Treatment for Inflammatory Bowel Disease and Radiation-induced Intestinal Injury
20220273763 · 2022-09-01
Assignee
- Ohio State Innovation Foundation (Columbus, OH)
- DAPING HOSPITAL, ARMY MEDICAL UNIVERSITY (Chongqing, CN)
- Institute Of Microbiology, Chinese Academy Of Sciences (Beijing, CN)
Inventors
- Jianjie MA (POWELL, OH, US)
- Chunyu Zeng (Chongqing, CN)
- Yu Han (Chongqing, CN)
- Donghai YANG (Chongqing, CN)
- Zhengfang GONG (Chongqing, CN)
- Zhongshu ZHOU (Chongqing, CN)
- Jin ZHONG (Chongqing, CN)
Cpc classification
A61K2035/11
HUMAN NECESSITIES
A23L33/40
HUMAN NECESSITIES
A61P1/04
HUMAN NECESSITIES
C12N15/74
CHEMISTRY; METALLURGY
A61P17/02
HUMAN NECESSITIES
A23V2002/00
HUMAN NECESSITIES
A61K9/0053
HUMAN NECESSITIES
A61P1/00
HUMAN NECESSITIES
International classification
A23L33/00
HUMAN NECESSITIES
A23L33/135
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
Abstract
Compositions for and methods of treating irritable bowel disease are provided. The compositions and methods employ MG53, which can be in the form of recombinant human MG53. The MG53 can be administered in a form to avoid or bypass gastric digestion or degradation. The composition can include a live MG53-expressing microbe, such as a probiotic composition that expresses MG53 in the gastrointestinal tract of a subject. An enteric release composition comprising MG53 is also provided.
Claims
1. A method of treating and/or preventing IBD or radiation induced intestinal injury comprising administering to a subject an effective amount of a) a composition comprising MG53; b) a composition comprising live MG53-expressing microbe; or c) a probiotic composition comprising live MG53-expressing microbe.
2. The method of claim 1, wherein said composition is an enteric release composition, probiotic composition, food supplement, health supplement, healthcare product, dosage form, medicament, food, or food additive.
3. The method of claim 1, wherein said method is a method of reducing the occurrence of and/or reducing the severity of symptoms associated with IBD or radiation induced intestinal injury.
4. The method of claim 3, wherein said composition is an enteric release composition, probiotic composition, food supplement, health supplement, healthcare product, dosage form, medicament, food, or food additive.
5. A probiotic composition comprising a safe and non-antigenic MG53-expressing probiotic microbe that expresses MG53 in the GI tract of a subject after said subject is orally administered said probiotic microbe.
6. The probiotic composition of claim 5, wherein said MG53-expressing probiotic microbe is genetically-modified probiotic microbe selected from the group consisting of genetically-modified bacteria, genetically-modified yeast, or combination thereof.
7. The probiotic composition of claim 6, wherein said genetically-modified probiotic microbe comprises an MG53-gene expression vector, and said microbe expresses and secretes human MG53 protein.
8. The probiotic composition of claim 5, wherein said composition is an enteric release composition, food supplement, health supplement, healthcare product, dosage form, medicament, food, or food additive.
9. A method of forming MG53 in the gastrointestinal tract of a subject, the method comprising administering to said subject the probiotic composition of claim 5.
10. The method of claim 9 further comprising administering to said subject exogenous MG53.
11. The method of claim 9, wherein said composition is an enteric release composition, food supplement, health supplement, healthcare product, dosage form, medicament, food, or food additive.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0028] The following drawings are part of the present specification and are included to further demonstrate certain aspects of the invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of the specific embodiments presented herein.
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
DETAILED DESCRIPTION OF THE INVENTION
[0055] Hereinafter, preferred embodiments of the present invention will be described in detail with reference to the accompanying drawings.
[0056] MG53 protein (also referred to as mitsugumin 53 or TRIM72) is known in the art. Unless specified otherwise, all embodiments of the invention comprising or employing “MG53” include all known forms of MG53. It also refers to recombinant human MG53 (rhMG53). As used herein and unless otherwise specified, the term MG53 (or MG53 protein) refers to the MG53 protein present as the native form, optimized form thereof, mutant thereof, derivative thereof or a combination of any two or more of said forms. Native MG53 contains 477 amino acids that are well conserved in different animal species. Methods of preparing and/or isolating MG53 are known: U.S. Pat. No. 7,981,866, WO2008/054561, WO2009/073808, US2011/0202033, US2011/0287004, US2011/0287015, US2013/0123340, WO2011/142744, WO2012/061793, U.S. Pat. Nos. 8,420,338, 9,139,630, 9,458,465, 9,494,602, US2014/0024594, WO2012/134478, WO2012/135868, US2015/0110778, WO2013/036610, US2012/0213737, WO2016/109638, the entire disclosures of which, including sequence information therein, are hereby incorporated by reference.
[0057] The sequence listing information for native MG53, and variants or various forms thereof, is disclosed in U.S. Pat. Nos. 7,981,866 and 9,139,630, the entire disclosures of which, including sequence information therein, are hereby incorporated by reference. The sequence listing information for a cDNA that encodes optimized native human MG53, or a fragment thereof, is disclosed in U.S. Pat. No. 9,139,630, the entire disclosure of which, including sequence information therein, is hereby incorporated by reference.
[0058] As used herein in reference to MG53, the term “mutant” means a recombinant form of MG53 having an amino acid change (replacement) of one, two, three or more amino acids in the amino acid sequence of native MG53. Mutant forms of MG53 and methods of preparing the same are known: US2015/0361146, EP3118317, WO2015/131728, U.S. Pat. No. 9,139,630, the entire disclosures of which, including sequence information therein, are hereby incorporated by reference.
[0059] As used herein the term “endogenous MG53”, refers to MG53 present in a subject prior to treatment with a composition or method according to the invention. As used herein, exogenous MG53 is nonendogenous MG53.
[0060] As used herein, nisin refers to a polycyclic antibacterial peptide produced by the bacterium Lactococcus lactis. It has 34 amino acid residues, including the uncommon amino acids lanthionine (Lan), methyllanthionine (MeLan), didehydroalanine (Dha), and didehydroaminobutyric acid (Dhb).
[0061] As used herein, the term “prebiotic” refers to a material in food that induces the growth or activity of beneficial microorganism such as bacteria and fungi. A prebiotic can be found in food or can be added to a composition of the invention. Dietary prebiotics are typically nondigestible fiber compounds that pass undigested through the upper part of the GI and stimulate the growth or activity of advantageous bacteria that colonize the large bowel (colon) by acting as a substrate for them. Prebiotics typically include plant derived carbohydrates, fructans, galactans, fructooligosaccharides, inulins, galactooligosaccharides, resistant starch, pectin, beta-glucans, xylooligosaccharides.
