DENDRITIC CELL IMMUNOTHERAPY
20220213440 · 2022-07-07
Inventors
Cpc classification
A61K35/17
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K31/4745
HUMAN NECESSITIES
A61K31/708
HUMAN NECESSITIES
A61K35/17
HUMAN NECESSITIES
A61K31/713
HUMAN NECESSITIES
A61K2039/5154
HUMAN NECESSITIES
A61K31/4745
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K31/708
HUMAN NECESSITIES
C12N5/0639
CHEMISTRY; METALLURGY
A61K31/713
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
A61K31/4745
HUMAN NECESSITIES
A61K31/708
HUMAN NECESSITIES
A61K31/713
HUMAN NECESSITIES
A61K35/17
HUMAN NECESSITIES
A61K39/00
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
Abstract
Methods of providing a targeted immune response in a subject comprising administration of a dendritic cell population are provided. In some aspects, dendritic cells are administered in conjunction with a Type I interferon (INF), a TLR-7 agonist, a TLR-9 agonist, AIMp1, a TLR-3 agonist, a retinoic acid inducible gene-1 (RIG-1)-like receptor ligand or a cytosolic DNA (CDS) receptor ligand and/or are administered to a tissue site proximal to diseased tissue. Therapeutic dendritic cell compositions are likewise provided.
Claims
1. A method for providing an immune response in a subject having a diseased cell population, the method comprising: (a) obtaining a mature dendritic cell population, wherein the cells have been primed with at least one antigen specific to the diseased cell population; and (b) administering an effective amount of the mature dendritic cell population to the subject, wherein the mature dendritic cell population is administered in conjunction with a Type I interferon (INF).
2-3. (canceled)
4. The method of claim 1, wherein the Type I INF is INF-α.
5. The method of claim 1, wherein the mature dendritic cell population is administered in further conjunction with a TLR-7 agonist.
6. The method of claim 5, wherein the TLR-7 agonist is selected from the group consisting of CL075, CL097, CL264, CL307, GS-9620, Poly(dT), imiquimod, gardiquimod, resiquimod (R848), loxoribine, and a ssRNA oligonucleotide.
7. The method of claim 1, wherein the mature dendritic cell population is administered in further conjunction with a TLR-9 agonist.
8. The method of claim 7, wherein the TLR-9 agonist is a CpG oligodeoxynucleotide (CpG ODN).
9. The method of claim 1, wherein the mature dendritic cell population is administered in further conjunction with AIMp1.
10. The method of claim 1, wherein the Type I INF is administered before or essentially simultaneously with the primed dendritic cell population.
11. The method of claim 1, wherein the Type I INF is administered after the mature dendritic cell population.
12. The method of claim 1, wherein the Type I INF is administered within about 1 week, 1 day, 8 hours, 4 hours, 2 hours or 1 hour of the mature dendritic cell population.
13. The method of claim 1, further comprising administering a composition comprising an effective amount of the mature dendritic cell population and a Type I INF to the subject.
14. The method of claim 1, further comprising administering an immune checkpoint inhibitor to the subject.
15. The method of claim 14, wherein the immune checkpoint inhibitor is a CTLA-4 antagonist.
16. (canceled)
17. The method of claim 1, wherein the mature dendritic cell population is administered to a lymphoid tissue site proximal to the diseased cell population in the subject.
18. (canceled)
19. The method of claim 17, wherein said lymphoid tissue site is lymphoid tissue that drains tissue surrounding the diseased cell population.
20. The method of claim 1, wherein the subject has a cancer, and autoimmune disease or an infectious disease.
21. The method of claim 20, wherein the diseased cell population is a tumor.
22. (canceled)
23. An immunogenic composition comprising: (i) an antigen-primed, mature dendritic cell and (ii) a Type I interferon (INF).
24-84. (canceled)
85. The method of claim 1, wherein the cells have been loaded with mRNA that encodes at least one antigen and homologous lysate that comprises at least one corresponding antigen.
86. The method of claim 1, wherein the cells have been loaded with mRNA and lysate from the diseased cell population.
87. The method of claim 1, wherein the cells have been genetically modified to reduce expression of CTLA-4.
88. The method of claim 87, wherein the cells comprise an inhibitory nucleic acid specific to CTLA-4.
89. The method of claim 88, wherein the inhibitor nucleic acid is a small interfering RNA (siRNA) or a short hairpin RNA (shRNA).
90. The method of claim 87, wherein the genetic modification comprises a genomic deletion or insertion in the cells that reduces CTLA-4 expression.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
I. The Present Embodiments
[0042] Dendritic cells comprise a highly specialized class of antigen presenting cells. Previous studies have demonstrated that dendritic cells can be effectively primed to stimulate a T-cell response that is specifically targeted to a cell population in in subject, such as cancer cell (see, e.g., U.S. Pat. No. 8,728,806, which is incorporated herein by reference). However, there remained a need for methods to enhance the efficacy of dendritic cell compositions and thereby provide a more robust immune response.
