COMPOSITIONS AND METHODS FOR MODULATING TAU EXPRESSION
20220243200 · 2022-08-04
Assignee
Inventors
Cpc classification
C12N15/113
CHEMISTRY; METALLURGY
C12N2310/3231
CHEMISTRY; METALLURGY
C12N2310/345
CHEMISTRY; METALLURGY
A61P25/28
HUMAN NECESSITIES
C12N2310/346
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Disclosed are methods for modulating splicing of Tau mRNA in an animal with Tau antisense compounds. Also disclosed herein are methods for reducing expression of Tau mRNA and protein in an animal with Tau antisense compounds. Such compounds and methods are useful to treat, prevent, or ameliorate neurodegenerative diseases in an individual in need thereof. Examples of neurodegenerative diseases that can be treated, prevented, and ameliorated with the administration Tau antisense oligonucleotides include Alzheimer's Disease, Fronto-temporal Dementia (FTD), FTDP-17, Progressive Supranuclear Palsy, Chronic Traumatic Encephalopathy, Epilepsy, and Dravet's Syndrome.
Claims
1. A compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of SEQ ID NOs: 8-200.
2. The compound of claim 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to SEQ ID NO: 1.
3. The compound of claim 1, wherein the nucleobase sequence of the modified oligonucleotide is 100% complementary to SEQ ID NO: 1.
4. The compound of claim 2, wherein the modified oligonucleotide consists of 16 to 22 linked nucleosides.
5. The compound of claim 2, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety.
6. The compound of claim 5, wherein the modified sugar moiety is a 2′-substituted sugar moiety.
7. The compound of claim 6, wherein the 2′-substituted sugar moiety is selected from: a 2′-OMe sugar moiety, a 2′-F sugar moiety, and a 2′-MOE sugar moiety.
8. The compound of claim 5, wherein the modified sugar moiety is a bicyclic sugar moiety.
9. The compound of claim 8, wherein the bicyclic sugar moiety is a LNA sugar moiety or a cEt sugar moiety.
10. The compound of claim 5, wherein the modified sugar moiety is a sugar surrogate.
11. The compound of claim 10, wherein the sugar surrogate is a morpholino.
12. The compound of claim 5, wherein at least one nucleoside of the modified oligonucleotide comprises a naturally occurring sugar moiety.
13. The compound of claim 2, wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety.
14. The compound of claim 13, wherein the modified sugar moiety is a 2′-substituted sugar moiety.
15. The compound of claim 14, wherein the 2′-substituted sugar moiety is selected from: a 2′ OMe sugar moiety, a 2′-F sugar moiety, and 2′ MOE a 2′-OCH.sub.2CH.sub.2OCH.sub.3 sugar moiety.
16. The compound of claim 13, wherein the modified sugar moiety is a bicyclic sugar moiety.
17. The compound of claim 16, wherein the bicyclic sugar moiety is a LNA sugar moiety or a cEt sugar moiety.
18. The compound of claim 13 wherein the modified sugar moiety is a sugar surrogate.
19. The compound of claim 18, wherein the sugar surrogate is a morpholino.
20. The compound of claim 5, wherein at least one nucleobase of the modified oligonucleotide is a modified nucleobase.
21. The compound of claim 20, wherein the modified nucleobase is a 5-methylcytosine.
22. The compound of claim 2, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
23. The compound of claim 22, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
24. The compound of claim 23, wherein the modified oligonucleotide comprises at least one naturally occurring internucleoside linkage.
25. The compound of claim 2, wherein each internucleoside linkage is a modified internucleoside linkage.
26. The compound of claim 25, wherein each modified internucleoside linkage is a phosphorothioate internucleoside linkage.
27. The compound of claim 5, comprising the modified oligonucleotide linked to a conjugate group.
28. A single-stranded modified oligonucleotide consisting of 18 linked nucleosides and having a nucleobase sequence comprising 18 contiguous nucleobases of any of SEQ ID NOs: 8-200, wherein each nucleoside of the modified oligonucleotide comprises a 2′-substituted sugar moiety and each internucleoside linkage is a phosphorothioate internucleoside linkage or a phosphodiester internucleoside linkage.
29. The single-stranded modified oligonucleotide of claim 28, wherein the 2′-substituted sugar moiety is 2′-OMe sugar moiety.
30. The single-stranded modified oligonucleotide of claim 29, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.
31. A pharmaceutical composition comprising a single-stranded modified oligonucleotide according to claim 28 and a pharmaceutically acceptable carrier or diluent.
32. The pharmaceutical composition of claim 31, wherein the single-stranded modified oligonucleotide is a salt.
33. The pharmaceutical composition of claim 32, wherein the salt is a sodium salt.
34. A method of reducing or ameliorating one or more symptoms associated with a tau-associated disorder, comprising contacting a cell with the single-stranded modified oligonucleotide of claim 28.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0214]
DETAILED DESCRIPTION
[0215] Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis. Certain such techniques and procedures may be found for example in “Carbohydrate Modifications in Antisense Research” Edited by Sangvi and Cook, American Chemical Society, Washington D.C., 1994; “Remington's Pharmaceutical Sciences,” Mack Publishing Co., Easton, Pa., 21.sup.st edition, 2005; and “Antisense Drug Technology, Principles, Strategies, and Applications” Edited by Stanley T. Crooke, CRC Press, Boca Raton, Fla.; and Sambrook et al., “Molecular Cloning, A laboratory Manual,” 2.sup.nd Edition, Cold Spring Harbor Laboratory Press, 1989, which are hereby incorporated by reference for any purpose. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety.
[0216] Unless otherwise indicated, the following terms have the following meanings:
[0217] As used herein, “nucleoside” means a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety.
[0218] As used herein, “chemical modification” means a chemical difference in a compound when compared to a naturally occurring counterpart. In reference to an oligonucleotide, chemical modification does not include differences only in nucleobase sequence. Chemical modifications of oligonucleotides include nucleoside modifications (including sugar moiety modifications and nucleobase modifications) and internucleoside linkage modifications.
[0219] As used herein, “furanosyl” means a structure comprising a 5-membered ring comprising four carbon atoms and one oxygen atom.
[0220] As used herein, “naturally occurring sugar moiety” means a ribofuranosyl as found in naturally occurring RNA or a deoxyribofuranosyl as found in naturally occurring DNA.
[0221] As used herein, “sugar moiety” means a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside.
[0222] As used herein, “modified sugar moiety” means a substituted sugar moiety, a bicyclic or tricyclic sugar moiety, or a sugar surrogate.
[0223] As used herein, “substituted sugar moiety” means a furanosyl comprising at least one substituent group that differs from that of a naturally occurring sugar moiety. Substituted sugar moieties include, but are not limited to furanosyls comprising substituents at the 2′-position, the 3′-position, the 5′-position and/or the 4′-position.
[0224] As used herein, “2′-substituted sugar moiety” means a furanosyl comprising a substituent at the 2′-position other than H or OH. Unless otherwise indicated, a 2′-substituted sugar moiety is not a bicyclic sugar moiety (i.e., the 2′-substituent of a 2′-substituted sugar moiety does not form a bridge to another atom of the furanosyl ring.
[0225] As used herein, “MOE” means —OCH.sub.2CH.sub.2OCH.sub.3.
[0226] As used herein, “bicyclic sugar moiety” means a modified sugar moiety comprising a 4 to 7 membered ring (including but not limited to a furanosyl) comprising a bridge connecting two atoms of the 4 to 7 membered ring to form a second ring, resulting in a bicyclic structure. In certain embodiments, the 4 to 7 membered ring is a sugar ring. In certain embodiments the 4 to 7 membered ring is a furanosyl. In certain such embodiments, the bridge connects the 2′-carbon and the 4′-carbon of the furanosyl.
[0227] As used herein the term “sugar surrogate” means a structure that does not comprise a furanosyl and that is capable of replacing the naturally occurring sugar moiety of a nucleoside, such that the resulting nucleoside is capable of (1) incorporation into an oligonucleotide and (2) hybridization to a complementary nucleoside. Such structures include rings comprising a different number of atoms than furanosyl (e.g., 4, 6, or 7-membered rings); replacement of the oxygen of a furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen); or both a change in the number of atoms and a replacement of the oxygen. Such structures may also comprise substitutions corresponding to those described for substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic sugar surrogates optionally comprising additional substituents). Sugar surrogates also include more complex sugar replacements (e.g., the non-ring systems of peptide nucleic acid). Sugar surrogates include without limitation morpholino, modified morpholinos, cyclohexenyls and cyclohexitols.
[0228] As used herein, “nucleotide” means a nucleoside further comprising a phosphate linking group. As used herein, “linked nucleosides” may or may not be linked by phosphate linkages and thus includes, but is not limited to “linked nucleotides.” As used herein, “linked nucleosides” are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).
[0229] As used herein, “nucleobase” means a group of atoms that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the group of atoms is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases may be naturally occurring or may be modified.
[0230] As used herein, “heterocyclic base” or “heterocyclic nucleobase” means a nucleobase comprising a heterocyclic structure.
[0231] As used herein the terms, “unmodified nucleobase” or “naturally occurring nucleobase” means the naturally occurring heterocyclic nucleobases of RNA or DNA: the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C), and uracil (U).
[0232] As used herein, “modified nucleobase” means any nucleobase that is not a naturally occurring nucleobase.
[0233] As used herein, “modified nucleoside” means a nucleoside comprising at least one chemical modification compared to naturally occurring RNA or DNA nucleosides. Modified nucleosides comprise a modified sugar moiety and/or a modified nucleobase.
[0234] As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
[0235] As used herein, “constrained ethyl nucleoside” or “cEt” means a nucleoside comprising a bicyclic sugar moiety comprising a 4′-CH(CH.sub.3)—O-2′bridge.
[0236] As used herein, “locked nucleic acid nucleoside” or “LNA” means a nucleoside comprising a bicyclic sugar moiety comprising a 4′-CH.sub.2—O-2′bridge.
[0237] As used herein, “2′-substituted nucleoside” means a nucleoside comprising a substituent at the 2′-position other than H or OH. Unless otherwise indicated, a 2′-substituted nucleoside is not a bicyclic nucleoside.
[0238] As used herein, “2′-deoxynucleoside” means a nucleoside comprising 2′-H furanosyl sugar moiety, as found in naturally occurring deoxyribonucleosides (DNA). In certain embodiments, a 2′-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (e.g., uracil).
[0239] As used herein, “oligonucleotide” means a compound comprising a plurality of linked nucleosides. In certain embodiments, an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and/or unmodified deoxyribonucleosides (DNA) and/or one or more modified nucleosides.
[0240] As used herein “oligonucleoside” means an oligonucleotide in which none of the internucleoside linkages contains a phosphorus atom. As used herein, oligonucleotides include oligonucleosides.
[0241] As used herein, “modified oligonucleotide” means an oligonucleotide comprising at least one modified nucleoside and/or at least one modified internucleoside linkage.
[0242] As used herein “internucleoside linkage” means a covalent linkage between adjacent nucleosides in an oligonucleotide.
[0243] As used herein “naturally occurring internucleoside linkage” means a 3′ to 5′ phosphodiester linkage.
[0244] As used herein, “modified internucleoside linkage” means any internucleoside linkage other than a naturally occurring internucleoside linkage.
[0245] As used herein, “oligomeric compound” means a polymeric structure comprising two or more sub-structures. In certain embodiments, an oligomeric compound comprises an oligonucleotide. In certain embodiments, an oligomeric compound comprises one or more conjugate groups and/or terminal groups. In certain embodiments, an oligomeric compound consists of an oligonucleotide.
[0246] As used herein, “terminal group” means one or more atom attached to either, or both, the 3′ end or the 5′ end of an oligonucleotide. In certain embodiments a terminal group is a conjugate group. In certain embodiments, a terminal group comprises one or more terminal group nucleosides.
[0247] As used herein, “conjugate” means an atom or group of atoms bound to an oligonucleotide or oligomeric compound. In general, conjugate groups modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and/or clearance properties.
[0248] As used herein, “conjugate linking group” means any atom or group of atoms used to attach a conjugate to an oligonucleotide or oligomeric compound.
[0249] As used herein, “antisense compound” means a compound comprising or consisting of an oligonucleotide at least a portion of which is complementary to a target nucleic acid to which it is capable of hybridizing, resulting in at least one antisense activity.
[0250] As used herein, “antisense activity” means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
[0251] As used herein, “detecting” or “measuring” means that a test or assay for detecting or measuring is performed. Such detection and/or measuring may result in a value of zero. Thus, if a test for detection or measuring results in a finding of no activity (activity of zero), the step of detecting or measuring the activity has nevertheless been performed.
[0252] As used herein, “detectable and/or measureable activity” means a statistically significant activity that is not zero.
[0253] As used herein, “essentially unchanged” means little or no change in a particular parameter, particularly relative to another parameter which changes much more. In certain embodiments, a parameter is essentially unchanged when it changes less than 5%. In certain embodiments, a parameter is essentially unchanged if it changes less than two-fold while another parameter changes at least ten-fold. For example, in certain embodiments, an antisense activity is a change in the amount of a target nucleic acid. In certain such embodiments, the amount of a non-target nucleic acid is essentially unchanged if it changes much less than the target nucleic acid does, but the change need not be zero.
[0254] As used herein, “expression” means the process by which a gene ultimately results in a protein. Expression includes, but is not limited to, transcription, post-transcriptional modification (e.g., splicing, polyadenlyation, addition of 5′-cap), and translation.
[0255] As used herein, “target nucleic acid” means a nucleic acid molecule to which an antisense compound hybridizes.
[0256] As used herein, “mRNA” means an RNA molecule that encodes a protein.
[0257] As used herein, “pre-mRNA” means an RNA transcript that has not been fully processed into mRNA. Pre-RNA includes one or more intron.
[0258] As used herein, “transcript” means an RNA molecule transcribed from DNA. Transcripts include, but are not limited to mRNA, pre-mRNA, and partially processed RNA.
[0259] As used herein, “Tau transcript” means a transcript transcribed from a Tau gene. In certain embodiments, a Tau transcript is represented by GENBANK Accession No NT_010783.15, truncated from nucleotides 9240000 to 9381000 (SEQ ID NO: 1), or a variant thereof.
[0260] As used herein, “Tau gene” means a gene that encodes a Tau protein and any Tau protein isoforms. In certain embodiments, Tau protein isoforms include the 3R isoform and the 4R isoform.
[0261] As used herein, “3R” means a Tau transcript that includes does not include exon 10.
[0262] As used herein, “3R Tau isoform” means a Tau protein isoform that does not include amino acids encoded from exon 10.
[0263] As used herein, “4R” means a Tau transcript that includes exon 10.
[0264] As used herein, “4R Tau isoform” means a Tau protein isoform that includes amino acids encoded from exon 10.
[0265] As used herein, “Tau-associated disease” means any neurological or neurodegenerative disease associated with Tau. Non-limiting examples of Tau-associated disorders include Alzheimer's disease, progressive supranuclear palsy, dementia pugilistica, frontotemporal dementia, parkinsonism linked to chromosome, Lytico-Bodig disease, tangle-predominant dementia, ganglioglioma, gangliocytoma, meningioangiomatosis, subacute sclerosing panencephalitis, lead encephalopathy, tuberous sclerosis, Hallervorden-Spatz disease, Pick's disease, corticobasal ganglionic degeneration, argyrophilic grain disease, supranuclear palsy, corticobasal degeneration, frontotemporal dementia, or frontotemporal lobar degeneration.
[0266] As used herein, “Tauopathy” means disorders characterized by a build-up of Tau protein in the brain.
[0267] As used herein, “Tau-specific inhibitor” includes but is not limited to a “antisense compound” targeted to Tau.
[0268] As used herein, “targeting” or “targeted to” means the association of an antisense compound to a particular target nucleic acid molecule or a particular region of a target nucleic acid molecule. An antisense compound targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid to allow hybridization under physiological conditions.
[0269] As used herein, “nucleobase complementarity” or “complementarity” when in reference to nucleobases means a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase means a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair. Nucleobases comprising certain modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of nucleobase complementarity.
[0270] As used herein, “non-complementary” in reference to nucleobases means a pair of nucleobases that do not form hydrogen bonds with one another.
[0271] As used herein, “complementary” in reference to oligomeric compounds (e.g., linked nucleosides, oligonucleotides, or nucleic acids) means the capacity of such oligomeric compounds or regions thereof to hybridize to another oligomeric compound or region thereof through nucleobase complementarity under stringent conditions. Complementary oligomeric compounds need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. In certain embodiments, complementary oligomeric compounds or regions are complementary at 70% of the nucleobases (70% complementary). In certain embodiments, complementary oligomeric compounds or regions are 80% complementary. In certain embodiments, complementary oligomeric compounds or regions are 90% complementary. In certain embodiments, complementary oligomeric compounds or regions are 95% complementary. In certain embodiments, complementary oligomeric compounds or regions are 100% complementary.
[0272] As used herein, “hybridization” means the pairing of complementary oligomeric compounds (e.g., an antisense compound and its target nucleic acid). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
[0273] As used herein, “specifically hybridizes” means the ability of an oligomeric compound to hybridize to one nucleic acid site with greater affinity than it hybridizes to another nucleic acid site. In certain embodiments, an antisense oligonucleotide specifically hybridizes to more than one target site.
[0274] As used herein, “percent complementarity” means the percentage of nucleobases of an oligomeric compound that are complementary to an equal-length portion of a target nucleic acid. Percent complementarity is calculated by dividing the number of nucleobases of the oligomeric compound that are complementary to nucleobases at corresponding positions in the target nucleic acid by the total length of the oligomeric compound.
[0275] As used herein, “percent identity” means the number of nucleobases in a first nucleic acid that are the same type (independent of chemical modification) as nucleobases at corresponding positions in a second nucleic acid, divided by the total number of nucleobases in the first nucleic acid.