[0062] The invention relates to medicinal use of the protein MG53. Recombinant human MG53 secreted by micrococcus acidi lactici is used for the preparation of drugs, pharmaceutical compositions, foods, healthy products, food additives and the like for preventing and/or treating inflammatory bowel diseases. The recombinant human MG53 has excellent preventive (prophylactic) and therapeutic effect for treatment of IBD, including ulcerative colitis or Crohn disease. The composition of the invention is free of toxicity or side effects and can be durably and effectively applied to the preparation of drugs, pharmaceutical compositions, foods, healthy products or food additives for preventing and/or treating the inflammatory bowel diseases. The compositions, foods, healthy products or food additives described herein can be used for preventing and treating the inflammatory bowel diseases to provide a substantial clinical benefit.
[0063] The present inventors have unexpectedly discovered that administration of MG53 to the gastrointestinal tract or administration of a MG53-expressing material to the gastrointestinal tract is effective for the treatment of irritable bowel disease (IBD) and inflammatory symptoms associated with IBD. As used herein, IBD is intended to include, by way of example and without limitation, any disease or disorder causing inflammation of gastrointestinal tissue. In some embodiments, said inflammation includes inflammation of any GI tissue from the mouth to the anus. In particular embodiments, the tissue is the small intestine, colon, and/or rectum. More particularly, IBD includes ulcerative colitis and Crohn's disease.
[0064] A mouse model for ulcerative colitis was developed (Example 1) for use in evaluating the effect of MG53 upon the condition. After being treated with DSS to induce IBD, MG53 knockout mice exhibit reduced MG53 content in blood/serum (
[0065] Wild-type and MG53 knockout mice were evaluated for bodyweight loss, disease activity index and survival rate after being treated with DSS to induce IBD. It was determined that WT mice exhibit reduced bodyweight loss (
[0066] The impact of MG53 treatment upon DSS-induced IBD was evaluated in C57 mice. Regarding bodyweight loss (
[0067] For the Crohn's disease model (Example 4), BALB/c mice were treated TNBS to induce symptoms similar to Crohn's disease. The TNBS-treated mice were then treated MG53, which resulted in improved survival rate (
[0068] Based upon the above in vivo findings, the inventors have determined that MG53 is therapeutically effective at treating IBD characterized as either ulcerative colitis or Crohn's disease when it is administered to a mammal. Systemic or local modes of administration are suitable.
[0069] Since MG53 can be degraded by proteases in the GI tract or by the acidic conditions of the stomach, we invented a probiotic composition whereby a safe microbe is engineered to express MG53. The probiotic composition is then administered orally (perorally) to a subject such that the microbe expresses MG53 in the GI tract of a subject.
[0070] Lactobacillus bacteria was genetically engineered as described in Example 5 to include a plasmid that induces expression of MG53. A food-grade expression vector pNZ8148 was ligated to the MG53 gene, wherein the ligation site is depicted in
[0071] For the ulcerative colitis model (Example 6), C57 mice were divided into four groups according to what they were administered: water (control); DSS (DSS group); normal lactobacillus (which does not express MG53; NZ9000−VC+DSS); and engineered lactobacillus that expresses and secretes MG53 (NZ9000−TRIM72+DSS). Administration of the engineered lactobacillus substantially improved survival rate in mice that had also been treated with DSS (
[0072] For the Crohn's disease model (Example 7), C57 mice were divided into four groups according to what they were administered: water (control); TNBS (TNBS group); normal lactobacillus (which does not express MG53; NZ9000−VC+TNBS); and engineered lactobacillus that expresses and secretes MG53 (NZ9000−TRIM72+TNBS). Administration of the engineered lactobacillus substantially improved survival rate in mice that had also been treated with TNBS (
[0073] The above in vivo data evidences the efficacy of the probiotic composition of the invention. The invention thus provides a therapeutically effective probiotic composition comprising a genetically engineered microbe that expresses and secretes MG53 and use of said probiotic composition for treating IBD following oral administration of said probiotic composition.
[0074] As another means of providing MG53 to the intestinal tract down stream of the stomach, an enteric release (ER) composition comprising MG53 was developed (Examples 8 and 9). The ER composition comprises MG53, an enteric release pharmaceutical excipient, and a cyclodextrin. In particular embodiments, the ER composition comprises MG53, at least one enteric release polymer, and at least one cyclodextrin derivative.
[0075] In particular embodiments, the enteric release polymer is a copolymer of methacrylic acid and methyl methacrylate. In particular embodiments, the enteric release polymer has a dissolution pH of ≥about 5, ≥about 5.5, ≥about 6, ≥about 6.5, or ≥about 7.
[0076] In particular embodiments, the cyclodextrin derivative is water soluble. In particular embodiments, the cyclodextrin derivative is hydroxypropyl-beta-cyclodextrin.
[0077] The MG53 release profile for the ER composition was determined according to Example 10. The ER composition exhibits a typical ER profile. MG53 release began at a pH above 6, above 6.5, above 7 or above 7.5.
[0078] The therapeutic efficacy of the ER composition was evaluated in the ulcerative colitis model according to Example 12. The data indicate that MG53-containing ER composition provides reduced bodyweight loss (
[0079] In order to determine a potential mechanism for its, MG53 was fluorescence-labeled with FITC (FITC-MG53) according to Example 13. DSS-treated mice were administered the FITC-MG53 or FITC label (with no protein attached). The data (
[0080] Another aspect of the protective action of MG53 was elucidated (Example 140. Enteroids formed from primary stem cells derived from C57BL6/J mice were treated with DSS, which led to the reduction of budding enteroids. When DSS-treated enteroids were then treated with MG53, there was a significant increase in the number of budding enteriods indicating the ability of MG53 to protect stem cells from DSS-induced damage.
[0081] Accordingly, the invention provides a method of protecting intestinal stem cells, the method comprising administering an effective amount of MG53.
[0082] Another probiotic composition according to the invention was prepared according to Example 15. The respective expression module of MG53 was inserted into the genomic DNA of lactobacilli (
[0083] The engineered lactobacillus was evaluated in the ulcerative colitis model using DSS-treated mice according to Example 16. The data (
[0084] The ability of MG53 to protect against other forms of damage to colonic tissue was further evaluated according to Example 17. Mice were treated with saline or MG53 in saline (tail vein injection) and irradiated with X-rays. The data indicate that irradiation caused shortening of the colon, which was partially mitigated by rhMG53 treatment (
[0085] The amount of probiotic administered to a subject may vary widely. In general, the probiotic composition (MG53-expressing microbe) will secrete at least about 1 ng of MG53/2×10.sup.8 CFU of microbe to about 1 ng of MG53/2×10.sup.9 CFU of microbe.