[0043] Studies presented herein demonstrate for the first time that both co-stimulator molecules and the site of dendritic cell application can be significantly effect the efficacy of the cell compositions. In particular, the administration of dendritic cells in conjunction with a co-stimulator such as Type I interferon (e.g., INFα), a TLR-7 agonist, a TLR-9 agonist, or AIMp1 was found to significantly enhance the T-cell response provided by primed dendritic cell compositions. Likewise, enhanced T-cell responses could be achieved with primed dendritic cells administered in conjunction with a TLR-3 agonist, a retinoic acid inducible gene-1 (RIG-1)-like receptor ligand or a cytosolic DNA (CDS) receptor ligand. Moreover, the site of application of dendritic cells was found to significantly vary the effectiveness of T-cell stimulation. In particular, without being bound by any particular theory of the mechanism of action, it is believed that the dendritic cells should preferably be exposed to T-cells that are proximal to the site to the targeted disease tissue (e.g., tumor). Accordingly, in some preferred aspects, dendritic cell compositions are administered to a subject by direct introduction into lymphoid tissue that drains the site of a diseased cell population, such as a tumor. Thus, by combined use of co-stimulator molecules and administration of primed dendritic cells to a site proximal to disease tissue an extremely robust immune response can be induced.
II. Dendritic Cell Populations of the Embodiments
[0044] Methods for isolating culturing and priming dendritic cells are well known in the art. For example, U.S. Pat. No. 8,728,806, which is incorporated herein by reference in its entirety, provides detailed methods for providing antigen primed dendritic cells that may be used in the compositions and methods of the embodiments. In certain aspects, dendritic cells for use according to the embodiments are isolated from a subject that is to be treated by a method of the embodiments. In other aspects, dendritic cells may be from a different subject, such as an HLA-matched donor. In certain aspects, the dendritic cells are from a bank of dendritic cells having a defined HLA typing. In preferred aspects, primed dendritic cells for use according to the embodiments are homologously-loaded with antigen as detailed herein and in U.S. Pat. No. 8,728,806.
[0045] Methods for isolating cell populations enriched for dendritic cell precursors and immature dendritic cells from various sources, including blood and bone marrow, are known in the art. For example, dendritic cell precursors and immature dendritic cells can be isolated by collecting heparinized blood, by apheresis or leukapheresis, by preparation of buffy coats, rosetting, centrifugation, density gradient centrifugation (e.g., using Ficoll (such as FICOLL-PAQUE®), PERCOLL® (colloidal silica particles (15-30 mm diameter) coated with non-dialyzable polyvinylpyrrolidone (PVP)), sucrose, and the like), differential lysis of cells, filtration, and the like. In certain embodiments, a leukocyte population can be prepared, such as, for example, by collecting blood from a subject, defribrinating to remove the platelets and lysing the red blood cells. Dendritic cell precursors and immature dendritic cells can optionally be enriched for monocytic dendritic cell precursors by, for example, centrifugation through a PERCOLL® gradient. In other aspects, dendritic cell precursors can be selected using CD14 selection of G-CSF mobilized peripheral blood.
[0046] Dendritic cell precursors and immature dendritic cells optionally can be prepared in a closed, aseptic system. As used herein, the terms “closed, aseptic system” or “closed system” refer to a system in which exposure to non-sterilize, ambient, or circulating air or other non-sterile conditions is minimized or eliminated. Closed systems for isolating dendritic cell precursors and immature dendritic cells generally exclude density gradient centrifugation in open top tubes, open air transfer of cells, culture of cells in tissue culture plates or unsealed flasks, and the like. In a typical embodiment, the closed system allows aseptic transfer of the dendritic cell precursors and immature dendritic cells from an initial collection vessel to a sealable tissue culture vessel without exposure to non-sterile air.
[0047] In certain embodiments, monocytic dendritic cell precursors are isolated by adherence to a monocyte-binding substrate. For example, a population of leukocytes (e.g., isolated by leukapheresis) can be contacted with a monocytic dendritic cell precursor adhering substrate. When the population of leukocytes is contacted with the substrate, the monocytic dendritic cell precursors in the leukocyte population preferentially adhere to the substrate. Other leukocytes (including other potential dendritic cell precursors) exhibit reduced binding affinity to the substrate, thereby allowing the monocytic dendritic cell precursors to be preferentially enriched on the surface of the substrate.
[0048] Suitable substrates include, for example, those having a large surface area to volume ratio. Such substrates can be, for example, a particulate or fibrous substrate. Suitable particulate substrates include, for example, glass particles, plastic particles, glass-coated plastic particles, glass-coated polystyrene particles, and other beads suitable for protein absorption. Suitable fibrous substrates include microcapillary tubes and microvillous membrane. The particulate or fibrous substrate usually allows the adhered monocytic dendritic cell precursors to be eluted without substantially reducing the viability of the adhered cells. A particulate or fibrous substrate can be substantially non-porous to facilitate elution of monocytic dendritic cell precursors or dendritic cells from the substrate. A “substantially non-porous” substrate is a substrate in which at least a majority of pores present in the substrate are smaller than the cells to minimize entrapping cells in the substrate.
