METHOD FOR DIAGNOSING AND TREATING ATHEROSCLEROSIS BY USING NANOVESICLE TARGETING SITE OF CHANGE IN BLOOD FLOW

20220290098 · 2022-09-15

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a method for diagnosing and treating atherosclerosis by using nanovesicle targeting a site of change in blood flow, and more specifically, the present invention provides a stem cell-derived nanovesicle, which is an anti-atherosclerosis diagnosis and treatment platform using a peptide capable of targeting a disturbed blood flow, wherein the nanovesicle provides strong anti-inflammatory and pre-endothelial recovery effects similar to that of a mesenchymal stem cell, and thus it can be used as a new diagnosis and treatment agent capable of preventing the onset of atherosclerosis.

Claims

1. Stem cell-derived nanovesicles displaying a disturbed blood flow site-targeting peptide on the surface thereof.

2. The nanovesicles of claim 1, wherein the disturbed blood flow site-targeting peptide is selected from the group consisting of SEQ ID NOs: 1 to 5.

3. The nanovesicles of claim 1, wherein the nanovesicles are derived from stem cells transfected with a vector into which coding sequences of signal peptide, disturbed blood flow site-targeting peptide, and transmembrane protein are sequentially inserted.

4. The nanovesicles of claim 3, wherein the transmembrane protein is one or more selected from the group consisting of CD86, CD105, CD271, CD34, and CD22.

5. The nanovesicles of claim 1, wherein the stem cells are any one of stem cells derived from one or more of tissue selected from the group consisting of bone marrow, the umbilical cord, umbilical cord blood, the placenta, blood, skin, adipose tissue, nervous tissue, the liver, the pancreatic duct, muscle, and the amniotic membrane; mesenchymal stem cells; embryonic stem cells; and induced pluripotent stem cells.

6. A method of preparing the nanovesicles of claim 1, comprising the step of obtaining nanovesicles displaying a disturbed blood flow site-targeting peptide on the surface thereof from stem cells transfected with a vector into which coding sequences of signal peptide, disturbed blood flow site-targeting peptide, and transmembrane protein are sequentially inserted.

7. A composition for diagnosing atherosclerosis, comprising the nanovesicles of claim 1.

8. A composition for preventing or treating atherosclerosis, comprising the nanovesicles of claim 1.

9. A method of diagnosing atherosclerosis, comprising the step of administering the nanovesicles of claim 1 into a subject.

10. A method of preventing or treating atherosclerosis, comprising the step of administering the nanovesicles of claim 1 into a subject.

11. A use of the nanovesicles of claim 1 for preventing or treating atherosclerosis.

Description

DESCRIPTION OF DRAWINGS

[0014] FIG. 1A is the operation mechanism of PREY/MSC-derived nanovesicles (PMSC-NVs) and a schematic diagram illustrating PREY peptide display, and specifically, a disturbed blood flow site-targeting peptide (PREY) is selected from phage display screening and displayed on the outside of an MSC membrane (PMSC) through transfection and expression of a specifically designed plasmid.

[0015] FIG. 1B shows that PMSC-derived NVs (PMSC-NVs) are produced by continuous extrusion process using a series of membranes controlled to a micropore size, and they include transmembrane and intracellular components, which are the same as those of PMSC's.

[0016] FIG. 1C shows that a partial carotid ligation (PCL) model is used in an in vivo test, in which PMSC-NVs are administered intravenously and circulate throughout the body to target a disturbed blood flow, thereby testing the theragnostic performance thereof.

[0017] FIG. 2A shows a schematic diagram of the design of a plasmid for expressing PREY on the outer layer of the MSC membrane. Green fluorescence protein (GFP: internal membrane signal)-transmembrane protein-v5 tag (outer membrane signal)-PREY was designed to validate the expression and location of PREY.

[0018] FIG. 2B is the results of quantitatively comparing transfection efficiency through FACS (x-axis: GFP+ cells/y-axis: V5 tag+ cells) in two types of hMSC types (ASCs and BMSCs) paired with three types of transmembrane proteins (CD86, CD105 and CD271). Here, the CD271-ASC pair was previously selected due to having the highest transfection efficiency.

[0019] FIG. 2C is the results of evaluating PREY-CD271 plasmid dose-dependent apoptosis (0×: electroporation without plasmid and 1×, 2×: 100, 200 ng plasmid/10.sup.5 cells) using Alexa Fluor 488-conjugated Annexin V, measured 30 minutes after transfection.

[0020] FIG. 2D shows the locations of GFP (green internal membrane signal) and PREY-v5 tag (red external membrane signal), visualized in PMSCs after transfection of PREY-CD271-v5 tag plasmids into ASCs, and the red and green signals are mainly observed outside and inside the cell membrane, respectively.

[0021] FIG. 2E is the results of measuring the size and the morphology distribution of PMSC-NVs using transmission electron microscopy (TEM), and a yellow dotted line represents the PMSC-NV membrane.

[0022] FIG. 2F is the results of analyzing the expression of transfected genes and the cell membrane protein CD9 through western blotting.

[0023] FIG. 2G is the results of analyzing the preservation of internal miRNA components using a miRNA array.

[0024] FIG. 3 is a schematic diagram of a vector design for expressing a PREY fusion protein, and a sequence gene of the PREY fusion protein is inserted into a common CMV promoter backbone along with an ampicillin resistance gene for cloning.

[0025] FIG. 4A shows fluorescent images (blue: DAPI-stained nucleus) representing the transfection efficiency of 1X plasmids in BMSCs and ASCs, respectively, 24 hours after transfection of PREY-CD271 plasmids to determine the transfection efficiency according to hMSC type.

[0026] FIG. 4B is the results of measuring the number of viable cells depending on the transfection dose (0×, 0.5×, 1× or 2×) of PREY-CD271 plasmids in BMSCs and ASCs, in which due to the higher number of viable cells in ASCs, they were selected as a hMSC type (*p<0.05 BMSC/ASC, #p<0.05/0×BMSC, $p<0.05/0×ASC).

[0027] FIG. 4C is the results of analyzing transfection efficiency depending on the PREY-CD271 plasmid dose (0.5×, 1× or 2×) in ASC through FACS.

[0028] FIG. 5 is the confocal imaging results to show the expression of PREY-CD271, in which PREY-CD271 expression can be confirmed by the expression of GFP and PREY-V5 tag on the cell membrane of adjacent ASCs (blue: DAPI-stained nucleus).

[0029] FIG. 6 is the western blotting results to analyze the expression of transfected genes and the level of the cell membrane protein CD9 in samples before and after extrusion of NVs from ASCs (PMSC-NVs) after transfection (MSC-NV: NV extrusion from ASCs which are not transfected, *p<0.05).

[0030] FIG. 7A illustrates the anti-inflammatory effects caused by the monocytes activated by BMSC (BMSC-NV)- or ASC (ASC-NV)-derived MSC-NV (without PREY transfection) treatments, in which the monocytes absorb MSC-MVs, thereby exhibiting anti-inflammatory and phagocytosis-inhibitory effects.

[0031] FIG. 7B is the imaging results (blue: DAPI-stained nucleus) visualizing RAW264.7 cells and MSC-NVs using DiO (green) and DiI (red), respectively. indicating that two MSC-NV types are efficiently internalized into macrophages.

[0032] FIG. 7C is the qRT-PCR results of measuring the mRNA expression levels of anti-inflammatory markers (IL-10 and IL-13) and pro-inflammatory markers (IL-10 and TNF-α) when murine Raw 264.7 cells are treated with LPS.

[0033] FIG. 7D is the dot blot assay results of using a conditioned medium, showing that the amount of black dots in the lower right of each type of anti-inflammatory cytokine is decreased in the group treated with nanovesicles. The upper left black dots (displayed with a solid circle) show that the amount of anti-inflammatory cytokines in a test medium is similar in all groups.

[0034] FIG. 7E is the results of analyzing phagocytotic activity by measuring the amount of internalized E. coli particles (green), showing that there was no significant difference between all MSC-NV types, and the Oil Red O staining result (lower panel) showing a decrease in ox-LDL uptake in all NV-treated groups except a BMSC-NV group, and the lower graphs show quantitative results.

[0035] FIG. 8A is a diagram showing vascular protective effects of ECs due to the treatments with BMSC (BMSC-NV)- or ASC (ASC-NV)-derived MSC-NVs (without PREY transfection), indicating that, as MSC-NVs provide EC protection and inhibit monocyte recruitment, EC dysfunction is repaired by MSC-NV uptake.

[0036] FIG. 8B is the imaging results visualizing immortalized mouse ECs (iMAECs) and MSC-NVs using DiO (green) and DiI (red), respectively, showing that both MSC-NV types are effectively internalized into the iMAECs (blue: DAPI-stained nucleus).

[0037] FIG. 8C is the qRT-PCR results of measuring gene expression levels of EC dysfunction markers (E-selectin, ICAM-1 and VCAM-1), showing that the expression of each gene is reduced by all MSC-NV treatments.

[0038] FIG. 8D is the immunostaining image to analyze the protein expression of VCAM-1 (green) in iMAECs and its quantification result (blue: DAPI-stained nucleus).

[0039] FIG. 8E is the results to show the vascular protective effects of BMSC-NV or ASC-NV treatments on the disruption of EC angiogenesis induced by cyclosporin A (CyA), showing that there is no significant difference between the two MSC-NV types (*p<0.05/LPS/saline-treated group).

[0040] FIG. 9 is the result of analyzing a pro-angiogenic effects of MSC-NVs in response to the disturbance of EC angiogenesis by CyA treatments, and it shows images of HUVECs stained with Calcein AM and the quantitative analysis result of vasculature factors (saline-treated group/*p<0.05).

[0041] FIG. 10 is the results to show the pro-EC repair effects of PMSC-NVs in response to VCAM1 expression, angiorrhexis, and anti-angiogenesis.

[0042] FIG. 11 shows the images of a murine PCL model before and after ligation (left/right), in which three of four left common carotid artery (LCA) branches (external carotid artery (ECA), internal carotid artery (ICA), and occipital artery (OA)) are ligated using 10-0 nylon suture, and the superior thyroid artery (STA) is not ligated.

[0043] FIG. 12 shows the results of verifying disturbed blood flow formation after ligation in the LCA by Doppler ultrasound imaging in murine PCL models, in which RCA images (top) show normal pulsating laminar flows, whereas LCA images (bottom), compared with the RCA images, show abnormal blood flows moving forward and backward with a significant decrease in liquid flow.