[0086] Suitable concentrations of MG53 in a dosage form include at least 1 ng of MG53/ml, at least 5 ng of MG53/ml, at least 10 ng of MG53/ml, at least 25 ng of MG53/ml, at least 50 ng of MG53/ml, at least 75 ng of MG53/ml, at least 100 ng of MG53/ml, at least 250 ng of MG53/ml, at least 500 ng of MG53/ml, at least 750 ng of MG53/ml, at least 1 μg of MG53/ml, at least 5 μg of MG53/ml, at least 10 μg of MG53/ml, at least 15 μg of MG53/ml, at least 20 μg of MG53/ml, at least 25 μg of MG53/ml, at least 30 μg of MG53/ml, at least 50 μg of MG53/ml, or at least 100 μg of MG53/ml. Higher concentrations are also acceptable, particularly in view the efficacy dose-response trend observed for MG53. These doses can be administered on a frequency as described herein or as determined to be most effective.
[0087] Suitable doses of MG53 that can be administered to a subject in one or more dosage forms include at least 1 ng of MG53, at least 5 ng of MG53, at least 10 ng of MG53, at least 25 ng of MG53, at least 50 ng of MG53, at least 75 ng of MG53, at least 100 ng of MG53, at least 250 ng of MG53, at least 500 ng of MG53, at least 750 ng of MG53, at least 1 μg of MG53, at least 5 μg of MG53, at least 10 μg of MG53, at least 15 μg of MG53, at least 20 μg of MG53, at least 25 μg of MG53, at least 30 μg of MG53, at least 50 μg of MG53, or at least 100 μg of MG53. Such doses can be on a total body weight basis or a per kg of body weight basis.
[0088] The dose of exogenous MG53 can be as low as about 1 up to about 1000 microg per kg of body weight.
[0089] The amount of therapeutic compound (MG53) incorporated in each dosage form will be at least one or more unit doses and can be selected according to known principles of pharmacy. An effective amount of therapeutic compound is specifically contemplated. By the term “effective amount”, it is understood that, with respect to, for example, pharmaceuticals, a pharmaceutically (therapeutically) effective amount is contemplated. A pharmaceutically effective amount is the amount or quantity of a drug or pharmaceutically active substance which is sufficient to elicit the required or desired therapeutic response, or in other words, the amount which is sufficient to elicit an appreciable biological response when administered to a patient.
[0090] The term “unit dosage form” is used herein to mean a dosage form containing a quantity of the drug, said quantity being such that one or more predetermined units may be provided as a single therapeutic administration.
[0091] The dosage form is independently selected at each occurrence from the group consisting of liquid solution, suspension, tablet, capsule, sachet or powder.
[0092] Compositions and dosage forms of the invention can further comprise one or more pharmaceutically acceptable excipients. Dosage forms can comprise one or more excipients independently selected at each occurrence from the group consisting of acidic agent, alkaline agent, buffer, tonicity modifier, osmotic agent, water soluble polymer, water-swellable polymer, thickening agent, complexing agent, chelating agent, penetration enhancer. Suitable excipients include U.S.F.D.A. inactive ingredients approved for use in parenteral or oral formulations (dosage forms), such as those listed in the U.S.F.D.A.'s “Inactive Ingredients Database (available on the following website: www.fda.gov/Drugs/InformationOnDrugs/ucm113978.htm; October 2018), the entire disclosure of which is hereby incorporated by reference.
[0093] As used herein, an acidic agent is a compound or combination of compounds that comprises an acidic moiety. Exemplary acidic agents include organic acid, inorganic acid, mineral acid and a combination thereof. Exemplary acids include hydrochloric acid, hydrobromic acid, sulfuric acid, sulfonic acid, sulfamic acid, phosphoric acid, or nitric acid or others known to those of ordinary skill; and the salts prepared from organic acids such as amino acids, acetic acid, propionic acid, succinic acid, glycolic acid, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, pamoic acid, maleic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, sulfanilic acid, 2-acetoxybenzoic acid, fumaric acid, toluenesulfonic acid, methanesulfonic acid, ethane disulfonic acid, oxalic acid, isethionic acid, others acids known to those of ordinary skill in the art, or combinations thereof.
[0094] As used herein, an alkaline agent is a compound or combination of compounds that comprises an alkaline moiety. Exemplary alkaline agents include primary amine, secondary amine, tertiary amine, quaternary amine, hydroxide, alkoxide, and a combination thereof. Exemplary alkaline agents include ammonia solution, ammonium carbonate, diethanolamine, monoethanolamine, potassium hydroxide, sodium borate, sodium carbonate, sodium bicarbonate, sodium hydroxide, triethanolamine, diethanolamine, monobasic phosphate salt, dibasic phosphate salt, organic amine base, alkaline amino acids and trolamine, others known to those of ordinary skill in the art, or combinations thereof.
[0095] Exemplary excipients (inactive ingredients as defined by the U.S.F.D.A.) that can be included in dosage forms of the invention include, by way of example and without limitation, water, benzalkonium chloride, glycerin, sodium hydroxide, hydrochloric acid, boric acid, hydroxyalkylphosphonate, sodium alginate, sodium borate, edetate disodium, propylene glycol, polysorbate 80, citrate, sodium chloride, polyvinylalcohol, povidone, copovidone, carboxymethylcellulose sodium, Dextrose, Dibasic Sodium Phosphate, Monobasic Sodium Phosphate, Potassium Chloride, Sodium Bicarbonate, Sodium Citrate, Calcium Chloride, Magnesium Chloride, stabilized oxychloro complex, Calcium Chloride Dihydrate, Erythritol, Levocarnitine, Magnesium Chloride Hexahydrate, Sodium Borate Decahydrate, Sodium Citrate Dihydrate, Sodium Lactate, Sodium Phosphate (Mono- and Dibasic-), Polyethylene Glycol 400, Hydroxypropyl Guar, Polyquaternium-1, Zinc Chloride, white petrolatum, mineral oil, hyaluronic acid, artificial tear, or combinations thereof.
[0096] One or more antioxidants can be included in a composition of dosage form of the invention. Exemplary antioxidants include SS-31, NAC, glutathione, selenium, vitamin A, vitamin C, vitamin E, co-enzyme Q10, resveratrol, other GRAS antioxidant, or a combination of two or more thereof.
