Medium Containing Bovine Serum Albumin
[0064] The Wnt protein activity of the conditioned medium prepared in Example 5-1 was measured. Specifically, reporter assay was conducted using 293-STF (ATCC) cells. 293-STF cells were plated on a 96-well plate coated with 0.05% poly-L-lysine to 70% confluency. Next day, after replacing the medium with 100 μL of a fresh medium, 50 μL of the conditioned medium was added. Luciferase assay was conducted 10-14 hours later. The measured Wnt protein activity was represented relative to the activity when fetal bovine serum (FBS) was added.
[0065] As a result, it was confirmed that, for the conditioned medium containing Wnt3, Wnt protein activity was increased as the addition amount of bovine serum albumin was increased. In particular, when bovine serum albumin was added at a concentration of 5 mg/mL or higher, Wnt protein activity was increased remarkably when the conditioned medium was added as compared to when the bovine serum albumin was not added (0 mg/mL) (
[0066] In addition, it was confirmed that, for the conditioned medium containing Wnt3a and afamin, Wnt protein activity was increased remarkably as compared to the conditioned medium containing Wnt3 only. In particular, when the bovine serum albumin was further added, Wnt protein activity was increased to a level similar to that when FBS was added (
[0067] 1-2. Investigation of Wnt Protein Activity for Conditioned Medium Containing Human Albumin
[0068] The Wnt protein activity of the conditioned medium prepared in Example 5-2 was measured. The measurement was made according to the same method as in Test Example 1-1.
[0069] As a result, it was confirmed that Wnt3a protein activity was increased in the medium supplemented with human albumin, similarly to that supplemented with bovine serum albumin. In addition, Wnt3a protein activity was further increased in the medium supplemented with 5 mg/mL afamin and human albumin as compared to the medium not containing afamin (
[0070] This result suggests that not only bovine serum albumin but also human albumin can be used, and that Wnt protein activity can be enhanced further by eliminating the effect by the impurities of bovine serum albumin.
Test Example 2
Measurement of Amount and Activity of Wnt Protein Depending on Medium Composition
[0071] A conditioned medium containing Wnt3a and afamin was prepared by culturing L3a-Afa cells for 5 days in the absence (−) or presence (+) of BSA. After incubating the conditioned medium containing Wnt3a and afamin at 37° C. for 0, 24 or 48 hours, the amount of Wnt3a protein was measured by western blot using human or mouse anti-Wnt3a antibody (
[0072] In addition, after incubating the same conditioned medium at 37° C. for 0, 24 or 48 hours, the change in the activity of Wnt protein with time was measured by TOPflash assay (
[0073] In addition, in order to investigate the type of Wnt protein, a conditioned medium prepared by culturing L3a-Afa cells in the absence (−) or presence (+) of BSA for 5 days was subjected to sucrose gradient centrifugation and western blot was performed on the obtained fractions. As seen from
Test Example 3
Measurement of Human Organoid Formation Efficiency of Wnt Protein Depending on Medium Composition
[0074] A human colon organoid was cultured by culturing L3a-Afa cells in the prepared conditioned medium for 5 days in the absence (−) or presence (+) of BSA. N-acetylcysteine (1 mM), B-27 supplement (2%), R-spondin-1 conditioned medium (10%), EGF (50 ng/mL), noggin (100 ng/mL), nicotinamide (10 mM), TGFβ inhibitor (A83-01, 500 nM) and p38 inhibitor (10 μM) were included in the conditioned medium. After placing colonic adult stem cells in a Matrigel dome, an organoid was cultured by adding the medium. The colon organoid was subcultured once in 10 days, and the efficiency of organoid formation and growth was measured by counting the number of cells. As a result, whereas the organoid formation was maintained in the BSA (+) medium, the growth of the organoid was stopped early in the BSA (−) medium. Through this, it was confirmed that the organoid is formed effectively only when the Wnt protein activity is maintained by a combination of afamin and albumin (
[0075] It will be easily understood by those having ordinary knowledge in the art to which the present disclosure belongs that the foregoing description of the present disclosure is for illustration only and the present disclosure can be easily changed into other specific forms without changing the technical idea or essential features. Therefore, it should be understood that the exemplary embodiments described above are illustrative not limitative.
[0076] It is to be understood that the scope of the present disclosure is defined by the appended claims, and the meaning and scope of the claims and all changes or modifications thereof derived from equivalent concepts thereof are included in the scope of the present disclosure.