[0044] FIG. 13A shows the theragnostic effects of PMSC-NVs on disturbed blood flow sites in a murine PCL model. Vivotrack680-labeled MSC-NVs and PMSC-NVs were intravenously administered into mice for systemic circulation three days after PCL surgery, and the in vivo distribution of MSC-NVs, PMSC-NVs, and PMSCs in the entire mouse body was analyzed using an in vivo imaging system 24 hours after surgery.

[0045] FIG. 13B shows the results of confirming MSC-NV, PMSC-NV, and PMSC distributions using an in vivo imaging system (IVIS) in RCAs (control) and LCAs (ligated) harvested after an experiment was performed in the same manner as described in FIG. 13A (*p<0.05 between groups).

[0046] FIG. 13C shows the expression levels of the filamin A protein and the co-existence of MSC-NVs and PMSC-NVs in harvested RCAs and LCAs by immunostaining and their quantitative result (*p<0.05 and *p<0.001 between groups).

[0047] FIG. 13D is the images of LCAs stained with H&E on day 14 after PCL (top row), which show the suppression of angiogenesis by PMSC-NV treatments through the quantitative analysis of neointimal structure parameters, and macrophage recruitment by ECs through immunostaining of CD68 (middle row) and VCAM-1 (bottom row) in collected LCAs (blue: DAPI-stained nucleus). Here, white lines indicate the inner boundary of the media layer facing the intima (*p<0.05/saline-treated group).

[0048] FIG. 14 shows the images to analyze the in vivo distributions of MSC-NVs, PMSC-NVs, and PMSCs in major organs after injection into PCL mice through imaging (left) of an IVIS system and their quantitative analysis results (HT: heart, LG: lung, LV: liver, SP: spleen and KN: kidney). Here, the lowest fluorescent intensity of PMSC-NVs in LG among the test groups indicates the synergistic role of PREY and NV that enables the cells to avoid lung capillary entrapment (right) (*p<0.001 between groups).

[0049] FIG. 15 is the images to show the accelerated atheroma formation in LCAs of ApoE KO and normal mice (balb/c) fed an atherosclerotic diet on day 14 after ligation and its quantitative analysis result. Even with an atherosclerotic diet, unligated mice exhibit no visible atheroma formation in the LCA (ND: non-detectable).

[0050] FIG. 16 shows the mouse organs (lung, liver, kidney, and spleen) stained with H&E on day 11 after a PCL mouse model is treated with MSC-NVs or PMSC-NVs.

[0051] FIG. 17A shows an image of a porcine PCL model formed by inducing the surgical ligation of the LCA using a stainless-steel rod (diameter=0.9 mm), followed by removal of the rod after ligation, and sonographic images showing a normal condition (top) and partial occlusion of the LCA (bottom) after ligation surgery (yellow arrow: upper and lower parts of ligation).

[0052] FIG. 17B is the Doppler ultrasound imaging result to show the formation of disturbed blood flow in the distal region of the ligation point of the LCA group in contrast to the unidirectional laminar flow in normal and RCA groups (yellow arrow: blood flow direction).

[0053] FIG. 17C is the images to show the filamin A expression of endothelial layers in the RCA and LCA.

[0054] FIGS. 17D to 17G are the IVIS and immunostaining results of analyzing blood vessels collected 24 hours after NVs are intravenously administered on day 3 after porcine PCL surgery, showing effective PMSC-NV targeting of disturbed blood flow sites in the porcine model in the collected LCA (FIGS. 17D and 17E) and aortic arch (FIGS. 17F and 17G) (region of natural disturbed blood flow formation) (***p<0.001 between groups).

[0055] FIG. 18 shows the IVIS images of the RCA and LCA (induced disturbed blood flow; left) and aortic arch (natural disturbed blood flow; right) 24 hours after PMSC-NV treatment in a porcine PCL model.

[0056] FIG. 19A illustrates a process in which human coronary artery endothelial cells (hCAEC) are cultured under unidirectional laminal flow or disturbed blood flow for one day, 12 hours after adherent culture, and treated with NVs for 1 hour in order to analyze the PMSC-NV targeting efficiency of arterial ECs under disturbed blood flow using a microfluidic model.

[0057] FIG. 19B shows normal (laminar) flow and disturbed blood flow pattern plots.

[0058] FIG. 19C the immunostaining results to show the alignment of hCAECs by filamin A expression (green) as well as F-actin expression (red).

[0059] FIG. 19D is the quantitative results to analyze the F-actin alignment in a flow direction based on the results of FIG. 19C.

[0060] FIG. 19E is the quantitative results to analyze the expression level of filamin A in the cytoplasm under disturbed blood flow based on the results of FIG. 19C (*p<0.05 between groups).

[0061] FIG. 19F is the quantitative results to analyze the in vitro targeting efficiency of MSC-NVs and PMSC-NVs for hCAECs at disturbed blood flow sites by measuring NV fluorescent intensity based on the results of FIG. 19C (***p<0.001 between groups).

[0062] FIG. 19G is the results of confirming PREY targeting of filamin A by quantitatively analyzing the co-existence of NVs and filamin A based on the results of FIG. 19C (***p<0.001 between groups).

[0063] FIG. 20 is the IVIS imaging results to show the efficiency of PMSC-NVs targeting human aortic ECs (hAECs) using an in vitro microfluidic model.

MODES OF THE INVENTION

[0064] Hereinafter, the configuration of the present invention will be described in detail.

[0065] The present invention relates to stem cell-derived nanovesicles displaying a disturbed blood flow site-targeting peptide on their surface.

[0066] In addition, the present invention provides a method of preparing the nanovesicles, which includes obtaining nanovesicles displaying a disturbed blood flow site-targeting peptide on their surface from stem cells transfected with a vector into which coding sequences of signal peptide-disturbed blood flow site-targeting peptide-transmembrane protein-green fluorescent protein (GFP) are sequentially inserted.

[0067] The “disturbed blood flow” used herein refers to abnormal and irregular blood flow due to the structural characteristics of a blood vessel, and it is an event of early atherosclerosis causing vascular endothelial cell dysfunction.

[0068] The “nanovesicles (NVs)” used herein are prepared through disruption of cells by artificially passing through a filter and formed by their self-assembly mechanism, and they are understood as being different from exosomes extracted from cells.

[0069] The present invention provides stem cell-derived nanovesicles functionalized with a peptide targeting a disturbed blood flow site (see FIGS. 1A to 1C).

[0070] The disturbed blood flow site-targeting peptide may be selected from the group consisting of SEQ ID NOs: 1 to 5. More specifically. SEQ ID NO: 1 is a PREY peptide having an amino acid sequence of GSPREYTSYMPH, SEQ ID NO: 2 is a myoferlin peptide having an amino acid sequence of SPREYTSYMPH, SEQ ID NO: 3 is an Eyes absent homolog 1 isoform 2 peptide having an amino acid sequence of SLSSYNGSALAS, SEQ ID NO: 4 is a partial peptide of a zinc finger protein having an amino acid sequence of ACNTGSPYEC, and SEQ ID NO: 5 is a Calsyntenin 1, isoform CRA_b peptide having an amino acid sequence of ACTPSFSKIC.

[0071] In the nanovesicles of the present invention, it is easy to confirm the expression of a disturbed blood flow site-targeting peptide, compared to the conventional disturbed blood flow site-targeting peptide-liposome, and a rate of the disturbed blood flow site-targeting peptide expression may be increased by GFP/v5tag FACS sorting in a cell stage prior to nanovesicle extraction. In addition, compared to liposomes, nanovesicles contain a stem cell-derived therapeutic substance for suppressing atherosclerosis. The nanovesicles have advantages over other chemical drugs in terms of stability or the risk of side effects. In addition, due to the use of patient-derived autologous stem cells, the nanovesicles are free from immune responses, and particularly, mesenchymal stem cell-derived nanovesicles are manufactured from cells free from host-immune rejection. Since PMSC-NVs possessing a surface marker of the mesenchymal stem cells also have the above-described characteristic, there also is a possibility for allotransplantation, and in the present invention, through a pre-clinical trial using mice and pigs, the possibility is partially confirmed. In addition, due to the host-immune rejection avoidance mechanism of mesenchymal stem cells, the mesenchymal stem cell-derive nanovesicles are expected to be free from macrophages compared to liposomes, which is expected to lead to an increase in targeting efficiency.

[0072] The nanovesicles may be separated through the size-controlled extrusion of the stem cells transfected with a vector into which coding sequences of signal peptide-disturbed blood flow site-targeting peptide-transmembrane protein (TMP)-green fluorescent protein (GFP) are sequentially inserted using a conventional transformation technology.

[0073] According to one embodiment of the present invention. plasmid DNA designed to functionalize a PREY peptide targeting a disturbed blood flow site to display it on the outside of an MSC membrane and produce NVs through physical cell disruption and subsequent self-assembly is used. To this end, a plasmid composed of external N-terminus-promoter-signal peptide-PREY-v5 tag-TMP-GFP-internal C-terminus structure is constructed (see FIGS. 2A to 2G, and 3). The signal peptide may induce localization of the PREY peptide to the outside of the cell membrane and deactivate an induction signal through cleavage. The v5 tag and GFP may be used to monitor the location and expression level of PREY. According to one embodiment of the present invention, GFP is expressed inside the cell membrane, and the v5 tag and the PREY peptide are expressed outside the cell membrane.

[0074] In addition, to improve the expression level of the disturbed blood flow site-targeting peptide, the ability of a peptide searching for and targeting the disturbed blood flow site may be maximized by using a transmembrane protein (TMP). Accordingly, the transmembrane protein may be i) a protein expressed in stem cells or nanovesicles. For example, as the transmembrane protein, an exosome marker such as CD86 and mesenchymal stem cell markers such as CD105 or CD271 may be used.

[0075] ii) The N-terminus and the C-terminus of the protein have to face in opposite directions with the cell membrane interposed therebetween.

[0076] Preferably, CD271 with high transfection efficiency may be used.

[0077] As the signal peptide, signal peptide F (BKU002587, Korea Human Gene Bank, Republic of Korea) and signal peptide R (BKU008396, Korea Human Gene Bank, Republic of Korea) may be used, but the present invention is not limited thereto.

[0078] The coding sequence of signal peptide-disturbed blood flow site-targeting peptide-transmembrane protein-green fluorescent protein (GFP) is a nucleic acid sequence, and the nucleic acid is used in the broadest sense, which includes single stranded (ss) DNA, double stranded (ds) DNA, cDNA, (−)-RNA, (+)-RNA, and dsRNA. Preferably, the nucleic acid is ds DNA.