[0097] One or more zinc salts can be included in a composition or dosage form of the invention. Such zinc salt(s) may also be administered to a subject receiving exogenous MG53 or expressed MG53. Pharmaceutically acceptable zinc salts include Zinc gluconate, Zinc acetate, Zinc sulfate, Zinc picolinate, Zinc orotate, Zinc citrate, and other such salts comprising a zinc cation and organic or inorganic anion(s).
[0098] It should be understood, that compounds used in the art of pharmaceutical formulations generally serve a variety of functions or purposes. Thus, if a compound named herein is mentioned only once or is used to define more than one term herein, its purpose or function should not be construed as being limited solely to that named purpose(s) or function(s).
[0099] As used herein, “pharmaceutically acceptable salts” refer to derivatives of the disclosed compounds wherein the compound is modified by making an acid or base salt thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and others known to those of ordinary skill. The pharmaceutically acceptable salts can be synthesized from the parent therapeutic compound which contains a basic or acidic moiety by conventional chemical methods. Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, the disclosure of which is hereby incorporated by reference.
[0100] The phrase “pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
[0101] MG53 can be used in cotherapy or adjunctive therapy with one or more other active ingredients to treat IBD. Exemplary suitable active ingredients include, among others, U.S.F.D.A. approved drugs for oral (peroral) dosage forms.
[0102] Other active ingredients that can be used in cotherapy or adjunctive therapy with MG53 include, by way of example and without limitation, antibiotics (ciprofloxacin (Cipro) and metronidazole (Flagyl), aminosalicylates (5-ASAs), corticosteroids (steroids), immune modifiers (immunomodulators), biologic therapies (biologics), Anti-inflammatories include corticosteroids and aminosalicylates, such as mesalamine (Asacol HD, Delzicol, others), balsalazide (Colazal) and olsalazine (Dipentum), Anti-diarrheal medications, Pain relievers, iron, calcium and vitamin D supplement or combinations thereof.
[0103] The therapeutically acceptable dose, maximum tolerated dose (MTD), and minimally effective dose (MED) for each of said active ingredients is well known and set forth in the respective U.S.F.D.A. approved product package insert for each said active ingredients.
[0104] A composition, dosage form or formulation of the invention can include one, two or more active ingredients in combination with MG53. The dose of each said active ingredient in said composition, dosage form or formulation of the invention will be a therapeutically effective dose including and above the MED and including and below the MTD.
[0105] In some embodiments, the combination treatment of MG53 with another active ingredient provides at least additive therapeutic efficacy. In some embodiments, said combination provides synergistic therapeutic efficacy. In some embodiments, MG53 reduces the occurrence of, reduces the level of, or eliminates adverse events caused by the other active ingredient.
[0106] The acceptable concentrations of said excipients are well known in the art and specific concentrations (amounts) thereof are set forth in the package insert or package label of known commercial products containing the same.
[0107] It should be understood, that compounds used in the art of pharmaceutics may serve a variety of functions or purposes. Thus, if a compound named herein is mentioned only once or is used to define more than one term herein, its purpose or function should not be construed as being limited solely to that named purpose(s) or function(s).
[0108] In the examples below, ranges are specified for the amount of each ingredient. Ranges including “0” as the lowest value indicate an optional ingredient. The lower limit “>0” indicates the respective material is present.
[0109] As used herein, the terms “about” or “approximately” are taken to mean a variation or standard deviation of ±10%, ±5%, or ±1% of a specified value. For example, about 20 mg is taken to mean 20 mg±10%, which is equivalent to 18-22 mg.
[0110] As used herein, the term “prodrug” is taken to mean a compound that, after administration, is converted within a subject's body, e.g. by metabolism, hydrolysis, or biodegradation, into a pharmacologically active drug. The prodrug may be pharmacologically active or inactive. For example, a prodrug of MG53 (native or mutant) would be converted to the native form or mutant form, respectively, of MG53. The term “precursor” may also be used instead of the term “prodrug”.
[0111] As used herein, the term “derivative” is taken to mean: a) a chemical substance that is related structurally to a first chemical substance and theoretically derivable from it; b) a compound that is formed from a similar first compound or a compound that can be imagined to arise from another first compound, if one atom of the first compound is replaced with another atom or group of atoms; c) a compound derived or obtained from a parent compound and containing essential elements of the parent compound; or d) a chemical compound that may be produced from first compound of similar structure in one or more steps. For example, a derivative may include a deuterated form, oxidized form, dehydrated, unsaturated, polymer conjugated or glycosilated form thereof or may include an ester, amide, lactone, homolog, ether, thioether, cyano, amino, alkylamino, sulfhydryl, heterocyclic, heterocyclic ring-fused, polymerized, pegylated, benzylidenyl, triazolyl, piperazinyl or deuterated form thereof.
[0112] In the examples below, ranges are specified for the amount of each ingredient. Ranges including “0” as the lowest value indicate an optional ingredient. Compositions with quantities of ingredients falling within the compositional ranges specified herein were made. Compositions of the invention comprising quantities of ingredients falling within the compositional ranges specified herein operate as intended and as claimed.
[0113] In view of the above description and the examples below, one of ordinary skill in the art will be able to practice the invention as claimed without undue experimentation. The foregoing will be better understood with reference to the following examples that detail certain procedures for the preparation and use of compositions according to the present invention. All references made to these examples are for the purposes of illustration. The following examples should not be considered exhaustive, but merely illustrative of only a few of the many embodiments contemplated by the present invention. The methods described herein can be followed to prepare and use compositions of the invention and to practice methods of the invention.
[0114] MG53 was kindly provided by TRIM-edicine, Inc. (1275 Kinnear RD, Columbus Ohio 43212-1155, U.S.A.).
Example 1
Preparation of an Ulcerative Colitis Model
[0115] All the animals in the experiment were provided with male C57BL/6 mice by the Experimental Animal Center of Daping Hospital of the Military Medical University, weighing 22-25 g. The surgical operation during the experiment was in accordance with the regulations of the experimental animals of the Army Military Medical University. Mice were randomly divided into the control group and the model group. The control group was given normal sterilized water. The model group was free to drink 4% dextran sulfate sodium (DSS) for 7 days, and the changes in the body signs were observed. On the 8th day of modeling, blood was collected from the eyelids of each group, and the supernatant serum was collected by centrifugation at 5000 rpm for 10 minutes. The colon-extracted tissue sample protein was preserved at 80 degrees and fixed in 4% paraformaldehyde. The protein samples were routinely extracted and quantified by paraffin, embedded in paraffin, and used for the detection of MG53 content and localization in tissue samples. The detection method of serum MG53 content was disclosed (Chinese patent application publication No. CN103430023A). The results are depicted in
Example 2
Preparation of MG53 Knockout Mouse Ulcerative Colitis Model
[0116] The MG53 knockout mice (kindly provided by Professor Ma Jianjie of TRIM-edicine, Inc.) from the SPF level of the Experimental Animal Center of Daping Hospital of the Army Military Medical University weighed 22 to 25 g. The experiment was conducted in accordance with the regulations of the experimental animals of the Army Military Medical University. Mice were randomly divided into a normal group, a model group (4% DSS), and a MG53 knock-out mouse model group (4% DSS). Except for the normal control group, the other two groups were free to drink 4% dextran sulfate sodium (DSS) for 7 days and then switched to mono-distilled water and continued to drink freely for 7 days. The body weight, disease activity index, and survival rate were continuously observed.