[0276] As used herein, “modulation” means a change of amount or quality of a molecule, function, or activity when compared to the amount or quality of a molecule, function, or activity prior to modulation. For example, modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression. As a further example, modulation of expression can include a change in splice site selection of pre-mRNA processing, resulting in a change in the absolute or relative amount of a particular splice-variant compared to the amount in the absence of modulation.
[0277] As used herein, “motif” means a pattern of chemical modifications in an oligomeric compound or a region thereof. Motifs may be defined by modifications at certain nucleosides and/or at certain linking groups of an oligomeric compound.
[0278] As used herein, “nucleoside motif” means a pattern of nucleoside modifications in an oligomeric compound or a region thereof. The linkages of such an oligomeric compound may be modified or unmodified. Unless otherwise indicated, motifs herein describing only nucleosides are intended to be nucleoside motifs. Thus, in such instances, the linkages are not limited.
[0279] As used herein, “sugar motif” means a pattern of sugar modifications in an oligomeric compound or a region thereof.
[0280] As used herein, “linkage motif” means a pattern of linkage modifications in an oligomeric compound or region thereof. The nucleosides of such an oligomeric compound may be modified or unmodified. Unless otherwise indicated, motifs herein describing only linkages are intended to be linkage motifs. Thus, in such instances, the nucleosides are not limited.
[0281] As used herein, “nucleobase modification motif” means a pattern of modifications to nucleobases along an oligonucleotide. Unless otherwise indicated, a nucleobase modification motif is independent of the nucleobase sequence.
[0282] As used herein, “sequence motif” means a pattern of nucleobases arranged along an oligonucleotide or portion thereof. Unless otherwise indicated, a sequence motif is independent of chemical modifications and thus may have any combination of chemical modifications, including no chemical modifications.
[0283] As used herein, “type of modification” in reference to a nucleoside or a nucleoside of a “type” means the chemical modification of a nucleoside and includes modified and unmodified nucleosides. Accordingly, unless otherwise indicated, a “nucleoside having a modification of a first type” may be an unmodified nucleoside.
[0284] As used herein, “differently modified” mean chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are “differently modified,” even though the DNA nucleoside is unmodified. Likewise, DNA and RNA are “differently modified,” even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified. For example, a nucleoside comprising a 2′-OMe modified sugar and an unmodified adenine nucleobase and a nucleoside comprising a 2′-OMe modified sugar and an unmodified thymine nucleobase are not differently modified.
[0285] As used herein, “the same type of modifications” refers to modifications that are the same as one another, including absence of modifications. Thus, for example, two unmodified DNA nucleoside have “the same type of modification,” even though the DNA nucleoside is unmodified. Such nucleosides having the same type modification may comprise different nucleobases.
[0286] As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an animal. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile saline. In certain embodiments, such sterile saline is pharmaceutical grade saline.
[0287] As used herein, “substituent” and “substituent group,” means an atom or group that replaces the atom or group of a named parent compound. For example a substituent of a modified nucleoside is any atom or group that differs from the atom or group found in a naturally occurring nucleoside (e.g., a modified 2′-substituent is any atom or group at the 2′-position of a nucleoside other than H or OH). Substituent groups can be protected or unprotected. In certain embodiments, compounds of the present invention have substituents at one or at more than one position of the parent compound. Substituents may also be further substituted with other substituent groups and may be attached directly or via a linking group such as an alkyl or hydrocarbyl group to a parent compound.
[0288] Likewise, as used herein, “substituent” in reference to a chemical functional group means an atom or group of atoms differs from the atom or a group of atoms normally present in the named functional group. In certain embodiments, a substituent replaces a hydrogen atom of the functional group (e.g., in certain embodiments, the substituent of a substituted methyl group is an atom or group other than hydrogen which replaces one of the hydrogen atoms of an unsubstituted methyl group). Unless otherwise indicated, groups amenable for use as substituents include without limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl (—C(O)R.sub.aa), carboxyl (—C(O)O—R.sub.aa), aliphatic groups, alicyclic groups, alkoxy, substituted oxy (—O—R.sub.aa), aryl, aralkyl, heterocyclic radical, heteroaryl, heteroarylalkyl, amino (—N(R.sub.bb)(R.sub.cc)), imino(=NR.sub.bb), amido (—C(O)N(R.sub.bb)(R.sub.cc) or —N(R.sub.bb)C(O)R.sub.aa), azido (—N.sub.3), nitro (—NO.sub.2), cyano (—CN), carbamido (—OC(O)N(R.sub.bb)(R.sub.cc) or —N(R.sub.bb)C(O)OR.sub.aa), ureido (—N(R.sub.bb)C(O)N(R.sub.bb)(R.sub.cc)), thioureido (—N(R.sub.bb)C(S)N(R.sub.bb)—(R.sub.cc)), guanidinyl (—N(R.sub.bb)C(═NR.sub.bb)N(R.sub.bb)(R.sub.cc)), amidinyl (—C(═NR.sub.bb)N(R.sub.bb)(R.sub.cc) or —N(R.sub.bb)C(═NR.sub.bb)(R.sub.aa)), thiol (—SR.sub.bb), sulfinyl (—S(O)R.sub.bb), sulfonyl (—S(O).sub.2R.sub.bb) and sulfonimidoyl (—S(O).sub.2N(R.sub.bb)(R.sub.cc) or —N(R.sub.bb)S—(O).sub.2R.sub.bb). Wherein each R.sub.aa, R.sub.bb and R.sub.cc is, independently, H, an optionally linked chemical functional group or a further substituent group with a preferred list including without limitation, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic and heteroarylalkyl. Selected substituents within the compounds described herein are present to a recursive degree.
[0289] As used herein, “alkyl,” as used herein, means a saturated straight or branched hydrocarbon radical containing up to twenty four carbon atoms. Examples of alkyl groups include without limitation, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl and the like. Alkyl groups typically include from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms (C1-C12 alkyl) with from 1 to about 6 carbon atoms being more preferred.
[0290] As used herein, “alkenyl,” means a straight or branched hydrocarbon chain radical containing up to twenty four carbon atoms and having at least one carbon-carbon double bond. Examples of alkenyl groups include without limitation, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene and the like. Alkenyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred. Alkenyl groups as used herein may optionally include one or more further substituent groups.
[0291] As used herein, “alkynyl,” means a straight or branched hydrocarbon radical containing up to twenty four carbon atoms and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, without limitation, ethynyl, 1-propynyl, 1-butynyl, and the like. Alkynyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred. Alkynyl groups as used herein may optionally include one or more further substituent groups.
[0292] As used herein, “acyl,” means a radical formed by removal of a hydroxyl group from an organic acid and has the general Formula —C(O)—X where X is typically aliphatic, alicyclic or aromatic. Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic phosphates and the like. Acyl groups as used herein may optionally include further substituent groups.
[0293] As used herein, “alicyclic” means a cyclic ring system wherein the ring is aliphatic. The ring system can comprise one or more rings wherein at least one ring is aliphatic. Preferred alicyclics include rings having from about 5 to about 9 carbon atoms in the ring. Alicyclic as used herein may optionally include further substituent groups.
[0294] As used herein, “aliphatic” means a straight or branched hydrocarbon radical containing up to twenty four carbon atoms wherein the saturation between any two carbon atoms is a single, double or triple bond. An aliphatic group preferably contains from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms with from 1 to about 6 carbon atoms being more preferred. The straight or branched chain of an aliphatic group may be interrupted with one or more heteroatoms that include nitrogen, oxygen, sulfur and phosphorus. Such aliphatic groups interrupted by heteroatoms include without limitation, polyalkoxys, such as polyalkylene glycols, polyamines, and polyimines. Aliphatic groups as used herein may optionally include further substituent groups.
[0295] As used herein, “alkoxy” means a radical formed between an alkyl group and an oxygen atom wherein the oxygen atom is used to attach the alkoxy group to a parent molecule. Examples of alkoxy groups include without limitation, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may optionally include further substituent groups.
[0296] As used herein, “aminoalkyl” means an amino substituted C.sub.1-C.sub.12 alkyl radical. The alkyl portion of the radical forms a covalent bond with a parent molecule. The amino group can be located at any position and the aminoalkyl group can be substituted with a further substituent group at the alkyl and/or amino portions.
[0297] As used herein, “aralkyl” and “arylalkyl” mean an aromatic group that is covalently linked to a C.sub.1-C.sub.12 alkyl radical. The alkyl radical portion of the resulting aralkyl (or arylalkyl) group forms a covalent bond with a parent molecule. Examples include without limitation, benzyl, phenethyl and the like. Aralkyl groups as used herein may optionally include further substituent groups attached to the alkyl, the aryl or both groups that form the radical group.
[0298] As used herein, “aryl” and “aromatic” mean a mono- or polycyclic carbocyclic ring system radicals having one or more aromatic rings. Examples of aryl groups include without limitation, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like. Preferred aryl ring systems have from about 5 to about 20 carbon atoms in one or more rings. Aryl groups as used herein may optionally include further substituent groups.
[0299] As used herein, “halo” and “halogen,” mean an atom selected from fluorine, chlorine, bromine and iodine.
[0300] As used herein, “heteroaryl,” and “heteroaromatic,” mean a radical comprising a mono- or poly-cyclic aromatic ring, ring system or fused ring system wherein at least one of the rings is aromatic and includes one or more heteroatoms. Heteroaryl is also meant to include fused ring systems including systems where one or more of the fused rings contain no heteroatoms. Heteroaryl groups typically include one ring atom selected from sulfur, nitrogen or oxygen. Examples of heteroaryl groups include without limitation, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl, quinoxalinyl and the like. Heteroaryl radicals can be attached to a parent molecule directly or through a linking moiety such as an aliphatic group or hetero atom. Heteroaryl groups as used herein may optionally include further substituent groups.
Oligomeric Compounds
[0301] In certain embodiments, the present invention provides oligomeric compounds. In certain embodiments, such oligomeric compounds comprise oligonucleotides optionally comprising one or more conjugate and/or terminal groups. In certain embodiments, an oligomeric compound consists of an oligonucleotide. In certain embodiments, oligonucleotides comprise one or more chemical modifications. Such chemical modifications include modifications one or more nucleoside (including modifications to the sugar moiety and/or the nucleobase) and/or modifications to one or more internucleoside linkage.
[0302] Certain Sugar Moieties
[0303] In certain embodiments, oligomeric compounds of the invention comprise one or more modified nucleosides comprising a modified sugar moiety. Such oligomeric compounds comprising one or more sugar-modified nucleosides may have desirable properties, such as enhanced nuclease stability or increased binding affinity with a target nucleic acid relative to oligomeric compounds comprising only nucleosides comprising naturally occurring sugar moieties. In certain embodiments, modified sugar moieties are substituted sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of substituted sugar moieties.
[0304] In certain embodiments, modified sugar moieties are substituted sugar moieties comprising one or more substituent, including but not limited to substituents at the 2′ and/or 5′ positions. Examples of sugar substituents suitable for the 2′-position, include, but are not limited to: 2′-F, 2′-OCH.sub.3 (“OMe” or “O-methyl”), and 2′-O(CH.sub.2).sub.2OCH.sub.3 (“MOE”). In certain embodiments, sugar substituents at the 2′ position is selected from allyl, amino, azido, thio, O-allyl, O—C.sub.1-C.sub.10 alkyl, O—C.sub.1-C.sub.10 substituted alkyl; O—C.sub.1-C.sub.10 alkoxy; O—C.sub.1-C.sub.10 substituted alkoxy, OCF.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2—O—N(Rm)(Rn), and O—CH.sub.2—C(═O)—N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted C.sub.1-C.sub.10 alkyl. Examples of sugar substituents at the 5′-position, include, but are not limited to: 5′-methyl (R or S); 5′-vinyl, and 5′-methoxy.
[0305] In certain embodiments, substituted sugars comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties (see, e.g., PCT International Application WO 2008/101157, for additional 5′, 2′-bis substituted sugar moieties and nucleosides).
[0306] Nucleosides comprising 2′-substituted sugar moieties are referred to as 2′-substituted nucleosides. In certain embodiments, a 2′-substituted nucleoside comprises a 2′-substituent group selected from halo, allyl, amino, azido, O—C.sub.1-C.sub.10 alkoxy; O—C.sub.1-C.sub.10 substituted alkoxy, SH, CN, OCN, CF.sub.3, OCF.sub.3, O-alkyl, S-alkyl, N(R.sub.m)-alkyl; O-alkenyl, S-alkenyl, or N(R.sub.m)-alkenyl; O-alkynyl, S-alkynyl, N(R.sub.m)-alkynyl; O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH.sub.2).sub.2SCH.sub.3, O—(CH.sub.2).sub.2—O—N(R.sub.m)(R.sub.n) or O—CH.sub.2—C(═O)—N(R.sub.m)(R.sub.n), where each R.sub.m and R.sub.n is, independently, H, an amino protecting group or substituted or unsubstituted C.sub.1-C.sub.10 alkyl. These 2′-substituent groups can be further substituted with one or more substituent groups independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol, thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and alkynyl.
[0307] In certain embodiments, a 2′-substituted nucleoside comprises a 2′-substituent group selected from F, NH.sub.2, N.sub.3, OCF.sub.3, O—CH.sub.3, O(CH.sub.2).sub.3NH.sub.2, CH.sub.2—CH═CH.sub.2, O—CH.sub.2—CH═CH.sub.2, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O—(CH.sub.2).sub.2—O—N(R.sub.m)(R.sub.n), O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and N-substituted acetamide (O—CH.sub.2—C(═O)—N(R.sub.m)(R.sub.n) where each R.sub.m and R.sub.n is, independently, H, an amino protecting group or substituted or unsubstituted C.sub.1-C.sub.10 alkyl.
[0308] In certain embodiments, a 2′-substituted nucleoside comprises a sugar moiety comprising a 2′-substituent group selected from F, OCF.sub.3, O—CH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3, O—(CH.sub.2).sub.2—O—N(CH.sub.3).sub.2, —O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and O—CH.sub.2—C(═O)—N(H)CH.sub.3.
[0309] In certain embodiments, a 2′-substituted nucleoside comprises a sugar moiety comprising a 2′-substituent group selected from F, O—CH.sub.3, and OCH.sub.2CH.sub.2OCH.sub.3.
[0310] Certain modified sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms. Examples of such 4′ to 2′ sugar substituents, include, but are not limited to: —[C(R.sub.a)(R.sub.b)].sub.n—, —[C(R.sub.a)(R.sub.b)].sub.n—O—, —C(R.sub.aR.sub.b)—N(R)—O— or, —C(R.sub.aR.sub.b)—O—N(R)—; 4′-(CH.sub.2).sub.2-2′, 4′—(CH.sub.2)—O-2′ (LNA); 4′—(CH.sub.2)—S-2; 4′—(CH.sub.2).sub.2—O-2′ (ENA); 4′-CH(CH.sub.3)—O-2′ (cEt) and 4′-CH(CH.sub.2OCH.sub.3)—O-2′, and analogs thereof (see, e.g., U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008); 4′-C(CH.sub.3)(CH.sub.3)—O-2′ and analogs thereof, (see, e.g., WO2009/006478, published Jan. 8, 2009); 4′-CH.sub.2—N(OCH.sub.3)-2′ and analogs thereof (see, e.g., WO2008/150729, published Dec. 11, 2008); 4′-CH.sub.2—O—N(CH.sub.3)-2′ (see, e.g., US2004/0171570, published Sep. 2, 2004); 4′-CH.sub.2—O—N(R)-2′, and 4′-CH.sub.2—N(R)—O-2′-, wherein each R is, independently, H, a protecting group, or C.sub.1-C.sub.12 alkyl; 4′-CH.sub.2—N(R)—O-2′, wherein R is H, C.sub.1-C.sub.12 alkyl, or a protecting group (see, U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008); 4′-CH.sub.2—C(H)(CH.sub.3)-2′ (see, e.g., Chattopadhyaya, et al., J. Org. Chem., 2009, 74, 118-134); and 4′-CH.sub.2—C(═CH.sub.2)-2′ and analogs thereof (see, published PCT International Application WO 2008/154401, published on Dec. 8, 2008).
[0311] In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from —[C(R.sub.a)(R.sub.b)].sub.n—, —C(R.sub.a)═C(R.sub.b)—, —C(R.sub.a)═N—, —C(═NR.sub.a)—, —C(═O)—, —C(═S)—, —O—, —Si(R.sub.a).sub.2—, —S(═O).sub.x—, and —N(R.sub.a)—;
[0312] wherein:
[0313] x is 0, 1, or 2;
[0314] n is 1, 2, 3, or 4;
[0315] each R.sub.a and R.sub.b is, independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O).sub.2-J.sub.1), or sulfoxyl (S(═O)-J.sub.1); and each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkyl, or a protecting group.
[0316] Nucleosides comprising bicyclic sugar moieties are referred to as bicyclic nucleosides or BNAs. Bicyclic nucleosides include, but are not limited to, (A) α-L-Methyleneoxy (4′-CH.sub.2—O-2′) BNA, (B) β-D-Methyleneoxy (4′-CH.sub.2—O-2′) BNA (also referred to as locked nucleic acid or LNA), (C) Ethyleneoxy (4′-(CH.sub.2).sub.2—O-2′) BNA, (D) Aminooxy (4′-CH.sub.2—O—N(R)-2′) BNA, (E) Oxyamino (4′-CH.sub.2—N(R)—O-2′) BNA, (F) Methyl(methyleneoxy) (4′-CH(CH.sub.3)—O-2′) BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4′-CH.sub.2—S-2′) BNA, (H) methylene-amino (4′-CH.sub.2—N(R)-2′) BNA, (I) methyl carbocyclic (4′-CH.sub.2—CH(CH.sub.3)-2′) BNA, and (J) propylene carbocyclic (4′-(CH.sub.2).sub.3-2′) BNA as depicted below.