[0079] Preferably, when DNA is selected as the coding sequence of signal peptide-disturbed blood flow site-targeting peptide-transmembrane protein, it may be used while being inserted into an expression vector.

[0080] The term “vector” used herein refers to a nucleic acid molecule capable of delivering another nucleic acid linked thereto. As one type of vector, “plasmid” refers to a circular double-stranded DNA loop into which an additional DNA segment may be ligated. Another type of vector is a viral vector that can ligate an additional DNA segment into a viral genome. Some vectors may be self-replicated in host cells when introduced into host cells (e.g., bacterial vectors having a bacterial replication origin and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) may be integrated into the genome of a host cell when introduced into the host cell and replicated with the host genome. In addition, some vectors may direct the expression of a gene to which they are operably linked. Such a vector used herein is called a “recombinant expression vector” (or simply, called “expression vector”). Generally, the expression vector useful for a recombinant DNA method is typically a plasmid form, and since the plasmid is the most common vector type, the “plasmid” and the “vector” may be used interchangeably. However, the present invention includes different types of expression vectors such as viral vectors providing equivalent functions (e.g., an adenovirus vector, an adeno-associated virus (AAV) vector, a herpes virus vector, a retrovirus vector, a lentivirus vector, a baculovirus vector). Preferably, a lentivirus vector can be used. Transformation includes any method to introduce a nucleic acid into an organism, a cell, a tissue or organ, and it may be performed by selecting appropriate standard techniques depending on host cells as known in the art. These methods include electroporation, protoplast fusion, calcium phosphate (CaPO.sub.4) precipitation, calcium chloride (CaCl.sub.2) precipitation, stirring using silicon carbide fibers, agrobacteria-mediated transformation, PEG, dextran sulfate, and Lipofectamine, but the present invention is not limited thereto.

[0081] The stem cells may be stem cells derived from one or more types of tissue selected from the group consisting of bone marrow, the umbilical cord, umbilical cord blood, the placenta, blood, skin, adipose tissue, nervous tissue, the liver, the pancreatic duct, muscle and the amniotic membrane: mesenchymal stem cells; embryonic stem cells; or induced pluripotent stem cells. Preferably, stem cells containing miRNAs such as miR-21, miR-132, miR-10, miR-146, miR-143 and let 7 having an anti-atherosclerotic characteristic may be used. For example, adipose-derived stem cells with high transfection efficiency and a low apoptosis rate may be used.

[0082] According to one embodiment of the present invention, the nanovesicles of the present invention may be obtained through extrusion while porous membranes with sizes of 10 μm, 5 μm and 400 nm are sequentially changed for stem cells transfected with a vector expressing a PREY peptide. According to one embodiment of the present invention, as a result of TEM and DLS analyses, a uniform distribution of nanovesicles having an average diameter of about 47.2±12.1 nm and about 83.7±20.6 nm, respectively, may be obtained, and the diameters are smaller than 14.9±2.0 μm of stem cells measured by DLS.

[0083] The nanovesicles of the present invention contain intracellular components even after extrusion, in comparison with intracellular components of stem cells, and the levels of anti-atherosclerotic miRNA, for example, miR-21, miR-132, miR-10, miR-146, miR-143 and let 7, are increased upon extrusion.

[0084] When macrophages activated by LPS treatments are treated with the nanovesicles of the present invention, the expression of an anti-inflammatory cytokine gene increases, exhibiting an anti-inflammatory effect. In addition, the foam cell formation of macrophages caused by the uptake of oxidized LDL results in the induction of phenotypic changes and the internal growth of VSMCs, therefore, the region in which such results are obtained is important for the development of atherosclerosis. These results show that the nanovesicles can prevent an atherosclerosis process.

[0085] In addition, as a result of testing an endothelial cell repair effect by nanovesicle treatments by activating the pro-inflammatory dysfunction of iMAECs, since endothelial cells dominantly express E-selectin, ICAM-1, and VCAM-1to recruit inflammatory cells in dysfunction activation, all of them are upregulated by LPS treatments when gene expression of these markers are measured. When treated with the nanovesicles, however, they are significantly downregulated, and therefore, the nanovesicles exhibit an endothelial cell repair effect. Moreover, by the CyA treatments in HUVECs, the nanovesicles can improve the pre-endothelial cell recovery and pre-angiogenic effects.

[0086] In addition, as a result of testing a disturbed blood flow site-targeting effect of nanovesicles in murine and porcine PCL models, it can be seen that a PREY peptide, which is the disturbed blood flow site-targeting peptide, targets filamin A overexpressed in the disturbed blood flow site, which may confirm a synergistic theragnostic effect of preventing the early progression of atherosclerosis. Moreover, in an in vitro microfluidic model, the nanovesicles co-exist with filamin A, and increase under a disturbed blood flow condition, which demonstrates the theragnostic potential of the nanovesicles.

[0087] In addition, the nanovesicles of the present invention reduce the expression level of the control without noticeable toxic effects in the heart, lungs, liver and spleen after systemic circulation.

[0088] Accordingly, the present invention also provides a composition for preventing, diagnosing and treating atherosclerosis, which includes the nanovesicles.

[0089] The composition for preventing or treating atherosclerosis of the present invention may include an active ingredient and an active or inactive pharmaceutically acceptable carrier, which are used for a composition suitable for a preventive, diagnostic, or therapeutic use in vitro, in vivo. or ex vivo.

[0090] The pharmaceutically acceptable carrier includes any pharmaceutically carrier which can be mixed with nanovesicles, like protein excipients including a phosphate-buffered saline (PBS) solution, serum albumin such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin and casein. Examples of carniers, stabilizers and adjuvants can be found in Martin REMINGTON'S PHARM. SCI, 18th Ed. (Mack Publ. Co., Easton (1995)) and the “PHYSICIAN'S DESK REFERENCE”, 58nd Ed., Medical Economics, Montvale, N.J. (2004). The term “carrier” may include a buffer solution or a pH adjuster, and the typical buffer solution is a salt prepared from an organic acid or base. Representative buffer solutions include organic acid salts such as a citric acid salt, an ascorbic acid salt, a gluconic acid salt, a carbonic acid salt, a tartaric acid salt, a succinic acid salt, an acetic acid salt, and a phthalic acid salt; Tris, tromethamine hydrochloride and a phosphate buffer.

[0091] Additional carriers include polymeric excipients/additives, for example, polyvinylpyrrolidone, Ficoll (polymer sugar), dextrates (e.g., cyclodextrins, such as 2-hydroxypropyl-quadrature, 2-hydroxypropyl-cyclodextrin), polyethylene glycol, antioxidants, anti-static agents, surfactants (e.g., polysorbates such as “TWEEN 20” and “TWEEN 80”), lipids (e.g., phospholipids and fatty acids), steroids (e.g., cholesterol) and chelating agents (e.g., EDTA). An anti-icing agent or freezing point depressing agent may also be included.

[0092] The composition for preventing, diagnosing, or treating atherosclerosis may be prepared in various appropriate formulations. For example, formulations and carriers suitable for administration via parenteral routes such as intra-arterial (at a joint), intravenous, intramuscular, intradermal, intraperitoneal, intranodal and subcutaneous routes, can include antioxidants, buffers, bacteriostats, solutes that allow a formulation to have the same osmotic pressure as the blood of a target recipient, and aqueous and non-aqueous sterile suspensions including a suspending agent, a solubilizing agent, a thickening agent, a stabilizing agent and a preservative. Intravenous or intraperitoneal administration are preferable methods. The dosage of cells administered to a subject is an amount effective to achieve a desired beneficial therapeutic response in the subject over time. For example, before injection, a blood sample is obtained from the subject and then stored, and then used in subsequent analysis and comparison. Generally, at least 10.sup.4 to 10.sup.6, and typically 1×10.sup.87 to 1×10.sup.10 cells may be intravenously or intraperitoneally injected into a 70-kg patient for approximately 60 to 120 minutes. In consideration of overall health conditions and the weight of a subject, the nanovesicles of the present invention are administered in a proportion determined by LD-50 (or other toxicity measurement methods) according to cell type and a side effect according to cell type at various concentrations. The cells may be administered at one time or in several divided portions. The nanovesicles of the present invention may supplement treatments for other specific symptoms using some known conventional therapeutic methods including a cytotoxic agent, a nucleotide analogue, or a biological response modifier. Similarly, the biological response modifier may be selectively added to the treatments with the nanovesicles of the present invention.

[0093] The present invention also provides a method of treating atherosclerosis, which includes administering a therapeutically effective amount of the nanovesicles into a subject.

[0094] As the nanovesicles and the administration method used in the atherosclerosis treatments are described above, in order to avoid excessive complexity of the specification. descriptions of the common contents between these are omitted.

[0095] The subject may be a mammal such as a dog, a cat, a rat, a mouse, or a human, but the present invention is not limited thereto.

[0096] Hereinafter, the advantages and features of the present invention and the methods of accomplishing the same will become apparent with reference to the detailed description of exemplary embodiments and the accompanying drawings.

[0097] However, the present invention is not limited to the exemplary embodiments disclosed below, and it may be embodied in many different forms. These exemplary embodiments are merely provided to complete the disclosure of the present invention and fully convey the scope of the present invention to those of ordinary skill in the art, and the present invention should be defined by only the accompanying claims.

[0098] Hereinafter, the present invention will be described in more detail with reference to examples. The examples are merely provided to more fully describe the present invention, and it will be obvious to those of ordinary skill in the art that the scope of the present invention is not limited to the following examples.

<Example 1> Preparation and Characterization of PREY Peptide-Nanovesicles (NVs)

[0099] (Plasmid Design and Cloning for PREY Expression)

[0100] A plasmid displaying and localizing PREY on a cell membrane consists of external N-terminus-signal peptide-PREY-V5-TMP-GFP-internal C-terminus. As the signal peptide, Signal peptide F (BKU002587, Korea Human Gene Bank, Republic of Korea) or Signal peptide R (BKU008396, Korea Human Gene Bank, Republic of Korea) are used. In the plasmid sequence, i) the signal peptide induces localization of the PREY peptide to the outside of the cell membrane: and ii) the V5 tag and GFP monitor the location and the expression level of PREY. An expression vector was cloned using a NEB Gibson Assembly kit (New England Biolabs, MA) according to the manufacturer's instructions. Signal peptides and each type of transmembrane protein were amplified y PCR using the following templates: Signal peptide F (BKU002587, Korea Human Gene Bank. Republic of Korea). Signal peptide R (BKU008390, Korea Human Gene Bank, Republic of Korea), NGFR (Addgene plasmid #27489, Addgene, MA) for CD86, CD105, and cleaved CD271 (LNGFR). The vector components were inserted into a Cas9-digested p3S-Cas9-HNa (Addgene plasmid #104171) backbone with plasmid synthesis (Macrogen Republic of Korea). According to the above procedure, PCR amplification and Gibson cloning were performed. All primers and plasmids are listed in Tables 1 and 2.

TABLE-US-00001 TABLE 1 List of primers used in cloning Name of Sequence Insert primer (5′.fwdarw. 3′) Template Notes CMV All pCMV TAACTCGAGCATGCATCT p3S-Cas9-HN (A linearized p3S- promoter Backbone_F AGAG gift from Cas9-HN backbone <SEQ ID Jin-Soo plasmid NO: 6> Kim; Addgene without Cas9 plasmid # Sequence 104171) pCMV GGTGGCAAGCTTGGGTCT Backbone_R CC <SEQ ID NO: 7> GS linker All itiEGFP_F GAAGCGGAGGAGGAGGA pC015- — and EGFP <SEQ ID  AGCGGAGGAGGAGGTAG dLwCas13a-NF NO: 8> CGTGAGCAAGGGCGAG (A gift from Feng Zhang; Addgene plasmid #91905) mEGFP R ATAGGGCCCTCTAGATGC — <SEQ ID ATGCTCGAGTTATTACTTG NO: 9> TACAGCTCGTCCATG Signal CD86 CD86 CTCACTATAGGGAGACCC NM_75862 — peptide Signal_F AAGCTTGCCACCATGGAT (BKU002587, and <SEQ ID CCCCAGTGCACTAT Korea Human PREY NO: 10> Gene Bank) CD86 GTGAGGCATATAGGAGGT Signal_ GTACTCGCGGGGACTGCC PREY_R AGCTTGAATCTTCAGAGG <SEQ ID AG NO: 11> CD271 NGFR CTCACTATAGGGAGACCC NGFR (A gift — Signal_F AAGCTTGCCACCATGGAC from Warren <SEQ ID GGGCCGCGCCT Pear; Addgene NO: 12> plasmid # 27489) NGFR CATATAGGAGGTGTACTC — Signal_R GCGGGGACTGCCGGCACC <SEQ ID TCCAAGGGACACCC NO: 13> CD105 CD 105 CTCACTATAGGGAGACCC NM 001114753 — Signal_F AAGCTTGCCACCATGGAC (BKU008396, <SEQ CGCGGCACGCTCCC Korea Human ID NO: Gene Bank) 14> CD105 CATATAGGAGGTGTACTC — Signal_R GCGGGGACTGCCTGCAAG <SEQ ACTTGTGGGGCTGA ID NO: 15> PREY All V5 GGCAGTCCCCGCGAGTAC Primer extension PREY and V5 and V5 tag PREY_F ACCTCCTATATGCCTCAC without tag Tag <SEQ ID GGCAAGCCCATCCCCAAC template NO: 16> CC CD86 V5 GCATGGCAGGTCTGCAGTCTCATTGAAAT V5 tag and tag CD86_R AGGTGCTGTCCAGGCCCAGCA 30bp <SEQ ID  homology with NO: 17> CD86 mature peptide CD271 V5 Full GGTGCTGTCCAGGCCCAGCAGGGGGTTG V5 tag anti or AS GGGATGGGCTTGCC sense CD105 <SEQ ID NO: 18> Mature CD86 CD86 TATTTCAATGAGACTGCAGACCT NM_175862 peptide MP_F (BKU002587) and GS <SEQ ID linker NO: 19> CD 86 TCCGCTTCCTCCTCCTCCGCTTCCACCTCC MP_Linker_ TCCAAAACATGTATCACTTTTGTCGCA R <SEQ ID NO: 20> CD271 V5_LNGFR_F CCCAACCCCCTGCTGGGCCTGGACAGCAC NGFR <SEQ ID CAAGGAGGCATGCCCCACAG (Addgene NO: 21> plasmid # 27489) LNGFR_ CTCCGCTTCCTCCTCCTCCGCTTCCACCTC Linker_R CTCCTCGATAAGCTTGGCTGCAGGT <SEQ ID NO: 22> CD105 V5- CCCAACCCCCTGCTGGGCCTGGACAGCAC NM_001114753 CD105_F CGAAACAGTCCATTGTGACCT (BKU008396) <SEQ ID NO: 23> CD105- CTCCGCTTCCTCCTCCTCCGCTTCCACCTC GS_R CTCCTGCCATGCTGCTGGTGGAGC <SEQ ID NO: 24>

TABLE-US-00002 TABLE 2 Types and sequences of plasmids (Signal peptide; PREY; V5 tag; Transmembrane protein; GS linker and EGFP) Plasmid Sequence (5′.fwdarw.3′) PREY-CD271- CCATCCTGGTCGAGCTGGACGGCGA EGFP (1701 CGTAAACGGCCACAAGTTCAGCGTG bp) TCCGGCGAGGGCGAGGGCGATGCCA <SEQ ID CCTACGGCAAGCTGACCCTGAAGTT NO: 25> CATCTGCACCACCGGCAAGCTGCCC GTGCCCTGGCCCACCCTCGTGACCA CCCTGACCTACGGCGTGCAGTGCTT CAGCCGCTACCCCGACCACATGAAG CAGCACGACTTCTTCAAGTCCGCCA TGCCCGAAGGCTACGTCCAGGAGCG CACCATCTTCTTCAAGGACGACGGC AACTACAAGACCCGCGCCGAGGTGA AGTTCGAGGGCGACACCCTGGTGAA CCGCATCGAGCTGAAGGGCATCGAC TTCAAGGAGGACGGCAACATCCTGG GGCACAAGCTGGAGTACAACTACAA CAGCCACAACGTCTATATCATGGCC GACAAGCAGAAGAACGGCATCAAGG TGAACTTCAAGATCCGCCACAACAT CGAGGACGGCAGCGTGCAGCTCGCC GACCACTACCAGCAGAACACCCCCA TCGGCGACGGCCCCGTGCTGCTGCC CGACAACCACTACCTGAGCACCCAG TCCGCCCTGAGCAAAGACCCCAACG AGAAGCGCGATCACATGGTCCTGCT GGAGTTCGTGACCGCCGCCGGGATC ACTCTCGGCATGGACGAGCTGTACA AGTAA PREY-CD86- AAAGTTCGAAGACATCTTCATGCGA EGFP CAAAAGTGATACATGTTTTGGAGGA (1827 bp) GGTGGAAGCGGAGGAGGAGGAAGCG <SEQ ID GAGGAGGAGGTAGCGTGAGCAAGGG NO: 26> CGAGGAGCTGTTCACCGGGGTGGTG CCCATCCTGGTCGAGCTGGACGGCG ACGTAAACGGCCACAAGTTCAGCGT GTCCGGCGAGGGCGAGGGCGATGCC ACCTACGGCAAGCTGACCCTGAAGT TCATCTGCACCACCGGCAAGCTGCC CGTGCCCTGGCCCACCCTCGTGACC ACCCTGACCTACGGCGTGCAGTGCT TCAGCCGCTACCCCGACCACATGAA GCAGCACGACTTCTTCAAGTCCGCC ATGCCCGAAGGCTACGTCCAGGAGC GCACCATCTTCTTCAAGGACGACGG CAACTACAAGACCCGCGCCGAGGTG AAGTTCGAGGGCGACACCCTGGTGA ACCGCATCGAGCTGAAGGGCATCGA CTTCAAGGAGGACGGCAACATCCTG GGGCACAAGCTGGAGTACAACTACA ACAGCCACAACGTCTATATCATGGC CGACAAGCAGAAGAACGGCATCAAG GTGAACTTCAAGATCCGCCACAACA TCGAGGACGGCAGCGTGCAGCTCGC CGACCACTACCAGCAGAACACCCCC ATCGGCGACGGCCCCGTGCTGCTGC CCGACAACCACTACCTGAGCACCCA GTCCGCCCTGAGCAAAGACCCCAAC GAGAAGCGCGATCACATGGTCCTGC TGGAGTTCGTGACCGCCGCCGGGAT CACTCTCGGCATGGACGAGCTGTAC AAGTAA PREY-CD105- CAGCATGGCAGGAGGAGGTGGAAGC EGFP GGAGGAGGAGGAAGCGGAGGAGGAG (2814 bp) GTAGCGTGAGCAAGGGCGAGGAGCT <SEQ ID GTTCACCGGGGTGGTGCCCATCCTG NO: 27> GTCGAGCTGGACGGCGACGTAAACG GCCACAAGTTCAGCGTGTCCGGCGA GGGCGAGGGCGATGCCACCTACGGC AAGCTGACCCTGAAGTTCATCTGCA CCACCGGCAAGCTGCCCGTGCCCTG GCCCACCCTCGTGACCACCCTGACC TACGGCGTGCAGTGCTTCAGCCGCT ACCCCGACCACATGAAGCAGCACGA CTTCTTCAAGTCCGCCATGCCCGAA GGCTACGTCCAGGAGCGCACCATCT TCTTCAAGGACGACGGCAACTACAA GACCCGCGCCGAGGTGAAGTTCGAG GGCGACACCCTGGTGAACCGCATCG AGCTGAAGGGCATCGACTTCAAGGA GGACGGCAACATCCTGGGGCACAAG CTGGAGTACAACTACAACAGCCACA ACGTCTATATCATGGCCGACAAGCA GAAGAACGGCATCAAGGTGAACTTC AAGATCCGCCACAACATCGAGGACG GCAGCGTGCAGCTCGCCGACCACTA CCAGCAGAACACCCCCATCGGCGAC GGCCCCGTGCTGCTGCCCGACAACC ACTACCTGAGCACCCAGTCCGCCCT GAGCAAAGACCCCAACGAGAAGCGC GATCACATGGTCCTGCTGGAGTTCG TGACCGCCGCCGGGATCACTCTCGG CATGGACGAGCTGTACAAGTAA

[0101] (Measurement of Transfection Efficiency)

[0102] PREY transfection efficiency was compared among the test candidates (CD86, CD105, and CD271) of transmembrane proteins with two types of MSCs (ASC and BMSC) one day after transfection by flow cytometry using FACSCanto (BD Biosciences, CA) with quantitative analysis. Therefore, cells were immunostained with an anti-v5 tag primary antibody (ab27671, Abcam, MA) and an Alexa Fluor 647-conjugated secondary antibody (Jackson Immuno Research, PA). To evaluate plasmid dose-dependent apoptosis, transfected ASCs and BMSCs were harvested 30 minutes after transfection, immunostained with Alexa Fluor 488-conjugated annexin V (Thermo Fisher Scientific, CA), and they were subjected to flow cytometry. The number of viable cells was also counted by trypan blue staining one day after transfection.