[0117] The disease activity index of mice with ulcerative colitis model accurately quantifies the severity of inflammatory bowel disease by disease activity index (DAI). The score is: body mass index (weight is 0, drop 1%-5% is 1 point, decrease 5%-10% is 2 points, 10%-15% is 3 points, the drop is greater than 15% is 4 points), stool trait score (normal 0, loose 2 points, diarrhea 4 points) and stool bleeding score (Normal 0 points, 2 points for recessive bleeding, and 4 points for dominant bleeding). DAI score=(body mass index+stool trait score+stool bleeding score)
[0118] The results of MG53 knockout mice with ulcerative colitis model body weight, disease activity index, and survival rate are shown in
Example 3
Determination of the Protective Effect of rhMG53 Against DSS-Induced Ulcerative Colitis in Mouse Model
[0119] C57 mice, maintained in (Specific Pathogen Free) SPF animal facility at Experimental Animal Center of Daping Hospital of the Army Military Medical University were 22 to 25 g in weight. The surgical operation during the experiment was conducted in accordance with the regulations of the Army Military Medical University concerning experimental animals. Mice were randomly divided into three groups: normal group, model group (2.5% DSS), and rhMG53 treatment group. Except for the normal control group, the other 2 groups were free to drink 4% dextran sulfate sodium (DSS) for 7 days. The rhMG53 treatment group was intramuscularly injected with 1 mg MG53/kg body weight per day, and then replaced with single distilled water, ad libitum for 7 days. The body weight, disease activity index, and survival rate were observed for each of the groups.
[0120] The pathological score of colitis in mice with ulcerative colitis was taken from the colon tissue of mice (day 7 after DSS treatment). The tissue was embedded in paraffin, sectioned, and stained with HE. The degree of pathological damage was scored. The score was marked as: ulcer (Invalid 0 points, less than or equal to 3 mm for 1 point, greater than 3 mm for 2 points), inflammation (normal is 0 points, mild for 1 point, severe for 2 points), granulation tissue (not 0 points, there is 1 point) The depth of the lesion (normally 0 points, 1 point in the submucosa, 2 points in the muscular layer, 3 points in the serosa layer) and fibrosis (normal 0 points, mild 1 point, and severe 2 points).
[0121] The results of recombinant rhMG53 protein protection of DSS-induced ulcerative colitis model mice are depicted in
[0122] Efficacy against ulcerative colitis was further established using colon length mouse model. The mouse colon tissue was measured for length from the ileocecal portion to the anus, and the results are shown in
Example 4
Evaluation of Efficacy in a Mouse Model for Crohn's Disease
[0123] BALB/c mice, male, 6-8 weeks old, weighing 22-25 g, were randomly divided into three groups: normal group, model group, and rhMG53 (1 mg/kg) treated group. Except for the normal control group, the other groups were intraperitoneally injected with 0.5% sodium pentobarbital anesthesia, and the flexible small tube was carefully inserted into the colon (3.5 cm proximal anus), and 2% 2,4,6-trinitrobenzenesulfonic acid (TNBS) was injected. 100 μL of benzenesulfonic acid was administered and the mice were inverted vertically for 1 minute. From the first day, rhMG53 (1 mg/kg) was administered intramuscularly, and the normal group and the 2,4,6-trinitrobenzenesulfonic acid model group were injected with an equal amount of 0.5% CMC-Na for 7 days. The body weight of the mice was weighed daily and the diarrhea and blood in the stool were observed. The results are depicted in
[0124] As shown in
[0125] The survival rate of mice used in the Crohn's disease model was evaluated.
Example 5
Preparation of Bioengineered Lactobacillus Bacteria that Express and Secrete MG53
[0126] Experimental strains and plasmids: Food grade Lactococcus (lactic acid bacteria) NZ9000 and secretory expression vector pNZ8148 were purchased from the BioVector Plasmid Vector Culture Cell Genetic Collection Center. The full sequence of the human TRIM72 gene (MG53 protein-coding gene), signal peptide and Lactobacillus acidophilus is found in the NCBI gene pool, and the primer and human TRIM72 gene were provided by Shanghai Biotech Co., Ltd., and the SPUSp45 signal peptide sequence was increased upstream of the TRIM72 gene. The His gene sequence is specifically shown in SEQ ID NO. 1 and SEQ ID NO. 4. The plasmid small kit is Tiangen's product; Tricine and Nisin are Sigma products; Coomassie Brilliant Blue Kit is Biyuntian's product; MG53 antibody was kindly provided by Prof. Ma Jianjie (TRIM-edicine, Inc., Columbus, Ohio, USA).
