ENTEROBACTER CHENGDUENSIS FOR PRODUCING NICOTINAMIDE MONONUCLEOTIDE AND APPLICATION THEREOF
20220282293 · 2022-09-08
Inventors
- Liqing Zhao (Shenzhen, CN)
- Jiansheng Chen (Shenzhen, CN)
- Zhigang Duan (Shenzhen, CN)
- Haichao Zhang (Shenzhen, CN)
Cpc classification
C12R2001/01
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure provides an Enterobacter chengduensis for producing NMN and application thereof, and relates to the technical field of screening and application of strains. The Enterobacter chengduensis of the present disclosure is determined as a Gram-negative bacterium and belongs to the genus Enterobacter chengduensis. When the Enterobacter chengduensis is used for producing the NMN by fermentation with the nicotinamide as a substrate, the yield of the NMN can reach 67.66 μM, namely 22.6 mg/L, at 15 minutes, indicating that the wild strain has a strong activity to synthesize the NMN, the dependence on Nampt during synthesis of the NMN is reduced, and a high large-scale application prospect is achieved.
Claims
1. An Enterobacter chengduensis 2021T4.7 for producing a nicotinamide mononucleotide (NMN), wherein the Enterobacter chengduensis 2021T4.7 was deposited at China General Microbiological Culture Collection Center (CGMCC) with deposit number of CGMCC No. 21695.
2. The Enterobacter chengduensis 2021T4.7 according to claim 1, wherein a 16S rDNA sequence of the Enterobacter chengduensis 2021T4.7 is shown in SEQ ID NO: 1.
3. (canceled)
4. A method for producing NMN by using the Enterobacter chengduensis 2021T4.7 according to claim 1, comprising the following steps: (1) performing fermentation enrichment on the Enterobacter chengduensis 2021T4.7 in a fermentation culture medium with nicotinamide as an inducer, and after fermentation, performing centrifugation and resuspension in a PBS buffer to obtain a bacterial liquid, wherein the fermentation culture medium comprises the following components by mass percent: 0.25% to 1.5% glucose, 0.25% to 1.5% tryptone, 0 to 1.5% KH.sub.2PO.sub.4 and 0 to 0.15% MgSO.sub.4.Math.7H.sub.2O, and a pH value is 5 to 10; and (2) performing a fermentation reaction by using the bacterial liquid obtained in step (1) with the nicotinamide as a substrate to obtain the NMN.
5. The method according to claim 4, wherein in step (1), the mass percentage of the inducer nicotinamide is 0 to 1.25%.
6. The method according to claim 5, wherein in step (1), the pH value of the fermentation culture medium is 7.0.
7. The method according to claim 4, wherein in step (1), a fermentation enrichment temperature is 25° C. to 40° C., and time is 12-24 hours.
8. The method according to claim 4, wherein a mother liquid is further involved in the fermentation reaction in step (2), a volume ratio of the mother liquid to the bacterial liquid is 1:1, and the mother liquid comprises the following components: a 50 mM Tris-Hcl buffer, BSA with a mass concentration of 0.02%, 12 mM MgCl.sub.2, 2 mM ATP, 2 mM DTT and 40 μM PRPP.
9. The method according to claim 4, wherein in step (2), a concentration of the substrate nicotinamide is 100-1,000 μM.
10. The method according to claim 4, wherein in step (2), a fermentation reaction temperature is 37° C., and time is 15 minutes.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
DETAILED DESCRIPTION
[0035] The present disclosure provides an Enterobacter chengduensis 2021T4.7 for producing NMN, and the Enterobacter chengduensis 2021T4.7 has a biological deposit number of CGMCC No. 21695.