##STR00001## ##STR00002##
wherein Bx is a nucleobase moiety and R is, independently, H, a protecting group, or C.sub.1-C.sub.12 alkyl.
[0317] Additional bicyclic sugar moieties are known in the art, for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Pat. Nos. 7,053,207, 6,268,490, 6,770,748, 6,794,499, 7,034,133, 6,525,191, 6,670,461, and 7,399,845; WO 2004/106356, WO 1994/14226, WO 2005/021570, and WO 2007/134181; U.S. Patent Publication Nos. US2004/0171570, US2007/0287831, and US2008/0039618; U.S. patent application Ser. Nos. 12/129,154, 60/989,574, 61/026,995, 61/026,998, 61/056,564, 61/086,231, 61/097,787, and 61/099,844; and PCT International Applications Nos. PCT/US2008/064591, PCT/US2008/066154, and PCT/US2008/068922.
[0318] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, a nucleoside comprising a 4′-2′ methylene-oxy bridge, may be in the α-L configuration or in the β-D configuration. Previously, α-L-methyleneoxy (4′-CH.sub.2—O-2′) bicyclic nucleosides have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).
[0319] In certain embodiments, substituted sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars). (see, PCT International Application WO 2007/134181, published on Nov. 22, 2007, wherein LNA is substituted with, for example, a 5′-methyl or a 5′-vinyl group).
[0320] In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the naturally occurring sugar is substituted, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moiety also comprises bridging and/or non-bridging substituents as described above. For example, certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2′-position (see, e.g., published U.S. Patent Application US2005/0130923, published on Jun. 16, 2005) and/or the 5′ position. By way of additional example, carbocyclic bicyclic nucleosides having a 4′-2′ bridge have been described (see, e.g., Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740).
[0321] In certain embodiments, sugar surrogates comprise rings having other than 5-atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran. Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, C J. Bioorg. & Med. Chem. (2002) 10:841-854), fluoro HNA (F-HNA), and those compounds having Formula VII:
##STR00003##
wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula VII:
[0322] Bx is a nucleobase moiety;
[0323] T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′-terminal group; q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each, independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or substituted C.sub.2-C.sub.6 alkynyl; and
[0324] each of R.sub.1 and R.sub.2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(═X)J.sub.1, OC(═X)NJ.sub.1J.sub.2, NJ.sub.3C(═X)NJ.sub.1J.sub.2, and CN, wherein X is O, S or NJ.sub.1, and each J.sub.1, J.sub.2, and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.
[0325] In certain embodiments, the modified THP nucleosides of Formula VII are provided wherein q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is other than H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of R.sub.1 and R.sub.2 is F. In certain embodiments, R.sub.1 is fluoro and R.sub.2 is H, R.sub.1 is methoxy and R.sub.2 is H, and R.sub.1 is methoxyethoxy and R.sub.2 is H.
[0326] Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used to modify nucleosides (see, e.g., review article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002, 10, 841-854).
[0327] In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Pat. Nos. 5,698,685; 5,166,315; 5,185,444; and 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:
##STR00004##
In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.”
[0328] Combinations of modifications are also provided without limitation, such as 2′-F-5′-methyl substituted nucleosides (see PCT International Application WO 2008/101157 Published on Aug. 21, 2008 for other disclosed 5′, 2′-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2′-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) or alternatively 5′-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007/134181, published on Nov. 22, 2007 wherein a 4′-CH.sub.2—O-2′ bicyclic nucleoside is further substituted at the 5′ position with a 5′-methyl or a 5′-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).
[0329] Certain Nucleobases
[0330] In certain embodiments, nucleosides of the present invention comprise one or more unmodified nucleobases. In certain embodiments, nucleosides of the present invention comprise one or more modified nucleobases.
[0331] In certain embodiments, modified nucleobases are selected from: universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein. 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil; 5-propynylcytosine; 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl CH.sub.3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, 3-deazaguanine and 3-deazaadenine, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine([5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3′,2′:4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288.
[0332] Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, U.S. Pat. Nos. 3,687,808; 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,645,985; 5,681,941; 5,750,692; 5,763,588; 5,830,653 and 6,005,096, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
[0333] Certain Internucleoside Linkages
[0334] In certain embodiments, the present invention provides oligomeric compounds comprising linked nucleosides. In such embodiments, nucleosides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters (P═O), phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates (P═S). Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (—CH.sub.2—N(CH.sub.3)—O—CH.sub.2—), thiodiester (—O—C(O)—S—), thionocarbamate (—O—C(O)(NH)—S—); siloxane (—O—Si(H).sub.2—O—); and N,N′-dimethylhydrazine (—CH.sub.2—N(CH.sub.3)—N(CH.sub.3)—). Modified linkages, compared to natural phosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the oligomeric compound. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.
[0335] The oligonucleotides described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), α or β such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the antisense compounds provided herein are all such possible isomers, as well as their racemic and optically pure forms.
[0336] Neutral internucleoside linkages include without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH.sub.2—N(CH.sub.3)—O-5′), amide-3 (3′-CH.sub.2—C(═O)—N(H)-5′), amide-4 (3′-CH.sub.2—N(H)—C(═O)-5′), formacetal (3′-O—CH.sub.2—O-5′), and thioformacetal (3′-S—CH.sub.2—O-5′). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH.sub.2 component parts.
[0337] Certain Motifs
[0338] In certain embodiments, the present invention provides oligomeric compounds comprising oligonucleotides. In certain embodiments, such oligonucleotides comprise one or more chemical modification. In certain embodiments, chemically modified oligonucleotides comprise one or more modified nucleosides. In certain embodiments, chemically modified oligonucleotides comprise one or more modified nucleosides comprising modified sugars. In certain embodiments, chemically modified oligonucleotides comprise one or more modified nucleosides comprising one or more modified nucleobases. In certain embodiments, chemically modified oligonucleotides comprise one or more modified internucleoside linkages. In certain embodiments, the chemically modifications (sugar modifications, nucleobase modifications, and/or linkage modifications) define a pattern or motif. In certain embodiments, the patterns of chemical modifications of sugar moieties, internucleoside linkages, and nucleobases are each independent of one another. Thus, an oligonucleotide may be described by its sugar modification motif, internucleoside linkage motif and/or nucleobase modification motif (as used herein, nucleobase modification motif describes the chemical modifications to the nucleobases independent of the sequence of nucleobases).
[0339] Certain Sugar Motifs
[0340] In certain embodiments, oligonucleotides comprise one or more type of modified sugar moieties and/or naturally occurring sugar moieties arranged along an oligonucleotide or region thereof in a defined pattern or sugar modification motif. Such motifs may include any of the sugar modifications discussed herein and/or other known sugar modifications.
[0341] In certain embodiments, the oligonucleotides comprise or consist of a region having a gapmer sugar modification motif, which comprises two external regions or “wings” and an internal region or “gap.” The three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3′-most nucleoside of the 5′-wing and the 5′-most nucleoside of the 3′-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap. In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar modification motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar modification motifs of the 5′-wing differs from the sugar modification motif of the 3′-wing (asymmetric gapmer). In certain embodiments, oligonucleotides comprise 2′-MOE modified nucleosides in the wings and 2′-F modified nucleosides in the gap.
[0342] In certain embodiments, oligonucleotides are fully modified. In certain such embodiments, oligonucleotides are uniformly modified. In certain embodiments, oligonucleotides are uniform 2′-MOE. In certain embodiments, oligonucleotides are uniform 2′-F. In certain embodiments, oligonucleotides are uniform morpholino. In certain embodiments, oligonucleotides are uniform BNA. In certain embodiments, oligonucleotides are uniform LNA. In certain embodiments, oligonucleotides are uniform cEt.
[0343] In certain embodiments, oligonucleotides comprise a uniformly modified region and additional nucleosides that are unmodified or differently modified. In certain embodiments, the uniformly modified region is at least 5, 10, 15, or 20 nucleosides in length. In certain embodiments, the uniform region is a 2′-MOE region. In certain embodiments, the uniform region is a 2′-F region. In certain embodiments, the uniform region is a morpholino region. In certain embodiments, the uniform region is a BNA region. In certain embodiments, the uniform region is a LNA region. In certain embodiments, the uniform region is a cEt region.
[0344] In certain embodiments, the oligonucleotide does not comprise more than 4 contiguous unmodified 2′-deoxynucleosides. In certain circumstances, antisesense oligonucleotides comprising more than 4 contiguous 2′-deoxynucleosides activate RNase H, resulting in cleavage of the target RNA. In certain embodiments, such cleavage is avoided by not having more than 4 contiguous 2′-deoxynucleosides, for example, where alteration of splicing and not cleavage of a target RNA is desired.
[0345] Certain Internucleoside Linkage Motifs
[0346] In certain embodiments, oligonucleotides comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif. In certain embodiments, internucleoside linkages are arranged in a gapped motif, as described above for sugar modification motif. In such embodiments, the internucleoside linkages in each of two wing regions are different from the internucleoside linkages in the gap region. In certain embodiments the internucleoside linkages in the wings are phosphodiester and the internucleoside linkages in the gap are phosphorothioate. The sugar modification motif is independently selected, so such oligonucleotides having a gapped internucleoside linkage motif may or may not have a gapped sugar modification motif and if it does have a gapped sugar motif, the wing and gap lengths may or may not be the same.
[0347] In certain embodiments, oligonucleotides comprise a region having an alternating internucleoside linkage motif. In certain embodiments, oligonucleotides of the present invention comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate.
[0348] In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3′ end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3′ end of the oligonucleotide.
[0349] In certain embodiments, compounds and compositions, including modified oligonucleotides, are delivered to the CNS. In certain embodiments, compounds and compositions, including modified oligonucleotides, are delivered to the CNS via intracerebroventricular administration or intracerebroventricular bolus administration. In certain embodiments, one or more modified oligonucleotides may exhibit high potency and high selectivity toward a nucleic acid target, but may possess certain degrees of acute toxicity when delivered into the CNS via intracerebroventricular administration. In certain embodiments, introduction of one or more modifications to the internucleoside linkages of the modified oligonucleotide ameliorates or reduces acute toxicity associated with CNS delivery via intracerebroventricular administration. In certain embodiments, introduction of one or more phosphodiester internucleoside linkages into the modified oligonucleotide ameliorates or reduces acute toxicity associated with CNS delivery via intracerebroventricular administration.
[0350] In certain embodiments, an oligomeric compound has an internucleoside linkage motif selected from the table below, wherein each “N” represents a nucleoside, each subscript “s” represents a phosphorothioate internucleoside linkage, and each subscript “o” represents a phosphodiester internucleoside linkage:
TABLE-US-00001 Internucleoside Linkage Motifs N.sub.SN.sub.SN.sub.ON.sub.SN.sub.ON.sub.SN.sub.ON.sub.SN.sub.ON.sub.SN.sub.ON.sub.SN.sub.ON.sub.SN.sub.ON.sub.SN.sub.SN N.sub.SN.sub.ON.sub.ON.sub.ON.sub.SN.sub.SN.sub.SN.sub.SN.sub.SN.sub.SN.sub.SN.sub.SN.sub.ON.sub.ON.sub.ON.sub.SN.sub.SN
[0351] In certain embodiments, the inclusion of 3, 4, 5, 6, 7, 8, or 9 phosphodiester internucleoside linkages into the modified oligonucleotide ameliorates or reduces acute toxicity associated with CNS delivery via intracerebroventricular administration.
[0352] Certain Nucleobase Modification Motifs
[0353] In certain embodiments, oligonucleotides comprise chemical modifications to nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or nucleobases modification motif. In certain such embodiments, nucleobase modifications are arranged in a gapped motif. In certain embodiments, nucleobase modifications are arranged in an alternating motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is chemically modified.
[0354] In certain embodiments, oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleotides of the 3′-end of the oligonucleotide. In certain such embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleotides of the 5′-end of the oligonucleotide.
[0355] In certain embodiments, nucleobase modifications are a function of the natural base at a particular position of an oligonucleotide. For example, in certain embodiments each purine or each pyrimidine in an oligonucleotide is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each cytosine is modified. In certain embodiments, each uracil is modified.
[0356] In certain embodiments, some, all, or none of the cytosine moieties in an oligonucleotide are 5-methyl cytosine moieties. Herein, 5-methyl cytosine is not a “modified nucleobase.” Accordingly, unless otherwise indicated, unmodified nucleobases include both cytosine residues having a 5-methyl and those lacking a 5 methyl. In certain embodiments, the methylation state of all or some cytosine nucleobases is specified.
[0357] Certain Overall Lengths
[0358] In certain embodiments, the present invention provides oligomeric compounds including oligonucleotides of any of a variety of ranges of lengths. In certain embodiments, the invention provides oligomeric compounds or oligonucleotides consisting of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X<Y. For example, in certain embodiments, the invention provides oligomeric compounds which comprise oligonucleotides consisting of 8 to 9, 8 to 10, 8 to 11, 8 to 12, 8 to 13, 8 to 14, 8 to 15, 8 to 16, 8 to 17, 8 to 18, 8 to 19, 8 to 20, 8 to 21, 8 to 22, 8 to 23, 8 to 24, 8 to 25, 8 to 26, 8 to 27, 8 to 28, 8 to 29, 8 to 30, 9 to 10, 9 to 11, 9 to 12, 9 to 13, 9 to 14, 9 to 15, 9 to 16, 9 to 17, 9 to 18, 9 to 19, 9 to 20, 9 to 21, 9 to 22, 9 to 23, 9 to 24, 9 to 25, 9 to 26, 9 to 27, 9 to 28, 9 to 29, 9 to 30, 10 to 11, 10 to 12, 10 to 13, 10 to 14, 10 to 15, 10 to 16, 10 to 17, 10 to 18, 10 to 19, 10 to 20, 10 to 21, 10 to 22, 10 to 23, 10 to 24, 10 to 25, 10 to 26, 10 to 27, 10 to 28, 10 to 29, 10 to 30, 11 to 12, 11 to 13, 11 to 14, 11 to 15, 11 to 16, 11 to 17, 11 to 18, 11 to 19, 11 to 20, 11 to 21, 11 to 22, 11 to 23, 11 to 24, 11 to 25, 11 to 26, 11 to 27, 11 to 28, 11 to 29, 11 to 30, 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides. In embodiments where the number of nucleosides of an oligomeric compound or oligonucleotide is limited, whether to a range or to a specific number, the oligomeric compound or oligonucleotide may, nonetheless further comprise additional other substituents. For example, an oligonucleotide comprising 8-30 nucleosides excludes oligonucleotides having 31 nucleosides, but, unless otherwise indicated, such an oligonucleotide may further comprise, for example one or more conjugates, terminal groups, or other substituents. In certain embodiments, a gapmer oligonucleotide has any of the above lengths.
[0359] One of skill in the art will appreciate that certain lengths may not be possible for certain motifs. For example: a gapmer having a 5′-wing region consisting of four nucleotides, a gap consisting of at least six nucleotides, and a 3′-wing region consisting of three nucleotides cannot have an overall length less than 13 nucleotides. Thus, one would understand that the lower length limit is 13 and that the limit of 10 in “10-20” has no effect in that embodiment.
[0360] Further, where an oligonucleotide is described by an overall length range and by regions having specified lengths, and where the sum of specified lengths of the regions is less than the upper limit of the overall length range, the oligonucleotide may have additional nucleosides, beyond those of the specified regions, provided that the total number of nucleosides does not exceed the upper limit of the overall length range. For example, an oligonucleotide consisting of 20-25 linked nucleosides comprising a 5′-wing consisting of 5 linked nucleosides; a 3′-wing consisting of 5 linked nucleosides and a central gap consisting of 10 linked nucleosides (5+5+10=20) may have up to 5 nucleosides that are not part of the 5′-wing, the 3′-wing, or the gap (before reaching the overall length limitation of 25). Such additional nucleosides may be 5′ of the 5′-wing and/or 3′ of the 3′ wing.
[0361] Certain Oligonucleotides
[0362] In certain embodiments, oligonucleotides of the present invention are characterized by their sugar motif, internucleoside linkage motif, nucleobase modification motif and overall length. In certain embodiments, such parameters are each independent of one another. Thus, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. Thus, the internucleoside linkages within the wing regions of a sugar-gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region. Likewise, such sugar-gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Herein if a description of an oligonucleotide or oligomeric compound is silent with respect to one or more parameter, such parameter is not limited. Thus, an oligomeric compound described only as having a gapmer sugar motif without further description may have any length, internucleoside linkage motif, and nucleobase modification motif. Unless otherwise indicated, all chemical modifications are independent of nucleobase sequence.
[0363] Certain Conjugate Groups
[0364] In certain embodiments, oligomeric compounds are modified by attachment of one or more conjugate groups. In general, conjugate groups modify one or more properties of the attached oligomeric compound including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, cellular distribution, cellular uptake, charge and clearance. Conjugate groups are routinely used in the chemical arts and are linked directly or via an optional conjugate linking moiety or conjugate linking group to a parent compound such as an oligomeric compound, such as an oligonucleotide. Conjugate groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes. Certain conjugate groups have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).
[0365] In certain embodiments, a conjugate group comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
[0366] In certain embodiments, conjugate groups are directly attached to oligonucleotides in oligomeric compounds. In certain embodiments, conjugate groups are attached to oligonucleotides by a conjugate linking group. In certain such embodiments, conjugate linking groups, including, but not limited to, bifunctional linking moieties such as those known in the art are amenable to the compounds provided herein. Conjugate linking groups are useful for attachment of conjugate groups, such as chemical stabilizing groups, functional groups, reporter groups and other groups to selective sites in a parent compound such as for example an oligomeric compound. In general a bifunctional linking moiety comprises a hydrocarbyl moiety having two functional groups. One of the functional groups is selected to bind to a parent molecule or compound of interest and the other is selected to bind essentially any selected group such as chemical functional group or a conjugate group. In some embodiments, the conjugate linker comprises a chain structure or an oligomer of repeating units such as ethylene glycol or amino acid units. Examples of functional groups that are routinely used in a bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In some embodiments, bifunctional linking moieties include amino, hydroxyl, carboxylic acid, thiol, unsaturations (e.g., double or triple bonds), and the like.