[0127] The construction of food-grade expression vector pNZ8148 was ligated to the MG53 gene: the ligation site is depicted in
TABLE-US-00001 TRIM72-seqF: (SEQ ID NO. 2) 5′-caccgttctctgcccctg-3′ TRIM72-seqR: (SEQ ID NO. 3) 5′-ctgtgtcttgaggcgtgc-3′ [0139] 4) Extraction plasmid [0140] The plasmid was extracted from the overnight bacterial solution in 3.2.5 (Tiangen Co., Ltd. plasmid extraction kit), and sent for sequencing. The result is shown in SEQ ID NO. 4. The correct plasmid was obtained and designated Pnz8148-SPusp45-TRIM72, and stored at −80° C. for later use. [0141] Preparation and electroporation of lactic acid bacteria NZ9000: [0142] 1) 4M1 G/L-SGM17B medium was inoculated with 4 μl of lactic acid NZ9000 at a concentration of 1%, and cultured at 30° C. for 12 h; [0143] 2) Adding all the bacterial liquid obtained in the first step to 80 ml of fresh G/L-SGM17B medium, and culturing until OD600=0.3-0.35; [0144] 3) 4Centrifuge at 5000 g for 20 min at ° C., discard the supernatant; [0145] 4) The pellet was resuspended in 80 ml of 0.5 M sucrose/10% glycerol, centrifuged at 6000 g for 20 min at 4° C., and the supernatant was discarded; [0146] 5) The pellet was resuspended in 40 ml of 0.5 M sucrose/10% glycerol/0.5 mM EDTA, pre-cooled for 15 min, centrifuged at 6000 g for 20 min at 4° C., and the supernatant was discarded: [0147] 6) The pellet was resuspended in 20 ml of 0.5 M sucrose/10% glycerol, centrifuged at 6000 g for 20 min at 4° C., and the supernatant was discarded; [0148] 7) The pellet was resuspended in 80 ml of 0.5 M sucrose/10% glycerol, dispensed into 40 μl/tube, and stored at −80° C. [0149] Recombinant sub-electricity: [0150] 1) The electric rotor was pre-cooled on ice and UV-sterilized in a clean bench. [0151] 2) The tube (40 μl/tube) was taken from a −80° C. refrigerator and thawed on ice. [0152] The plasmid was removed from the −20° C. freezer and thawed on ice. [0153] 3) The Pnz8148-linked MG53 product was added to 40 ul of the competent state, and after flicking, the mixture was iced for 10 min. [0154] 4) Transfer the mixture from step 3 to a pre-cooled electric rotor to ensure that the mixture is at the bottom of the electric rotor and that no air bubbles are present. [0155] 5) Remove the condensate from the outer wall of the electric rotor and place the electric rotor into the electric shock meter. [0156] 6) Set the voltage of the electric shock meter to 2000V and the electric shock time to 4 ms. [0157] 7) Electric shock once. [0158] Recombinant resuscitation and PCR identification: [0159] 1) After the shock is completed, quickly remove the electric rotor from the shock slot. [0160] 2) Add lg17MC regeneration medium to 1 ml ice bath. [0161] 3) Gently mix with a pipette, ice bath for 5 min, then transfer to 1.5 ml EP tube, and let stand for 1-1.5 h at 30° C. [0162] 4) 10 μl, 100 μl, and 900 μl were plated on a BCP plate at 30° C. for anaerobic standing for 1-2 days. [0163] 5) A single colony that turned yellow from the BCP plate was placed in 3 ml of GM17 liquid medium, and cultured overnight at 30° C.; [0164] 6) Preparation of bacterial solution template DNA: 200 μl of the bacterial solution was centrifuged in a 1.5 ml sterile EP centrifuge tube, centrifuged at 12,000 rpm, the medium was discarded, and the cells were resuspended by adding 100 μl of sterile ultrapure water. Then, the above EP tube was placed at −80° C. for 15 min, heated in a boiling water bath for 15 min, the cells were fully lysed, centrifuged at 12000 rpm for 3 min, and the supernatant was template DNA; [0165] 7) Take 1 μl of bacterial DNA as a template, MG53 as the upstream and downstream primers 0.3 μl each, the primer sequence as the upstream primer: 5′-caccgttctctgcccctg-3′ (SEQ ID NO. 2); downstream primer: 5′-ctgtgtcttgaggcgtgc-3′ (SEQ ID NO. 3), molecular weight: 250 bp. 102 μl of PCR buffer, 2 μl of dNTP solution and 0.2 μl of TaqDNA polymerase were denatured for 5 min and then entered into circulation. The cycle temperature and time were 94° C., 30 s of water was added to the total volume of 20 μl; after 94° C., 55° C., 74° C., 25 cycles. Then, it was further extended at 72° C. for 10 min; the product was detected by 1.0% agarose gel electrophoresis, and the results are shown in B of
Example 6
MG53 Secreted by Lactobacillus Protects Against DSS-Induced Ulcerative Colitis and TNBS-Induced Crohn's Disease
[0172] The C57 mice maintained in a SPF animal facility at the Experimental Animal Center of Daping Hospital of the Army Military Medical University weighed 22 to 25 g. The surgical operation during the experiment was conducted in accordance with the regulations concerning experimental animals of the Army Military Medical University. Mice were randomly divided into four groups: normal group, model group (4% DSS), lactobacillus treatment group (engineered lactobacillus that secretes exogenous MG53), and Lactococcus lactis control group. Except for the normal control group and the Lactococcus lactis control group, the other two groups were free to drink 4% dextran sulfate sodium (DSS) for 7 days, and the exogenous MG53 Lactococcus lactis treatment group was given DSS daily and then switched to single distilled water and allowed to drink freely for 7 days. The effect MG53 upon the survival rate of mice was monitored, and the results are depicted in
Example 7
Effect of Engineered Lactobacillus Lactis (that Secretes MG53) Upon TNBS-Induced Crohn's Disease
[0173] The C57 mice maintained in a SPF animal facility at the Experimental Animal Center of Daping Hospital of the Army Military Medical University weighed 22 to 25 g. The surgical operation during the experiment was conducted in accordance with the regulations of the experimental animals of the Army Military Medical University. Mice were randomly divided into four groups: normal group, model group (TNBS), lactobacillus treatment group (engineered lactobacillus that secretes exogenous MG53), and Lactococcus lactis control group. As depicted in
Example 8
Oral Dosage Form of rhMG53 and EUDRAGIT S-100
[0174] rhMG53 is provided by TRIM-edicine, Inc. (Columbus, Ohio). EUDRAGIT S-100 (Poly(methacylic acid-co-methyl methacrylate) 1:2) is provided by EVONIK (https://healthcare.evonik.com/product/health-care/en/). The following procedure is used to prepare beads.
[0175] In a 100 mL beaker, add 35 mL water, and stir. While stirring add Eudragit S-100 powder (1.4 g), then and 12N NH.sub.4OH (0.82 mL).
[0176] Add 2-hydroxypropyl)-β-cyclodextrin (0.24 g) to a 10 mL water (CD: 24 mg/mL).
[0177] Prepare a solution of MG53 (70 mg in ˜15.5 mL PBS) at a pH 8. To this solution, add 10 mL of the CD solution and 10 mL of water for a total volume of 35.55 mL.
[0178] Mix the MG53/CD solution with the Eudragit solution while stirring.
[0179] Spray dry the resulting suspension to form the powdered dosage form containing MG53 (70 mg), EUDRAGIT (1.4 g), salts (130 mg), and CD (0.24 g) for a total solids content of 1.77 g or a MG53-loading of 40 mg/g of solid (4% loading). Spray drying conditions used: nozzle size—0.6 mm; air speed—0.3 m.sup.3/min; air outlet temp: 38 C; room temperature: 24 C; room humidity: 53%.
[0180] The powder can be included in a capsule, caplet, tablet or other oral dosage form.