[0103] (NV Extrusion)

[0104] Three days after transfection, human ASCs (Promocell, Germany), BMSCs (Lonza, Switzerland), and PMSCs were washed twice with PBS, and detached with 0.25% trypsin/EDTA. Subsequently, to produce nanovesicles, 1×10.sup.6 cells/mL of the cell suspension in PBS was extruded 6 times sequentially with polycarbonate membrane filters with pore sizes of 10 μm, 5 μm, and 400 nm (Whatman, UK) using an extrusion kit (Avanti Polar Lipids, AL). The NVs were collected by centrifugation at 15,000 g for 30 minutes. Subsequently, the pellet was re-suspended in PBS, filtered using a 0.20-μm syringe filter (Avantec, Japan), and the resulting product was stored at −70° C. until use. The size and morphology of PMSC-NVs were determined by transmission electron microscope (TEM; JEM-F200, JEOL, Japan) and dynamic light scattering (DLS; ELS-1000ZS, Otsuka Electronics, Japan).

[0105] (Measurement of In Vitro Anti-Inflammatory Effects)

[0106] RAW264.7 cells were seeded on a24-well plate (5×10.sup.5 cells/well). The pro-inflammatory activation of the RAW264.7 cells was induced in ASC-NV or BMSC-NV (10 μg/mL) after 24-hour LPS (Sigma-Aldrich: 100 ng/mL) treatments. To visualize cellular uptake, the RAW264.7 cells and NVs were labeled with DiO and DiI (Invitrogen, CA), respectively, and imaged using a confocal microscope (LSM780; Zeiss, Germany). For qRT-PCR analysis, the cells were collected 24 hours after NV treatments. Primer sequences of IL-10, IL-10, IL-6, and TNF-α are listed in Table 3. For cytokine analysis using a mouse inflammation antibody array (ab133999, Abcam), a cell supernatant was collected according to the manufacturer's instructions. The anti-phagocytic effects of MSC-NVs were measured according to the manufacturer's instructions using a Vybrant™ Phagocytosis Assay Kit (V6694, Molecular Probes, OR). Images were obtained using a confocal microscope, and a fluorescent intensity was measured using a Vanoskan™ LUX multimode microplate reader (Thermo Fisher Scientific, MA).

TABLE-US-00003 TABLE 3 SEQ Target ID gene Primer sequence (5′.fwdarw.3′) NO. GAPDH Forward ATG TGT CCG TCG 28 TGG ATC TGA Reverse TGC CTG CTT CAC 29 CAC CTT CT IL-10 Forward ACT GGC ATG AGG 30 ATC AGC AG Reverse CTC CTT GAT TTC 31 TGG GCC AT IL-1β Forward GCC ACC TTT TGA 32 CAG TGA TGA G Reverse ATC AGG ACA GCC 33 CAG GTC AA IL-13 Forward ATG GCC TCT GTA 34 ACC GCA AG Reverse TCC TCA TTA GAA 35 GGG GCC GT TNF-α Forward CCT GTA GCC CAC 36 GTC GTA GC Reverse AGC AAT GAC TCC 37 AAA GTA GAC C VCAM1 Forward AGT TGG GGA TTC 38 GGT TGT TC Reverse CAT TCC TTA CCA 39 CCC CAT TG E-selectin Forward CCA GAA TGG CGT 40 CAT GGA Reverse TAA AGC CCT CAT 41 TGC ATT GA ICAM1 Forward CAA TTT CTC ATG 42 CCG CAC AG Reverse AGC TGG AAG ATC 43 GAA AGT CCG

[0107] (Evaluation of In Vitro Pro-EC Recovery Effects)

[0108] iMAECs (ATCC, VA) were seeded on a 24-well plate (1×10.sup.5 cells/well) and then treated with LPS (100 ng/mL) for 24 hours. Subsequently, the cells were additionally treated with ASC-NVs, BMSC-NVs or PMSC-NVs (10 μg/mL) for 24 hours. For visualization of cell uptake, the iMAECs and NVs were labeled with DiO and DiI, respectively, and visualized using a confocal microscope. For qRT-PCR analysis, iMAECs were collected 24 hours after NV treatments. Primer sequences of E-selectin, ICAM-1, and VCAM-1 are listed in Table 3. The iMAECs were immunostained with a VCAM-1 antibody (ab134047, Abcam) and imaged using a confocal microscope with quantitative analysis by ImageJ. HUVECs (Lonza) were treated with NVs (10 μg/mL) and CyA (25 μg/mL; Santa Cruz Biotechnology, CA), and they were cultured on Matrigel (BD Biosciences, MA) for 2 hours or 24 hours, followed by measuring the pro-EC recovery effects caused by anti-angiogenesis and angiorrhexis. Images were obtained using a confocal microscope and quantified using ImageJ.

[0109] (Murine PCL Model)

[0110] All animal studies were carried out by procedures (2018-0044) approved by the Institutional Animal Care and Use Committee (IACUC) of the College of Medicine of Yonsei University, Republic of Korea. The surgical procedure was performed with 6-week-old male Balb/c (Orient Bio Inc, Korea) or KOR-ApoE (shl) (SLC, Japan) mice. For PCL surgery, the animals were anesthetized by intraperitoneal injection of a mixture of xylazine (10 mg/kg) and zoletil (50 mg/kg). The neck of each animal was shaved and disinfected with betadine. Subsequently, a midline incision was performed (5 mm). After LCA exposure, three (ECA, ICA and OA) of the four branches of the LCA were ligated with 10-0 polyamide suture, and the STA was left unligated. Subsequently. the incision was closed with 6-0 silk suture. In addition, the mice were monitored and fed an atherosclerotic diet (Research Diets, NJ), followed by intravenously administering MSC-NVs, PMSCs, or PMSC-NVs three days after ligation.

[0111] (Measurement of Targeting Efficiency and Anti-Atherosclerotic Effects in Murine PCL Model)

[0112] The in vivo PMSC-NV targeting efficiency of disturbed blood flow sites was measured in murine PCL models through IVIS imaging (PerkinElmer, WA) and histological analysis 24 hours after injection of the test groups. The MSC and NV groups were labeled with VivoTrack 680 (PerkinElmer) for 30 minutes and injected into the PCL models. Subsequently, IVIS imaging was performed under inhalational anesthetization with isoflurane. Afterwards, the mice were sacrificed, and their LCAs, RCAs and major organs were harvested for ex-vivo IVIS imaging and histological analysis. Tissue sections of the LCAs and RCAs were immunostained with an anti-filamin A antibody (ab51217, Abcam), and the corresponding fluorescence intensity was quantified using ImageJ software. Tissue sections were also stained with H&E, or immunostained with an anti-CD68 antibody (ab125212, Abcam) and an anti-VCAM-1 antibody (ab134047, Abcam). Neointima structure factors (area ratio of neointima to neointima+ lumen, area ratio of neointima to media. and neointima area) or the corresponding fluorescence intensities were quantitatively analyzed using ImageJ.

[0113] (Measurement of Targeting Efficiency in Porcine PCL Model)

[0114] PCL surgery was performed on female Yorkshire pigs with a weight of 25 to kg (XP bio, Republic of Korea) according to a previous study. The pigs were subjected to intramuscular injection with atropine (0.04 mg/kg), xylazine (2 mg/kg), and azaperone (2 mg/kg) as premedication. The pigs were anesthetized with alfaxan (1 mg/kg) and maintained in this state by endotracheal intubation of 2% isoflurane during surgery. The neck was disinfected using betadine and then a midline skin incision was performed. A sterilized stainless-steel rod (outer diameter=0.9 mm) was placed as a spacer on the LCA and ligated together with 5-0 silk suture. The rod was sequentially removed, and the incision was closed by suturing, resulting in 80% occlusion of a carotid artery. The RCA was left unligated as a normal group. A blood flow pattern was observed using ultrasound (S22V; SonoScape Medical Corp., China). At three days after ligations, Vivotrack680-labeled MSC-NVs or PMSC-NVs were intravenously injected into an ear vein (1 mg/pig), and the pigs were sacrificed on day 1 or 21 after injection. For ex-vivo IVIS and histological analysis, RCAs, LCAs, and aortic arches were collected. These tissue sections were immunostained with an anti-filamin A antibody and an anti-CD31 antibody (sc-1506, Santa Cruz Biotechnology, CA), followed by fluorescence imaging with ImageJ analysis.

[0115] (Measurement of Human EC Targeting Efficiency in In Vitro Blood Flow Model)

[0116] As previously described (Sei, Y. J. et al. Sci Rep 7, 10019, 2017), a microfluidic device was produced with polydimethylsiloxane (PDMS, Dow Corning, MI) by soft lithography, bonded with glass coverslips (VWR, PA), and placed in a polystyrene box (Ted Pella Inc., CA). The devices were sterilized with 70% ethanol and washed with PBS. Channels were then coated with 50 μg/mL of collagen 1 (Corning, MA) at 37° C. for 1 hour. Human coronary artery endothelial cells (hCAECs; Lonza) or human aortic endothelial cells (hAECs; Lonza) were seeded into the channel for 12 hours (2×10.sup.7 cells/mL). The outlet of each device was connected to a PhD Ultra syringe pump (Harvard Apparatus, MA) to create a normal medium flow or a disturbed blood flow. To create the normal laminal flow, the medium was perfused with a shear stress of 10 dyne/cm.sup.2 at 22.5 μL/min. The disturbed blood flow was generated by repeated cycles of injecting and removing the medium at 22.5 μL/min (10 dyne/cm.sup.2) and 20 μL/min (9 dyne/cm.sup.2), respectively. After the human ECs were exposed to one of the flow types, NVs (10 μg/mL) were perfused into the channels at 37° C. for 1 hour. NV uptake into human ECs in each test group was quantitatively analyzed using ImageJ.

[0117] (qRT-PCR and miRNA Array)

[0118] Total RNA was extracted from each sample using a I mL TRIzol reagent (Invitrogen) according to the manufacturer's instructions. The RNA was dissolved in diethyl pyrocarbonate (DEPC) water, and cDNA was synthesized using AccuPower CycleScript RT Premix (Bioneer, Republic of Korea). Subsequently, PCR was performed with SYBR Green PCR mix (Thermo Fisher Scientific) in a StepOnePlus real-time PCR system (Applied Biosystems, CA). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was provided as a housekeeping gene, and the gene expression of each marker was measured using the relative quantification method (2.sup.−ΔΔCt). Primer sequences are listed in Table 3. The dissolved RNA was profiled using a miRNA array (GeneChip 4.0 microRNA Microarray; Affimetrix, Japan) according to the manufacturer's instructions.

[0119] (Immunofluorescence Staining of Cells and Tissue)

[0120] Cell samples were fixed with 4% paraformaldehyde (Sigma-Aldrich) for 10 minutes, tissue samples were fixed with 10% paraformaldehyde for 3 days, and both were performed at room temperature. The fixed samples were washed with PBS, and embedded in paraffin to make tissue sections. Subsequently, the sections were hydrated using a series of xylene and ethanol solutions (100%, 95%, 80% and 70% v/v in distilled water) and treated with a pepsin reagent (Sigma-Aldrich) for 30 minutes at 37° C. for antigen retrieval. The tissue sections were then treated with a blocking solution (5% bovine serum albumin (Millipore, MD)+0.3% Triton X-100 (Sigma-Aldrich)) at room temperature for 1 hour. The primary antibodies are an anti-v5 tag antibody (ab27671, Abcam), anti-VCAM-1 (ab134047, Abcam), anti-CD68 (ab125212, Abcam), anti-Filamin A (ab51217, Abcam), and anti-CD31 (sc-1506, Santa Cruz Biotechnology, CA, USA). These antibodies were treated in PBS with 1:100 dilutions, and subsequent secondary antibodies were treated with PBS in 1:200 dilutions. The secondary antibodies are an anti-mouse antibody conjugated to Alexa Fluor 594, an anti-rabbit antibody conjugated to Alexa Fluor 594, an anti-rabbit antibody conjugated to Alexa Fluor 488 and an anti-goat antibody conjugated to Alexa Fluor 488 (all from Jackson Laboratories). Subsequently, the samples were mounted and counterstained with a mounting solution containing 4′,6-diamidino-2-phenylindole (DAPI, Vector Laboratories, CA) to visualize the cell nuclei.

[0121] (Western Blotting)

[0122] The samples were lysed with RIPA buffer (Sigma-Aldrich) to obtain total proteins, and the concentrations of the proteins were measured using a Bradford assay (Sigma-Aldrich). Protein extracts were run on a 10% (w/v) SDS-PAGE gel by electrophoresis and then transferred to a nitrocellulose membrane. The membrane was blocked in TBST (20 mM Tris, 0.9% NaCl, 0.1% Tween 20, pH 7.4) with 5% (w/v) skim milk and then incubated with primary antibodies such as anti-v5 tag (ab27671, Abcam), anti-CD271 (345102, Biolegend, CA), anti-GFP (ab32146, Abcam), anti-CD9(ab92726, Abcam), and anti-β-actin (ab8227, Abcam). Subsequently, secondary antibodies such as goat anti-mouse IgG (H+L)-HRP conjugated and goat anti-rabbit IgG (H+L)-HRP conjugated antibodies (all from Vector Laboratories) were applied according to the manufacturer's instructions. The signals were visualized using a CL Plus Western Blotting Detection Kit (Amersham Biosciences, UK) according to the manufacturer's instructions and analyzed using a LAS-3000 image reader (Fujifilm, Japan).

[0123] (Statistical Analysis)

[0124] Quantitative data is expressed as mean±standard deviation (stdev). The results are statistically analyzed through by one-way ANOVA by a Tukey's significant difference post hoc test using SigmaPlot 12.0 (Systat Software, Inc., California. USA).

<Experimental Example 1> PREY Display at Outside of Membrane

[0125] To enable NVs to target disturbed blood flow sites, a targeting peptide PREY was externally displayed by expressing a specifically-designed plasmid across the MSC membrane (PMSCs: PREY-expressing human MSCs). The plasmid was designed to express a PREY extracellular domain with a signal peptide at the N-terminus so that the signal peptide can induce the outward localization of the PREY-extracellular domain from the MSC membrane and deactivate the induction signal by cleavage.

[0126] In addition, the ability of three transmembrane proteins (TMPs), that is, the exosome marker (CD86) and MSC markers (CD105 and CD271), for improving PREY expression was tested. In this way, the ability of PREY to search for and target disturbed blood flow sites was maximized. PREY was linked with V5 tag and then with GFP (external N-terminus-promoter-signal peptide-PREY-V5 tag-TMP-GFP-internal C-terminus) to confirm the localization and the expression levels of PREY outside and inside the cell membrane (FIGS. 2A and 3).

[0127] Among the test groups having the three transmembrane proteins, the expression level of PREY-CD271 (nerve growth factor receptor, NGFR) was higher than those of PREY-CD86 and PREY-CD105 in both adipose-derived stem cells (ASCs) and bone marrow-derived stem cells (BMSCs), showing excellent transfection efficiency (FIGS. 2B, and 4A to 4C). When the dose of the PREY-CD271 plasmid was increased, the expression level increased in a dose-dependent manner, whereas cell viability was dramatically reduced after 2×-dose transfection (FIGS. 2C, and 4A to 4C). Accordingly, in consideration of the balance with cell viability, the plasmid dose was determined to be 1×(1 μg PREY-plasmid per 1×10.sup.6 cells). Comparing the number of dead cells using Annexin V+, there were more viable ASCs than BMSCs after transfection, indicating ASCs are a more suitable source for PREY transfection (FIGS. 2C, and 4A to 4C).

[0128] To verify the external display of PREY on the MSC membrane, the V5 tag was immunostained when placed next to the PREY in the sequence (external N-terminus-promoter-signal peptide-PREY-V5-TMP-GFP-internal C-terminus). Since neither of the two types worked to clearly obtain both information types, adhered (FIG. 5) and suspended (FIG. 2D, and FIGS. 1A to 1C) forms of PMSCs were used to determine the expression level and location of PREY.

[0129] In the adhered form, PREY was highly expressed along the cell membrane as shown by the v5 tag and GFP signal, indicating successful transfection. When suspended forms were formed by inserting cells into a gelatin hydrogel, the confocal images showed the appearance of the v5 tag (red) and GFP (green) signals outside and inside the boundary of the MSC membrane, respectively, confirming the external PREY display on the cell membrane.

<Experimental Example 2> Extrusion and Characterization of Nanovesicles

[0130] To produce PMSC-NVs, PMSCs were sequentially extruded through a series of polycarbonate micropore membranes while gradually decreasing the pore diameters from 10 to 5 μm and finally to 0.4 μm (FIG. 1B). A TEM result (FIG. 2E) shows a uniform distribution of PMSC-NV diameters with an average of 47.2t12.1 nm. In addition, the intact preservation of the PREY-peptide (GFP and v5 tag) and exosome characteristics (CD9) during transfection and NV extrusion were assessed by western blotting (FIGS. 2F and 6).

[0131] Next, comparing the intracellular components in MSC-NVs, PMSCs and PMSC-NVs, the preservation of intracellular components was confirmed after PREY transfection and NV extrusion. miRNAs are provided as important therapeutic agents, and most of them are delivered by exosomes. Since NVs are inherently similar to exosomes, the miRNA contents of PMSC-NVs, MSC-NVs, and PMSCs were profiled by miRNA array (FIG. 2G and Tables 4 and 5, and FIG. 6). The transfection (MSC-NV vs, PMSC-NV) and extrusion (PMSC vs. PMSC-NV) processes change the expression levels at least two-fold with respect to 2.72 and 6.71% of the total miRNAs, proving the preservation of intracellular content during their production. Among anti-atherosclerotic miRNAs, miR-21, miR-132, miR-10, miR-146, miR-143, and let 7 levels increased during extrusion, but the expression levels of other miRNAs were maintained during NV production from MSCs.

TABLE-US-00004 TABLE 4 Name of miRNA Change rate Regulation pattern Name of miRNA Change rate Regulation pattern hsa-miR-21-5p 17.321 up-regulation hsa-miR-3195 5.080 down-regulation hsa-miR-140-5p 10.011 up-regulation hsa-miR-106b-3p 4.296 down-regulation hsa-miR-7641 9.352 up-regulation hsa-miR-3663-3p 3.766 down-regulation hsa-miR-337-5p 8.283 up-regulation hsa-miR-345-5p 3.375 down-regulation hsa-miR-4443 8.228 up-regulation hsa-miR-3178 3.057 down-regulation hsa-miR-4726-5p 7.288 up-regulation hsa-miR-3687 3.035 down-regulation hsa-miR-132-3p 4.383 up-regulation hsa-miR-8063 2.958 down-regulation hsa-miR-376c-3p 4.236 up-regulation hsa-miR-4634 2.843 down-regulation hsa-miR-19b-3p 3.558 up-regulation hsa-miR-7112-5p 2.840 down-regulation hsa-miR-503-5p 3.481 up-regulation hsa-miR-663b 2.661 down-regulation hsa-miR-196a-5p 3.366 up-regulation hsa-miR-3124-5p 2.549 down-regulation hsa-miR-15a-5p 3.178 up-regulation hsa-miR-4497 2.523 down-regulation hsa-miR-143-3p 3.091 up-regulation hsa-miR-7975 2.505 down-regulation hsa-miR-143-5p 2.750 up-regulation hsa-miR-3679-5p 2.490 down-regulation hsa-miR-629-5p 2.689 up-regulation hsa-miR-6127 2.450 down-regulation hsa-miR-194-5p 2.549 up-regulation hsa-miR-6871-5p 2.442 down-regulation hsa-miR-30b-5p 2.521 up-regulation hsa-miR-4486 2.405 down-regulation hsa-miR-27a-3p 2.467 up-regulation hsa-miR-4750-5p 2.278 down-regulation hsa-miR-3131 2.466 up-regulation hsa-miR-6509-5p 2.221 down-regulation hsa-miR-7109-5p 2.442 up-regulation hsa-miR-4649-5p 2.158 down-regulation hsa-miR-30a-5p 2.424 up-regulation hsa-miR-6820-5p 2.156 down-regulation hsa-miR-152-3p 2.407 up-regulation hsa-miR-15b-5p 2.149 down-regulation hsa-miR-6837-5p 2.379 up-regulation hsa-miR-505-5p 2.145 down-regulation hsa-miR-1247-3p 2.370 up-regulation hsa-miR-378a-3p 2.136 down-regulation hsa-miR-379-5p 2.254 up-regulation hsa-miR-1343-5p 2.126 down-regulation hsa-miR-199a-5p 2.248 up-regulation hsa-miR-30d-5p 2.097 down-regulation hsa-let-7f-5p 2.246 up-regulation hsa-miR-486-5p 2.089 down-regulation hsa-miR-6876-5p 2.239 up-regulation hsa-miR-1469 2.082 down-regulation hsa-miR-642a-3p 2.221 up-regulation hsa-miR-6831-5p 2.025 down-regulation hsa-miR-1260b 2.195 up-regulation hsa-miR-210-3p 2.184 up-regulation hsa-let-7i-5p 2.181 up-regulation hsa-miR-452-5p 2.157 up-regulation hsa-miR-27b-3p 2.131 up-regulation hsa-miR-4521 2.128 up-regulation hsa-miR-3201 2.119 up-regulation hsa-miR-371b-5p 2.084 up-regulation hsa-miR-654-3p 2.081 up-regulation hsa-miR-4487 2.049 up-regulation hsa-miR-22-3p 2.039 up-regulation hsa-let-7c-5p 2.022 up-regulation