[0367] Some nonlimiting examples of conjugate linking moieties include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other linking groups include, but are not limited to, substituted C.sub.1-C.sub.10 alkyl, substituted or unsubstituted C.sub.2-C.sub.10 alkenyl or substituted or unsubstituted C.sub.2-C.sub.10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
[0368] Conjugate groups may be attached to either or both ends of an oligonucleotide (terminal conjugate groups) and/or at any internal position.
[0369] In certain embodiments, conjugate groups are at the 3′-end of an oligonucleotide of an oligomeric compound. In certain embodiments, conjugate groups are near the 3′-end. In certain embodiments, conjugates are attached at the 3′end of an oligomeric compound, but before one or more terminal group nucleosides. In certain embodiments, conjugate groups are placed within a terminal group.
[0370] In certain embodiments, the present invention provides oligomeric compounds. In certain embodiments, oligomeric compounds comprise an oligonucleotide. In certain embodiments, an oligomeric compound comprises an oligonucleotide and one or more conjugate and/or terminal groups. Such conjugate and/or terminal groups may be added to oligonucleotides having any of the chemical motifs discussed above. Thus, for example, an oligomeric compound comprising an oligonucleotide having region of alternating nucleosides may comprise a terminal group.
Antisense Compounds
[0371] In certain embodiments, oligomeric compounds of the present invention are antisense compounds. Such antisense compounds are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, antisense compounds specifically hybridize to one or more target nucleic acid. In certain embodiments, a specifically hybridizing antisense compound has a nucleobase sequence comprising a region having sufficient complementarity to a target nucleic acid to allow hybridization and result in antisense activity and insufficient complementarity to any non-target so as to avoid non-specific hybridization to any non-target nucleic acid sequences under conditions in which specific hybridization is desired (e.g., under physiological conditions for in vivo or therapeutic uses, and under conditions in which assays are performed in the case of in vitro assays).
[0372] In certain embodiments, the present invention provides antisense compounds comprising oligonucleotides that are fully complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are 95% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 90% complementary to the target nucleic acid.
[0373] In certain embodiments, such oligonucleotides are 85% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 80% complementary to the target nucleic acid. In certain embodiments, an antisense compound comprises a region that is fully complementary to a target nucleic acid and is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain such embodiments, the region of full complementarity is from 6 to 14 nucleobases in length.
[0374] In certain embodiments antisense compounds and antisense oligonucleotides comprise single-strand compounds. In certain embodiments antisense compounds and antisense oligonucleotides comprise double-strand compounds.
[0375] Certain Modified Oligonucleotides
[0376] In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 31. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 33. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO.34. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO.35. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 36. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 37. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 45.
[0377] In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 72. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 79. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 82. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 83. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 97. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 106. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 107. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 112. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 113. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 130. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 140.
[0378] In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 141. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 142. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 143. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 144. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 145. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 146. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 147. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 148. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 149.
[0379] In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 150. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 151. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 152. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 153. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 157. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 158. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 160. In certain embodiments, a modified oligonucleotide has the sequence of SEQ ID NO. 200.
[0380] Certain Pathways and Mechanisms Associated with Neurodegenerative Disorders
[0381] In certain embodiments, a neurodegenerative syndrome or disorder may be any neurodegenerative syndrome or disorder associated with Tau. Non limiting examples of a neurodegenerative disorder associated with Tau may include Alzheimer's disease, progressive supranuclear palsy, dementia pugilistica, frontotemporal dementia, parkinsonism linked to chromosome, Lytico-Bodig disease, tangle-predominant dementia, ganglioglioma, gangliocytoma, meningioangiomatosis, subacute sclerosing panencephalitis, lead encephalopathy, tuberous sclerosis, Hallervorden-Spatz disease, Pick's disease, corticobasal ganglionic degeneration, argyrophilic grain disease, supranuclear palsy, corticobasal degeneration, frontotemporal dementia, or frontotemporal lobar degeneration. In some embodiments, the method of the invention comprises modifying frontotemporal dementia (FTD). In other embodiments, the method of the invention comprises modifying Alzheimer's disease (AD). In yet other embodiments, the method of the invention comprises modifying progressive supranuclear palsy. In other embodiments, the method of the invention comprises modifying corticobasalganglionic degeneration.
[0382] In certain embodiments, described herein are compositions and methods of modifying a neurodegenerative syndrome by altering the splicing of a nucleic acid encoding Tau. Tau is a protein found in multiple tissues, but is particularly abundant in axons of neurons. The primary function of Tau is to bind to and stabilize microtubules, which are important structural components of the cytoskeleton involved in mitosis, cytokinesis and vesicular transport. In humans, there are six isoforms of Tau that are generated by alternative splicing of exons 2, 3, and 10. Splicing of exons 2 and 3 at the N-terminus of the protein leads to inclusion of zero, one or two 29 amino acid, acidic domains and is termed 0N, 1N, or 2N Tau respectively. Inclusion of exon 10 at the C-terminus leads to inclusion of the microtubule binding domain encoded by exon 10. Since there are 3 mictrotubule binding domains elsewhere in Tau, this Tau isoform (with exon 10 included) is termed 4R Tau, where R refers to the number of repeats of microtubule binding domains. (
[0383] In certain embodiments, the 4R:3R Tau ratio in the central nervous system of the subject may be normal, low or high. As used herein, a “normal 4R:3R Tau ratio” in the central nervous system signifies a 4R:3R Tau ratio in the central nervous system that is substantially the same as the 4R:3R Tau ratio in the central nervous system of a subject from the same species and of approximately the same age not suffering from a neurodegenerative disease. In certain embodiments, certain antisense oligonucleotide compositions and/or methods decrease the normal 4R:3R Tau ratio in the central nervous system of a subject. In other embodiments, certain antisense oligonucleotide compositions and/or methods decreases a low 4R:3R Tau ratio in the central nervous system of a subject.
[0384] In certain embodiments, certain antisense oligonucleotide compositions and/or methods decrease a high 4R:3R Tau ratio in the central nervous system of a subject. In certain embodiments, certain antisense oligonucleotide compositions and/or methods decreases a high 4R:3R Tau ratio caused by a defect in splicing of the nucleic acid encoding Tau in the subject. Defects in splicing of the nucleic acid encoding Tau in the subject may be caused, for instance, by genetic mutations altering the splicing of the nucleic acid encoding Tau and leading to a high 4R:3R Tau ratio. A mutation may be either a substitution mutation or a deletion mutation which creates a new, aberrant, splice element. Non-limiting examples of genetic mutations that may alter the splicing of the nucleic acid encoding Tau and lead to a high 4R:3R Tau ratio may include N279K, P301S, 280, L284L, N296H, N296N, 296N, P301S, G303V, E10+11, E10+12, E10+13, E+10+14 and E10+16, and E10+19.
[0385] In certain embodiments, administration of an antisense oligonucleotide decreases the 4R:3R Tau ratio in the central nervous system of a subject by altering the splicing of a nucleic acid encoding Tau.
[0386] In certain embodiments, increasing exclusion of exon 10 of a Tau transcript inhibits one or more tau-associated disorders. In certain embodiments, the tau-associated disorder may be any of Alzheimer's Disease, frontotemporal Dementia (FTD), FTDP-17, Progressive Supranuclear Palsy (PSP), Chronic Traumatic Encephalopathy (CTE), Corticobasal Ganglionic Degeneration (CBD), epilepsy, Dravet's Syndrome, dementia pugilistica, parkinsonism linked to chromosome, Lytico-Bodig disease, tangle-predominant dementia, ganglioglioma, gangliocytoma, meningioangiomatosis, subacute sclerosing panencephalitis, lead encephalopathy, tuberous sclerosis, Hallervorden-Spatz disease, Pick's disease, argyrophilic grain disease, supranuclear palsy, corticobasal degeneration, or frontotemporal lobar degeneration.
[0387] Certain Target Nucleic Acids and Mechanisms
[0388] In certain embodiments, antisense compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target nucleic acid is a tau transcript. In certain embodiments, the target RNA is a Tau pre-mRNA.
[0389] In certain embodiments, an antisense compound is complementary to a region of Tau pre-mRNA. In certain embodiments, an antisense compound is complementary within a region of Tau pre-mRNA comprising an exon encoding the 4R isoform. In certain embodiments, an antisense compound is complementary to a region of Tau pre-mRNA comprising an intron-exon splice junction. In certain embodiments, an antisense compound is complementary to a region of Tau pre-mRNA comprising the intron-exon splice junction adjacent to exon 10. In certain embodiments, an antisense compound is complementary to a region of Tau pre-mRNA comprising the intron-exon splice junction between intron 9 and exon 10. In certain embodiments, an antisense compound is complementary to a region of Tau pre-mRNA comprising the intron-exon splice junction between exon 10 and intron 10. In certain embodiments, an antisense compound is complementary within a region of Tau pre-mRNA consisting of exon 10.
[0390] In certain embodiments, an antisense compound is complementary within a region of Tau pre-mRNA comprising an exonic splicing silencer within exon 10. In certain embodiments, an antisense compound is complementary within a region of Tau pre-mRNA comprising an exonic splicing enhancer within exon 10.
[0391] In certain embodiments, an antisense compound comprises a modified oligonucleotide consisting of 8 to 30 linked nucleosides and having a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region of equal length of a Tau transcript.
[0392] In certain embodiments, the target region is within nucleobase 121708 and nucleobase 122044 of SEQ ID NO: 1. In certain embodiments, the target region is within nucleobase 121796 and nucleobase 122044 of SEQ ID NO: 1. In certain embodiments, the target region is within nucleobase 121796 and nucleobase 121885 of SEQ ID NO: 1. In certain embodiments, the target region is within nucleobase 121873 and nucleobase 121898 of SEQ ID NO: 1. In certain embodiments, the target region is within nucleobase 121869 and nucleobase 121943 of SEQ ID NO: 1. In certain embodiments, the target region is within nucleobase 122020 and nucleobase 122044 of SEQ ID NO: 1. In certain embodiments, the target region is within nucleobase 121881 and nucleobase 121898 of SEQ ID NO: 1. In certain embodiments, the target region is within nucleobase 121880 and nucleobase 121897 of SEQ ID NO: 1. In certain embodiments, the target region is within nucleobase 121879 and nucleobase 121896 of SEQ ID NO: 1.
[0393] In certain embodiments, the target region is within nucleobase 121878 and nucleobase 121895 of SEQ ID NO: 1. In certain embodiments, the target region is within nucleobase 121877 and nucleobase 121894 of SEQ ID NO: 1. In certain embodiments, the target region is within nucleobase 121876 and nucleobase 121893 of SEQ ID NO: 1. In certain embodiments, the target region is within nucleobase 121875 and nucleobase 121892 of SEQ ID NO: 1. In certain embodiments, the target region is within nucleobase 121874 and nucleobase 121891 of SEQ ID NO: 1. In certain embodiments, the target region is within nucleobase 121873 and nucleobase 121890 of SEQ ID NO: 1.
[0394] In certain embodiments, an antisense oligonucleotide modulates splicing of a pre-mRNA. In certain embodiments, an antisense oligonucleotide modulates splicing a Tau pre-mRNA. In certain embodiments, an antisense oligonucleotide increases the amount of Tau 3R mRNA. In certain embodiments, an antisense oligonucleotide increases the exclusion of exon 10 in Tau mRNA. In certain embodiments, an antisense oligonucleotide decreases the inclusion of exon 10 in Tau mRNA. In certain embodiments, an antisense oligonucleotide increases the amount of 3R Tau mRNA. In certain embodiments, an antisense oligonucleotide decreases the amount of 4R Tau mRNA.
[0395] In certain embodiments it is desirable to alter the splicing of Tau pre-mRNA to exclude exon 10. By altering the splicing of Tau pre-mRNA to exclude exon 10, expression of 3R Tau will increase and expression of 4R Tau will decrease. In certain embodiments it is desirable to alter the splicing of Tau pre-mRNA to decrease expression of 4R Tau.
[0396] In certain embodiments, an antisense oligonucleotide decreases the amount of Tau 3R mRNA. In certain embodiments, an antisense oligonucleotide decreases the exclusion of exon 10 in Tau mRNA. In certain embodiments, an antisense oligonucleotide increases the inclusion of exon 10 in Tau mRNA. In certain embodiments, an antisense oligonucleotide decreases the amount of 3R Tau mRNA. In certain embodiments, an antisense oligonucleotide increases the amount of 4R Tau mRNA. In certain embodiments it is desirable to alter the splicing of Tau pre-mRNA to include exon 10, for example to produce a phenotypic effect in a mouse or animal model.
Certain Pharmaceutical Compositions
[0397] In certain embodiments, the present invention provides pharmaceutical compositions comprising one or more antisense compound. In certain embodiments, such pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more antisense compound. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more antisense compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more antisense compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one or more antisense compound and sterile water. In certain embodiments, the sterile saline is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more antisense compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more antisense compound and sterile phosphate-buffered saline (PBS). In certain embodiments, the sterile saline is pharmaceutical grade PBS.
[0398] In certain embodiments, antisense compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
[0399] Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising antisense compounds comprise one or more oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
[0400] A prodrug can include the incorporation of additional nucleosides at one or both ends of an oligomeric compound which are cleaved by endogenous nucleases within the body, to form the active antisense oligomeric compound.
[0401] Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
[0402] In certain embodiments, pharmaceutical compositions provided herein comprise one or more modified oligonucleotides and one or more excipients. In certain such embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
[0403] In certain embodiments, a pharmaceutical composition provided herein comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.
[0404] In certain embodiments, a pharmaceutical composition provided herein comprises one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
[0405] In certain embodiments, a pharmaceutical composition provided herein comprises a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80™ and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
[0406] In certain embodiments, a pharmaceutical composition provided herein is prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration.
[0407] In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, such suspensions may also contain suitable stabilizers or agents that increase the solubility of the pharmaceutical agents to allow for the preparation of highly concentrated solutions.
[0408] In certain embodiments, a pharmaceutical composition is prepared for transmucosal administration. In certain of such embodiments penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
[0409] In certain embodiments, a pharmaceutical composition provided herein comprises an oligonucleotide in a therapeutically effective amount. In certain embodiments, the therapeutically effective amount is sufficient to prevent, alleviate or ameliorate symptoms of a disease or to prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art.
[0410] In certain embodiments, one or more modified oligonucleotide provided herein is formulated as a prodrug. In certain embodiments, upon in vivo administration, a prodrug is chemically converted to the biologically, pharmaceutically or therapeutically more active form of an oligonucleotide. In certain embodiments, prodrugs are useful because they are easier to administer than the corresponding active form. For example, in certain instances, a prodrug may be more bioavailable (e.g., through oral administration) than is the corresponding active form. In certain instances, a prodrug may have improved solubility compared to the corresponding active form. In certain embodiments, prodrugs are less water soluble than the corresponding active form. In certain instances, such prodrugs possess superior transmittal across cell membranes, where water solubility is detrimental to mobility. In certain embodiments, a prodrug is an ester. In certain such embodiments, the ester is metabolically hydrolyzed to carboxylic acid upon administration. In certain instances the carboxylic acid containing compound is the corresponding active form. In certain embodiments, a prodrug comprises a short peptide (polyaminoacid) bound to an acid group. In certain of such embodiments, the peptide is cleaved upon administration to form the corresponding active form.
[0411] In certain embodiments, the present invention provides compositions and methods for reducing the amount or activity of a target nucleic acid in a cell. In certain embodiments, the cell is in an animal. In certain embodiments, the animal is a mammal. In certain embodiments, the animal is a rodent. In certain embodiments, the animal is a primate. In certain embodiments, the animal is a non-human primate. In certain embodiments, the animal is a human.
[0412] In certain embodiments, the present invention provides methods of administering a pharmaceutical composition comprising an oligomeric compound of the present invention to an animal. Suitable administration routes include, but are not limited to, oral, rectal, transmucosal, intestinal, enteral, topical, suppository, through inhalation, intrathecal, intracerebroventricular, intraperitoneal, intranasal, intraocular, intratumoral, and parenteral (e.g., intravenous, intramuscular, intramedullary, and subcutaneous). In certain embodiments, pharmaceutical intrathecals are administered to achieve local rather than systemic exposures. For example, pharmaceutical compositions may be injected directly in the area of desired effect (e.g., into the eyes, ears).
[0413] In certain embodiments, a pharmaceutical composition is administered to an animal having at least one Tau-associated disorder. In certain embodiments, such administration results in reduction in expression of the 4R isoform. In certain embodiments, a pharmaceutical composition is administered to an animal having at least one symptom associated with a Tau-associated disorder. In certain embodiments, such administration results in amelioration of at least one symptom. In certain embodiments, administration of a pharmaceutical composition to an animal results in a decrease of 4R mRNA in a cell of the animal. In certain embodiments, such administration results in an increase in 3R mRNA. In certain embodiments, such administration results in a decrease in 4R protein and an increase 3R protein. In certain embodiments, a 3R protein is preferred over a 4R protein. In certain embodiments, the administration of certain antisense oligonucleotides delays the onset of one or more Tau-associated disorders. In certain embodiments, the administration of certain antisense oligonucleotides prevents or reduces seizures. In certain embodiments, the administration of certain antisense oligonucleotides causes the amount of 4R protein to decrease in the CNS. In certain embodiments, the administration of certain antisense oligonucleotides rescues cellular phenotype.
Nonlimiting Disclosure and Incorporation by Reference
[0414] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.