Example 9
Preparation of MG53-Containing Enteric Release Composition
[0181] The enteric release formulation comprises MG53, hydroxypropyl-beta-cyclodextrin (HP-b-CD), and methacrylic acid/methyl methacrylate anionic copolymer (EUDRAGIT S 100; dissolution in water at pH above 7.0). The following procedure was used. [0182] 1. In a 100 mL beaker, added 35 mL water; [0183] 2. weighed 1.4 g Eudragit S-100 powder and added to the H.sub.2O above while stirring; [0184] 3. added 0.82 mL of 12N NH.sub.4OH and stirred continuously for half an hour while periodically checking pH; [0185] 4. weighed 0.24 g of 2-hydroxypropyl)-O-cyclodextrin and added to a vial containing 10 mL water (CD: 24 mg/mL); [0186] 5. added 70 mg MG53 to 15.5 mL PBS at pH 8; [0187] 6. mixed the HP-b-CD solution with the MG53-containing solution and add water to a total volume of 35.55 mL; [0188] 7. added the MG53/CD solution to the 35 mL Eudragit-containing solution while stirring, and added 1 mL of water; [0189] 6. spray dried the MG53/CD/EUDRAGIT solution according to Example 11;
[0190] The resulting enteric release composition contained: MG53 70 mg; Eudragit 1.4 g; salts: 15.5/2*17 mg/mL=130 mg; CD 0.24 g.
Example 10
Determination of In-Vitro Release Profile
[0191] A known amount of powdered samples of MG53 containing enteric release composition (made according to Example 9) was dispersed in pH 2 (0.01N HCl) solution for 2 hrs, followed by addition of Na.sub.3PO.sub.4 solution (9.7 g in 112.8 mL H.sub.2O; to pH 6.5), then followed by addition of same Na.sub.3PO.sub.4 solution to pH 7.5. At different time points, the released MG53 solution was centrifuged at 17,000 g for 20 min, filtered through 0.22 um filter, and the absorbance at 280 nm was measured (n=2 per time points). The release experiments were performed in an orbital shaker at 37° C. and 150 rpm.
Example 11
Spraying Drying of MG53/CD/EUDRAGIT Mixture
[0192] The MG53/CD/EUDRAGIT mixture was produced by spray-drying using the laboratory scale ProCept 4M8-TriX spray-dryer (Zelzate, Belgium). Drug-polymer solutions were prepared in the binary solvent mixture of interest DCM/EtOH 2:1 (v/v) at 50 mg/mL. The feed solution flow rate was adjusted at 5 g/min. An atomizing air pressure of 0.65 bars was applied to a 1.2 mm bifluid nozzle to create a spray. The drying gas airflow was set at 0.35 m3/min and maintained at 65° C. The lateral cooling air was kept constant at 100 L/min and dried particles were separated from the exhaust air within the medium cyclone (height/diameter of 242 mm/60 mm). After processing, the spray-dried material was stored in a vacuum oven for 48 h before analysis to eliminate the last traces of residual solvent.
Example 12
Evaluation of MG53-Containing Enteric Formulation
[0193] The formulation of Example 9 was administered daily to mice by oral gavage: dose of rhMG53 equivalent to 200 microg/dose. The mice were subjected to DSS-induced IBD as described herein. The body weight, GI integrity (FITC-dextran level), and colon length were determined as described herein.
Example 13
Evaluation of Fluorescence-Labeled Enteric Formulations
[0194] A fluorescence labeled-MG53 (FITC-MG53) was prepared according to well-known procedure and then encapsulated with EUDRAGIT according to Example 9, wherein FITC-MG53 was used in place of native MG53. The fluorescence label (FITC) was also encapsulated with EUDRAGIT according to Example 9, wherein FITC was used in place of native MG53.
[0195] Mice were administered the encapsulated FITC and FITC-MG53 by oral gavage at seven days post DSS treatment. Colon tissue was resected from control (untreated) mice, FITC-treated mice and FITC-MG53-treated mice. Confocal microscopy imaging revealed targeting of FITC-MG53 to the injured intestinal epithelia layer. FITC vehicle alone did not show targeting at the epithelia layer (
Example 14
Evaluation of MG53 for Protection of Enteroids
[0196] Enteroids were formed from primary intestinal stem cells derived from C57BL6/J mice and cultured for 1 week. Treatment of enteroids with DSS for 48 hours led to the reduction of budding enteroids. rhMG53 (10 μg/mL) significantly increased the number of budding enteriods indicating the ability of MG53 to protect stem cells from DSS-induced damage.
Example 15
Preparation of Food-Grade Engineered MG53-Expressing Lactobacillus
[0197] The genetic code of MG53 protein was optimized for expression in Lactobacillus paracasei. The maltose-induced promotor P.sub.mal, signal peptide SP.sub.H5 from the surface protein slpH5, and mg53 gene were composed of MG53 gene expression element (PS53). The upstream fragment (UF, 673 bp) and the downstream fragment (DF, 764 bp) flanking upp gene (encoding uracil phosphoribosyltransferase, used as counterselectable genetic marker) in the chromosomal DNA were amplified and purified by gel recovery kit, respectively. The two fragments were successively fused with PS53 by overlap PCR to produce UF-PS53-DF fragment, which was ligated into temperature-sensitive plasmid pMG36 cm (containing chloramphenicol resistance gene cat) by Gibson assembly. The resulting recombinant plasmid, pMG3653, was electroporated into L. paracasei 27092. The correct transformants were propagated for 30 generations in MRS medium with chloramphenicol (10 μg/mL) at 30° C. and the single-crossover clones were selected by colony PCR. The single-crossover strains were subsequently propagated in MRS medium (without chloramphenicol) with 5-fluorouracil (20 μg/mL) and the concentration of 5-fluorouracil gradually increased to 150 μg/mL to induce double-crossover integration at 42° C. After 20 generations, the cultures were diluted and spread on MRS plates. The signal clones were simultaneously streaked on MRS plates with 5-fluorouracil (150 μg/mL) and with chloramphenicol (10 μg/mL) and the clones with 5-fluorouracil-resistance and chloramphenicol-sensitive phenotypes were the potential double-crossover strains. The chromosomal DNA fragments (about 4.0 kb) of the recombinant regions in the potential strains were amplified and sequenced to confirm the integration of PS53 fragment. The chromosomal DNA maps of the wild type (WT) and the recombinant strain (M1) are depicted in
[0198] The M1 strain was cultured in MRS medium at 37° C. until stationary phase (about 24 hours) and then the cells were harvested and washed by MRS medium without glucose (MRSm medium). The above cells were propagated in MRSm medium with 1% maltose and 0.1 mol/L phosphate buffer (pH 7.4) for about 18 hours and the supernatant of the culture was collected by centrifugation. The proteins in the supernatant were precipitated by organic solution and detected by western blot. Secretion of MG53 from the engineered Lactobacillus was confirmed by Western blot (
[0199] The signal peptide SP-prtP (PrtP cell wall associated protease) has the following sequences: protein (SEQ ID NO. 6) MQRKKKGLSILLAGTVALGALAVLPVG EIQAKADTNSD; DNA (SEQ ID NO. 7) ATGCAACGTAAAAAGAAAGGTT TAAGTATCTTATTAGCTGGTACAGTTGCTTTAGGTGCTTTAGCTGTTTTACCAGT TGGCGAAATCCAAGCAAAGGCTGACACAAACAGTGAT.