[0036] The Enterobacter chengduensis 2021T4.7 of the present disclosure is a Gram-negative bacterium, a 16S rDNA sequence is preferably shown in SEQ ID NO: 1: TTACTGGGCGTAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCG GGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGG GGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGT GGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGG AGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCGACTTGG AGGTTGTGCCCTTGAGGCGTGGCTTCCGGAGCTAACGCGTTAAGTCGACCGCCTG GGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAG CGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACTCTTGA CATCCAGAGAACTTTCCAGAGATGGATTGGTGCCTTCGGGAACTCTGAGACAGGT GCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAGTCCCGCAACG AGCGCAACCCTTATCCTTTGTTGCCAGCGGTTAGGCCGGGAACTCAAAGGAGACT GCCAGTGATAAACTGGAGGAAGGTGGGGATGACGTCAAGTCATCATGGCCCTTA CGAGTAGGGCTACACACGTGCTACAATGGCGCATACAAAGAGAAGCGACCTCGC GAGAGCAAGCGGACCTCATAAAGTGCGTCGTAGTCCGGATTGGAGTCTGCAACT CGACTCCATGAAGTCGGAATCGCTAGTAATCGTAGATCAGAATGCTACGGTGAA TACGTTCCCGGGCCTTGTACACACCGCCCGTCACACCATGGGAGTGGGTTGCAAA AGAAGTAGGTAGCTTAACCTTCGGGAGGGCGCTTACCACTTTGTGATTCATGACT GGGGTGAA, the similarity between the sequence and available sequences of known species in an NCBI database is 99%, and it is determined that the strain belongs to the genus Enterobacter.
[0037] The Enterobacter chengduensis 2021T4.7 of the present disclosure is screened and separated from soil near a sewer of a factory of Bontac Bioengineering (Shenzhen) Co., Ltd., and after preliminary screening and secondary screening, a strain with a strong ability to convert Nam into the NMN is selected.
[0038] The present disclosure also provides application of the Enterobacter chengduensis 2021T4.7 in production of NMN. The Enterobacter chengduensis 2021T4.7 of the present disclosure has the ability to decompose the Nam and produce the NMN and can be used for industrial production of the NMN.
[0039] The present disclosure also provides a method for producing NMN by using the Enterobacter chengduensis 2021T4.7, and the method includes the following steps:
[0040] (1) performing fermentation enrichment on the Enterobacter chengduensis 2021T4.7 in a fermentation culture medium with the Nam as an inducer, and after fermentation, performing centrifugation and resuspension in a PBS buffer to obtain a bacterial liquid, where the fermentation culture medium includes the following components by mass percent: 0.25% to 1.5% glucose, 0.25% to 1.5% tryptone, 0 to 1.5% KH.sub.2PO.sub.4 and 0 to 0.15% MgSO.sub.4.Math.7H.sub.2O, and a pH value is 5 to 10; and
[0041] (2) performing a fermentation reaction by using the bacterial liquid obtained in step (1) with the Nam as a substrate to obtain the NMN.
[0042] In the present disclosure, the fermentation enrichment is performed on the Enterobacter chengduensis 2021T4.7 in a fermentation culture medium with the Nam as an inducer, and after fermentation, the centrifugation and the resuspension in a PBS buffer are performed. The fermentation culture medium includes the following components by mass percent: 0.25% to 1.5% glucose, 0.25% to 1.5% tryptone, 0 to 1.5% KH.sub.2PO.sub.4 and 0 to 0.15% MgSO.sub.4.Math.7H.sub.2O. A pH value is 5 to 10. The fermentation culture medium in the present disclosure is obtained by using the glucose as a carbon source, the tryptone as a nitrogen source and the Nam as an inducer. The mass percentage of the glucose in the fermentation culture medium is preferably 1%, the mass percentage of the tryptone is preferably 1.25%, the mass percentage of the KH.sub.2PO.sub.4 is preferably 0.75%, the mass percentage of the MgSO.sub.4.Math.7H.sub.2O is preferably 0.025%, and the mass of the inducer Nam is preferably 0 to 1.25% of the mass of the fermentation culture medium, more preferably 1%. The pH value of the fermentation culture medium in the present disclosure is preferably 7. A preparation method of the fermentation culture medium in the present disclosure is not particularly limited and preferably includes uniformly mixing the components above. Sources of the components of the fermentation culture medium in the present disclosure are not particularly limited. The Nam included in the fermentation culture medium in the present disclosure achieves an inducing effect and can be used for amplifying the Enterobacter.
[0043] In the present disclosure, when the fermentation enrichment is performed, the inoculation volume of the Enterobacter is preferably 0.1% to 2% of the volume of the fermentation culture medium, more preferably 1.5%. In the present disclosure, the fermentation enrichment temperature is preferably 25° C. to 40° C., more preferably 37° C. The fermentation enrichment time is preferably 12-24 hours, more preferably 20 hours. In the present disclosure, shaking is preferably performed in the fermentation enrichment process, and the shaking frequency is preferably 200 rpm.
[0044] In the present disclosure, after the fermentation, the centrifugation and the resuspension in a PBS buffer are performed. The centrifugation is preferably performed at a rotation speed of 4,000 rpm at 4° C. for 20 minutes. In the present disclosure, a method for performing resuspension in a PBS buffer is not particularly limited. The resuspension can be performed by using a conventional method in the art. The OD.sub.600 of the bacterial liquid after the resuspension is preferably adjusted to 1.5.
[0045] After the bacterial liquid is obtained, the Nam is used as a substrate in the present disclosure, and the bacterial liquid is used to perform a fermentation reaction to obtain the NMN. The fermentation reaction in the present disclosure is preferably performed in a system obtained by mixing the bacterial liquid and a mother liquid at a volume ratio of 1:1. The mother liquid preferably includes the following components: a 50 mM Tris-Hcl buffer, BSA with a mass concentration of 0.02%, 12 mM MgCl.sub.2, 2 mM ATP, 2 mM DTT and 40 μM PRPP. When the fermentation reaction in the present disclosure is performed, the concentration of the substrate Nam is preferably 100-1,000 μM, more preferably 400 μM. The reaction is preferably performed at 37° C. for 15 minutes.
[0046] The present disclosure also provides a primer pair for identifying the Enterobacter chengduensis 2021T4.7. The primer pair includes a forward primer 516f and a reverse primer 1540r. A nucleotide sequence of the forward primer 516f is shown in SEQ ID NO: 2: TGCCAGCAGCCGCGGTA, and a nucleotide sequence of the reverse primer 1540r is shown in SEQ ID NO: 3: AGGAGGTGATCCAGCCGCA.
[0047] The Enterobacter chengduensis for producing NMN and application thereof provided in the present disclosure are described in detail below with reference to examples, but it should not be understood that the protection scope of the present disclosure is limited thereto.
[0048] Unless otherwise specified, components and sources of culture media in the examples of the present disclosure are all common commercial products.
EXAMPLE 1 SCREENING AND IDENTIFICATION OF STRAINS
1. Soil Collection and Pretreatment
[0049] Soil near a sewer of a factory of Bontac Bioengineering (Shenzhen) Co., Ltd. was collected with a sampling depth of 5-10 cm. 1 g of a soil sample was weighed and added into a 50 ml conical flask, 20 ml of physiological saline was added, the conical flask was placed in a shaker and thoroughly shaken uniformly, and then the conical flask was taken out for standing and later use.
2. Enrichment Culture
[0050] 1 ml of a supernatant of a soil suspension obtained after pretreatment was sucked, inoculated into an enrichment culture medium (10 ml/50 ml conical flask) and then cultured in a constant-temperature incubator at 37° C. and 150 r/min for 12 hours. The enrichment culture medium included 2 g/L Nam, 5 g/L glucose, a 5 g/L yeast extract, 5 g/L peptone, 14 g/L K.sub.2HPO.sub.4.Math.3H.sub.2O, 5.2 g/L KH.sub.2PO.sub.4 and 2 g/L MgSO.sub.4.Math.7H.sub.2O, and the pH of the enrichment culture medium was 7.0.
3. Screening
[0051] Preliminary screening: An enrichment liquid was subjected to gradient dilution with the physiological saline at different levels, and bacterial liquids diluted to gradients of 10.sup.−4, 10.sup.−5 and 10.sup.−6 are used for preliminary screening of strains. 100 μl of each diluted liquid was taken, spread on a preliminary screening plate separation culture medium and then cultured overnight, and single colonies on the plate were selected on the next day (bacteria with different shapes, colors and sizes were selected) and transferred into a 96 deep-well cell plate (same as the preliminary screening plate separation culture medium) for shaking culture at a rotation speed of 600 r/min for 12 hours. The content of NMN in each sample was detected by using a microplate reader detection method. Strains with a high NMN content were selected based on fluorescence intensity and then preserved in a glycerol tube. The preliminary screening plate separation culture medium included 2 g/L Nam, a 5 g/L yeast extract, 5 g/L peptone, 14 g/L K.sub.2HPO.sub.4.3H.sub.2O, 5.2 g/L KH.sub.2PO.sub.4 and 14 g/L MgSO.sub.4.Math.7H.sub.2O, and the pH of the preliminary screening plate separation culture medium was 7.0.
[0052] Secondary screening: The strains obtained after preliminary screening were inoculated into a nutrient agar culture medium (10 ml/50 ml conical flask) at 1% for fermentation subculture, the OD.sub.600 value of a fermentation liquid was determined, an enzymatic conversion reaction experiment was performed, the fluorescence intensity of a system after NMN derivatization was determined, and strains with a high NMN yield were obtained after secondary screening based on indexes of a product concentration and a conversion rate. The nutrient agar culture medium included 12.5 g/L agar powder, 10 g/L tryptone, a 5 g/L yeast extract and 5 g/L NaCl, and the pH of the nutrient agar culture medium was 7.0.
4. Enzymatic Conversion Reaction Experiment
[0053] 1 ml of the bacterial liquids obtained after the enrichment culture were taken, first centrifuged to remove culture solutions in supernatants and then resuspended in a PBS buffer (the Nam in a fermentation culture medium was removed), the OD.sub.600 value was determined, and the concentration of the bacterial liquids was appropriate when the OD.sub.600 was adjusted to 1.5. The Nam was taken as a substrate, a 50 mM Tris-Hcl buffer, BSA with a mass concentration of 0.02%, 12 mM MgCl.sub.2, 2 mM ATP, 2 mM DTT, 40 μM PRPP and 80 μM Nam were taken in a total of 12.5 μl, and 12.5 μl of the bacterial liquids were taken, sequentially added into a black 96-well Elisa plate (special for fluorescence measurement) and shaken and mixed uniformly for a reaction at 37° C. for 15 minutes.
5. Determination of the Yield of the NMN
[0054] Since the NMN has fluorescence signals at an excitation wavelength of 382 nm and an emission wavelength of 445 nm, the ability of different strains to produce the NMN can be compared.
[0055] After an enzymatic conversion reaction was completed, 10 μl of 20% acetophenone and 10 μl of 2 M KOH were added into a reaction well of the 96-well Elisa plate and shaken and mixed uniformly to produce a white precipitate, and the white precipitate was placed into a metal bath at 0° C. for a reaction for 10 minutes. The Elisa plate was taken out from the metal bath, and 45 μl of 88% formic acid was added into the metal bath for a reaction at 70° C. for 5 minutes. After cooling, the fluorescence intensity was measured at the excitation wavelength of 382 nm and the emission wavelength of 445 nm by using a microplate reader, and the gain value was set to 70.
[0056] In this example, under the same reaction system of the “enzymatic conversion reaction experiment”, the NMN was added to achieve different concentrations (0, 5 μM, 10 μM, 15 μM, 20 μM, 25 μM, 30 μM, 35 μM, 40 μM, 45 μM, 50 μM, 55 μM, 60 μM, 70 μM, and 80 μM), the fluorescence intensity was measured at the excitation wavelength of 382 nm and the emission wavelength of 445 nm by using the microplate reader, the gain value was set to 70, and a standard curve of the NMN concentration and the fluorescence intensity was obtained and shown in
6. Strain Identification
[0057] Morphological observation: The strains preserved in the glycerol tube were taken for activation culture in an LB liquid culture medium (37° C., 180 rpm, shaking culture for 12 hours), a bacterial liquid was taken and spread on an LB plate separation culture medium to culture and isolate a single colony, the state of the single colony on a solid plate was observed, and results were shown in
[0058] A bacterial genomic DNA rapid extraction kit purchased from Sangon Biotech (Shanghai) Co., Ltd. was used to extract DNA from a chromosome, and PCR was used for amplification, followed by agarose gel electrophoresis analysis. An amplified DNA sequence was about 1,000 bp in length, a PCR amplified product was sent to Guangzhou Ige Biotechnology Co., Ltd. for 16S rDNA sequencing, sequencing results were shown in SEQ ID NO: 1, and it was identified that the strain belonged to the genus Enterobacter chengduensis and was named Enterobacter chengduensis 2021T4.7.
TABLE-US-00001 Forward and reverse primers of PCR were: 516f: TGCCAGCAGCCGCGGTA, and 1540r: AGGAGGTGATCCAGCCGCA.
EXAMPLE 2 INFLUENCE OF OPTIMIZATION OF FERMENTATION ENRICHMENT CONDITIONS OF ENTEROBACTER CHENGDUENSIS 2021T4.7 ON THE YIELD OF NMN
[0059] When the Enterobacter chengduensis 2021T4.7 was subjected to fermentation enrichment in a fermentation culture medium, concentrations of various components of the fermentation culture medium (including the concentration of glucose, the concentration of tryptone, the concentration of KH.sub.2PO.sub.4 and the concentration of MgSO.sub.4.Math.7H.sub.2O), the initial pH value of the fermentation culture medium, the concentration of an inducer Nam and the fermentation enrichment temperature and time were sequentially changed, other conditions were not changed, and shaking culture was performed in a constant-temperature shaker at 200 rpm. Then fermentation was performed under the conditions of the “enzymatic conversion reaction experiment” in Example 1, and after the fermentation was completed, the OD.sub.600 and the enzymatic activity were determined.
[0060] 1. When different concentrations of the glucose (0.25%, 0.5%, 0.75%, 1%, 1.25% and 1.5% by mass fraction) were added into the fermentation culture medium and other components were not changed, results were shown in
[0061] 2. When different concentrations of the tryptone (0.25%, 0.5%, 0.75%, 1%, 1.25% and 1.5% by mass fraction) and 1% glucose were added into the fermentation culture medium and other components were not changed, results were shown in
[0062] 3. When different concentrations of the KH.sub.2PO.sub.4 (0, 0.25%, 0.5%, 0.75%, 1%, 1.25% and 1.5% by mass fraction), 1% glucose and 1.25% tryptone were added into the fermentation culture medium and other components were not changed, results were shown in
[0063] 4. When different concentrations of the MgSO.sub.4.Math.7H.sub.2O (0, 0.025%, 0.05%, 0.075%, 0.1%, 0.125% and 0.15% by mass fraction), 1% glucose, 1.25% tryptone and 0.75% KH.sub.2PO.sub.4 were added into the fermentation culture medium and other conditions were not changed, results were shown in
[0064] 5. When different concentrations of the inducer Nam (0%, 0.25%, 0.5%, 0.75%, 1.0% and 1.25% by mass fraction), 1% glucose, 1.25% tryptone, 0 .75% KH.sub.2PO.sub.4 and 0.025% MgSO.sub.4.Math.7H.sub.2O were added into the fermentation culture medium and other conditions were not changed, results were shown in
[0065] 6. When a fermentation culture medium containing 1% of the glucose, 1.25% of the tryptone, 0.75% of the KH.sub.2PO.sub.4, 0.025% of the MgSO.sub.4.Math.7H.sub.2O and 1% of the inducer Nam was used, the initial pH value (5.0, 6.0, 7.0, 8.0, 9.0 and 10.0) of the fermentation culture medium and the fermentation enrichment temperature (25° C., 28° C., 30° C., 34° C., 37° C. and 40° C.) and time (12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 22 hours and 24 hours) were sequentially changed and other conditions were not changed, results were shown in
EXAMPLE 3 INFLUENCE OF THE CONCENTRATION OF A SUBSTRATE NAM ON THE YIELD OF NMN
[0066] Under optimal fermentation enrichment conditions of the Enterobacter chengduensis 2021T4.7 in Example 2 (that is to say, the fermentation culture medium included 1% glucose, 1.25% tryptone, 0.75% KH.sub.2PO.sub.4, 0.025% MgSO.sub.4.Math.7H.sub.2O and 1% inducer Nam, the pH value was 7.0, the fermentation temperature was 37° C., and the fermentation time was 20 hours), fermentation was performed by only changing the concentration of the substrate Nam in the enzymatic conversion reaction experiment in Example 1 (100 μM, 200 μM, 300 μM, 400 μM, 500 μM, 600 μM, 700 μM, 800 μM, 900 μM and 1,000 μM), other conditions were not changed, and after the fermentation was completed, the OD.sub.600 and the enzymatic activity were determined.
[0067] Results were shown in
[0068] The foregoing descriptions are exemplary implementations of the present disclosure. It is to be noted that a person of ordinary skill in the art may make some improvements and modifications without departing from the principle of the present disclosure and such improvements and modifications shall fall within the protection scope of the present disclosure.