[0415] Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2′-OH for the natural 2′-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) for natural uracil of RNA).
[0416] Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified or naturally occurring bases, such as “AT.sup.meCGAUCG,” wherein .sup.meC indicates a cytosine base comprising a methyl group at the 5-position.
EXAMPLES
Non-Limiting Disclosure and Incorporation by Reference
[0417] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.
Example 1: Effects of Uniform 2′-MOE Modified Oligonucleotides on Human Tau Exon 10
[0418] A series of modified oligonucleotides were designed to target exon 10 of human Tau and were screened for their effects in reducing exon 10 inclusion in vitro. These modified oligonucleotides were designed by shifting 4 nucleotides upstream or downstream (i.e. microwalk) across the target site. They are 18 nucleosides in length, wherein each nucleoside has a 2′-MOE modification. Each internucleoside linkage throughout the modified oligonucleotide are phosphorothioate internucleoside linkages (P═S). All cytosine residues throughout the modified oligonucleotides are 5-methylcytosines.
[0419] “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is targeted. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is targeted. Each modified oligonucleotide listed in the tables below is targeted to SEQ ID NO: 1 (GENBANK Accession No NT_010783.15 truncated from nucleotides 9240000 to 9381000).
[0420] A172 cells were transfected using Lipofectamine2000® with 5 nM concentration of modified oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and the mRNA levels of Tau transcripts containing exon 10 were measured by quantitative real-time PCR. Human primer probe set 9_10 or 10_11 was used to measure mRNA levels. Tau exon 10 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent of Tau exon 10 mRNA expression, relative to untreated control levels and is denoted as “% UTC.”
[0421] Human primer probe set 9_10 (forward sequence CACTGAGAACCTGAAGCACC, designated herein as SEQ ID NO: 2; reverse sequence GGACTGGACGTTGCTAAGATC, designated herein as SEQ ID NO: 3; probe sequence TTAATTATCTGCACCTTCCCGCCTCC, designated herein as SEQ ID NO: 4).
[0422] Human primer probe set 10_11 (forward sequence GGATAATATCAAACACGTCCCG, designated herein as SEQ ID NO: 5; reverse sequence TGCCTAATGAGCCACACTTG, designated herein as SEQ ID NO: 6; probe sequence GTCTACAAACCAGTTGACCTGAGC, designated herein as SEQ ID NO: 7).
[0423] As illustrated in Tables 1 and 2, ISIS 549583, 549584, 549585, 549586, 549595, 549571, 549566, 549570, 549587, 549568, 549617, 549567, 549576, 549577, 549580, and 549581 show 70% or greater reduction in human Tau exon 10 inclusion comparing to untreated control.
TABLE-US-00002 TABLE 1 Effects of uniform 2′-MOE modified oligonucleotides on human Tau exon 10 using Primer Probe Set 9_10 SEQ ID SEQ ID NO: 1 NO: 1 SEQ ID ISIS NO Sequence % UTC Start Site Stop Site NO 549543 CCCGCCTACTTGCTCGCA 130 121708 121725 8 549544 TGGACCCGCCTACTTGCT 119 121712 121729 9 549545 ACCCTGGACCCGCCTACT 106 121716 121733 10 549546 CATGCGCCACCCTGGACC 84 121724 121741 11 549547 GTGACATGCGCCACCCTG 78 121728 121745 12 549548 ATGAGTGACATGCGCCAC 63 121732 121749 13 549549 TTCGATGAGTGACATGCG 70.0 121736 121753 14 549550 CACTTTCGATGAGTGACA 69 121740 121757 15 549551 CCTCCACTTTCGATGAGT 103 121744 121761 16 549552 GACGCCTCCACTTTCGAT 148 121748 121765 17 549553 CAAGGACGCCTCCACTTT 116 121752 121769 18 549554 CTCGCAAGGACGCCTCCA 80 121756 121773 19 549555 CTTGCTCGCAAGGACGCC 102 121760 121777 20 549556 CCTGCTTGCTCGCAAGGA 109 121764 121781 21 549557 CCCGCCTGCTTGCTCGCA 100 121768 121785 22 549558 TGGACCCGCCTGCTTGCT 111 121772 121789 23 549559 ACCCTGGACCCGCCTGCT 108 121776 121793 24 549560 CGCCACCCTGGACCCGCC 88 121720 121737 25 121780 121797 549561 GACACGCCACCCTGGACC 83 121784 121801 26 549562 GAGTGACACGCCACCCTG 77 121788 121805 27 549563 GGATGAGTGACACGCCAC 58 121792 121809 28 549564 AAAAGGATGAGTGACACG 49 121796 121813 29 549565 AGAAAAAAGGATGAGTGA 35 121800 121817 30 549566 AGCCAGAAAAAAGGATGA 21 121804 121821 31 549567 TGGTAGCCAGAAAAAAGG 32 121808 121825 32 549583 TTATCCTTTGAGCCACAC 11 121876 121893 33 549584 GATATTATCCTTTGAGCC 11 121880 121897 34 549585 GTTTGATATTATCCTTTG 13 121884 121901 35 549586 ACGTGTTTGATATTATCC 17 121888 121905 36 549587 CGGGACGTGTTTGATATT 24 121892 121909 37 549588 CTCCCGGGACGTGTTTGA 52 121896 121913 38 549589 CCGCCTCCCGGGACGTGT 57 121900 121917 39 549590 ACTGCCGCCTCCCGGGAC 84 121904 121921 40 549591 TCACACTGCCGCCTCCCG 48 121908 121925 41 549592 GTACTCACACTGCCGCCT 30 121912 121929 42 549593 GAAGGTACTCACACTGCC 35 121916 121933 43 549594 GTGTGAAGGTACTCACAC 63 121920 121937 44 549595 GGACGTGTGAAGGTACTC 20 121924 121941 45 549596 CATGGGACGTGTGAAGGT 125 121928 121945 46 549597 GGCGCATGGGACGTGTGA 216 121932 121949 47 549598 GCACGGCGCATGGGACGT 242 121936 121953 48 549599 CACAGCACGGCGCATGGG 158 121940 121957 49 549600 AAGCCACAGCACGGCGCA 162 121944 121961 50 549601 ATTCAAGCCACAGCACGG 175 121948 121965 51 549602 AATAATTCAAGCCACAGC 164 121952 121969 52 549603 TCCTAATAATTCAAGCCA 200 121956 121973 53 549604 CACTTCCTAATAATTCAA 133 121960 121977 54 549605 ACACCACTTCCTAATAAT 113 121964 121981 55 549606 ACTCACACCACTTCCTAA 136 121968 121985 56 549608 GTGTACGCACTCACACCA 80.6 121976 121993 57 549609 GCAAGTGTACGCACTCAC 49.9 121980 121997 58 549610 TCTCGCAAGTGTACGCAC 86.5 121984 122001 59 549611 AGTGTCTCGCAAGTGTAC 62.4 121988 122005 60 549612 ATGCAGTGTCTCGCAAGT 46.4 121992 122009 61 549613 TTCTATGCAGTGTCTCGC 46.6 121996 122013 62 549614 TTTATTCTATGCAGTGTC 33.2 122000 122017 63 549615 AGGATTTATTCTATGCAG 34.3 122004 122021 64 549616 AAGAAGGATTTATTCTAT 46.5 122008 122025 65 549617 GCCCAAGAAGGATTTATT 29.6 122012 122029 66 549618 GAGAGCCCAAGAAGGATT 38.6 122016 122033 67 549619 TCCTGAGAGCCCAAGAAG 36.9 122020 122037 68 549620 CAGATCCTGAGAGCCCAA 38.3 122024 122041 69
TABLE-US-00003 TABLE 2 Effects of uniform 2′-MOE modified oligonucleotides on human Tau exon 10 using Primer Probe Set 10_11 SEQ ID NO: 1 SEQ ID NO: 1 SEQ ISIS No. Sequence % UTC Start Site Stop Site Mismatches ID No. 549543 CCCGCCTACTTGCTCGCA 128 121725 121708 0 8 121768 121785 1 549544 TGGACCCGCCTACTTGCT 117 121712 121729 0 9 121772 121789 1 549545 ACCCTGGACCCGCCTACT 98 121716 121733 0 10 121776 121793 1 549546 CATGCGCCACCCTGGACC 78 121724 121741 0 11 549547 GTGACATGCGCCACCCTG 75 121728 121745 0 12 549548 ATGAGTGACATGCGCCAC 63 121732 121749 0 13 549549 TTCGATGAGTGACATGCG 74 121736 121753 0 14 549550 CACTTTCGATGAGTGACA 76 121740 121757 0 15 549551 CCTCCACTTTCGATGAGT 107 121744 121761 0 16 549552 GACGCCTCCACTTTCGAT 137 121748 121765 0 17 549553 CAAGGACGCCTCCACTTT 108 121692 121709 1 18 121752 121769 0 549554 CTCGCAAGGACGCCTCCA 71 121696 121713 1 19 121756 121773 0 549555 CTTGCTCGCAAGGACGCC 108 121700 121717 1 20 121760 121777 0 549556 CCTGCTTGCTCGCAAGGA 106 121704 121721 1 21 121764 121781 0 549557 CCCGCCTGCTTGCTCGCA 93 121708 121725 1 22 121768 121785 0 549558 TGGACCCGCCTGCTTGCT 111 121712 121729 1 23 121772 121789 0 549559 ACCCTGGACCCGCCTGCT 100 121716 121733 1 24 121776 121793 0 549560 CGCCACCCTGGACCCGCC 89 121720 121737 0 25 121780 121797 0 549561 GACACGCCACCCTGGACC 80 121784 121801 0 26 549562 GAGTGACACGCCACCCTG 81 121788 121805 0 27 549563 GGATGAGTGACACGCCAC 54 121792 121809 0 28 549564 AAAAGGATGAGTGACACG 45 121796 121813 0 29 549565 AGAAAAAAGGATGAGTGA 34 121800 121817 0 30 549566 AGCCAGAAAAAAGGATGA 19 121804 121821 0 31 549567 TGGTAGCCAGAAAAAAGG 31 121808 121825 0 32 549568 CCTTTGGTAGCCAGAAAA 23 121812 121829 0 70 549569 TGCACCTTTGGTAGCCAG 53 121816 121833 0 71 549570 TAATTATCTGCACCTTTG 26 121824 121841 0 72 549571 TTCTTAATTATCTGCACC 21 121828 121845 1 73 549572 CTTCTTCTTAATTATCTG 30 121832 121849 1 74 549573 CCAGCTTCTTCTTAATTA 34 121836 121853 1 75 549574 AGATCCAGCTTCTTCTTA 43 121840 121857 1 76 549575 GCTAAGATCCAGCTTCTT 25 121844 121861 0 77 549576 CGTTGCTAAGATCCAGCT 18 121848 121865 0 78 549577 TGGACGTTGCTAAGATCC 16 121852 121869 0 79 549578 GGACTGGACGTTGCTAAG 44 121856 121873 0 80 549579 ACTTGGACTGGACGTTGC 36 121860 121877 0 81 549580 CCACACTTGGACTGGACG 19 121864 121881 0 82 549581 TGAGCCACACTTGGACTG 16 121868 121885 0 83 549595 GGACGTGTGAAGGTACTC 20 121924 121941 0 45 549596 CATGGGACGTGTGAAGGT 128 121928 121945 0 46 549597 GGCGCATGGGACGTGTGA 199 121932 121949 0 47 549598 GCACGGCGCATGGGACGT 199 121936 121953 0 48 549599 CACAGCACGGCGCATGGG 149 121940 121957 0 49 549600 AAGCCACAGCACGGCGCA 156 121944 121961 0 50 549601 ATTCAAGCCACAGCACGG 166 121948 121965 0 51 549602 AATAATTCAAGCCACAGC 159 121952 121969 0 52 549603 TCCTAATAATTCAAGCCA 179 121956 121973 0 53 549604 CACTTCCTAATAATTCAA 123 121960 121977 0 54 549605 ACACCACTTCCTAATAAT 113 121964 121981 0 55 549606 ACTCACACCACTTCCTAA 119 121968 121985 0 56 549608 GTGTACGCACTCACACCA 77.2 121976 121993 0 57 549609 GCAAGTGTACGCACTCAC 53.0 121980 121997 0 58 549610 TCTCGCAAGTGTACGCAC 87.4 121984 122001 0 59 549611 AGTGTCTCGCAAGTGTAC 69.2 121988 122005 0 60 549612 ATGCAGTGTCTCGCAAGT 43.3 121992 122009 0 61 549613 TTCTATGCAGTGTCTCGC 41.4 121996 122013 0 62 549614 TTTATTCTATGCAGTGTC 29.2 122000 122017 0 63 549615 AGGATTTATTCTATGCAG 30.9 122004 122021 0 64 549616 AAGAAGGATTTATTCTAT 45.8 122008 122025 0 65 549617 GCCCAAGAAGGATTTATT 31.8 122012 122029 0 66 549618 GAGAGCCCAAGAAGGATT 41.8 122016 122033 0 67 549619 TCCTGAGAGCCCAAGAAG 41.7 122020 122037 0 68 549620 CAGATCCTGAGAGCCCAA 35.6 122024 122041 0 69
Example 2: Effects of Uniform 2′-MOE Modified Oligonucleotides on Human Tau Exon 10
[0424] A series of modified oligonucleotides were designed to target exon 10 of human Tau and were screened for their effects in reducing exon 10 inclusion in vitro. These modified oligonucleotides were designed by shifting 1 nucleotide upstream or downstream (i.e. microwalk) across the target site. They are 18 nucleosides in length, wherein each nucleoside has a 2′-MOE modification. Each internucleoside linkage throughout the modified oligonucleotide are phosphorothioate internucleoside linkages (P═S). All cytosine residues throughout the modified oligonucleotides are 5-methylcytosines.
[0425] “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is targeted. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is targeted. Each modified oligonucleotide listed in the tables below is targeted to SEQ ID NO: 1 (GENBANK Accession No NT_010783.15 truncated from nucleotides 9240000 to 9381000).
[0426] A172 cells were transfected using Lipofectamine2000® with 5 nM concentration of modified oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and the mRNA levels of Tau transcripts containing exon 10 were measured by quantitative real-time PCR. Human Tau primer probe set 10_11 or 9_10 R.sub.5 was used to measure mRNA levels. Tau exon 10 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent of Tau exon 10 mRNA expression, relative to untreated control levels and is denoted as “% UTC.”
[0427] Human primer probe set 10_11 (forward sequence GGATAATATCAAACACGTCCCG, designated herein as SEQ ID NO: 5; reverse sequence TGCCTAATGAGCCACACTTG, designated herein as SEQ ID NO: 6; probe sequence GTCTACAAACCAGTTGACCTGAGC, designated herein as SEQ ID NO: 7).
[0428] Human Tau primer probe set 9_10 R.sub.5 (forward sequence CACTGAGAACCTGAAGCACC, designated herein as SEQ ID NO: 2; reverse sequence GGACGTTGCTAAGATCCAGCT, designated herein as SEQ ID NO: 3; probe sequence TTAATTATCTGCACCTTCCCGCCTCC, designated herein as SEQ ID NO: 4).
TABLE-US-00004 TABLE 3 Effects of uniform 2′-MOE modified oligonucleotides on human Tau exon 10 using Human Tau primer probe set 10_11 SEQ ID NO: 1 SEQ ID NO: SEQ ID ISIS NO Sequence % UTC Start Site 1 Stop Site NO 549564 AAAAGGATGAGTGACACG 43 121796 121813 29 617296 AAAAAGGATGAGTGACAC 38 121797 121814 84 617297 AAAAAAGGATGAGTGACA 40 121798 121815 85 617298 GAAAAAAGGATGAGTGAC 39 121799 121816 86 549565 AGAAAAAAGGATGAGTGA 45 121800 121817 30 617299 CAGAAAAAAGGATGAGTG 39 121801 121818 87 617300 CCAGAAAAAAGGATGAGT 34 121802 121819 88 617301 GCCAGAAAAAAGGATGAG 34 121803 121820 89 549566 AGCCAGAAAAAAGGATGA 21 121804 121821 31 617302 TAGCCAGAAAAAAGGATG 26 121805 121822 90 617303 GTAGCCAGAAAAAAGGAT 27 121806 121823 91 617304 GGTAGCCAGAAAAAAGGA 32 121807 121824 92 549567 TGGTAGCCAGAAAAAAGG 39 121808 121825 32 617305 TTGGTAGCCAGAAAAAAG 34 121809 121826 93 617306 TTTGGTAGCCAGAAAAAA 49 121810 121827 94 617307 CTTTGGTAGCCAGAAAAA 37 121811 121828 95 549568 CCTTTGGTAGCCAGAAAA 27 121812 121829 70 617308 ACCTTTGGTAGCCAGAAA 31 121813 121830 96 617309 CACCTTTGGTAGCCAGAA 23 121814 121831 97 617310 GCACCTTTGGTAGCCAGA 59 121815 121832 98 549569 TGCACCTTTGGTAGCCAG 59 121816 121833 71 617311 CTGCACCTTTGGTAGCCA 59 121817 121834 99 617312 TCTGCACCTTTGGTAGCC 58 121818 121835 100 617313 ATCTGCACCTTTGGTAGC 53 121819 121836 101 415866 TATCTGCACCTTTGGTAG 41 121820 121837 102 617314 TTATCTGCACCTTTGGTA 36 121821 121838 103 617315 ATTATCTGCACCTTTGGT 31 121822 121839 104 617316 AATTATCTGCACCTTTGG 38 121823 121840 105 549570 TAATTATCTGCACCTTTG 21 121824 121841 72 617317 TTAATTATCTGCACCTTT 23 121825 121842 106 617318 ATTAATTATCTGCACCTT 25 121826 121843 107 617319 TATTAATTATCTGCACCT 27 121827 121844 108 617320 TTATTAATTATCTGCACC 27 121828 121845 109 617321 CTTATTAATTATCTGCAC 26 121829 121846 110 617322 TCTTATTAATTATCTGCA 25 121830 121847 111 617323 TTCTTATTAATTATCTGC 25 121831 121848 112 617324 CTTCTTATTAATTATCTG 25 121832 121849 113 617325 GCTTCTTATTAATTATCT 26 121833 121850 114 617326 AGCTTCTTATTAATTATC 32 121834 121851 115 617327 CAGCTTCTTATTAATTAT 31 121835 121852 116 617328 CCAGCTTCTTATTAATTA 29 121836 121853 117 617329 TCCAGCTTCTTATTAATT 35 121837 121854 118 617330 ATCCAGCTTCTTATTAAT 29 121838 121855 119 617331 GATCCAGCTTCTTATTAA 33 121839 121856 120 617332 AGATCCAGCTTCTTATTA 33 121840 121857 121 617333 AAGATCCAGCTTCTTATT 37 121841 121858 122 617334 TAAGATCCAGCTTCTTAT 42 121842 121859 123 617335 CTAAGATCCAGCTTCTTA 34 121843 121860 124 549575 GCTAAGATCCAGCTTCTT 29 121844 121861 77 617336 TGCTAAGATCCAGCTTCT 42 121845 121862 125 617337 TTGCTAAGATCCAGCTTC 36 121846 121863 126 617338 GTTGCTAAGATCCAGCTT 35 121847 121864 127 549576 CGTTGCTAAGATCCAGCT 26 121848 121865 78 617339 ACGTTGCTAAGATCCAGC 25 121849 121866 128 617340 GACGTTGCTAAGATCCAG 30 121850 121867 129 617341 GGACGTTGCTAAGATCCA 24 121851 121868 130 549577 TGGACGTTGCTAAGATCC 25 121852 121869 79 617342 CTGGACGTTGCTAAGATC 27 121853 121870 131 617343 ACTGGACGTTGCTAAGAT 29 121854 121871 132 617344 GACTGGACGTTGCTAAGA 34 121855 121872 133 549578 GGACTGGACGTTGCTAAG 40 121856 121873 80 617345 TGGACTGGACGTTGCTAA 51 121857 121874 134 617346 TTGGACTGGACGTTGCTA 43 121858 121875 135 617347 CTTGGACTGGACGTTGCT 38 121859 121876 136 549579 ACTTGGACTGGACGTTGC 34 121860 121877 81 617348 CACTTGGACTGGACGTTG 39 121861 121878 137 617349 ACACTTGGACTGGACGTT 30 121862 121879 138 617350 CACACTTGGACTGGACGT 32 121863 121880 139 549580 CCACACTTGGACTGGACG 27 121864 121881 82 617351 GCCACACTTGGACTGGAC 23 121865 121882 140 617352 AGCCACACTTGGACTGGA 23 121866 121883 141 617353 GAGCCACACTTGGACTGG 26 121867 121884 142 549581 TGAGCCACACTTGGACTG 24 121868 121885 83
TABLE-US-00005 TABLE 4 Effects of uniform 2′-MOE modified oligonucleotides on human Tau exon 10 using Human Tau primer probe set 9_10 R5 SEQ ID NO: 1 SEQ ID NO: SEQ ID ISIS NO Sequence % UTC Start Site 1 Stop Site NO 617354 TTGAGCCACACTTGGACT 21 121869 121886 143 617355 TTTGAGCCACACTTGGAC 22 121870 121887 144 617356 CTTTGAGCCACACTTGGA 16 121871 121888 145 549582 CCTTTGAGCCACACTTGG 14 121872 121889 146 617357 TCCTTTGAGCCACACTTG 17 121873 121890 147 617358 ATCCTTTGAGCCACACTT 17 121874 121891 148 617359 TATCCTTTGAGCCACACT 19 121875 121892 149 549583 TTATCCTTTGAGCCACAC 20 121876 121893 33 617360 ATTATCCTTTGAGCCACA 21 121877 121894 150 617361 TATTATCCTTTGAGCCAC 15 121878 121895 151 617362 ATATTATCCTTTGAGCCA 16 121879 121896 152 549584 GATATTATCCTTTGAGCC 17 121880 121897 34 565989 TGATATTATCCTTTGAGC 17 121881 121898 153 565990 TTGATATTATCCTTTGAG 20 121882 121899 154 565991 TTTGATATTATCCTTTGA 28 121883 121900 155 549585 GTTTGATATTATCCTTTG 22 121884 121901 35 617363 TGTTTGATATTATCCTTT 25 121885 121902 156 617364 GTGTTTGATATTATCCTT 22 121886 121903 157 617365 CGTGTTTGATATTATCCT 20 121887 121904 158 549586 ACGTGTTTGATATTATCC 21 121888 121905 36 617366 GACGTGTTTGATATTATC 24 121889 121906 159 617367 GGACGTGTTTGATATTAT 16 121890 121907 160 617368 GGGACGTGTTTGATATTA 33 121891 121908 161 549587 CGGGACGTGTTTGATATT 20 121892 121909 37 617369 CCGGGACGTGTTTGATAT 25 121893 121910 162 617370 CCCGGGACGTGTTTGATA 43 121894 121911 163 617371 TCCCGGGACGTGTTTGAT 52 121895 121912 164 549588 CTCCCGGGACGTGTTTGA 53 121896 121913 38 549590 ACTGCCGCCTCCCGGGAC 48 121904 121921 40 617372 CACTGCCGCCTCCCGGGA 71 121905 121922 165 617373 ACACTGCCGCCTCCCGGG 60 121906 121923 166 617374 CACACTGCCGCCTCCCGG 40 121907 121924 167 549591 TCACACTGCCGCCTCCCG 47 121908 121925 41 617375 CTCACACTGCCGCCTCCC 33 121909 121926 168 617376 ACTCACACTGCCGCCTCC 34 121910 121927 169 617377 TACTCACACTGCCGCCTC 34 121911 121928 170 549592 GTACTCACACTGCCGCCT 31 121912 121929 42 617378 GGTACTCACACTGCCGCC 29 121913 121930 171 617379 AGGTACTCACACTGCCGC 34 121914 121931 172 617380 AAGGTACTCACACTGCCG 43 121915 121932 173 549593 GAAGGTACTCACACTGCC 33 121916 121933 43 617381 TGAAGGTACTCACACTGC 28 121917 121934 174 617382 GTGAAGGTACTCACACTG 41 121918 121935 175 617383 TGTGAAGGTACTCACACT 43 121919 121936 176 549594 GTGTGAAGGTACTCACAC 68 121920 121937 44 617384 CGTGTGAAGGTACTCACA 35 121921 121938 177 617385 ACGTGTGAAGGTACTCAC 34 121922 121939 178 617386 GACGTGTGAAGGTACTCA 29 121923 121940 179 549595 GGACGTGTGAAGGTACTC 26 121924 121941 45 617387 GGGACGTGTGAAGGTACT 36 121925 121942 180 617388 TGGGACGTGTGAAGGTAC 36 121926 121943 181 617389 ATGGGACGTGTGAAGGTA 94 121927 121944 182 549596 CATGGGACGTGTGAAGGT 141 121928 121945 46 617390 GCATGGGACGTGTGAAGG 297 121929 121946 183 510184 CGCATGGGACGTGTGAAG 295 121930 121947 184 617391 GCGCATGGGACGTGTGAA 274 121931 121948 185 549597 GGCGCATGGGACGTGTGA 284 121932 121949 47 510185 CGGCGCATGGGACGTGTG 276 121933 121950 186 617392 ACGGCGCATGGGACGTGT 304 121934 121951 187 510186 CACGGCGCATGGGACGTG 268 121935 121952 188 549598 GCACGGCGCATGGGACGT 305 121936 121953 48 617393 AGCACGGCGCATGGGACG 237 121937 121954 189 510187 CAGCACGGCGCATGGGAC 144 121938 121955 190 617394 ACAGCACGGCGCATGGGA 170 121939 121956 191 549599 CACAGCACGGCGCATGGG 183 121940 121957 49 549619 TCCTGAGAGCCCAAGAAG 42 122020 122037 68 617395 ATCCTGAGAGCCCAAGAA 38 122021 122038 192 617396 GATCCTGAGAGCCCAAGA 44 122022 122039 193 617397 AGATCCTGAGAGCCCAAG 35 122023 122040 194 549620 CAGATCCTGAGAGCCCAA 35 122024 122041 69 617398 CCAGATCCTGAGAGCCCA 39 122025 122042 195 617399 GCCAGATCCTGAGAGCCC 47 122026 122043 196 617400 AGCCAGATCCTGAGAGCC 38 122027 122044 197
Example 3: Inhibitory Effect of Uniform 2′-MOE Modified Oligonucleotides on Human Tau Exon 10
[0429] Several modified oligonucleotides from Tables 3 and 4 were selected and further evaluated for their effects on inhibiting human Tau exon 10 expression in vitro. ISIS 549595 was included in the study for comparison.
[0430] “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is targeted. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is targeted. Each modified oligonucleotide listed in the tables below is targeted to SEQ ID NO: 1 (GENBANK Accession No NT_010783.15 truncated from nucleotides 9240000 to 9381000).
[0431] A172 cells were transfected using Lipofectamine2000® with 0, 0.1, 0.3, 1, 3, 10, or 30 nM concentration of modified oligonucleotide as specified in the table below. After a treatment period of approximately 24 hours, RNA was isolated from the cells and the mRNA levels of Tau transcripts containing exon 10 were measured by quantitative real-time PCR. Human Tau primer probe set 9_10 R.sub.5 was used to measure mRNA levels, except for ISIS 549581. Human Tau primer probe set 10_11 was used for this oligonucleotide. Human Tau exon 10 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®.
[0432] The half maximal inhibitory concentration (IC.sub.50) of each oligonucleotide is presented in the table below and was calculated by plotting the concentrations of oligonucleotides used versus the percent inhibition of human Tau exon 10 mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 50% inhibition of human Tau exon 10 mRNA expression was achieved compared to the control. Results are presented below.
TABLE-US-00006 TABLE 5 Inhibitory effect of uniform 2′-MOE modified oligonucleotides on human Tau exon 10 expression SEQ ID NO: 1 Start SEQ ID NO: SEQ ID ISIS NO Sequence IC.sub.50 (nM) Site 1 Stop Site NO 549581 TGAGCCACACTTGGACTG 1.20 121868 121885 83 617354 TTGAGCCACACTTGGACT 1.39 121869 121886 143 617355 TTTGAGCCACACTTGGAC 1.08 121870 121887 144 617356 CTTTGAGCCACACTTGGA 0.74 121871 121888 145 549582 CCTTTGAGCCACACTTGG 0.49 121872 121889 146 617357 TCCTTTGAGCCACACTTG 0.64 121873 121890 147 617358 ATCCTTTGAGCCACACTT 0.44 121874 121891 148 617359 TATCCTTTGAGCCACACT 0.54 121875 121892 149 549583 TTATCCTTTGAGCCACAC 0.37 121876 121893 33 617360 ATTATCCTTTGAGCCACA 0.39 121877 121894 150 617361 TATTATCCTTTGAGCCAC 0.38 121878 121895 151 549595 GGACGTGTGAAGGTACTC 0.97 121924 121941 45
Example 4: Inhibitory Effect of Uniform 2′-MOE Modified Oligonucleotides on Human Tau Exon 10
[0433] Several modified oligonucleotides from Table 4 were selected and further evaluated for their effects on inhibiting human Tau exon 10 expression in vitro. ISIS 549595 was included in the study for comparison.
[0434] “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is targeted. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is targeted. Each modified oligonucleotide listed in the tables below is targeted to SEQ ID NO: 1 (GENBANK Accession No NT_010783.15 truncated from nucleotides 9240000 to 9381000).
[0435] A172 cells were transfected using Lipofectamine2000® with 0, 0.1, 0.3, 1, 3, 10, or 30 nM concentration of modified oligonucleotide as specified in the table below. After a treatment period of approximately 24 hours, RNA was isolated from the cells and the mRNA levels of Tau transcripts containing exon 10 were measured by quantitative real-time PCR. Human Tau primer probe set 9_10 R.sub.5 was used to measure mRNA levels. Human Tau exon 10 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®.
[0436] The IC.sub.50 of each oligonucleotide was calculated in the same manner as illustrated in Example 3 and the results are presented below.
TABLE-US-00007 TABLE 6 Inhibitory effect of uniform 2′-MOE modified oligonucleotides on human Tau exon 10 expression SEQ ID NO: 1 Start SEQ ID NO: SEQ ID ISIS NO Sequence IC.sub.50 (nM) Site 1 Stop Site NO 617362 ATATTATCCTTTGAGCCA 0.27 121879 121896 152 549584 GATATTATCCTTTGAGCC 0.40 121880 121897 34 565989 TGATATTATCCTTTGAGC 0.58 121881 121898 153 565990 TTGATATTATCCTTTGAG 1.23 121882 121899 154 549585 GTTTGATATTATCCTTTG 0.71 121884 121901 35 617364 GTGTTTGATATTATCCTT 0.61 121886 121903 157 617365 CGTGTTTGATATTATCCT 0.74 121887 121904 158 549586 ACGTGTTTGATATTATCC 0.93 121888 121905 36 617367 GGACGTGTTTGATATTAT 0.64 121890 121907 160 549587 CGGGACGTGTTTGATATT 0.97 121892 121909 37 549620 CAGATCCTGAGAGCCCAA 3.46 122024 122041 69 549595 GGACGTGTGAAGGTACTC 1.25 121924 121941 45
Example 5: Inhibitory Effect of Uniform 2′-MOE Modified Oligonucleotides on Human Tau Exon 10
[0437] Several modified oligonucleotides from Tables 3 and 4 were selected and further evaluated for their effects on inhibiting human Tau exon 10 expression in vitro. ISIS 549595 was included in the study for comparison.
[0438] “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is targeted. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is targeted. Each modified oligonucleotide listed in the tables below is targeted to SEQ ID NO: 1 (GENBANK Accession No NT_010783.15 truncated from nucleotides 9240000 to 9381000).
[0439] A172 cells were transfected using Lipofectamine2000® with 0, 0.1, 0.3, 1, 3, 10, or 30 nM concentrations of modified oligonucleotide as specified in the table below. After a treatment period of approximately 24 hours, RNA was isolated from the cells and the mRNA levels of Tau transcripts containing exon 10 were measured by quantitative real-time PCR. Human Tau primer probe set 10_11 was used to measure mRNA levels, except for ISIS 549595. Human Tau primer probe set 9_10 R.sub.5 was used for this oligonucleotide. Human Tau exon 10 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®.
[0440] The IC.sub.50 of each oligonucleotide was calculated in the same manner as illustrated in Example 3 and the results are presented below.
TABLE-US-00008 TABLE 7 Inhibitory effect of uniform 2′-MOE modified oligonucleotides on human Tau exon 10 expression SEQ ID NO: 1 Start SEQ ID NO: SEQ ID ISIS NO Sequence IC.sub.50 (nM) Site 1 Stop Site NO 549566 AGCCAGAAAAAAGGATGA 1.00 121804 121821 31 617309 CACCTTTGGTAGCCAGAA 1.11 121814 121831 97 549570 TAATTATCTGCACCTTTG 1.39 121824 121841 72 617317 TTAATTATCTGCACCTTT 1.26 121825 121842 106 617318 ATTAATTATCTGCACCTT 1.21 121826 121843 107 617323 TTCTTATTAATTATCTGC 0.96 121831 121848 112 617324 CTTCTTATTAATTATCTG 1.06 121832 121849 113 617341 GGACGTTGCTAAGATCCA 0.82 121851 121868 130 549577 TGGACGTTGCTAAGATCC 0.87 121852 121869 79 617351 GCCACACTTGGACTGGAC 0.91 121865 121882 140 617352 AGCCACACTTGGACTGGA 0.79 121866 121883 141 549595 GGACGTGTGAAGGTACTC 0.73 121924 121941 45
Example 6: Inhibitory Effect of Uniform 2′-MOE Modified Oligonucleotides on Human Tau Exon 10
[0441] Several modified oligonucleotides from Tables 1 and 4 were selected and further evaluated for their effect on inhibiting human Tau exon 10 expression in vitro. ISIS 617782, 617781, and 415833 were included in the study for comparison.
[0442] “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is targeted. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is targeted. Each modified oligonucleotide listed in the tables below is targeted to SEQ ID NO: 1 (GENBANK Accession No NT_010783.15 truncated from nucleotides 9240000 to 9381000).
[0443] ISIS 617782 is 21 nucleosides in length, wherein each nucleoside has a 2′-OCH.sub.3 modification and is denoted as the subscript “m”. Each internucleoside linkage throughout the modified oligonucleotide are phosphorothioate internucleoside linkages (P═S).
[0444] ISIS 617781 is 18 nucleosides in length, wherein each nucleoside has a 2′-OCH.sub.3 modification and is denoted as the subscript “m”. Each internucleoside linkage throughout the modified oligonucleotide are phosphorothioate internucleoside linkages (P═S).
[0445] ISIS 415833 is 20 nucleosides in length, wherein each nucleoside has a 2′-MOE modification. Each internucleoside linkage throughout the modified oligonucleotide are phosphorothioate internucleoside linkages (P═S). All cytosine residues throughout the modified oligonucleotides are 5-methylcytosines. “
[0446] A172 cells were transfected using Lipofectamine2000® with 0, 0.1, 0.3, 1, 3, 10, or 30 nM concentration of modified oligonucleotide as specified in the table below. After a treatment period of approximately 24 hours, RNA was isolated from the cells and the mRNA levels of Tau transcripts containing exon 10 were measured by quantitative real-time PCR. Human Tau primer probe set 9_10 R.sub.5 was used to measure mRNA levels, except for ISIS 617781 and 415883. Human Tau primer probe set 10_11 was used for these two oligonucleotides. Human Tau exon 10 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®.
[0447] The IC.sub.50 of each oligonucleotide was calculated in the same manner as illustrated in Example 3 and the results are presented below.
TABLE-US-00009 TABLE 8 Inhibitory effect of uniform 2′-MOE modified oligonucleotides on human Tau exon 10 expression SEQ ID NO: 1 Start SEQ ID NO: SEQ ID ISIS NO Sequence IC.sub.50 (nM) Site 1 Stop Site NO 617357 TCCTTTGAGCCACACTTG 0.48 121873 121890 147 617358 ATCCTTTGAGCCACACTT 0.34 121874 121891 148 617359 TATCCTTTGAGCCACACT 0.41 121875 121892 149 549583 TTATCCTTTGAGCCACAC 0.27 121876 121893 33 617360 ATTATCCTTTGAGCCACA 0.33 121877 121894 150 617361 TATTATCCTTTGAGCCAC 0.24 121878 121895 151 617362 ATATTATCCTTTGAGCCA 0.27 121879 121896 152 549584 GATATTATCCTTTGAGCC 0.19 121880 121897 34 565989 TGATATTATCCTTTGAGC 0.39 121881 121898 153 617782 U.sub.mG.sub.mA.sub.mA.sub.mG.sub.mG.sub.mU.sub.mA.sub.mC.sub.mU.sub.m 4.33 121914 121934 198 C.sub.mA.sub.mC.sub.mA.sub.mC.sub.mU.sub.mG.sub.mC.sub.mC.sub.mG.sub.mC.sub.m 617781 U.sub.mA.sub.mU.sub.mC.sub.mU.sub.mG.sub.mC.sub.mA.sub.mC.sub.mC.sub.m 20.25 121820 121837 199 U.sub.mU.sub.mU.sub.mG.sub.mG.sub.mU.sub.mA.sub.mG.sub.m 415883 TCTTATTAATTATCTGCACC 0.65 121828 121847 200
Example 7: Modified Oligonucleotides Targeting Exon 10 of Human Tau
[0448] A series of modified oligonucleotides were designed to target exon 10 of human Tau. “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is targeted. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is targeted. Each modified oligonucleotide listed in the tables below is targeted to SEQ ID NO: 1 (GENBANK Accession No NT_010783.15 truncated from nucleotides 9240000 to 9381000).
[0449] In the table below, “.sup.mC” indicates 5-methylcytosine, subscript “e” indicates 2′-O-methoxyethyl, subscript “f” indicates 2′-deoxyfluoro, subscript “d” indicates 2′-deoxy, subscript “p” indicates a peptide nucleic acid monomer, subscript “s” indicates a phosphorothioate internucleoside linkage, subscript “o” indicates a phosphodiester internucleoside linkage, “P-” indicates an O-linker at the 5′-end (PNA Bio, Thousand Oaks, Calif.), “—N” indicates a 3′-end carboxy amide.
TABLE-US-00010 TABLE 9 Modified oligonucleotides targeting human Tau ISIS SEQ ID NO: SEQ ID NO: SEQ NO Sequence 1 Start Site 1 Stop Site ID NO 549607 A.sub.es.sup.mC.sub.esG.sub.es.sup.mC.sub.esA.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.esA.sub.es.sup.mC.sub.esA.sub.es.sup.mC.sub.es.sup.mC.sub.es 121972 121989 201 A.sub.es.sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.e 565985 .sup.mC.sub.esG.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esA.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.esG.sub.es 121706 121723 202 .sup.mC.sub.esA.sub.esA.sub.esG.sub.e 565986 G.sub.esA.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.esG.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esA.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.es 121710 121727 203 .sup.mC.sub.esT.sub.es.sup.mC.sub.esG.sub.e 565987 G.sub.esA.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.esG.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.esG.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.es 121770 121787 204 .sup.mC.sub.esT.sub.es.sup.mC.sub.esG.sub.e 565988 .sup.mC.sub.es.sup.mC.sub.esT.sub.esG.sub.esG.sub.esA.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.esG.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.es 121774 121791 205 G.sub.es.sup.mC.sub.esT.sub.esT.sub.esG.sub.e 566007 .sup.mC.sub.esG.sub.esC.sub.fsC.sub.fsU.sub.fsA.sub.fsC.sub.fsU.sub.fsU.sub.fsG.sub.fsC.sub.fsU.sub.fsC.sub.fsG.sub.fsC.sub.fsA.sub.fs 121706 121723 206 A.sub.esG.sub.e 566012 .sup.mC.sub.es.sup.mC.sub.esU.sub.fsG.sub.fsG.sub.fsA.sub.fsC.sub.fsC.sub.fsC.sub.fsG.sub.fsC.sub.fsC.sub.fsU.sub.fsG.sub.fsC.sub.fsU.sub.fs 121774 121791 207 T.sub.esG.sub.e 566013 T.sub.esG.sub.esA.sub.fsU.sub.fsA.sub.fsU.sub.fsU.sub.fsA.sub.fsU.sub.fsC.sub.fsC.sub.fsU.sub.fsU.sub.fsU.sub.fsG.sub.fsA.sub.fsG.sub.es 121881 121898 208 .sup.mC.sub.e 566014 T.sub.esT.sub.esG.sub.fsA.sub.fsU.sub.fsA.sub.fsU.sub.fsU.sub.fsA.sub.fsU.sub.fsC.sub.fsC.sub.fsU.sub.fsU.sub.fsU.sub.fsG.sub.fsA.sub.es 121882 121899 209 G.sub.e 566015 T.sub.es T.sub.es U.sub.fs G.sub.fs A.sub.fs U.sub.fs A.sub.fs U.sub.fs U.sub.fs A.sub.fs U.sub.fs C.sub.fs C.sub.fs U.sub.fs 121883 121900 210 U.sub.fs U.sub.fs G.sub.es A.sub.e 566016 .sup.mC.sub.es A.sub.es C.sub.fs U.sub.fs U.sub.fs C.sub.fs C.sub.fs U.sub.fs A.sub.fs A.sub.fs U.sub.fs A.sub.fs A.sub.fs 121960 121977 211 U.sub.fs U.sub.fs C.sub.fs A.sub.es A.sub.e 566017 A.sub.es .sup.mC.sub.es A.sub.fs C.sub.fs C.sub.fs A.sub.fs C.sub.fs U.sub.fs U.sub.fs C.sub.fs C.sub.fs U.sub.fs A.sub.fs A.sub.fs 121964 121981 212 U.sub.fs A.sub.fs A.sub.es T.sub.e 566018 A.sub.es .sup.mC.sub.es U.sub.fs C.sub.fs A.sub.fs C.sub.fs A.sub.fs C.sub.fs C.sub.fs A.sub.fs C.sub.fs U.sub.fs U.sub.fs C.sub.fs 121968 121985 213 C.sub.fs U.sub.fs A.sub.es A.sub.e 568409 .sup.mC.sub.es .sup.mC.sub.es C.sub.fs G.sub.fs C.sub.fs C.sub.fs U.sub.fs A.sub.fs C.sub.fs U.sub.fs U.sub.fs G.sub.fs C.sub.fs 121708 121725 214 U.sub.fs C.sub.fs G.sub.fs .sup.mC.sub.es A.sub.e 568410 G.sub.es A.sub.es C.sub.fs C.sub.fs C.sub.fs G.sub.fs C.sub.fs C.sub.fs U.sub.fs A.sub.fs C.sub.fs U.sub.fs U.sub.fs G.sub.fs 121710 121727 215 C.sub.fs U.sub.fs .sup.mC.sub.es G.sub.e 568411 G.sub.es A.sub.es C.sub.fs C.sub.fs C.sub.fs G.sub.fs C.sub.fs C.sub.fs U.sub.fs G.sub.fs C.sub.fs U.sub.fs U.sub.fs G.sub.fs 121770 121787 216 C.sub.fs U.sub.fs .sup.mC.sub.es G.sub.e 568412 T.sub.es G.sub.es G.sub.fs A.sub.fs C.sub.fs C.sub.fs C.sub.fs G.sub.fs C.sub.fs C.sub.fs U.sub.fs G.sub.fs C.sub.fs U.sub.fs 121772 121789 217 U.sub.fs G.sub.fs .sup.mC.sub.es T.sub.e 624464 U.sub.ms C.sub.ms U.sub.ms U.sub.ms A.sub.ms U.sub.ms U.sub.ms A.sub.ms A.sub.ms U.sub.ms U.sub.ms 121828 121847 218 A.sub.ms U.sub.ms C.sub.ms U.sub.ms G.sub.ms C.sub.ms A.sub.ms C.sub.ms C.sub.m 624465 T.sub.ks .sup.mC.sub.ds T.sub.ds T.sub.ks A.sub.ds T.sub.ds T.sub.ks A.sub.ds A.sub.ds T.sub.ks T.sub.ds A.sub.ds T.sub.ks 121828 121847 200 .sup.mC.sub.ds T.sub.ds G.sub.ks .sup.mC.sub.ds A.sub.ds .sup.mC.sub.ks .sup.mC.sub.k 624466 T.sub.ks .sup.mC.sub.es T.sub.es T.sub.ks A.sub.es T.sub.es T.sub.ks A.sub.es A.sub.es T.sub.ks T.sub.es A.sub.es T.sub.ks 121828 121847 200 .sup.mC.sub.es T.sub.es G.sub.ks .sup.mC.sub.es A.sub.es .sup.mC.sub.ks .sup.mC.sub.k 624467 T.sub.ks .sup.mC.sub.es T.sub.es T.sub.ko A.sub.es T.sub.es T.sub.ko A.sub.es A.sub.es T.sub.ko T.sub.es A.sub.es T.sub.ko 121828 121847 200 .sup.mC.sub.es T.sub.es G.sub.ko .sup.mC.sub.es A.sub.es .sup.mC.sub.ks .sup.mC.sub.k 624468 T.sub.ks .sup.mC.sub.ds T.sub.ds T.sub.ko A.sub.ds T.sub.ds T.sub.ko A.sub.ds A.sub.ds T.sub.ko T.sub.ds A.sub.ds T.sub.ko 121828 121847 200 .sup.mC.sub.ds T.sub.ds G.sub.ko .sup.mC.sub.ds A.sub.ds .sup.mC.sub.ks .sup.mC.sub.k 626881 P-T.sub.p C.sub.p T.sub.p T.sub.p A.sub.p T.sub.p T.sub.p A.sub.p A.sub.p T.sub.p T.sub.p A.sub.p T.sub.p C.sub.p T.sub.p G.sub.p 121828 121847 200 C.sub.p A.sub.p C.sub.p C.sub.p-N 670011 G.sub.es G.sub.es A.sub.eo .sup.mC.sub.es G.sub.eo T.sub.es T.sub.eo G.sub.es .sup.mC.sub.eo T.sub.es A.sub.eo A.sub.es 121851 121868 130 G.sub.eo A.sub.es T.sub.eo .sup.mC.sub.es .sup.mC.sub.es A.sub.e 670012 .sup.mC.sub.es .sup.mC.sub.es T.sub.eo T.sub.es T.sub.eo G.sub.es A.sub.eo G.sub.es .sup.mC.sub.eo .sup.mC.sub.es A.sub.eo .sup.mC.sub.es 121872 121889 146 A.sub.eo .sup.mC.sub.es T.sub.eo T.sub.es G.sub.es G.sub.e 670013 A.sub.es T.sub.es .sup.mC.sub.eo .sup.mC.sub.es T.sub.eo T.sub.es T.sub.eo G.sub.es A.sub.eo G.sub.es .sup.mC.sub.eo .sup.mC.sub.es 121874 121891 148 A.sub.eo .sup.mC.sub.es A.sub.eo .sup.mC.sub.es T.sub.es T.sub.e 670014 T.sub.es T.sub.es A.sub.eo T.sub.es .sup.mC.sub.eo .sup.mC.sub.es T.sub.eo T.sub.es T.sub.eo G.sub.es A.sub.eo G.sub.es 121876 121893 33 .sup.mC.sub.eo .sup.mC.sub.es A.sub.eo .sup.mC.sub.es A.sub.es .sup.mC.sub.e 670015 A.sub.es T.sub.es T.sub.eo A.sub.es T.sub.eo .sup.mC.sub.es .sup.mC.sub.eo T.sub.es T.sub.eo T.sub.es G.sub.eo A.sub.es G.sub.eo 121877 121894 150 .sup.mC.sub.es .sup.mC.sub.eo A.sub.es .sup.mC.sub.es A.sub.e 670016 T.sub.es A.sub.es T.sub.eo T.sub.es A.sub.eo T.sub.es .sup.mC.sub.eo .sup.mC.sub.es T.sub.eo T.sub.es T.sub.eo G.sub.es A.sub.eo 121878 121895 151 G.sub.es .sup.mC.sub.eo .sup.mC.sub.es A.sub.es .sup.mC.sub.e 670017 A.sub.es T.sub.es A.sub.eo T.sub.es T.sub.eo A.sub.es T.sub.eo .sup.mC.sub.es .sup.mC.sub.eo T.sub.es T.sub.eo T.sub.es G.sub.eo 121879 121896 152 A.sub.es G.sub.eo .sup.mC.sub.es .sup.mC.sub.es A.sub.e 670018 G.sub.es A.sub.es T.sub.eo A.sub.es T.sub.eo T.sub.es A.sub.eo T.sub.es .sup.mC.sub.eo .sup.mC.sub.es T.sub.eo T.sub.es T.sub.eo 121880 121897 34 G.sub.es A.sub.eo G.sub.es .sup.mc.sub.es .sup.mC.sub.e 670019 G.sub.es T.sub.es T.sub.eo T.sub.es G.sub.eo A.sub.es T.sub.eo A.sub.es T.sub.eo T.sub.es A.sub.eo T.sub.es .sup.mC.sub.eo 121884 121901 35 .sup.mC.sub.es T.sub.eo T.sub.es T.sub.es G.sub.e 670020 G.sub.es G.sub.eo A.sub.eo .sup.mC.sub.eo G.sub.es T.sub.es T.sub.es G.sub.es .sup.mC.sub.es T.sub.es A.sub.es A.sub.es G.sub.eo 121851 121868 130 A.sub.eo T.sub.eo .sup.mC.sub.es .sup.mC.sub.es A.sub.e 670021 .sup.mC.sub.es .sup.mC.sub.eo T.sub.eo T.sub.eo T.sub.es G.sub.es A.sub.es G.sub.es .sup.mc.sub.es .sup.mC.sub.es A.sub.es .sup.mc.sub.es 121872 121889 146 A.sub.eo .sup.mC.sub.eo T.sub.eo T.sub.es G.sub.es G.sub.e 670022 A.sub.es T.sub.eo .sup.mC.sub.eo .sup.mC.sub.eo T.sub.es T.sub.es T.sub.es G.sub.es A.sub.es G.sub.es .sup.mC.sub.es .sup.mC.sub.es 121874 121891 148 A.sub.eo .sup.mC.sub.eo A.sub.eo .sup.mC.sub.es T.sub.es T.sub.e 670023 T.sub.es T.sub.eo A.sub.eo T.sub.eo .sup.mC.sub.es .sup.mC.sub.es T.sub.es T.sub.es T.sub.es G.sub.es A.sub.es G.sub.es 121876 121893 33 .sup.mC.sub.eo .sup.mC.sub.eo A.sub.eo .sup.mC.sub.es A.sub.es .sup.mC.sub.e 670024 A.sub.es T.sub.eo T.sub.eo A.sub.eo T.sub.es .sup.mC.sub.es .sup.mC.sub.es T.sub.es T.sub.es T.sub.es G.sub.es A.sub.es G.sub.eo 121877 121894 150 .sup.mC.sub.eo .sup.mC.sub.eo A.sub.es .sup.mC.sub.es A.sub.e 670025 T.sub.es A.sub.eo T.sub.eo T.sub.eo A.sub.es T.sub.es .sup.mC.sub.es .sup.mC.sub.es T.sub.es T.sub.es T.sub.es G.sub.es A.sub.eo 121878 121895 151 G.sub.eo .sup.mC.sub.eo .sup.mC.sub.es A.sub.es .sup.mC.sub.e 670026 A.sub.es T.sub.eo A.sub.eo T.sub.eo T.sub.es A.sub.es T.sub.es .sup.mC.sub.es .sup.mC.sub.es T.sub.es T.sub.es T.sub.es G.sub.eo 121879 121896 152 A.sub.eo G.sub.eo .sup.mC.sub.es .sup.mC.sub.es A.sub.e 670027 G.sub.es A.sub.eo T.sub.eo A.sub.eo T.sub.es T.sub.es A.sub.es T.sub.es .sup.mC.sub.es .sup.mC.sub.es T.sub.es T.sub.es T.sub.eo 121880 121897 34 G.sub.eo A.sub.eo G.sub.es .sup.mC.sub.es .sup.mC 670028 G.sub.es T.sub.eo T.sub.eo T.sub.eo G.sub.es A.sub.es T.sub.es A.sub.es T.sub.es T.sub.es A.sub.es T.sub.es .sup.mC.sub.eo 121884 121901 35 .sup.mC.sub.eo T.sub.eo T.sub.es T.sub.es G.sub.e 678329 G.sub.es .sup.mC.sub.es .sup.mC.sub.eo A.sub.es .sup.mC.sub.eo A.sub.es .sup.mC.sub.eo T.sub.es T.sub.eo G.sub.es G.sub.eo A.sub.es 121865 121882 140 .sup.mC.sub.eo T.sub.es G.sub.eo G.sub.es A.sub.es .sup.mC.sub.e 678330 A.sub.es G.sub.es .sup.mC.sub.eo .sup.mC.sub.es A.sub.eo .sup.mC.sub.es A.sub.eo .sup.mC.sub.es T.sub.eo T.sub.es G.sub.eo G.sub.es 121866 121883 141 A.sub.eo .sup.mC.sub.es T.sub.eo G.sub.es G.sub.es A.sub.e 678331 T.sub.es G.sub.es A.sub.eo G.sub.es .sup.mC.sub.eo .sup.mC.sub.es A.sub.eo .sup.mC.sub.es A.sub.eo .sup.mC.sub.es T.sub.eo T.sub.es 121868 121885 83 G.sub.eo G.sub.es A.sub.eo .sup.mC.sub.es T.sub.es G.sub.e 678332 G.sub.es .sup.mC.sub.eo .sup.mC.sub.eo A.sub.eo .sup.mC.sub.es A.sub.es .sup.mC.sub.es T.sub.es T.sub.es G.sub.es G.sub.es A.sub.es 121865 121882 140 .sup.mC.sub.eo T.sub.eo G.sub.eo G.sub.es A.sub.es .sup.mC.sub.e 678333 A.sub.es G.sub.eo .sup.mC.sub.eo .sup.mC.sub.eo A.sub.es .sup.mC.sub.es A.sub.es .sup.mC.sub.es T.sub.es T.sub.es G.sub.es G.sub.es 121866 121883 141 A.sub.eo .sup.mC.sub.eo T.sub.eo G.sub.es G.sub.es A.sub.e 678334 T.sub.es G.sub.eo A.sub.eo G.sub.eo .sup.mC.sub.es .sup.mC.sub.es A.sub.es .sup.mC.sub.es A.sub.es .sup.mC.sub.es T.sub.es T.sub.es 121868 121885 83 G.sub.eo G.sub.eo A.sub.eo .sup.mc.sub.es T.sub.es G.sub.e 693840 T.sub.es G.sub.es G.sub.eo A.sub.es .sup.mC.sub.eo G.sub.es T.sub.eo T.sub.es G.sub.eo .sup.mC.sub.es T.sub.eo A.sub.es A.sub.eo 121852 121869 79 G.sub.es A.sub.eo T.sub.es .sup.mC.sub.es .sup.mC.sub.e 693841 .sup.mC.sub.es .sup.mC.sub.es A.sub.eo .sup.mC.sub.es A.sub.eo .sup.mC.sub.es T.sub.eo T.sub.es G.sub.eo G.sub.es A.sub.eo .sup.mC.sub.es 121864 121881 82 T.sub.eo G.sub.es G.sub.eo A.sub.es .sup.mC.sub.es G.sub.e 693842 A.sub.es .sup.mC.sub.es G.sub.eo T.sub.es G.sub.eo T.sub.es T.sub.eo T.sub.es G.sub.eo A.sub.es T.sub.eo A.sub.es T.sub.eo 121888 121905 36 T.sub.es A.sub.eo T.sub.es .sup.mC.sub.es .sup.mC.sub.e 693843 G.sub.es G.sub.es A.sub.eo .sup.mC.sub.es G.sub.eo T.sub.es G.sub.eo T.sub.es G.sub.eo A.sub.es A.sub.eo G.sub.es G.sub.eo 121924 121941 45 T.sub.es A.sub.eo .sup.mC.sub.es T.sub.es .sup.mC.sub.e 693844 G.sub.es A.sub.es G.sub.eo .sup.mC.sub.es .sup.mC.sub.eo A.sub.es .sup.mC.sub.eo A.sub.es .sup.mC.sub.eo T.sub.es T.sub.eo G.sub.es 121867 121884 142 G.sub.eo A.sub.es .sup.mC.sub.eo T.sub.es G.sub.es G.sub.e 693845 T.sub.es G.sub.eo G.sub.eo A.sub.eo .sup.mC.sub.es G.sub.es T.sub.es T.sub.es G.sub.es .sup.mC.sub.es T.sub.es A.sub.es A.sub.eo 121852 121869 79 G.sub.eo A.sub.eo T.sub.es .sup.mC.sub.es .sup.mC.sub.e 693846 .sup.mC.sub.es .sup.mC.sub.eo A.sub.eo .sup.mC.sub.eo A.sub.es .sup.mC.sub.es T.sub.es T.sub.es G.sub.es G.sub.es A.sub.es .sup.mC.sub.es 121864 121881 82 T.sub.eo G.sub.eo G.sub.eo A.sub.es .sup.mC.sub.es G.sub.e 693847 A.sub.es .sup.mC.sub.eo G.sub.eo T.sub.eo G.sub.es T.sub.es T.sub.es T.sub.es G.sub.es A.sub.es T.sub.es A.sub.es T.sub.eo 121888 121905 36 T.sub.eo A.sub.eo T.sub.es .sup.mC.sub.es .sup.mC.sub.e 693848 G.sub.es G.sub.eo A.sub.eo .sup.mC.sub.eo G.sub.es T.sub.es G.sub.es T.sub.es G.sub.es A.sub.es A.sub.es G.sub.es G.sub.eo 121924 121941 45 T.sub.eo A.sub.eo .sup.mC.sub.es T.sub.es .sup.mC.sub.e 693849 G.sub.es A.sub.eo G.sub.eo .sup.mC.sub.eo .sup.mC.sub.es A.sub.es .sup.mC.sub.es A.sub.es .sup.mC.sub.es T.sub.es T.sub.es G.sub.es 121867 121884 142 G.sub.eo A.sub.eo .sup.mC.sub.eo T.sub.es G.sub.es G.sub.e
Example 8: In Vivo Analysis of Oligonucleotides Targeting Human Tau Exon 10
[0450] Sprague Dawley rats were separated into groups of 3 rats for the experiment presented in Table 11 and into groups of 2 or 4 rats for the experiment presented in Table 12. Each rat in each group of rats was administered a single 3 mg intrathecal (IT) dose of an oligonucleotide selected from Table 3, 4, or 9. At various time points after injection from 3 hours to 8 weeks, the movement of 7 different parts of the body was evaluated for each rat. The 7 body parts are (1) the rat's tail; (2) the rat's posterior posture; (3) the rat's hind limbs; (4) the rat's hind paws; (5) the rat's forepaws; (6) the rat's anterior posture; and (7) the rat's head. For each of the 7 different body parts, each rat was given a sub-score of 0 if the body part was moving or 1 if the body part was paralyzed. After each of the 7 body parts were evaluated, the sub-scores were summed for each rat and then averaged for each group. For example, if a rat's tail, head, and all other evaluated body parts were moving 3 hours after the 3 mg IT dose, it would get a summed score of 0. If another rat was not moving its tail 3 hours after the 3 mg IT dose but all other evaluated body parts were moving, it would receive a score of 1. Saline treated rats generally receive a score of 0. A score of at the top end of the range would be suggestive of toxicity. Results are presented as the average score for each treatment group in Tables 11 and 12.
TABLE-US-00011 TABLE 11 3 mg IT bolus in vivo study ISIS Score 3 hours Score 2 weeks Score 8 weeks SEQ No. after injection after injection after injection ID NO. 670020 1.0 2.7 2.7 130 670011 2.3 2.3 2.3 130 617341 3.0 0.0 0.0 130 678329 2.3 0.0 0.0 140 678332 3.0 0.0 1.3 140 617351 7.0 0.0 4.0 140 678330 2.7 2.3 3.0 141 678333 2.7 2.3 2.3 141 617352 7.0 0.0 2.0 141 678331 3.0 0.0 0.0 83 678334 4.3 2.3 2.3 83 549581 7.0 0.0 0.3 83 670012 2.7 0.0 0.0 146 670021 3.0 0.0 1.0 146 549582 4.3 0.0 0.0 146 670013 0.3 2.3 2.3 148 670022 2.0 2.3 3.0 148 617358 3.7 0.0 1.3 148 670014 0.0 0.0 0.0 33 670023 2.0 1.0 0.3 33 549583 2.3 0.0 0.0 33 670015 1.0 2.0 0.7 150 670024 1.0 0.7 0.0 150 617360 5.3 0.0 1.0 150 670025 0.3 5.3 5.3 151 670016 2.3 1.3 1.7 151 617361 3.0 0.0 0.3 151 670017 0.0 1.7 1.3 152 670026 1.0 3.7 3.3 152 617362 4.7 3.7 2.7 152 670018 0.3 0.3 0.3 34 670027 1.0 0.7 0.7 34 549584 5.0 2.7 3.7 34 670028 2.0 0.0 0.0 35 670019 3.0 0.0 0.0 35 549585 4.7 5.3 7.0 35
TABLE-US-00012 TABLE 12 3 mg IT bolus in vivo study ISIS No. of rats in Score 3 hours SEQ No. treatment group after injection ID NO. 549577 4 3.3 79 693840 4 1.8 79 693845 4 0.0 79 549580 4 7.0 82 693841 4 1.8 82 693846 4 2.5 82 617353 4 7.0 142 693844 2 3.5 142 693849 4 5.0 142 549582 4 4.3 146 549586 4 5.0 36 693847 2 1.0 36 549595 4 6.5 45 693843 2 2.0 45 693848 2 7.0 45
Example 9: Inhibitory Effect In Vivo of a Modified Oligonucleotide Targeting Human Tau Exon 10
[0451] B6.Cg-Mapttm1(EGFP)Klt Tg(MAPT)8cPdav/J mice (The Jackson Laboratory) express the 3R and 4R isoforms of human Tau. The effect of oligonucleotides selected from Table 3, 4, or 8 on shifting of the 4R isoform to 3R isoform was assessed in this mouse model.
[0452] Groups of four B6.Cg-Mapttm1(EGFP)Klt Tg(MAPT)8cPdav/J mice (3-4 months of age) were administered 500 μg of oligonucleotide via an intracerebroventricular (ICV) bolus injection. A control group of four mice was similarly treated with PBS. Two weeks after the dose, animals were sacrificed and RNA was extracted from the cerebral cortex, hippocampus, and/or spinal cord. mRNA expression of the 4R isoform and total human Tau were analyzed by qRT-PCR. The 4R isoform was analyzed using primer probe set hTau 9_10 junction (forward sequence 5′-CACTGAGAACCTGAAGCACC-3′, SEQ ID NO: 219; reverse sequence 5′-GTTGCTAAGATCCAGCTTCTT-3′, SEQ ID NO: 220; probe sequence 5′-TTAATTATCTGCACCTTCCCGCCTCC-3′, SEQ ID NO: 221) or primer probe set hTau 10_11 junction (forward sequence 5′-AATATCAAACACGTCCCGGGAG-3′, SEQ ID NO: 222; reverse sequence 5′-TGCCTAATGAGCCACACTTG-3′, SEQ ID NO: 223; probe sequence 5′-GTCTACAAACCAGTTGACCTGAGC-3′, SEQ ID NO: 224). Total Tau was analyzed using primer probe set RTS3104 (forward sequence 5′-AAGATTGGGTCCCTGGACAAT-3′, SEQ ID NO: 225; reverse sequence 5′-AGCTTGTGGGTTTCAATCTTTTTATT-3′, SEQ ID NO: 226; probe sequence 5′-CACCCACGTCCCTGGCGGA-3′, SEQ ID NO: 227). The ratio of 4R isoform to total Tau mRNA levels was normalized to mouse GAPDH levels, which were analyzed using primer probe set mGapdh_LTS00102 (forward sequence 5′-GGCAAATTCAACGGCACAGT-3′, SEQ ID NO: 228; reverse sequence 5′-GGGTCTCGCTCCTGGAAGAT-3′, SEQ ID NO: 229; probe sequence 5′-AAGGCCGAGAATGGGAAGCTTGTCATC-3′, SEQ ID NO: 230). The results are presented in Tables 13-15 as the average ratio of 4R isoform to total Tau mRNA normalized to GAPDH levels for each treatment group divided by the average ratio for the PBS group. “ND” indicates no data.
[0453] Inflammation was also assessed by performing RT-PCT to determine the expression levels of AIF1 in the cortex, hippocampus, and/or spinal cord. After normalization of all samples to GADPH, the average AIF1 value for each treatment group was divided by the average AIF1 value for the PBS control group. The results are presented in Tables 13-15.
TABLE-US-00013 TABLE 13 Effect of modified oligonucleotides on Tau exon 10 skipping in transgenic mice 4R AIF1 ISIS 4R 4R spinal AIF1 AIF1 spinal SEQ NO. cortex hippo cord cortex hippo cord ID NO. 415883 0.50 0.46 0.56 1.35 1.27 1.44 200 549566 0.54 0.54 0.66 1.09 1.13 1.46 31 549570 0.58 0.60 0.64 1.17 1.16 1.39 72 549577 0.25 0.30 0.38 2.92 3.27 4.39 79 549581 0.25 ND ND 1.04 1.07 1.40 83 549582 0.07 0.10 0.12 0.89 0.95 1.15 146 549583 0.25 0.26 0.25 0.97 0.94 1.09 33 617309 0.36 0.36 0.51 1.06 1.06 1.09 97
TABLE-US-00014 TABLE 14 Effect of modified oligonucleotides on Tau exon 10 skipping in transgenic mice ISIS 4R 4R 4R spinal AIF1 spinal SEQ NO. cortex hippo cord cord ID NO. 549582 0.21 0.21 0.23 0.97 146 549584 0.32 0.28 0.28 1.12 34 549585 0.30 0.27 0.30 1.05 35 565989 0.36 0.32 0.36 1.03 153 565990 0.50 0.46 0.53 0.97 154 617341 0.25 0.28 0.28 1.16 130 617351 0.13 0.18 0.14 1.01 140 617352 0.09 0.13 0.09 1.06 141 617354 0.31 ND ND 1.21 143 617355 0.43 0.50 0.37 1.18 144 617356 0.30 0.40 0.49 0.98 145 617357 0.33 0.33 0.27 1.31 147 617358 0.27 0.27 0.34 1.12 148 617359 0.32 0.32 0.37 0.95 149 617360 0.21 0.19 0.29 1.19 150 617361 0.26 0.21 0.37 1.04 151 617362 0.26 0.27 0.34 0.90 152 617364 0.39 0.33 0.43 1.09 157
TABLE-US-00015 TABLE 15 Effect of modified oligonucleotides on Tau exon 10 skipping in transgenic mice ISIS 4R 4R 4R spinal AIF1 AIF1 spinal SEQ NO. cortex hippo cord cortex cord ID NO. 549582 0.26 0.34 0.29 0.74 1.03 146 549586 0.25 0.43 0.38 0.97 0.98 36 549587 0.39 0.47 0.46 0.96 1.17 37 549595 0.27 0.39 0.39 0.84 0.92 45 617317 0.62 0.83 0.53 0.88 1.05 106 617318 0.57 0.69 0.49 0.94 1.06 107 617323 0.60 0.82 0.49 0.92 1.10 112 617324 0.72 0.88 0.49 0.70 1.03 113 617365 0.31 0.42 0.27 0.79 0.87 158 617367 0.39 0.46 0.35 0.90 1.29 160
Example 10: Effect In Vivo of Mixed Backbone Oligonucleotides on Human Tau Exon 10 Skipping
[0454] Groups of four B6.Cg-Mapttm1(EGFP)Klt Tg(MAPT)8cPdav/J mice (see Example 9) were administered 125 μg of an oligonucleotide selected from Table 3, 4, or 9 or PBS via ICV bolus injection. Two weeks after the dose, animals were sacrificed and RNA was extracted from the cerebral cortex and/or hippocampus and analyzed as described in Example 9. The results are presented in Tables 16 and 17 as the average ratio of the 4R isoform to total Tau mRNA normalized to PBS for each treatment group.
[0455] Expression of allograft inflammatory factor (AIF1) was tested as a measure of inflammation by performing RT-PCT to determine the expression levels of AIF1 in the cortex and spinal cord. After normalization of all samples to GADPH, the average AIF1 value for each treatment group was divided by the average AIF1 value for the PBS control group. The results are presented in Tables 16 and 17.
TABLE-US-00016 TABLE 16 Effect of modified oligonucleotides on Tau exon 10 skipping in transgenic mice ISIS 4R AIF1 AIF1 spinal SEQ NO. Cortex cortex cord ID NO. 549582 0.42 1.0 0.9 146 549583 0.71 0.9 1.2 33 617341 0.64 1.0 0.9 130 617361 0.63 1.1 1.1 151 670011 0.78 1.0 1.0 130 670012 0.47 0.9 1.1 146 670013 0.63 1.0 0.9 148 670014 0.90 0.9 1.0 33 670015 0.70 0.9 0.9 150 670018 0.75 1.0 1.0 34 670019 0.58 1.1 1.0 35 670020 0.67 0.9 0.9 130 670023 0.87 1.0 1.0 33 670024 0.60 1.0 1.1 150 670025 0.72 1.1 0.9 151 670027 0.79 1.0 0.9 34 670028 0.66 1.1 1.0 35 678329 0.13 1.0 1.0 140 678330 0.51 0.9 0.9 141 678331 1.12 0.9 1.0 83 678332 0.27 0.9 1.0 140 678333 0.56 0.9 0.9 141 678334 1.10 0.9 1.2 83
TABLE-US-00017 TABLE 17 Effect of modified oligonucleotides on Tau exon 10 skipping in transgenic mice ISIS 4R AIF1 AIF1 spinal SEQ No. Cortex cortex cord ID NO. 549577 0.56 1.4 1.6 79 549580 0.52 0.9 1.2 82 549582 0.27 0.9 1.0 146 549586 0.90 1.1 1.3 36 549595 0.90 1.0 1.4 45 617353 1.35 1.0 1.3 142 693840 0.80 0.9 1.2 79 693841 0.91 1.1 1.1 82 693842 1.20 1.0 0.8 36 693843 1.31 1.0 1.6 45 693844 2.22 1.1 1.6 142 693845 0.86 1.0 1.4 79 693846 0.84 1.0 1.4 82 693847 0.89 1.0 1.8 36 693848 0.76 0.9 1.9 45 693849 2.08 0.8 1.8 142