[0200] The signal peptide SP-slpA (SplA, cell surface protein) has the following sequences: protein (SEQ ID NO. 8) MKKNLRIVSAAAAALLAVAPVAASAVSVNAAATTTN; DNA (SEQ ID NO. 9) ATGAAGAAAAATTTAAGAATTGTTAGCGCTGCTGCTGCTGC TTTATTAGCTGTTGCTCCAGTTGCTGCTTCAGCTGTTTCTGTTAACGCTGCTGCA ACCACTACCAAC.
Example 16
Evaluation of Engineered MG53-Expressing Lactobacillus for the Treatment of IBD
[0201] Efficacy of engineered MG53-expressing Lactobacillus (Example 15) for the treatment of IBD was evaluated in mice with DSS-induced IBD. The engineered Lactobacillus (Lacto MG53) was compared to the native Lactobacillus (Lacto Co) and control (no treatment). Mice were administered the lactobacillus by oral gavage at seven days post DSS treatment. Bodyweight and FITC-dextran concentration in serum were determined as described herein. [0202] 1. 10 Male C57BL/6J mice (12 wk old) were randomly assigned to two groups and added 3.0% (w/v) DSS in the drinking water ad libitum for the first 5 days, then switch to 1% DSS till day 26. [0203] 2. Each mouse was given 250 mg (in 200 ul PBS) Control (native) Lactobacillus or MG35-expressing Lactobacillus by oral gavage every other day since day 6. (MG53˜125 ng/mouse) [0204] 3. At the end of the schedule, the mice were water starved for 4 hr. FITC-dextran was dissolved in PBS at a concentration of 100 mg/ml and administered to each mouse (40 mg/100 g body weight) by oral gavage. [0205] 4. After 4 hr, blood was collected by cheek punch from each mouse. The blood was held for 30 min at room temperature (RT), then centrifuged at 8,000 rpm for 10 min and serum was collected. After that, the serum was diluted with an equal volume of PBS and 100 μl aliquots of diluted serum were placed in a 96-well microplate in duplicate. [0206] 5. The concentration of FITC in serum was determined by spectrophotofluorometry with an excitation of 485 nm (20 nm band width) and an emission wavelength of 528 nm (20 nm band width) using as standard serially diluted FITC-dextran (0, 250, 500, 1,000, 2,000, 4,000, 8,000, 10,000 ng/ml) as standard. Serum from mice not administered with FITC-dextran was used to determine background. [0207] 6. After 6 days, mice were euthanized and vital organs collected to compare intestine length and collect Peyer's patches.
[0208] The data (
Example 17
Evaluation of MG53 for the Treatment of X-Ray Irradiation-Induced Intestinal Injury
[0209] C57BL6/J mice (both male and female) were irradiated by X-ray (10-30 Gy/day, IR) for a total of 6 days. Control mice injected with saline without IR. IR mice group receive X-ray and injected with saline. rhMG53 mice group receive X-Ray and tail vein injection of rhMG53 (1 mg/kg) at 15 min before IR.
[0210] At 6 days post IR, mice were sacrificed and the colon length measured. IR exposure caused shortening of the colon, which was partially mitigated by rhMG53 treatment (
[0211] FITC-dextran measurement show disrupted GI integrity in mice receiving IR exposure (as indicated by the >500 fold elevation of FITC-dextran measured in the serum;
Example 18
Western Blot
[0212] Protein lysates from indicated tissue and cell sources were separated by SDS-PAGE. Proteins were transferred from gels to PVDF membranes at 4° C. The blots were washed with PBST (PBS+0.5% Tween-20), blocked with 5% milk in PBST for 2 hours, and incubated with indicated primary antibodies overnight at 4° C. under rotation. Secondary antibodies, anti-mouse or anti-rabbit IgG HRP conjugated, were applied at 1:5000 dilution and incubated for approximately 1.5 hours with shaking at room temperature. Immunoblots were visualized with an ECL plus kit (Pierce). The antibodies used in this study were as follows: rabbit anti-MG53 antibody was generated by our laboratory and the sensitivity and specificity were previously confirmed: anti-p-Smad2 antibody (Cell Signaling Technology, Cat. No. 3108); anti-Smad2 antibody (Cell Signaling Technology, Cat. No. 5339); anti-Smad5, (Cell Signaling Technology, Cat. No. 12534); anti-p-Smad5 antibody (Cell Signaling Technology, Cat. No. 9516); anti-GAPDH antibody (Cell Signaling Technology, Cat. No. 2118s); anti-alpha-SMA antibody (Invitrogen, Cat. No. 14-9760-82); and anti-fibronectin antibody (Sigma-Aldrich, Cat. No. F3648).
[0213] All data are expressed as mean±S.D. Groups were compared by Student's t test and analysis of variance for repeated measures. A value of p<0.05 was considered significant.
[0214] For any range herein, the upper and lower limits thereof are considered as being part of the range. Moreover, all integer and fractional values within said ranges are also considered as being within said range. Accordingly, all integers and fractional values within each specified range are hereby incorporated by reference.
[0215] All values disclosed herein may have standard technical measure error (standard deviation) of ±10%. The term “about” or “approximately” is intended to mean±10%, ±5%, ±2.5% or ±1% relative to a specified value, i.e. “about” 20% means 20±2%, 20±1%, 20±0.5% or 20±0.25%. The term “majority” or “major portion” is intended to mean more than half, when used in the context of two portions, or more than one-third, when used in the context of three portions. The term “minority” or “minor portion” is intended to mean less than half, when used in the context of two portions, or less than one-third, when used in the context of three portions. It should be noted that, unless otherwise specified, values herein concerning pharmacokinetic or dissolution parameters are typically representative of the mean or median values obtained.
[0216] The above is a detailed description of particular embodiments of the invention. It will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without departing from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims. All of the embodiments disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure.