Humanized transgenic animal

11439132 · 2022-09-13

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are a humanized transgenic non-human animal, especially a rodent, in particular a transgenic mouse containing a human interleukin 17A (IL-17A) gene, a human gene 17RA (IL-17RA) and/or a human TNF-alpha gene, and a preparation method therefor and the use thereof.

Claims

1. A genetically-modified, non-human animal whose genome comprises a sequence encoding a humanized IL-17RA protein at an endogenous IL-17RA gene locus, wherein the sequence encoding the humanized IL-17RA protein is operably linked to an endogenous IL-17RA regulatory element at an endogenous IL-17RA gene locus, wherein the animal comprises a replacement of a part of exon 2, exons 3-10 and a part of exon 11 of the endogenous IL-17RA gene, with a part of exon 2, exons 3-10 and a part of exon 11 of a human IL-17RA gene, wherein the non-human animal detectably expresses the humanized IL-17RA protein on the surface of spleen cells, and the humanized IL-17RA protein comprises an amino acid sequence that is at least 95% identical SEQ ID NO: 39.

2. The animal of claim 1, wherein the humanized IL-17RA protein comprises SEQ ID NO: 39.

3. The animal of claim 1, wherein the genome of the animal further comprises a sequence encoding a human IL-17A protein, wherein the sequence encoding the human IL-17A protein is operably linked to an endogenous 5′UTR at an endogenous IL-17A gene locus.

4. The animal of claim 3, wherein the human IL-17A protein comprises an amino acid sequence that is at least 80% identical to SEQ ID NO: 4.

5. The animal of claim 3, wherein the human IL-17A protein comprises SEQ ID NO: 4.

6. The animal of claim 3, wherein the animal expresses the human IL-17A protein.

7. The animal of claim 3, wherein the animal is a rodent.

8. The animal of claim 3, wherein the animal is a mouse.

9. The animal of claim 3, whose genome comprises a replacement of a sequence encoding an endogenous IL-17A protein with a sequence encoding the human IL-17A protein.

10. The animal of claim 3, wherein the animal further comprises a sequence encoding a human TNF-α protein.

11. A method for making a genetically-modified non-human animal, comprising: (a) replacing in a fertilized egg or an embryonic stem cell, at an endogenous IL-17RA gene locus, a part of exon 2, exons 3-10, and a part of exon 11 of endogenous IL-17RA gene with a part of exon 2, exons 3-10 and a part of exon 11 of a human IL-17RA gene; (b) transplanting the fertilized egg of step (a) into a female non-human animal or transplanting the embryonic stem cell of step (a) into a blastocyst, which is then transferred into a female non-human animal; and (c) obtaining a genetically-modified, non-human animal, wherein the non-human animal has genome that comprises a sequence encoding a humanized IL-17RA protein that is operably linked to an endogenous IL-17RA regulatory element at an endogenous IL-17RA gene locus.

12. The method of claim 11, wherein the humanized IL-17RA protein comprises an amino acid sequence that is at least 95% identical SEQ ID NO: 39.

13. The method of claim 11, wherein the humanized IL-17RA protein comprises SEQ ID NO: 39.

14. The method of claim 11, wherein the non-human animal detectably expresses the humanized IL-17RA protein on the surface of spleen cells.

Description

DESCRIPTION OF DRAWINGS

(1) Herein after, the embodiments of the disclosure will be described in detail with reference to the accompanying drawings.

(2) FIG. 1: Schematic diagram showing mouse IL-17A gene locus and human IL-17A gene locus (not to scale).

(3) FIG. 2: Schematic diagram showing humanized mouse IL-17A gene (not to scale).

(4) FIG. 3: Schematic diagram showing the targeting strategy for replacing the endogenous IL-17A gene sequence in mice with a targeting vector containing the human IL-17A gene sequence (not to scale).

(5) FIG. 4: Southern Blot results from different positive cell colonies, in which WT is wild-type control.

(6) FIG. 5: Schematic diagram showing the FRT recombination process (not to scale).

(7) FIG. 6: tail vein PCR identification results for F1 generation mice, in which, panel (A), use primer pair WT-F and WT-R to amplify the endogenous mouse wild-type IL-17A gene fragment; panel (B), use primer pair WT-F and Mut-R to amplify the modified IL-17A gene fragment to verify whether the targeting vector is correctly inserted into the mouse genome site;

(8) panel (C), use primer pair Frt-F and Frt-R to amplify the neo fragment to verify whether the resistance gene is removed; and panel (D), use primer pair Flp-F2 and Flp-R2 to confirm the presence of the Flp fragment; in which, WT: wild-type mouse, M: Marker, and PC: positive control.

(9) FIG. 7: ELISA test results of human IL-17A.

(10) FIG. 8: Schematic diagram showing mouse IL-17RA gene compared with human IL-17RA gene (not to scale).

(11) FIG. 9: Schematic diagram showing humanized mouse IL-17RA gene (not to scale).

(12) FIG. 10: Schematic diagram showing the targeting strategy for replacing the mouse endogenous IL-17RA gene sequence with a targeting vector containing the human IL-17RA gene sequence (not to scale).

(13) FIG. 11: Southern Blot results from different positive cell colonies, in which WT refers to a wild-type control.

(14) FIG. 12: tail vein PCR identification results for F1 generation mouse, in which: panel (A), use primer pair WT-F and WT-R to amplify the endogenous mouse wild-type IL-17RA gene fragment; panel (B), use primer pair WT-F and Mut-R to amplify the modified IL-17RA gene fragment to verify whether the targeting vector is correctly inserted into the mouse genome site; panel (C), use primer pair Frt-F and Frt-R to amplify the neo fragment to verify whether the resistance gene is removed; and panel (D), use primer pair Flp-F2 and Flp-R2 to confirm the presence of the Flp fragment; in which, WT: wild-type, M: marker, and PC: positive control.

(15) FIG. 13: Results of flow cytometric analysis of C57BL/6 wild-type mice (panels (A) and (C)) and IL-17RA humanized genetically-modified mice (panels (B) and (D)) using mIL-17RA PE (panels (A) and (C)) or hIL-17RA PE (panels (B) and (D)) and mGR1PerCP for cell labeling.

(16) FIG. 14: tail vein PCR identification results for F1 generation mouse, in which: panel (A), use primer pair WT-F and WT-R to amplify the endogenous mouse wild-type TNF-α gene fragment; panel (B), use primer pair Neo-F and WT-R to amplify modified TNF-α gene fragments to verify whether the neo fragments are present and inserted into the genome site correctly; in which, WT: wild type, M: marker, and +: positive control.

(17) FIG. 15: A graph of the body weight of mice over time, in the MOG-induced EAE model and the control group (no induction) of IL-17A gene humanized mouse homozygotes. G1 and G3 are control groups; G2 and G4 are EAE models.

(18) FIG. 16: A graph of the clinical score of mice over time, in the MOG-induced EAE model and the control group using mouse homozygotes for humanized IL-17A gene. G1 and G3 are control groups; G2 and G4 are EAE models.

(19) FIG. 17: HE staining results (100×) of spinal cord tissue sections from the MOG-induced EAE model and the control group of mice homozygous for humanized IL-17A gene, 45 day after the induction. G1 is the control group, and G2 is the EAE model.

(20) FIG. 18: Immunohistochemical staining results (100×) of spinal cord tissue sections from the MOG-induced EAE model and the control group of mice homozygous for humanized IL-17A gene, 45 day after the induction. Green: MBP; blue: DAPI. G1 is the control group, and G2 is the EAE model.

(21) FIG. 19: Exemplary FACS results for detecting IL-17 and IFNγ in lymph nodes in vitro from the MOG-induced EAE model and the control group of mice homozygous for humanized IL-17A gene, 45 day after the induction. Panel A shows the result of a mouse from the control group G1, and panel B shows the result of a mouse from the model group G2.

(22) FIG. 20: Experimental flow chart for evaluating the effectiveness of anti-human IL-17A antibodies in the MOG-induced EAE model of mice homozygous for humanized IL-17A gene.

(23) FIG. 21: A statistical graph of body weights of mice in the anti-human IL-17A antibody treatment group and the control group (PBS), in MOG-induced EAE models of mice homozygous for humanized IL-17A gene.

(24) FIG. 22: A statistical graph of clinical scores of mice in the anti-human IL-17A antibody treatment group and the control group, in MOG-induced EAE models of mice homozygous for humanized IL-17A gene.

(25) FIG. 23: Experimental flow chart for evaluating the effectiveness of anti-human IL-17A antibodies in imiquimod-induced psoriasis model of mice homozygous for humanized IL-17A gene.

(26) FIG. 24: A statistical graph of body weights of mice in the control group (G1), model group (G2) and anti-human IL-17A antibody treatment group (G3), in imiquimod-induced psoriasis model of mice homozygous for humanized IL-17A gene.

(27) FIG. 25: A statistical graph of erythema scores on psoriasis-like lesions of mice in the control group (G1), model group (G2) and anti-human IL-17A antibody treatment group (G3), in imiquimod-induced psoriasis model of mice homozygous for humanized IL-17A gene.

(28) FIG. 26: A statistical graph of psoriasis-like scales scores of mice in the control group (G1), model group (G2) and anti-human IL-17A antibody treatment group (G3), in imiquimod-induced psoriasis model of mice homozygous for humanized IL-17A gene.

(29) FIG. 27: A statistical graph of PASI scores of mice in the control group (G1), model group (G2) and anti-human IL-17A antibody treatment group (G3), in imiquimod-induced psoriasis model of mice homozygous for humanized IL-17A gene.

(30) FIG. 28: HE staining results of the dorsal tissue sections of mice in the control group (G1), model group (G2) and anti-human IL-17A antibody treatment group (G3), in imiquimod-induced psoriasis model of mice homozygous for humanized IL-17A gene.

(31) FIG. 29: A statistical graph of the epidermal thickness of the back tissue of mice in the control group (G1), model group (G2) and anti-human IL-17A antibody treatment group (G3), in imiquimod-induced psoriasis model of mice homozygous for humanized IL-17A gene.

(32) FIG. 30: A statistical graph of the pathological scores of the back skin sections of mice in the control group (G1), model group (G2) and anti-human IL-17A antibody treatment group (G3), in imiquimod-induced psoriasis model of mice homozygous for humanized IL-17A gene.

(33) FIG. 31: Experimental flow chart of evaluating the effectiveness of different doses of anti-human IL-17A antibody in imiquimod-induced psoriasis model of mice homozygous for humanized IL-17A gene.

(34) FIG. 32: A statistical graph of body weights of mice in the blank control group (G1), NaCl control group (G2), IgG.sub.4 isotype control group (G3) and treatment groups of anti-human IL-17A antibody at different concentrations (G4-G6), in imiquimod-induced psoriasis model of mice homozygous for humanized IL-17A gene.

(35) FIG. 33: A statistical graph of erythema scores on psoriasis-like lesions of mice in the blank control group (G1), NaCl control group (G2), IgG.sub.4 isotype control group (G3) and treatment groups of anti-human IL-17A antibody at different concentrations (G4-G6), in imiquimod-induced psoriasis model of mice homozygous for humanized IL-17A gene.

(36) FIG. 34: A statistical graph of psoriasis-like scales scores of mice in the blank control group (G1), NaCl control group (G2), IgG.sub.4 isotype control group (G3) and treatment groups of anti-human IL-17A antibody at different concentrations (G4-G6), in imiquimod-induced psoriasis model of mice homozygous for humanized IL-17A gene.

(37) FIG. 35: A statistical graph of PASI scores of mice in the blank control group (G1), NaCl control group (G2), IgG.sub.4 isotype control group (G3) and treatment groups of anti-human IL-17A antibody at different concentrations (G4-G6), in imiquimod-induced psoriasis model of mice homozygous for humanized IL-17A gene.

(38) FIG. 36: A statistical graph of the epidermal thickness of the back tissue of mice in the blank control group (G1), NaCl control group (G2), IgG.sub.4 isotype control group (G3) and treatment groups of anti-human IL-17A antibody at different concentrations (G4-G6), in imiquimod-induced psoriasis model of mice homozygous for humanized IL-17A gene.

(39) FIG. 37: A statistical graph of the pathological scores of the back skin sections of mice in the blank control group (G1), NaCl control group (G2), IgG.sub.4 isotype control group (G3) and treatment groups of anti-human IL-17A antibody at different concentrations (G4-G6), in imiquimod-induced psoriasis model of mice homozygous for humanized IL-17A gene.

SEQUENCE LISTING

(40) The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Nov. 19, 2019, is named Revised Sequence Listing.txt and is 129,510 bytes in size.

DETAILED DESCRIPTION

(41) The invention will be further described below in conjunction with specific examples, and the advantages and characteristics of the invention will become clearer with the description. However, these examples are only exemplary and do not constitute any limitation to the scope of the invention. Those skilled in the art should understand that the details and forms of the technical solution of the invention can be modified or replaced without departing from the spirit and scope of the invention, and these modifications and replacements fall within the protection scope of the invention.

(42) In the following examples, the equipment and materials were obtained from the companies indicated below.

(43) EcoRI, ScaI, HindIII, amHI, XhoI, EcoRV, SalI and BbsI enzymes were purchased from NEB, with catalog numbers R3101M, R3122M, R3104M, R3136M, R0146M, R3195M, R3138M and R0539L, respectively.

(44) C57BL/6 mice were purchased from the National Resource Center for Rodent Laboratory Animal of the National Institutes for Food and Drug Control, China.

(45) Mouse MC38 colon cancer cells were purchased from Shanghai Biological Technology Co., Ltd. enzyme research.

(46) The BAC library was purchased from Invitrogen, with catalog numbers RPCI23.0 and RPCI11.C.

(47) BV711 hamster anti-mouse CD3e (mCD3) was purchased from BD, with catalog number 63123.

(48) Flow cytometer was purchased from BD, with model Calibur.

(49) IL-17A ELISA kit was purchased from Biolegend, with catalog number 433917.

(50) CD217 (IL-17Ra) monoclonal antibody (PM-17R), PE (mIL17RA PE) was purchased from ebioscience, with catalog number 12-7182-80.

(51) CD217 (IL-17Ra) monoclonal antibody (J10MBS), PE (hIL17RA PE) was purchased from ebioscience, with catalog number 12-7517-41.

(52) APC anti-mouse Ly-6G/Ly-6C (Gr-1) antibody (mGR1PerCP) was purchased from Biolegend, with catalog number 108412.

(53) PE anti-human IL-17A antibody (anti-human IL-17A PE) was purchased from Biolegend, with catalog number 512305.

(54) APC anti-mouse IFN-γ antibody (anti-mouse IFN-γAPC) was purchased from Biolegend, with catalog number 505809.

(55) Alexa Fluor® 488 anti-mouse CD3 antibody was purchased from Biolegend, with catalog number 100212.

(56) Brilliant Violet 421™ anti-mouse CD4 antibody was purchased from Biolegend, with catalog number 100443.

(57) Brilliant Violet 510™ anti-mouse CD45 antibody was purchased from Biolegend, with catalog number 103137.

(58) eBioscience™ Foxp3/Transcription Factor Staining Buffer Set was purchased from ThermoFisher, with catalog number 00-5523-00.

(59) Imiquimod cream (Aldara) was purchased from 3M Health Care Limited, with specification 250 mg: 12.5 mg, and approval number H20160079.

(60) MOG35-55 was purchased from Pro Spec, with specification 100 mg.

(61) Pertussis toxin (PTX) was purchased from Millipore, with catalog number 516560.

Example 1

IL-17A Gene Humanized Mice

(62) The mouse IL-17A gene (NCBI Gene ID: 16171, Primary source: MGI: 107364, UniProt ID: Q62386, located at 20730905 to 20734496 of chromosome 1 NC_000067.6, based on the transcript NM_010552.3 (SEQ ID NO: 1) and encoded protein NP_034682.1 (SEQ ID NO: 2)) and human IL-17A gene (NCBI Gene ID: 3605, Primary source: HGNC: 5981, UniProt ID: Q16552, located at 52186387 to 52190638 of chromosome 6 NC_000006.12, based on the transcript NM_002190.3 (SEQ ID NO: 3) and encoded protein NP_002181.1 (SEQ ID NO: 4)) is shown in FIG. 1.

(63) In order to achieve the purpose of the disclosure, a sequence encoding human IL-17A protein can be introduced into the mouse endogenous IL-17A locus, such that the mouse can express human IL-17A protein. Specifically, gene editing technology can be used to replace the specific mouse IL-17A gene sequence on the mouse endogenous IL-17A locus with a human IL-17A gene sequence, for example, replace the about 2.9 kb (2898 bp) sequence containing at least the start codon ATG to the stop codon TAA of the mouse IL-17A gene with the corresponding human DNA sequence to obtain a humanized IL-17A locus (as shown schematically in FIG. 2), to realize the humanization of mouse IL-17A gene.

(64) Bacterial Artificial Chromosome (BAC) was used to obtain the DNA sequences of mouse and human IL-17A genes, respectively. In the schematic diagram of the targeting strategy shown in FIG. 3, it shows the 3708 bp and 4765 bp upstream and downstream homology arm sequences and the 2861 bp sequence of the human IL-17A gene (extended from the ATG in exon 1 to the stop codon TAA in exon 3) on the targeting vector. The upstream homology arm sequence (5′ homology arm, SEQ ID NO: 5) is identical to the 20727254-20730961 of NC_000067.6, the downstream homology arm sequence (3′homology arm, SEQ ID NO: 6) is identical to the 20735137-20739901 of NC_000067.6, and the sequence of the human IL-17A gene (SEQ ID NO: 7) is identical to the 52186432-52189292 of NC_000006.12. The connection sequence of the human IL-17A gene and the mouse locus upstream is designed as 5′-GCACCCAGCACCAGCTGATCAGGACGCGCAAACATGACTCCTGGGAAGACCTCATTG GTG-3′ (SEQ ID NO: 8), in which the last “C” of the sequence “CAAAC” is the last nucleotide of the mouse sequence, and the first “A” of the sequence “ATGAC” is the first nucleotide of the human sequence. The connection sequence of the human IL-17A gene and the mouse locus downstream is designed as 5′-CGATTGTCCACCATGTGGCCTAAACAGAGACCCGCGGCTGACCCCTAAGA-3′(SEQ ID NO: 9), in which the last “A” of the sequence “CCTAA” is the last nucleotide of the human sequence, and the first “A” of the sequence “ACAGA” is the first nucleotide of the mouse sequence. The mRNA sequence and the encoded protein sequence of the modified humanized mouse IL-17A are shown in SEQ ID NO: 66 and SEQ ID NO: 4, respectively.

(65) In addition, the targeting vector also includes an antibiotic resistance gene for positive clone screening (neomycin phosphotransferase coding sequence Neo) and two FRT recombination sites on both sides of the antibiotic resistance gene that formed a Neo cassette. The connection sequence between the 5′end of the Neo cassette and the mouse locus is designed as 5′-CCGGTGGACACATCTGGAGTACAGCGTCTGCGTCGACGGTATCGATAAGCTTGATATC GAATTCCGAAGTTCCTATTCTCTAG-3′ (SEQ ID NO: 10), in which the last “C” of the sequence “TCTGC” is the last nucleotide of the mouse sequence, and the first “G” of the sequence “GTCGA” is the first nucleotide of the Neo cassette. The connection sequence between the 3′ end of the Neo cassette and the mouse locus is designed as 5′-AGTATAGGAACTTCATCAGTCAGGTACATAATGGTGGATCCACTAGTATCTGTAGCTCG GGGAACATCATGAGAGAGGAGC-3′(SEQ ID NO: 11), in which the last “T” of the sequence “CTAGT” is the last nucleotide of the Neo cassette, and the “A” of the sequence “ATCTG” is the first nucleotide of the mouse sequence. In addition, a coding sequence for a negative selectable marker, that is, the coding sequence for diphtheria toxin A subunit (DTA) was designed downstream of the 3′homology arm of the targeting vector.

(66) The vector can be constructed by conventional methods, such as restriction digestion and ligation, and the like. The constructed targeting vector sequence can be initially verified by restriction digestion, followed the sequencing company for sequencing verification. The targeting vector verified by sequencing was transferred into embryonic stem cells of C57BL/6 mice by electroporation, and the obtained cells were screened by selectable marker for the positive clones, and the integration of foreign genes was confirmed by PCR and Southern Blot methods, to screen out the correct positive clones. The positive clones were identified by PCR (PCR results not shown) were then subjected to Southern Blot (DNA extracted from cells was digested with EcoRV or SpeI or SacI, and then hybridized with 3 probes). The results are shown in FIG. 4, and the detection results indicate that among the 8 clones that are positive in PCR, 6 clones (1-A10, 1-B7, 1-C10, 2-G3, 2-H5, 2-H12) are positive heterozygous clones without random insertion.

(67) The following primers are used for PCR.

(68) TABLE-US-00002 F1: (SEQ ID NO: 12) 5′-CTTCTGATACATATGCATCCACGTGC-3′; R1: (SEQ ID NO: 13) 5′-ATGCCCACGGTCCAGAAATACTAT-3′; F2: (SEQ ID NO: 14) 5′-GCTCGACTAGAGCTTGCGGA-3′; R2: (SEQ ID NO: 15) 5′-GTGAGAGCAGCAAGTGCTCTTAACC-3′.

(69) The following probes are used for Southern Blot.

(70) TABLE-US-00003 5′Probe: F: (SEQ ID NO: 16) 5′-AGAGCAGCATACCAATTAGCAACAT-3′; R: (SEQ ID NO: 17) 5′-CTAGGTGGGTTCCTCACTGGTCT-3′. 3′Probe: F: (SEQ ID NO: 18) 5′-ACCAAAGGAACAAGTGGAAAGAATCGG-3′; R: (SEQ ID NO: 19) 5′-ATCTTCCTGCCCAGCATTGCCT-3′. Neo Probe: F: (SEQ ID NO: 20) 5′-GGATCGGCCATTGAACAAGATGG-3′; R: (SEQ ID NO: 21) 5′-CAGAAGAACTCGTCAAGAAGGCG-3′.

(71) According to the technique known in the art, the positive colonies (from black mouse) were selected and introduced into the isolated blastocyst (from white mouse), and the obtained chimeric blastocyst was transferred to the culture medium for short-term culture and then transplanted into the oviduct of the recipient mother mouse (white mouse) to produce F0 generation chimeric mouse (black and white chequered). The F0 generation chimeric mice and wild-type mice were backcrossed to obtain F1 generation mice, and then F1 generation heterozygous mice were mated with each other to obtain F2 generation homozygous mice. The positive mouse can also be bred with the Flp tool mouse to remove the selectable marker gene from the positive clone (the process diagram is shown in FIG. 5), and then mated with each other to obtain the IL-17A gene humanized homozygous mouse expressing human IL-17A protein. The genotypes of the somatic cells of the offspring mice can be identified by PCR. The identification results of exemplary F1 generation mice (the Neo marker gene removed) are shown in FIG. 6, in which mice numbered F1-2, F1-5, F1-7, F1-21, F1-26 are positive heterozygous mice. The following primers are used for PCR.

(72) TABLE-US-00004 WT-F: (SEQ ID NO: 22) 5′-TCTCTGTTCAGCTCCCAAGAAGTCA-3′; WT-R: (SEQ ID NO: 23) 5′-CTCATTGCATAGCGTCATGTGACA-3′; WT-F: SEQ ID NO: 22; Mut-R: (SEQ ID NO: 24) 5′-ATGCCCACGGTCCAGAAATACTAT-3′; Frt-F: (SEQ ID NO: 25) 5′-GAATGTAGCTAGCCTGTGCAAGGA-3′; Frt-R: (SEQ ID NO: 26) 5′-CAGCAGACTTCCTGTTGTTCTGCTC-3′; Flp-F2: (SEQ ID NO: 27) 5′-GACAAGCGTTAGTAGGCACATATAC-3′; Flp-R2: (SEQ ID NO: 28) 5′-GCTCCAATTTCCCACAACATTAGT-3′.

(73) Through this method, it is possible to construct a humanized IL-17A gene genetically-modified mouse without random insertion that can be stably passaged.

(74) The expression of human IL-17A protein in the obtained positive mice can be confirmed by routine detection methods, for example, using the ELISA method. One wild-type C57BL/6 mouse and one mouse heterozygous for humanized IL-17A gene were selected, and 7.5 μg anti-mouse CD3 antibody (mCD3) and 4 μg anti-mouse CD28 antibody (mCD28) were injected intraperitoneally into the mice. After 2 hours, the serum was collected and diluted 2 times, and then the level of human IL-17A protein was detected. The detection results (see FIG. 7) showed that no human or humanized IL-17A protein was detected in the wild-type C57BL/6 mice, while human IL-17A protein was detected in mouse heterozygous for humanized IL-17A gene.

Example 2

IL-17RA Gene Humanized Mice

(75) Schematic diagram of mouse IL-17RA gene (NCBI Gene ID: 16172, Primary source: MGI: 107399, UniProt ID: Q60943, located at 120463181 to 120483731 of chromosome 6 NC_000072.6, based on the transcript NM_008359.2 (SEQ ID NO: 29) and encoded protein NP_032385.1 (SEQ ID NO: 30)) compared with human IL-17RA gene (NCBI Gene ID: 23765, Primary source: HGNC: 5985, UniProt ID: Q96F46, located at 17084959 to 17115694 of chromosome 22 NC_000022.11, based on the transcript NM_014339.6 (NM_014339.6) and encoded protein NP_055154.3 (SEQ ID NO: 32) is shown in FIG. 8.

(76) In order to achieve the purpose of the disclosure, a sequence encoding human IL-17RA protein can be introduced into the extracellular region of the mouse endogenous IL-17RA locus, so that the mouse expresses human or humanized IL-17RA protein. Specifically, gene editing technology is used to modify mouse cells to replace the specific mouse IL-17RA gene sequence on the mouse endogenous IL-17RA locus with a human IL-17RA gene sequence. Under the control of the mouse IL-17RA gene regulatory element, for example, at least a 8.9 kb sequence from exon2 to exon 11 of the mouse IL-17RA gene was replaced with the corresponding human gene sequence to obtain the mouse humanized IL-17RA locus, as shown in FIG. 9.

(77) Further, a target strategy as shown in FIG. 10 was designed. Bacterial artificial chromosome (BAC) was used to obtain the DNA sequences of mouse and human IL-17RA genes, respectively. The targeting vector shown in FIG. 10 contains a 5′homology arm (SEQ ID NO: 33), a 3′homology arm (SEQ ID NO: 34) and a human IL-17RA gene fragment (SEQ ID NO: 35), in which the 5′homology arm is identical to the 120467551-120472097 of NC_000072.6, the 3′ homology arm is identical to the 120478869-120482476 of NC_000072.6, and the human IL-17RA gene fragment identical to the 17097068-17105932 of NC_000022.11. The connection between the sequence of the human IL-17RA gene and the mouse locus upstream is designed as 5′-CTTCCTTTCTTCCCACAGGGGCTGAACTGCACGGTCAAGAATAGTAAGTC-3′(SEQ ID NO: 36), in which the last “G” of the sequence “GGCTG” is the last nucleotide of the mouse sequence, and the first “A” of the sequence “AACTG” is the first nucleotide of the human sequence. The connection sequence between the human IL-17RA gene and the mouse locus downstream is designed as 5′-TGGTGGGCTCCGTCATCCTGCTCATCGTCTGTATGACCTGGAGGCTTTCTGGTAAGGA CT-3′ (SEQ ID NO: 37), in which the last “C” of the sequence “TCGTC” is the last nucleotide of the human sequence, and the first “T” of the sequence “TGTAT” is the first nucleotide of the mouse sequence. The mRNA sequence and the encoded protein sequence of the modified humanized mouse IL-17RA are shown in SEQ ID NO: 38 and SEQ ID NO: 39, respectively.

(78) The targeting vector also includes an antibiotic resistance gene for positive clone screening, (neomycin phosphotransferase coding sequence Neo), and two FRT recombination sites on both sides of antibiotic the resistance gene, which constitutes a Neo cassette. The connection sequence between the 5′ end of the Neo cassette and the mouse IL-17RA locus is designed as 5′-AGGAGCAGACCCTGAACTCACAAGGGAAGACCCTCACTCGATATCGAATTCCGAAGT TCCTATTCTCTAGAAAGTATAGG-3′ (SEQ ID NO: 40), in which the last “C” of the sequence “CACTC” is the last nucleotide of the mouse, and the “G” of the sequence “GATAT” is the first nucleotide of the Neo cassette. The connection sequence between the 3′ end of the Neo cassette and the mouse IL-17RA locus is designed as 5′-GTATAGGAACTTCATCAGTCAGGTACATAATGGTGGATCCCAATTGTCCACCAGCTTTG TAGTCACAGGAGACCTAATCT-3′(SEQ ID NO: 41), in which the “G” of the sequence “AATTG” is the last nucleotide of the Neo cassette, and the “T” of the sequence “TCCAC” is the first nucleotide of the mouse sequence. In addition, a coding sequence for a negative selectable marker, that is, the coding sequence for diphtheria toxin A subunit (DTA) was designed downstream of the 3′ homology arm of the targeting vector.

(79) The targeting vectors can be constructed by conventional methods, such as restriction digestion and ligation, direct synthesis and the like. The constructed targeting vector sequence can be initially verified by restriction digestion, followed the sequencing company for sequencing verification. The targeting vector verified by sequencing was transferred into embryonic stem cells of C57BL/6 mice by electroporation, and the obtained cells were screened by selectable marker gene of the positive clones, and the integration of foreign genes was confirmed by PCR and Southern Blot methods, to screen out the correct positive clones. The positive clones that were identified by PCR were then subjected to Southern Blot (DNA extracted from cells was digested with PstI, MfeI or SspI, and hybridized with 3 probes). The Southern Blot results are shown in FIG. 11, and the detection results indicate that 12 clones identified as positive by PCR (1-A02, 1-B07, 1-D07, 1-E05, 1-F05, 1-G06, 2-A09, 2-A10, 2-D03, 2-E06, 2-F07, 2-G10) are all determined to be positive heterozygous clones without random insertion.

(80) The following primers are used for PCR.

(81) TABLE-US-00005 F1: (SEQ ID NO: 42) 5′-GCTCGACTAGAGCTTGCGGA-3′; R1: (SEQ ID NO: 43) 5′-TCTTAAGTAGCAGGCTCAGGAGGCC-3′; F2: (SEQ ID NO: 44) 5′-GTTCACCAGCGTGAATGCTCACA-3′; R2: (SEQ ID NO: 45) 5′-CTGTCAGAAGTTGGCAGCAGG-3′.

(82) The following probes are used for Southern Blot.

(83) TABLE-US-00006 5′Probe: F: (SEQ ID NO: 46) 5′-GGACTGGATGAGACAGCTCAAAGGG-3′; R: (SEQ ID NO: 47) 5′-GCTGCTTACAGGGCTTCTTCCTCAA-3′. 3′Probe: F: (SEQ ID NO: 48) 5′-GAGACGCAATGGGCAGTTAGATTCC-3′; R: (SEQ ID NO: 49) 5′-AAATGTTCCAGCACTTCCTGGGTGT-3′. Neo Probe: F: (SEQ ID NO: 20); R: (SEQ ID NO: 21).

(84) According to the methods described in Example 1, the blastocyst injection and progeny breeding were carried out to obtain heterozygous and homozygous mice for humanized IL-17RA gene expressing humanized IL-17RA protein. The genotypes of somatic cells in offspring mice can be identified by PCR. The identification results of exemplary F1 generation mice (Neo has been removed) are shown in FIG. 12, in which the mice numbered R-F1-1, R-F1-2, and R-F1-5 are positive heterozygous mice. The following primers are used for PCR.

(85) TABLE-US-00007 WT-F: (SEQ ID NO: 50) 5′-ACCACTCACCTCCTCTGCTGGA-3′; WT-R: (SEQ ID NO: 51) 5′-CCTCATGGAGCACAGATGCCTAT-3′; WT-F: SEQ ID NO: 50; Mut-R: (SEQ ID NO: 52) 5′-CTGTCAGAAGTTGGCAGCAGG-3′; Frt-F: (SEQ ID NO: 53) 5′-CAAACAGCAGCCTACACAACTTCAT-3′; Frt-R: (SEQ ID NO: 54) 5′-CTAGGCAACACACCTTCTCCCTGT-3′; Flp-F2: SEQ ID NO: 27; Flp-R2: SEQ ID NO: 28.

(86) Through this method, a humanized IL-17RA gene genetically-modified mouse without random insertion that can be stably passaged was constructed.

(87) The expression of humanized IL-17RA protein in mice can be confirmed by conventional detection methods, for example, the anti-mouse IL-17RA antibody mIL-17RA PE and the anti-mouse Gr-1 antibody mGR1PerCP, or the anti-human IL-17RA antibody hIL-17RA PE and anti-mouse Gr-1 antibody mGR1PerCP were used to identify and stain the bone marrow cells of mice, and then a flow cytometry was used to detect the expression of IL-17RA protein. The flow analysis result is shown (see FIG. 13). In the spleen of mice heterozygous for humanized IL-17RA gene, cells expressing murine IL-17RA protein (FIG. 13B) and humanized IL-17RA protein (FIG. 13D) were detected; while in the spleen of wild-type C57BL/6 mice, only murine IL-17RA protein was detected (FIG. 13A), and no cells expressing human or humanized IL-17RA protein were detected (FIG. 13C).

Example 3

TNF-α Gene Humanized Mice

(88) Mouse TNF-α gene (NCBI Gene ID: 21926, Primary source: MGI: 104798, UniProt ID: P06804, located at 35199367 to 35202007 of 17 NC_000083.6, based on the transcript NM_013693.3 (SEQ ID NO: 55) and encoded protein NP_038721.1 (SEQ ID NO: 56)), human TNF-α gene (NCBI Gene ID: 7124, Primary source: HGNC: 11892, UniProt ID: P01375, located at 31575567 to 31575567 of chromosome 6 NC_000006.12, based on the transcript NM_000594.3 (SEQ ID NO: 57) and encoded protein NP_000585.2 (SEQ ID NO: 58)).

(89) In order to achieve the purpose of the disclosure, a sequence encoding human TNF-α protein can be introduced into the endogenous mouse TNF-α locus so that the mouse expresses human TNF-α protein. Specifically, gene editing technology can be used to replace a specific mouse TNF-α gene sequence on the mouse endogenous TNF-α locus with a human TNF-α gene sequence, for example, replace the about 1.8 kb (1,796 bp) sequence containing at least the start codon ATG to the stop codon TAA of the mouse TNF-α gene with the corresponding human gene sequence to realize the humanization of the mouse TNF-α gene.

(90) A targeting vector for homologous recombination was constructed, which contains an upstream homology arm sequence and a downstream homology arm sequence (the DNA sequence of 6,173 bp upstream and 4,033 bp downstream of the mouse endogenous TNF-α locus), and a sequence of the human TNF-α locus. The upstream homology arm sequence (5′ homology arm, SEQ ID NO: 59) is identical to the 35209909-35203737 of NC_0000083.6, the downstream homology arm sequence (3′ homology arm, SEQ ID NO: 60) is identical to the 35197201 to 35193169 of NC_0000083.6, and the DNA fragment containing the human TNF-α gene sequence (6,287 bp, SEQ ID NO: 61) is identical to the 31573694-31579980 of NC_000006.12.

(91) The targeting vector also includes an antibiotic resistance gene for positive clone screening (neomycin phosphotransferase coding sequence Neo), and two LoxP recombination sites on both sides of the resistance gene, which constitutes a Neo cassette. The 5′ end of the Neo cassette is directly connected to the DNA fragment sequence (SEQ ID NO: 61) containing human TNF-α, and the connection sequence between the 3′ end of the Neo cassette and the mouse locus is designed as 5′-AATGTATGCTATACGAAGTTATTAGGTCCCTCGAGGGGATCCGAATTCATCGGCTTCCT CCTGGAACTCCTCCTCCTCG-3′(SEQ ID NO: 62), in which the last “T” of the sequence “GAATT” is the last nucleotide of the Neo cassette, and the first “C” of the sequence “CATCG” is the first nucleoside of the mouse sequence acid. In addition, a coding sequence for a negative selectable marker, for example, the coding sequence for diphtheria toxin A subunit (DTA) was designed downstream of the 3′ homology arm of the targeting vector.

(92) The vector can be constructed by conventional methods, such as restriction digestion and ligation and the like. After the constructed targeting vector was first verified by restriction digestion, it was sent to the sequencing company for sequencing verification. The targeting vector verified by sequencing was transferred into embryonic stem cells of C57BL/6 mice by electroporation, and the obtained cells were screened by selectable marker for the positive clones, and the integration of foreign genes was confirmed by PCR and Southern Blot methods, to screen out the correct positive clones. According to the method described in Example 1, the blastocyst injection and progeny breeding were carried out to obtain humanized TNF-α gene heterozygous and homozygous mice expressing human TNF-α protein. The genotype of the somatic cells of the offspring mouse can be identified by PCR. The identification result of an exemplary F1 generation mouse is shown in FIG. 14, in which the mouse numbered 10 is a positive heterozygous mouse. The following primers are used for PCR.

(93) TABLE-US-00008 WT-F: (SEQ ID NO: 63) 5′-GGTGACCTAGATAGTGCCTGG-3′; WT-R: (SEQ ID NO: 64) 5′-TCAGTCGCAGGCACGTTAAG-3′; Neo-F: (SEQ ID NO: 65) 5′-TGCATCGCATTGTCTGAGTAGG-3′; WT-R: (SEQ ID NO: 64) 5′-TCAGTCGCAGGCACGTTAAG-3′.

(94) Through this method, a humanized TNF-α gene genetically-modified mouse without random insertion that can be stably passaged was constructed.

Example 4

Production and Identification of Double Humanized or Multi-humanized Mice

(95) The genetically-modified mice with humanized IL-17A gene, IL-17RA gene, or TNF-α gene produced by the method can also be used to produce mouse model with double humanized or multi-humanized genes. For example, in the above Example 1, the embryonic stem cells used for blastocyst microinjection can be selected from mice containing other genetic modifications. Alternatively, on the basis of genetically-modified mice with humanized IL-17A and/or IL-17RA and/or TNF-α, isolated mouse ES cells and gene homologous recombination technology can be used to obtain double-gene or multi-gene modified mouse model with modified IL-17A and/or IL-17RA and/or TNF-α genes and other gene.

(96) The homozygous or heterozygous IL-17A and/or IL-17RA and/or TNF-α genetically-modified mice obtained by this method can also be bred with other genetically modified homozygous or heterozygous mice, and their offspring can be screened. According to Mendelian inheritance rules, there is a certain chance of getting double-gene or multi-gene modified heterozygous mice with humanized IL-17A and/or IL-17RA and/or TNF-α genes and other genetic modifications, and then the heterozygous mice can be bred with each other to obtain double-gene or multi-gene modified homozygous mice. These double-gene or multi-gene modified mice can be used for in vivo pharmacodynamics verification of regulators targeting human IL-17A and/or IL-17RA and/or TNF-α and other related signaling pathways.

(97) For example, for L-17A/TNF-α genes double humanized mice, since the mouse IL-17A gene and TNF-α gene are located on chromosomes 1 and 17, respectively, the IL-17A gene humanized mice are bred with the TNF-α gene humanized mice, and the positive offspring mice are screened to finally obtain the IL-17A/TNF-α genes double humanized mice.

(98) For example, for L-17A/IL-17RA genes double humanized mice, since the mouse IL-17A gene and IL-17RA gene are located on chromosomes 1 and 6, respectively, the IL-17A gene humanized mice are mated with the IL-17RA gene humanized mice, and the positive offspring mice are screened to finally obtain the IL-17A/IL-17RA genes double humanized mice.

Example 5

Establishment of EAE Disease Model Using Humanized Mice

(99) The humanized mice disclosed in the disclosure can be used to produce a variety of human disease models, including multiple sclerosis, asthma, allergies, and other diseases, which can be used to test the in vivo effectiveness of human specific antibodies. For example, mice with humanized IL-17A and/or IL-17RA genes can be used to evaluate the pharmacodynamics, pharmacokinetics and in vivo therapeutic effectiveness of specific antagonists for human IL-17 signaling pathway in various disease models known in the art.

(100) For example, for the production of Experimental Autoimmune Encephalomyelitis (EAE) model, the mice (about 10 weeks age) with humanized IL-17A, IL-17A/IL-17RA and other genes produced in the disclosure can be immunized with MOG once (on day 0, by subcutaneous injection of 200m/mouse), and given intraperitoneal injection of pertussis toxin (PTX) twice (day 0 and day 1, at a dose of 400m/mouse). After the first immunization, the mice were weighed and observed continuously every day. After the onset of the disease, the mice were divided into groups and administered drugs by gavage, intraperitoneal injection, or tail vein injection. Multiple detection indicators such as behavioral score, brain/spinal cord IHC pathology, HE pathology examination, detection of Th17 type cytokines of serum/brain homogenate, and flow cytometry of CNS, spleen, and lymph nodes maybe used to assess the in vivo effectiveness of different drugs for human.

(101) In one study, the mouse homozygous for humanized IL-17A as described in Example 1 was used to establish an EAE disease model. The experimental groups are shown in Table 1. After immunization as described in the above method, none of the mice in the PBS control group (G1, G3) developed the disease, and only mice in the modeling group (G2, G4) were found to have the disease. The clinical symptoms included listlessness, weight loss, loss of tail tension, paralysis of hind limbs or extremities, incontinence, and ataxia developed in individual mice. A total of 10 mice in the two modeling groups developed the disease at 10-12 days after the first immunization, and had weight loss. With the increase in the number of days after sensitization, the number of cases gradually increased. The clinical symptoms reached a peak 3-5 days after the onset, and then entered a remission period, when the weight gradually increased, showing an “onset-remission” trend.

(102) The incidence of female mice was compared with that of the male mice in the modeling group. Every day, animal body weight was measured and the neurological indicators were evaluated according to a 4-point scale (clinical score): 0, normal; 1, weak tail; 2, paralysis of partial hind limbs; 3, paralysis of all hind limbs; 4, paralysis of limbs. It was found that there was no significant difference in morbidity, onset time, peak time, and severity of symptom during the modeling process of both sexes, but the weight and clinical symptoms of female mice recovered better (see FIG. 15, FIG. 16). At the end of the experiment (the 45th day), the spinal cord tissues of female mice were fixed with paraformaldehyde, subjected to paraffin embeding and then sectioned, and stained with HE and IHC to observe histopathological changes. The longitudinal section of white matter of the lumbar enlargement of spinal cord was stained. As shown in FIG. 17 and FIG. 18, there are a large number of inflammatory cells infiltrated and myelin protein is greatly reduced in the spinal cord of MOG-immunized mice (modeling group). No abnormalities in the spinal cord of control mice.

(103) TABLE-US-00009 TABLE 1 Age Number Group Immunogen (weeks) of mice Gender Genotype G1(control group) PBS 10 4 Female IL17A (h/h) G2(model group) MOG 10 5 Female IL17A (h/h) G3(control group) PBS 10 5 Male IL17A (h/h) G4(model group) MOG 10 5 Male IL17A (h/h)

(104) In the EAE model, IL-17A is mainly produced by CD4+Th17 cells during the development of the disease. In order to detect the production of human IL-17 in mice, lymph node cells from MOG-immunized mice homozygous for humanized IL-17A (female, n=5) were isolated and stimulated with PMA and ionomycin in the presence of Brefeldin A for 6 hours. Cells producing IL-17 and IFNγ were analyzed by FACS. FIG. 19 shows exemplary flow cytometry results. The results show that the percentages of hIL-17+CD3+CD4+ T cells and IFNγ+ T cells in CD3+CD4+ T cells in mouse lymph nodes increased after MOG immunization, which proved the successful establishment of EAE model in the molecular level.

(105) The above results indicate that the genetically humanized mice produced by the methods of the disclosure can be used to establish a stable EAE model.

Example 6

Evaluation of In Vivo Effectiveness Using EAE Model of IL-17A Humanized Mice

(106) The EAE model was established according to the method described in Example 5 using female IL-17A humanized mouse homozygotes. After the onset of disease, the mice were divided into groups and injected intraperitoneally with the anti-human IL-17A antibody Ixekizumab according to different dosing schedules; and the control group was injected with PBS. The experimental procedure is shown in FIG. 20, and the dosage regimen is shown in Table 2. Specifically, from the day of MOG immunization (day 0), the weights of the mice were recorded every day and the mice were clinically scored to observe the neurological performance. The mice were grouped on day 15. As shown in FIG. 21 and FIG. 22, compared with the control group, the weight loss of the mice in the treatment group was significantly alleviated, and the clinical scores were significantly reduced. In addition, the administration mode of the G2 group provides a better effect than that of the G3 and G4 groups. The above results indicate that the EAE model established using the IL-17A humanized mice of the disclosure can be used to evaluate the in vivo effectiveness of drugs targeting human IL-17A.

(107) TABLE-US-00010 TABLE 2 Number Single of dose Dosing Group animals Administration (mg/kg) Frequency times G1 6 PBS / QW 6 G2 6 Anti-human 15 QW 6 IL17A antibody G3 6 Anti-human 15 BIW 6 IL17A antibody G4 6 Anti-human 30 QW 6 IL17A antibody BIW: once every two weeks, QW: once a week

Example 7

Establishment of Psoriasis Model Using IL-17A Humanized Mice And Evaluation of In Vivo Effectiveness Using The Model

(108) Toll-like receptors play an important role in the occurrence and development of psoriasis. Imiquimod is a Toll-like receptor agonist and can be used to model psoriasis. In this example, the humanized mouse homozygous for IL-17A as described in Example 1 was used to establish a psoriasis model by the method of imiquimod induction. The female IL-17A humanized mice were randomly divided into a control group (G1; no induction), a model group (G2) and a treatment group (G3), with 5 mice in each group. At the beginning of the experiment (−D3), the back hairs of the mice were removed with a shaver, exposing a 2 cm×3 cm skin area. After 3 days (D0), mice in the model group and the treatment group were administered with 5% Imiquimod (IMQ) cream (local dose 83 mg) to the back skin area every day for 12 consecutive days; and mice in the control group were administered with Vaseline. Mice in the treatment group were intraperitoneally injected with anti-human IL-17A antibody (Ixekizumab, 100 mg/kg single dose) at −D3, D0, D4, D7 and D11 for 5 times in total. The entire experiment period is 17 days, and the specific experiment scheme is shown in FIG. 23.

(109) Starting from D0, the mice were weighed daily and photographed to observe the back skin conditions, and the clinical score of the condition of the mice was obtained. The scoring items include erythema and scales in mouse skin lesions. Each item is divided into 0-4 points according to the severity, based on the following PASI scoring standards: 0-none; 1-mild; 2-moderate; 3-severe; 4-extremely severe. For each group of mice, the score of each item or the average of the total scores of two items are compared. At the end of the experiment (D14), the skin specimens of the back and right ear of the mice were sliced and stained with hematoxylin and eosin (HE). The erosion, appearance of spinous processes, hypokeratosis, and mixed inflammatory cell infiltration on the back of each group of mice were scored according to the severity (0.5-2 points): 0.5-slight, 1-mild, 1.5-moderate, 2-severe. Stromal cell proliferation was scored (0.5-2 points): 0.5: 2-4 layers, 1: 4-6 layers, 1.5: 6-8 layers, and 2: 8-10 layers; the appearance of scabs: 0.5. Results statistics and pathological analysis scores between groups were performed, and the epidermal thickness was measured.

(110) From the change of mouse body weight over time (FIG. 24), it can be seen that the weight of the control group was stable throughout the experimental period; and the weight trend of the model group and the treatment group was the same, that is, decreased firstly from D0, to the minimum around D2, and then slowly increased. During the experiment, there was little difference in body weight between the two groups. At the end of the experiment, the body weights of mice in all groups were close and had no significant difference. The results of back skin erythema, scaly and comprehensive PASI scores in FIGS. 25-27 show that none of the mice in the control group developed the disease, while the model group and the treatment group showed different degrees of disease. Comparing the model group and the treatment group, the skin PASI score of the mice in the treatment group is significantly lower than that of the model group, indicating that administration of anti-human IL-17A antibody to model mice has a therapeutic effect on psoriasis. The HE staining results of the back tissue sections of the mice (FIG. 28), the statistical results of the epidermal thickness of the back tissues (FIG. 29) and the pathological score statistical results of the back tissue sections (FIG. 30) showed that, the pathological changes of the back skin of the treatment group in terms of stromal cell proliferation and thickening of the epidermis were lower than those in the model group. In addition, some mice in the model group showed scabs on the back and ear skins, but no such lesions were seen in the treatment group, suggesting that the skin of the animals in the model group had ulceration or erosion, and the severity of the lesions was worse than that in the treatment group.

(111) The above results demonstrate that the humanized mice of the disclosure can be used to establish a psoriasis model for evaluating the in vivo effectiveness of drugs targeting human IL-17A.

Example 8

Establishment of Psoriasis Model Using Humanized IL-17A Mice for Testing In Vivo Dose

(112) The humanized mouse homozygous for IL-17A as described in Example 1 was used to establish a psoriasis model by the method of imiquimod induction. Female mice were randomly divided into blank control G1 group (Vaseline; no induction of disease) and different treatment model groups (the following doses are single doses): control G2 group (0.9% NaCl), isotype control G3 group (10 mg/kg IgG.sub.4), G4 group (1 mg/kg ixekizumab), G5 group (3 mg/kg ixekizumab), G6 group (10 mg/kg ixekizumab), with 5 animals in each group. At the beginning of the experiment (−D3), the back hairs were removed with a shaver, exposing a 2 cm×3 cm skin area. Three days later (D0), mice in the treatment group were administered with 5% imiquimod (IMQ) cream (local dose 80 mg) to the back skin area every day for 12 consecutive days; and mice in the G1 group were administered with Vaseline as a blank control. The treatment group was intraperitoneally injected with anti-human IL17A antibody (ixekizumab), 0.9% NaCl or IgG.sub.4 every week from the beginning of the experiment (−D3) for a total of 5 administrations. The entire experimental period is 14 days, and the specific experimental scheme is shown in FIG. 31.

(113) From the change of mouse body weight over time (FIG. 32), it can be seen that the weight of the control group was stable throughout the experimental period; the weight trend of the model group and the treatment group was the same, that is, decreased firstly from D0, to the minimum around D2, and then slowly increased. During the experiment, there was little difference in body weight between the two groups, and the weight of mice in all groups was similar and had no significant difference. The results of the erythema, scaly and comprehensive PASI score of the back skin in FIGS. 33-35 showed that none of the mice in the blank control group developed the disease, while the model groups treated with different treatments showed different degrees of skin diseases. The skin PASI score of mice (G4-G6) treated with the anti-human IL-17A antibody ixekizumab was lower than that of NaCl and IgG.sub.4 treated mice, indicating that anti-human IL-17A antibody treatment in model mice alleviated the clinical signs of skin inflammation caused by imiquimod, and the treatment with 10 mg/kg ixekizumab had the best effect.

(114) The statistical results of the epidermal thickness of the back tissues of the mice in each group (FIG. 36) show that the pathological changes of the back skin of the anti-human IL-17A antibody administration group in terms of stromal cell proliferation and epidermal thickening were lower than those of the NaCl and IgG.sub.4 injection groups, indicating that the anti-human IL-17A antibody reduces the epidermal thickening of disease model mice. The pathological score statistical results of the back tissue sections of the mice are shown in FIG. 37. The pathological changes of the back skin of the treatment group in terms of stromal cell proliferation and epidermal thickening are lower than those of the model group. In addition, some mice in the model group showed scabs on the back and ear skins, but no such lesions were seen in the treatment group, suggesting that the skin of the animals in the model group had ulceration or erosion, and the severity of the lesions was higher than that in the treatment group. It shows that administration of mouse anti-human IL-17A antibody alleviated the signs of inflammation caused by imiquimod. Among them, treatment with a dose of 10 mg/kg ixekizumab had the best effect. The above results indicate that the humanized mice of the disclosure can be used to establish a psoriasis model to evaluate the in vivo dose of drugs targeting human IL-17A.

(115) The preferred embodiments of the invention are described in detail above. However, the invention is not limited to the specific details in the above embodiments. Those skilled in the art will understand that within the scope of the technical concept of the invention, various modifications can be made to the technical solution of the invention, and these modifications all belong to the protection scope of the invention.

(116) In addition, it should be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, various possible combinations are not described separately in the invention.

(117) In addition, various different embodiments of the invention can also be combined arbitrarily, as long as they do not violate the spirit of the invention, and they should also be regarded as the disclosed content of the invention.