TABLE-US-00005 TABLE 5 At least 2-fold miRNA change by extrusion process (PMSC vs. PMSC-NV) Name of miRNA Change rate Regulation pattern Name of miRNA Change rate Regulation pattern hsa-miR-21-5p 11.055 up-regulation hsa-miR-3162-5p 8.520 down-regulation hsa-miR-132-3p 10.252 up-regulation hsa-miR-4298 8.288 down-regulation hsa-miR-4521 9.785 up-regulation hsa-miR-6778-5p 6.988 down-regulation hsa-miR-337-5p 7.805 up-regulation hsa-miR-1973 5.582 down-regulation hsa-miR-1260b 7.468 up-regulation hsa-miR-3911 5.221 down-regulation hsa-miR-27b-5p 7.120 up-regulation hsa-miR-7107-5p 5.104 down-regulation hsa-miR-1260a 7.045 up-regulation hsa-miR-6782-5p 4.878 down-regulation hsa-miR-99b-3p 6.854 up-regulation hsa-miR-7847-3p 4.844 down-regulation hsa-miR-425-3p 5.547 up-regulation hsa-miR-6831-5p 4.763 down-regulation hsa-miR-10a-5p 5.071 up-regulation hsa-miR-6726-5p 4.708 down-regulation hsa-miR-214-5p 4.763 up-regulation hsa-miR-6068 4.695 down-regulation hsa-miR-7975 4.746 up-regulation hsa-miR-4656 4.567 down-regulation hsa-miR-15a-5p 4.745 up-regulation hsa-miR-6812-5p 4.230 down-regulation hsa-miR-378a-3p 4.567 up-regulation hsa-miR-485-3p 4.208 down-regulation hsa-miR-487a-5p 4.512 up-regulation hsa-miR-8089 4.136 down-regulation hsa-miR-27a-5p 4.421 up-regulation hsa-miR-4534 4.126 down-regulation hsa-miR-140-5p 4.360 up-regulation hsa-miR-3135b 4.065 down-regulation hsa-miR-500a-5p 4.265 up-regulation hsa-miR-6813-5p 4.014 down-regulation hsa-miR-7641 3.989 up-regulation hsa-miR-6808-5p 3.966 down-regulation hsa-miR-381-3p 3.901 up-regulation hsa-miR-4732-5p 3.920 down-regulation hsa-miR-378h 3.799 up-regulation hsa-miR-7111-5p 3.902 down-regulation hsa-miR-30a-5p 3.795 up-regulation hsa-miR-6848-5p 3.889 down-regulation hsa-miR-629-5p 3.739 up-regulation hsa-miR-4433-3p 3.768 down-regulation hsa-miR-452-5p 3.706 up-regulation hsa-miR-4433b-3p 3.750 down-regulation hsa-miR-196a-5p 3.677 up-regulation hsa-miR-6086 3.710 down-regulation hsa-miR-4487 3.663 up-regulation hsa-miR-6165 3.646 down-regulation hsa-miR-29b-1-5p 3.659 up-regulation hsa-miR-5189-3p 3.630 down-regulation hsa-miR-4454 3.457 up-regulation hsa-miR-1229-5p 3.532 down-regulation hsa-miR-93-3p 3.367 up-regulation hsa-miR-6763-5p 3.513 down-regulation hsa-miR-154-5p 3.333 up-regulation hsa-miR-619-5p 3.467 down-regulation hsa-miR-146a-5p 3.332 up-regulation hsa-miR-6861-5p 3.457 down-regulation hsa-miR-501-5p 3.243 up-regulation hsa-miR-150-3p 3.302 down-regulation hsa-miR-654-3p 3.232 up-regulation hsa-miR-3687 3.261 down-regulation hsa-miR-193b-5p 3.220 up-regulation hsa-miR-5739 3.122 down-regulation hsa-miR-18a-5p 3.208 up-regulation hsa-miR-1247-3p 3.119 down-regulation hsa-miR-339-3p 3.043 up-regulation hsa-miR-6820-5p 3.041 down-regulation hsa-miR-542-5p 3.014 up-regulation hsa-miR-6716-5p 3.038 down-regulation hsa-miR-299-3p 3.005 up-regulation hsa-miR-6775-5p 2.971 down-regulation hsa-miR-151a-3p 2.986 up-regulation hsa-miR-4749-5p 2.968 down-regulation hsa-miR-199a-5p 2.942 up-regulation hsa-miR-3679-5p 2.960 down-regulation hsa-miR-30b-5p 2.891 up-regulation hsa-miR-4728-5p 2.921 down-regulation hsa-miR-382-5p 2.879 up-regulation hsa-miR-6769b-5p 2.822 down-regulation hsa-miR-379-5p 2.842 up-regulation hsa-miR-7106-5p 2.805 down-regulation hsa-miR-187-5p 2.797 up-regulation hsa-miR-7845-5p 2.794 down-regulation hsa-miR-376c-3p 2.795 up-regulation hsa-miR-4669 2.783 down-regulation hsa-miR-4443 2.701 up-regulation hsa-miR-4459 2.761 down-regulation hsa-let-7i-5p 2.680 up-regulation hsa-miR-937-5p 2.730 down-regulation hsa-miR-31-3p 2.618 up-regulation hsa-miR-6776-5p 2.730 down-regulation hsa-miR-378c 2.604 up-regulation hsa-miR-6819-5p 2.668 down-regulation hsa-miR-143-3p 2.576 up-regulation hsa-miR-8063 2.590 down-regulation hsa-miR-99a-5p 2.574 up-regulation hsa-miR-1202 2.585 down-regulation hsa-miR-34a-5p 2.543 up-regulation hsa-miR-6771-5p 2.573 down-regulation hsa-miR-210-3p 2.533 up-regulation hsa-miR-7114-5p 2.557 down-regulation hsa-miR-93-5p 2.523 up-regulation hsa-miR-6127 2.557 down-regulation hsa-miR-22-3p 2.523 up-regulation hsa-miR-6871-5p 2.440 down-regulation hsa-miR-320e 2.515 up-regulation hsa-miR-6743-5p 2.434 down-regulation hsa-miR-345-5p 2.510 up-regulation hsa-miR-5006-5p 2.415 down-regulation hsa-miR-493-3p 2.508 up-regulation hsa-miR-663b 2.410 down-regulation hsa-miR-411-5p 2.503 up-regulation hsa-miR-4687-3p 2.409 down-regulation hsa-miR-28-3p 2.489 up-regulation hsa-miR-197-3p 2.387 down-regulation hsa-miR-130b-3p 2.487 up-regulation hsa-miR-149-3p 2.370 down-regulation hsa-miR-362-5p 2.464 up-regulation hsa-miR-7162-3p 2.359 down-regulation hsa-miR-130a-3p 2.388 up-regulation hsa-miR-6799-5p 2.342 down-regulation hsa-miR-320d 2.364 up-regulation hsa-miR-6779-5p 2.340 down-regulation hsa-miR-19b-3p 2.336 up-regulation hsa-miR-6794-5p 2.340 down-regulation hsa-miR-3651 2.333 up-regulation hsa-miR-4507 2.324 down-regulation hsa-miR-140-3p 2.320 up-regulation hsa-miR-6132 2.316 down-regulation hsa-miR-27a-3p 2.299 up-regulation hsa-miR-6785-5p 2.291 down-regulation hsa-miR-425-5p 2.269 up-regulation hsa-miR-7112-5p 2.279 down-regulation hsa-miR-503-5p 2.233 up-regulation hsa-miR-197-5p 2.267 down-regulation hsa-miR-4269 2.220 up-regulation hsa-miR-4505 2.262 down-regulation hsa-miR-127-3p 2.214 up-regulation hsa-miR-6075 2.253 down-regulation hsa-miR-4429 2.208 up-regulation hsa-miR-6756-5p 2.236 down-regulation hsa-miR-1273g-3p 2.206 up-regulation hsa-miR-4492 2.198 down-regulation hsa-miR-106a-5p 2.197 up-regulation hsa-miR-328-5p 2.171 down-regulation hsa-miR-27b-3p 2.158 up-regulation hsa-miR-6802-5p 2.168 down-regulation hsa-miR-125b-1-3p 2.154 up-regulation hsa-miR-6869-5p 2.160 down-regulation hsa-miR-195-5p 2.148 up-regulation hsa-miR-4758-5p 2.131 down-regulation hsa-miR-151a-5p 2.117 up-regulation hsa-miR-504-3p 2.121 down-regulation hsa-miR-30a-3p 2.115 up-regulation hsa-miR-3937 2.116 down-regulation hsa-miR-106b-3p 2.092 up-regulation hsa-miR-5572 2.092 down-regulation hsa-miR-532-5p 2.083 up-regulation hsa-miR-3620-5p 2.038 down-regulation hsa-miR-660-5p 2.080 up-regulation hsa-miR-3124-5p 2.028 down-regulation hsa-miR-138-5p 2.044 up-regulation hsa-miR-3141 2.026 down-regulation hsa-miR-20a-5p 2.043 up-regulation hsa-miR-4485 2.023 down-regulation hsa-miR-185-5p 2.031 up-regulation hsa-miR-4649-5p 2.002 down-regulation hsa-miR-152-3p 2.017 up-regulation

<Experimental Example 3> In Vitro Anti-Inflammatory Effects of MSC-NVs

[0132] It is well known that MSCs and MSC-derived intracellular contents exhibit a potent anti-inflammatory effect. Accordingly, the anti-inflammatory effects of BMSC-NVs and ASC-NVs were examined before PREY transfection (FIG. 7A). Murine monocytes/macrophages (RAW264.7 cells) were treated with MSC-NVs to inhibit the inflammatory responses thereof. The effective cellular uptake of MSC-NVs by the activated macrophages was confirmed by visualizing the cells and MSC-NVs with DiO and DiI, respectively (FIG. 7B). Similar uptake of both ASC-NV and BMSC-NV by the activated macrophages was shown.

[0133] The anti-inflammatory activity of BMSC-NVs, ASC-NVs, and PMSC-NVs was analyzed by qRT-PCR (FIG. 7C), dot blot cytokine array (FIG. 7D), and phagocytosis array (FIG. 7E). The gene expression of anti-inflammatory interleukin-(IL-10) and IL-13 was upregulated, but that of pro-inflammatory markers (IL-10 and TNF-α) was not, indicating that the anti-inflammatory potential of macrophages by MSC-NVs was maintained even after extrusion from MSCs. These results were also supported by analysis showing an anti-inflammatory effects by cytokines secreted from conditioned media (FIG. 7D) and decreased phagocytic activity of bacterial components in all NV-treated groups (FIG. 7E). Oil red O staining for detecting the uptake level of oxidized LDL (FIG. 7E, lower panel) confirmed the reduction in oxidized LDL uptake in all MSC-NVs except BMSC-NV, supporting the inhibitory effects of ASC-NV and PMSC-NV on foam cells. The foam cell formation of macrophages caused by the uptake of oxidized LDL is a critical part in atherosclerosis development since phenotypic changes and internal growth of VSMCs are induced. These results show that MSC-NVs can prevent the atherosclerosis process.

<Experimental Example 4> In Vitro Pro-EC Recovery Effects of MSC-NV

[0134] The EC-recovery effects of MSC-NV treatment was examined by activating the pro-inflammatory dysfunction of immortalized murine aortic endothelial cells (iMAEC) by LPS treatments (FIG. 8A). The effective internalization of both ASC-NVs and BMSC-NVs into activated iMAECs was visualized by labeling with DiO and DiI, respectively (FIG. 8B). There was no visible difference in NV uptake between ASC-NVs and BMSC-NVs. ECs dominantly express E-selectin, ICAM-1, and VCAM-1, and they recruit inflammatory cells upon dysfunction activation. Accordingly, when the gene expression of these markers in iMAECs is detected by qRT-PCR (FIG. 8C), both were upregulated by LPS treatments, but the gene expression significantly downregulated by treatments with both MSC-NV types or even without treatment, indicating the effective induction of EC dysfunction by 100 ng/mL of LPS as well as the promising EC-recovery effects of both MSC-NV types. This result was also supported by VCAM-1 protein expression through immunostaining since VCAM-1 is one of the initial endothelial dysfunction markers (FIG. 8D). The pro-EC repair effect was not significantly different among ASC-NVs, BMSC-NVs and PMSC-NVs (FIGS. 9 and 10), indicating that PREY transfection does not impair the therapeutic effects of MSC-NVs.

[0135] Cyclosporin A (CyA) treatments are known to disturb angiogenesis by inhibiting angiogenic EC activity. Therefore, the pro-angiogenic (FIG. 9) and pro-EC recovery (FIG. 8E) effects of MSC (BMSC vs. ASC)-NVs were examined by culturing human umbilical vein endothelial cells (HUVECs) on Matrigel and treating them with CyA and NVs 2 hours (FIG. 9) or 12 hours (FIG. 8E) after seeding. Subsequently, vasculature factors (that is, junctions, master segments, total length, and the number of extreme nodes) of HUVECs were measured. As a result, MSC-NV treatments enhanced the pro-EC recovery and pro-angiogenic effects of HUVECs in response to CyA treatments regardless of an MSC source. In addition, the consistency of the pro-EC recovery and pro-angiogenic effects of PMSC-NVs in HUVECs was confirmed upon CyA treatments at 12 hours and 2 hours after seeding. respectively (FIG. 10).

<Experimental Example 5> In Vivo Targeting and Anti-Atherosclerotic Function

[0136] The theragnostic efficiency of PMSC-NVs was determined in a murine PCL model. As three of four left carotid artery (LCA) branches, i.e., the external carotid artery (ECA), internal carotid artery (ICA), and occipital artery (OA) were ligated (FIG. 11), the formation of a disturbed blood flow was confirmed by Doppler ultrasound imaging (FIG. 12). Subsequently, MSC-NVs, PMSC-NVs, and PMSCs were intravenously injected into the tail vein for three days after ligation. An in vivo imaging system (IVIS) was used to visualize the distribution of MSC-NVs, PMSC-NVs, and PMSCs in the body at 24 hours after injection (FIG. 13A-B, FIG. 14). The LCA-targeting efficiency of PMSC-NVs was higher than that of MSC-NVs or PMSCs, indicating the synergistic roles of PREY and NV to disturb the pulmonary capillary entrapment of cells and effectively target disturbed blood flow sites. Pulmonary capillary entrapment is the major obstacle for systemic cell delivery. The inventors identified filamin A as a target molecule of PREY through a previous proteomic analysis. The RCA and LCA were obtained and immunostained 24 hours after injection (FIG. 13C). Filamin A expression was significantly higher in the LCA than in RCA, confirming its overexpression at the disturbed blood flow site for PMSC recruitment. Among the test groups in which NVs were labeled with Vivotrack680, only PMSC-NVs were clearly co-internalized with filamin A.

[0137] Since the anti-inflammatory and pro-EC recovery effects of MSC-NVs (FIGS. 7A to E, FIGS. 8A to E, FIG. 9 and FIG. 10) and the PREY targeting efficiency (FIG. 13A to C) had been demonstrated, it was hypothesized that their combination (PMSC-NV) can exhibit a synergistic theragnostic effects that prevent early progression of atherosclerosis. ApoE KO mice that underwent PCL surgery were used for this part of this experiment. This is because this mouse strain showed more aggressive atherosclerosis development compared with the corresponding normal strain (FIG. 15). When the LCA and RCA were obtained from the ApoE KO PCL model 11 days after NV injection, PMSC-NVs maintain a similar vascular form to a normal control and effectively prevent angiogenesis, but other test groups did not show clear therapeutic effects (top row of FIG. 13D). Meanwhile, since the dose of PMSCs was not sufficient for allowing effective targeting, angiogenesis could not be effectively prevented in comparison with PMSC-NVs (FIG. 13B). Protein expression levels of CD68 (middle row of FIG. 13D) and VCAM-1 (bottom row of FIG. 13D) were determined as indications of monocyte recruitment and EC activation, respectively. When PMSC-NVs were treated, their expression level decreased to that of the control without exhibiting visible toxic effects in the heart, lungs, liver, and spleen after systemic circulation (FIG. 16). In contrast, the other test groups exhibited significantly higher expression of markers compared to those of the normal controls and PMSC-NV groups.

<Experimental Examples 6> In Vivo Porcine PCL and In Vitro Human EC Models

[0138] As a pre-clinical large animal model, a porcine PCL model was used to confirm the targeting efficiency of PMSC-NVs for disturbed blood flow sites according to a previously established method. Briefly, a stainless-steel rod (diameter=0.9 mm) was tightly ligated to the LCA (diameter=4.5 mm) and then removed (top, FIG. 17A), inducing 70 to 80% LCA occlusion (bottom, FIG. 17B). Clear formation of a disturbed blood flow at the distal part of the ligated LCA was confirmed by Doppler ultrasound imaging (FIG. 17B). In addition, filamin A was highly expressed in the endothelium of the LCA compared to the RCA (FIG. 17C). Vivotrack680-labeled MSC-NVs or PMSC-NVs were intravenously administered through the ear vein, and systemically circulated for 3 days after ligation. The RCA, LCA, and aortic arch were harvested from tissue samples of normal, induced disturbed blood flow, and naturally disturbed blood flow sites 24 hours or 21 hours after NV injection. The naturally disturbed blood flow is formed in an aortic arch due to its curvature and branching structure. IVIS images demonstrated that PMSC-NVs are highly accumulated in the distal region of the ligation point of the LCA, which is an indicator of pathogenic remodeling, but they were not observed in the RCA (FIG. 17D, left of FIG. 18). In the aortic arch samples, the IVIS fluorescence distribution of PMSC-NVs was highly correlated with the disturbed blood flow sites compared with MSC-NVs, indicating the effective targeting function of PREY (FIG. 17F, right of FIG. 18), which was supported by the greater co-existence of CD31 with PMSC-NVs than MSC-NVs (FIGS. 17E and 17G).

[0139] Finally, under a disturbed blood flow, the efficiency of PMSC-NV targeting hCAECs (FIGS. 19A to G) and human aortic ECs (hAECs; FIG. 20) were detected using an in vitro microfluidic model. In the microfluidic model, the EC monolayer attached to a collagen-coated glass surface was exposed to a medium flow generated by a pumping system, which successfully mimics blood flow under a healthy or atherosclerotic condition. In addition, the microfluidic system enables precise observation of target sites as well as the targeting efficiency of PMSC-NVs, which is difficult to achieve in an in vivo experiment. To mimic healthy and atherosclerotic conditions of blood vessels, ECs were exposed to normal (10 dyne/cm.sup.2) or disturbed blood flow (10 dyne/cm.sup.2 and −9 dyne/cm.sup.2 with 1 Hz pulse) (FIGS. 19A to C) before MSC-NV treatments. It was confirmed that ECs exposed to normal flow were aligned to the flow direction, whereas ECs exposed to disturbed blood flow were not (FIG. 19D). In addition, filamin A expression increased under a disturbed blood flow (FIG. 19E), whereas F-actin expression was similar between ECs exposed to normal flow and disturbed blood flow (FIG. 19F). More importantly, it was revealed that, in the microfluidic model, the signals of PMSC-NVs increased under a disturbed blood flow condition (FIG. 20), compared with the normal flow condition, due to high coexistence with filamin A, proving the theragnostic potential of PMSC-NVs in clinical interpretation.

[0140] As above, as specific parts of the present invention have been described in detail, although it is clear to those skilled in the art that this specific technique is merely a preferred embodiment, the scope of the specification is not limited thereto.

INDUSTRIAL APPLICABILITY

[0141] Since stem cell-derived nanovesicles using a peptide capable of targeting a disturbed blood flow site according to the present invention provide potent anti-inflammatory and pre-endothelial recovery effects similar to mesenchymal stem cells as an anti-atherosclerosis theragnostic platform, they are expected to be effectively used in related medical industry as a novel theragnostic agent for preventing and treating atherosclerosis.