[0049] Adherence of the monocytic dendritic cell precursors to the substrate can optionally be enhanced by addition of binding media. Suitable binding media include monocytic dendritic cell precursor culture media (e.g., AIM-V®, RPMI 1640, DMEM, X-VIVO 15®, and the like) supplemented, individually or in any combination, with for example, cytokines (e.g., Granulocyte/Macrophage Colony Stimulating Factor (GM-CSF), Interleukin 4 (IL-4), or Interleukin 13 (IL-13)), blood plasma, serum (e.g., human serum, such as autologous or allogenic sera), purified proteins, such as serum albumin, divalent cations (e.g., calcium and/or magnesium ions) and other molecules that aid in the specific adherence of monocytic dendritic cell precursors to the substrate, or that prevent adherence of non-monocytic dendritic cell precursors to the substrate. In certain embodiments, the blood plasma or serum can be heated-inactivated. The heat-inactivated plasma can be autologous or heterologous to the leukocytes.
[0050] Following adherence of monocytic dendritic cell precursors to the substrate, the non-adhering leukocytes are separated from the monocytic dendritic cell precursor/substrate complexes. Any suitable means can be used to separate the non-adhering cells from the complexes. For example, the mixture of the non-adhering leukocytes and the complexes can be allowed to settle, and the non-adhering leukocytes and media decanted or drained. Alternatively, the mixture can be centrifuged, and the supernatant containing the non-adhering leukocytes decanted or drained from the pelleted complexes.
[0051] Isolated dendritic cell precursors can be cultured ex vivo for differentiation, maturation and/or expansion. (As used herein, isolated immature dendritic cells, dendritic cell precursors, T cells, and other cells, refers to cells that, by human hand, exists apart from their native environment, and are therefore not a product of nature. Isolated cells can exist in purified form, in semi-purified form, or in a non-native environment.) Briefly, ex vivo differentiation typically involves culturing dendritic cell precursors, or populations of cells having dendritic cell precursors, in the presence of one or more differentiation agents. Suitable differentiating agents can be, for example, cellular growth factors (e.g., cytokines such as (GM-CSF), Interleukin 4 (IL-4), Interleukin 13 (IL-13), and/or combinations thereof). In certain embodiments, the monocytic dendritic cells precursors are differentiated to form monocyte-derived immature dendritic cells.
[0052] The dendritic cell precursors can be cultured and differentiated in suitable culture conditions. Suitable tissue culture media include AIM-V®, RPMI 1640, DMEM, X-VIVO 15®, and the like. The tissue culture media can be supplemented with serum, amino acids, vitamins, cytokines, such as GM-CSF and/or IL-4, divalent cations, and the like, to promote differentiation of the cells. In certain embodiments, the dendritic cell precursors can be cultured in the serum-free media. Such culture conditions can optionally exclude any animal-derived products. A typical cytokine combination in a typical dendritic cell culture medium is about 500 units/ml each of GM-CSF (50 ng/ml) and IL-4 (10 ng/ml). Dendritic cell precursors, when differentiated to form immature dendritic cells, are phenotypically similar to skin Langerhans cells. Immature dendritic cells typically are CD14− and CD11c+, express low levels of CD86 and CD83, and are able to capture soluble antigens via specialized endocytosis. The immature DC expressed very high levels of CD86. Also, the population was mixed in terms of CD14 and CD11C. Though the majority were CD11c+, there were distinct subpopulations that were CD11c− and CD 14+.
[0053] The immature dendritic cells are matured to form mature dendritic cells. Mature DC lose the ability to take up antigen and display up-regulated expression of costimulatory cell surface molecules and various cytokines. Specifically, mature DC express higher levels of MHC class I and II antigens than immature dendritic cells, and mature dendritic cells are generally identified as being CD80+, CD83+, CD86+, and CD14−. Greater MHC expression leads to an increase in antigen density on the DC surface, while up regulation of costimulatory molecules CD80 and CD86 strengthens the T cell activation signal through the counterparts of the costimulatory molecules, such as CD28 on the T cells.
[0054] Mature dendritic cells of the present invention can be prepared (i.e., matured) by contacting the immature dendritic cells with effective amounts or concentrations of a nucleic acid composition and a tumor antigen composition. Effective amounts of nucleic acid composition typically range from at most, at least, or about 0.01, 0.1, 1, 5, 10, to 10, 15, 20, 50, 100 ng or mg of nucleic acid per culture dish or per cell, including all values and ranges there between. Effective amounts of tumor antigen composition typically range from at most, at least, or about 0.01, 0.1, 1, 5, 10, to 10, 15, 20, 50, 100 ng or mg of protein per culture dish or per cell. In certain aspects 0.001 ng of tumor antigen/cell to 1 μg of tumor antigen/million cells) can be used. The tumor antigen composition can optionally be heat inactivated or treated (e.g., exposed to protease) prior to contact with dendritic cells. Maturing the immature dendritic cells with a nucleic acid composition and a tumor antigen composition primes the mature dendritic cells for a type 1 (Th-1) response.
[0055] The immature DC are typically contacted with effective amounts of a nucleic acid composition and a tumor antigen composition for at most, at least, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, to 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 minutes, hours, or days. The immature dendritic cells can be cultured and matured in suitable maturation culture conditions. Suitable tissue culture media include AIM-V®, RPMI 1640, DMEM, X-VIVO 15®, and the like. The tissue culture media can be supplemented with amino acids, vitamins, cytokines, such as GM-CSF and/or IL-4, divalent cations, and the like, to promote maturation of the cells.
[0056] Maturation of dendritic cells can be monitored by methods known in the art. Cell surface markers can be detected in assays familiar to the art, such as flow cytometry, immunohistochemistry, and the like. The cells can also be monitored for cytokine production (e.g., by ELISA, FACS, or other immune assay). Dendritic cell precursors, immature dendritic cells, and mature dendritic cells, either primed or unprimed, with antigens can be cryopreserved for use at a later date. Methods for cryopreservation are well-known in the art. For example, U.S. Pat. No. 5,788,963, which is incorporated herein by reference in its entirety.
[0057] A. Genetically Modified Dendritic Cells
[0058] Certain aspects of the embodiments concern dendritic cells that have been genetically modified. In some aspects, the genetic modification comprises introduction of an exogenous transgene in the cells, such as an inhibitory nucleic acid. In further aspects, the transgene may be a suicide gene, such as a gene encoding thymidine kinase, under the control of an inducible promoter. Thus, in some aspects, after stimulating an immune response, administered dendritic cells can be killed-off by induction of the promoter controlling expression of the suicide gene.
[0059] In further aspects, the genetic modification comprises a genomic deletion or insertion in the cell population. For example, one or more HLA gene may be disrupted to render the dendritic cells as an effective HLA match for a subject to be treated.
[0060] Further aspects of the embodiments concern dendritic cells that have been genetically modified, such as to reduce the expression of CTLA-4. In some aspects, the genetic modification comprises introduction of an exogenous inhibitory nucleic acid specific to CTLA-4. In certain aspects, the inhibitory nucleic acid is a RNA, such as a RNA that is expressed from a DNA vector in the dendritic cells. In further aspects, the inhibitory nucleic acid may be a siRNAs, dsRNA, miRNA or shRNA that is introduced in the dendritic cells. A detailed disclosure of such RNAs is provided above.
[0061] In further aspects, the genetic modification comprises a genomic deletion or insertion in the cell population that reduces CTLA-4. In other aspects, the dendritic cells comprises a hemizygous or homozygous deletion within the CTLA-4 gene. For example, in some aspects, one or both copies of the CTLA-4 gene of a dendritic cell can be completely or partially deleted, such that expression the CTLA-4 polypeptides inhibited. In some aspects, modification the cells so that they do not express one or more CTLA-4 gene may comprise introducing into the cells an artificial nuclease that specifically targets the CTLA-4 locus. In various aspects, the artificial nuclease may be a zinc finger nuclease, TALEN, or CRISPR/Cas9. In various aspects, introducing into the cells an artificial nuclease may comprise introducing mRNA encoding the artificial nuclease into the cells.
III. Combination Therapies
[0062] In order to increase the effectiveness of dendritic cell therapies of the embodiments, it may be desirable to combine these compositions with other agents effective in the treatment of the disease of interest.
[0063] In some aspects, the dendritic cell therapies are administered in conjunction with molecules such as TLR agonists, Type I interferon (INF), AIMp1, a retinoic acid inducible gene-1 (RIG-1)-like receptor ligand or a cytosolic DNA (CDS) receptor ligand. The TLR agonist may be a TLR3, TLR7, TLR8 or TLR9 agonist. The Type I INF may be INF-α, IFN-β, IFN-ε, IFN-κ or IFN-ω. For example, the TLR-7 agonist may be selected from the group consisting of CL075, CL097, CL264, CL307, GS-9620, Poly(dT), imiquimod, gardiquimod, resiquimod (R848), loxoribine, and a ssRNA oligonucleotide. Exemplary TLR-9 agonists include a CpG oligodeoxynucleotide (CpG ODN). Other TLR agonists are described for example in U.S. Patent Publication No. 2014/0005255; incorporated herein by reference.
[0064] A RIG-I-like receptor (RLR) ligand, which are known in the art, refers to activator of RIG-I, Mda5, as well as LGP2 signaling. These ligands include, but are not restricted to, single-stranded RNA, double-stranded RNA, and 5′-triphosphate RNA. RIG-I-like receptor ligand also refers to any modification introduced in an RNA molecule that can lead to binding and activation of RIG-I, Mda5, and LGP2 leading to RLR-like biological activity. In some aspects, the RLR ligand may be a modulator of common adaptor protein such as IPS-1, also known as MAVS, VISA or CARDIF. For example, the RIG-1-like receptor ligand is selected from the group consisting of a MDA5 ligand, a LGP2 ligand, a ssRNA, a dsRNA, 5′ppp-dsRNA, Poly(dA:dT), and Poly(I:C).
[0065] In certain aspects, the primed dendritic cell population is administered in conjunction with a CDS receptor ligand. In some aspects, the CDS receptor ligand is further defined as a cGAS-STING ligand. For example, the cGAS-STING ligand is bacterial cyclic-dinucleotides (CDNs). Other cGAS-STING agonists such as nucleic acid, a protein, a peptide, or a small molecule are described for example in International Patent Publication No. WO2015/077354.
[0066] As a non-limiting example, the treatment of cancer may be implemented with a primed dendritic cell composition of the present embodiments along with other anti-cancer agents. An “anti-cancer” agent is capable of negatively affecting cancer in a subject, for example, by killing cancer cells, inducing apoptosis in cancer cells, reducing the growth rate of cancer cells, reducing the incidence or number of metastases, reducing tumor size, inhibiting tumor growth, reducing the blood supply to a tumor or cancer cells, promoting an immune response against cancer cells or a tumor, preventing or inhibiting the progression of cancer, or increasing the lifespan of a subject with cancer. More generally, these other compositions would be provided in a combined amount effective to kill or inhibit proliferation of the cell. This process may involve contacting the cells with the anti-cancer peptide or nanoparticle complex and the agent(s) or multiple factor(s) at the same time. This may be achieved by contacting the cell with a single composition or pharmacological formulation that includes both agents, or by contacting the cell with two distinct compositions or formulations, at the same time, wherein one composition includes the dendritic cell composition and the other includes the second agent(s).
[0067] Treatment with the a dendritic cell composition may precede or follow the other agent treatment by intervals ranging from minutes to weeks. In embodiments where the other agent and dendritic cell composition are applied separately to the subject, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the agent and the dendritic cell composition would still be able to exert an advantageously combined effect on the cell. In such instances, it is contemplated that one may contact the cell with both modalities within about 12-24 hours of each other and, more preferably, within about 6-12 hours of each other. In some situations, it may be desirable to extend the time period for treatment significantly where several days (e.g., 2, 3, 4, 5, 6 or 7 days) to several weeks (e.g., 1, 2, 3, 4, 5, 6, 7 or 8 weeks) lapse between the respective administrations.
[0068] Various combinations may be employed, where dendritic cell therapy is “A” and the secondary agent, such as radiotherapy, chemotherapy or anti-inflammatory agent, is “B”:
TABLE-US-00001 A/B/A B/A/B B/B/A A/A/B A/B/B B/A/A A/B/B/B B/A/B/B B/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A B/A/B/A B/A/A/B A/A/A/B B/A/A/A A/B/A/A A/A/B/A
[0069] In certain embodiments, administration of dendritic cell therapy of the present embodiments to a patient will follow general protocols for the administration of chemotherapeutics, taking into account the toxicity, if any, of the vector. It is expected that the treatment cycles would be repeated as necessary. It also is contemplated that various standard therapies, as well as surgical intervention, may be applied in combination with the described hyperproliferative cell therapy.
[0070] A. Chemotherapy
[0071] Cancer therapies also include a variety of combination therapies. In some aspects a dendritic cell composition of the embodiments is administered (or formulated) in conjunction with a chemotherapeutic agent. For example, in some aspects the chemotherapeutic agent is a protein kinase inhibitor such as a EGFR, VEGFR, AKT, Erb1, Erb2, ErbB, Syk, Bcr-Abl, JAK, Src, GSK-3, PI3K, Ras, Raf, MAPK, MAPKK, mTOR, c-Kit, eph receptor or BRAF inhibitors. Nonlimiting examples of protein kinase inhibitors include Afatinib, Axitinib, Bevacizumab, Bosutinib, Cetuximab, Crizotinib, Dasatinib, Erlotinib, Fostamatinib, Gefitinib, Imatinib, Lapatinib, Lenvatinib, Mubritinib, Nilotinib, Panitumumab, Pazopanib, Pegaptanib, Ranibizumab, Ruxolitinib, Saracatinib, Sorafenib, Sunitinib, Trastuzumab, Vandetanib, AP23451, Vemurafenib, MK-2206, GSK690693, A-443654, VQD-002, Miltefosine, Perifosine, CAL101, PX-866, LY294002, rapamycin, temsirolimus, everolimus, ridaforolimus, Alvocidib, Genistein, Selumetinib, AZD-6244, Vatalanib, P1446A-05, AG-024322, ZD1839, P276-00, GW572016 or a mixture thereof.
[0072] Yet further combination chemotherapies include, for example, alkylating agents such as thiotepa and cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gammall and calicheamicin omegall; dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores, aclacinomysins, actinomycin, authrarnycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalarnycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK polysaccharide complex; razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2′,2″-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside (“Ara-C”); cyclophosphamide; taxoids, e.g., paclitaxel and docetaxel gemcitabine; 6-thioguanine; mercaptopurine; platinum coordination complexes such as cisplatin, oxaliplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (e.g., CPT-11); topoisomerase inhibitor RFS 2000; difluorometlhylornithine (DMFO); retinoids such as retinoic acid; capecitabine; carboplatin, procarbazine, plicomycin, gemcitabien, navelbine, farnesyl-protein tansferase inhibitors, transplatinum, and pharmaceutically acceptable salts, acids or derivatives of any of the above. In certain embodiments, the compositions provided herein may be used in combination with gefitinib. In other embodiments, the present embodiments may be practiced in combination with Gleevac (e.g., from about 400 to about 800 mg/day of Gleevac may be administered to a patient). In certain embodiments, one or more chemotherapeutic may be used in combination with the compositions provided herein.
[0073] B. Radiotherapy
[0074] Other factors that cause DNA damage and have been used extensively include what are commonly known as Trays, X-rays, and/or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated such as microwaves and UV-irradiation. It is most likely that all of these factors effect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.
[0075] The terms “contacted” and “exposed,” when applied to a cell, are used herein to describe the process by which a therapeutic composition and a chemotherapeutic or radiotherapeutic agent are delivered to a target cell or are placed in direct juxtaposition with the target cell. To achieve cell killing or stasis, both agents are delivered to a cell in a combined amount effective to kill the cell or prevent it from dividing.
[0076] C. Gene Therapy
[0077] In yet another embodiment, the secondary treatment is a gene therapy in which a therapeutic polynucleotide is administered before, after, or at the same time as the therapeutic composition. Viral vectors for the expression of a gene product are well known in the art, and include such eukaryotic expression systems as adenoviruses, adeno-associated viruses, retroviruses, herpesviruses, lentiviruses, poxviruses including vaccinia viruses, and papiloma viruses, including SV40. Alternatively, the administration of expression constructs can be accomplished with lipid based vectors such as liposomes or DOTAP:cholesterol vesicles. All of these method are well known in the art (see, e.g. Sambrook et al., 1989; Ausubel et al., 1998; Ausubel, 1996).
[0078] D. Surgery
[0079] Approximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative and palliative surgery. Curative surgery is a cancer treatment that may be used in conjunction with other therapies, such as the treatments provided herein, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy and/or alternative therapies.
[0080] Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and miscopically controlled surgery (Mohs' surgery). It is further contemplated that the present embodiments may be used in conjunction with removal of superficial cancers, precancers, or incidental amounts of normal tissue. In some aspects, following tumor resection a dendritic cell composition of the embodiments is administered to lymphoid tissue that drained the previous site for the tumor.
IV. Examples
[0081] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
Example 1—Materials and Methods
[0082] As used in the examples described below, Eight-to-twelve-week-old C57BL/6, Balb/c, and FVB mice were obtained from Harlan Laboratories (Indianapolis, Ind.) or from the Jackson Laboratory (Barr Harbor, Me.). H2-DM knockout mice in the C57BL/6 background were a kind gift from Dr. Jenny Ting at the University of North Carolina, Chapel Hill. Pro-Cat/JOCK1 transgenic mice in the FVB background were created in the laboratory of Dr. David Spencer at Baylor College of Medicine, Houston Tex. as described (Carstens et al., 2014). All mice were maintained in accordance with the specific IACUC requirements of Baylor College of Medicine.
[0083] Preparation of Vaccine Materials, Loading of DC, and In vitro CoCulture—Seminal vesicle (SV) and prostate were harvested from 10 week old male mice and immediately frozen at −80° C. RAW264.7, B16-F10, 4T1, and WPMY-1 cell lines were obtained from the American Type Culture Collection (ATCC, Manassas, Va.), grown to confluence in T225 flasks (Corning Lifesciences, Tewksbury, Mass.) at 37° C., 5% CO.sub.2, harvested, and also immediately frozen at −80° C. Peptides were reconstituted in an 80:20 dH.sub.2O:DMSO solution at 10 mg/ml and stored at −80° C. To generate MHC class I (mRNA) or II (lysate) determinants, tissue fractions were first disrupted using a Polytron PT1200E tissue homogenizer (Kinematica, Inc, Bohemia, N.Y.). To generate cell lysates, homogenized tissue suspensions were diluted to 50 mg/ml in PBS (Life Technologies, Carlsbad, Calif.), subjected to repetitive freeze-thaw cycles, and stored at −20° C. To generate mRNA, total RNA was isolated from homogenized tissue using Trizol reagent (Life Technologies, Carlsbad, Calif.) according to the manufacturer's instructions, and mRNA was isolated from total RNA using an Oligotex mRNA Maxi Kit (Qiagen, Valencia, Calif.) also according to the manufacturer's instructions. mRNA was quantitated with a Nanodrop spectrophotometer (Thermo Scientific) and integrity was verified by gel electrophoresis. Human (Decker et al., 2006; Decker et al., 2009) and wild type mouse (Konduri et al., 2013) dendritic cells were prepared, loaded, and matured as described. Use of siRNA was performed according to the manufacturer's instructions (Thermo Scientific—Dharmacon). Maturation cocktail of H2-DM.sup.−/− DC was additionally supplemented with 1 μg/ml CpG-ODN (InvivoGen). In vitro co-cultures were performed as described previously (Decker et al., 2006; Decker et al., 2009; Konduri et al., 2013).
[0084] Vaccination—All mice vaccinated therapeutically were administered 5×10.sup.4-5×10.sup.5 DC i.p. and 0.5 mg imiquimod (LC Labs, Woburn, Mass.) suspended but not solubilized in 20% DMSO/80% AIM-V, also i.p. Mice were vaccinated one to four times as shown in
[0085] Histological and Gross Analysis—Paraffin sections were stained with hematoxylin and eosin for gross histological analysis by light microscopy using an Olympus CX41 microscope (Olympus corporation, Center Valley, Pa.) with an Olympus DP70 digital camera (Olympus Corporation). Blinded histopathological scoring of prostate cancer consisted of a four-point scale based upon predominant stage of disease present among all anterior, ventral, and dorsolateral fields observed in two sections of differing depths: 0=normal, 1=hyperplasia, 2=PIN, 3=adenocarcinoma, 4=transitional. Half points were permitted if a predominant stage could not be discerned.
[0086] MRI Analysis—MRI of the prostate and seminal vesicles was performed using a 9.4T, 21 cm bore horizontal scanner with a 35 mm volume resonator (Bruker BioSpin, Billerica, Mass.). The imaging parameters used to obtain three dimensional (3D) Turbo rapid acquisition with relaxation enhancement (RARE) images were as follows: TR=3000 ms; Effective TE=30 ms; FOV=30 mm.sup.3; matrix=128×128×128; RARE Factor=8; Number of Averages=1. Images were obtained using Paravision software version 5 (Bruker BioSpin). During imaging, mice were anesthetized with 0.25% isoflurane (Abbott, Abbott Park, Ill.) mixed with oxygen and the core temperature was maintained at 37° C. MRI images were analyzed using Amira 3.1 software (Visage Imaging, San Diego, Calif.).
[0087] CTLA-4/sCTLA-4 RT-PCR Assay—Loaded, matured DC were resuspended in 1 mL Trizol (Life Technologies) at <1×10.sup.7 cells per sample and total RNA was extracted according to manufacture's instructions. RNA was treated with 1 μg/μl DNase I (Invitrogen). cDNA was synthesized from the DNase-treated RNA sample using the SuperScript™ III First-Strand Synthesis kit (Life Technologies) and amplified by PCR for 35 cycles at an annealing temperature of 55° C. with CTLA-4 Fwd primer: ATGGCTTGCCTTGGATTTCAGCGGC (SEQ ID NO: 12) and CTLA-4 Rev primer: TCAATTGATGGGAATAAAATAAGGCTG (SEQ ID NO: 13). Primers were designed to amplify transcripts corresponding to both soluble and membrane-bound CTLA-4 isoforms.
[0088] Quantitation of Western Blot Images—Western blot chemiluminescent signal was detected using a ChemiDoc XRS digital imaging system running Image Lab software Version 2.0.1 (Bio-Rad Laboratories, Hercules, Calif.). All Western blots were quantitated by densitometry of Ponceau S (Sigma-Aldrich) stained membranes. Contamination of supernatants with residual cell lysate or debris from cell death was controlled for by immunostaining with anti-β-actin (Santa Cruz) and additional densitometry. Densitometry was performed using ImageJ software (NIH; Bethesda, Md.). For detection of both sCTLA-4 and AIMp1 on a single membrane, the membrane was typically probed first with anti-CTLA-4 after which it was stripped in Western Blot Restore buffer (Pierce, Rockford, Ill.) according to the manufacturer's instructions and re-probed with anti-AIMp1.
[0089] Pro-Cat/JOCK′ Prostate Cancer Treatment Model—Pro-Cat/JOCK1 mice were housed in a pathogen-free facility following approved IACUC protocols. Double transgenic mice were generated and genotyped as described (Carstens et al., 2014). Mice were treated biweekly starting at six weeks of age by i.p. injections of 100 μl AP20187 (Ariad Pharmaceuticals) at 2 mg/kg in drug diluent (16.7% propanediol, 22.5% PEG400, 1.25% TWEEN 80). Mice were vaccinated i.p. in the lower urogenital region after 24 weeks of AP20187 treatment with 5×10.sup.4-4×10.sup.5 loaded DC+0.5 mg particulate imiquimod (LC LABS) in 100 μl 20% DMSO or injected with 0.5 mg imiquimod only. Mice received four vaccine+imiquimod injections spaced at 10 day intervals. AP20187 injections were maintained biweekly until sacrifice.
[0090] Spontaneous Canine Oligodendroglioma Treatment Model—Upon diagnosis of CNS malignancy by clinical MR imaging, large (>25 kg) canine patients were enrolled in a non-randomized phase I trial following informed consent of the owners under an IACUC protocol established through the Translational Genomics Research Institute. Canine patients underwent craniotomy and conservative tumor resection after which the excised tumor was flash frozen in liquid nitrogen. To prepare vaccine antigens, the thawed tumor specimen was sub-divided into soluble lysate and mRNA components, and antigenic fractions were prepared as described above. Subsequently, patients were mobilized with G-CSF (Neupogen, Amgen, Thousand Oaks, Calif.) and peripheral blood mononuclear cells (PBMC) were harvested. Canine DCs were generated from the adherent monocytic fraction by six days of culture in AIM-V medium supplemented with 10% canine serum (Equitech Bio), 1% anti-anti (Life Technologies), 30 ng/ml rcGM-CSF and 10 ng/ml rcIL-4 (both from R&D Systems). Following loading with tumor antigens as described above, loaded DC matured using the same culture medium as described but supplemented additionally with 10 ng/ml rcIL-1β, 15 ng/ml rcIL-6, 10 ng/ml rcTNF-α (all from R&D Systems) and 1 μg/ml PGE.sub.2 (Sigma-Aldrich). DC were then harvested and resuspended in 2×500 μl aliquots PBS for bilateral injection into the vicinity of the deep cervical lymph nodes by means of ultrasound sonography. If multiple doses were administered, injections were spaced two weeks apart. During the course of treatment, animals were adjuvanted with 12 weeks of human IFN-α administered subcutaneously thrice weekly at two to eight million units per dose. Tumor volume was determined from digital MRI measurements by the following formula: Volume=4/3π (smallest radius).sup.2×(largest radius/smallest radius).
[0091] Statistical Analysis—Statistical significance was defined as p<0.05 (*=p<0.05, **=p<0.01) and was determined by Student's unpaired or paired t-test with one or two tails as statistically appropriate. Statistical differences between multiple groups were validated by one-way or two-way ANOVA. Statistical tests were performed with Microsoft Excel 2008 for the Macintosh Version 12.0. All normalized quantitation graphs were derived from three independent experiments unless stated otherwise and with error bars=+/−SD.
[0092] Reagents—Antibodies: αHuman CTLA-4 (ELISA) (eBioscience, San Diego, Calif.); αHuman/mouse CTLA-4 (WB) (Abcam; Cambridge, Mass.); αHuman/mouse AIMP1 (Lifespan Biosciences Inc, Seattle, Wash.); αMouse IL-12p70 (ELISA) (BD Biosciences, San Jose, Calif.); αHuman CD8 (ICH) (Biorbyt; San Francisco, Calif.), αMouse CD8 (flow cytometry), αMouse CD25, αMouse CD3, and αMouse CD4 (BD Biosciences); αMouse CD8 (in vivo depletion) and isotype control (BioXCell, West Lebanon, N.H.). αHuman/mouse β-actin was purchased from Santa Cruz Biotechnologies (Santa Cruz, Calif.). αHLA-A, B, C was purchased from BioLegend, San Diego, Calif. HLA typing antibodies: αHLA-A2-FITC (BD Biosciences), αHLA-B8-biotin (Abcam), and unconjugated αHLA-DR3/DR6 (Lifespan Biosciences). TLR agonists: TLR-3 agonist poly(I:C)-rhodamine, TLR-9 agonist CpG ODN-FITC, and TLR-5 agonist flagellin were obtained from InvivoGen (San Diego, Calif.). TLR-4 agonist LPS was obtained from Sigma-Aldrich (St. Louis, Mo.). DC uptake of poly(I:C)-rhodamine and CpG-FITC was confirmed and quantitated by fluorescent microscopy and flow cytometry using an LSR II flow cytometer (BD Biosciences) and analyzed with FlowJo version 10.0.00003 for the MacIntosh (Tree Star Inc, Ashland, Oreg.). All TLR agonists were used at a concentration of 1 μg/ml. Peptides: Influenza A New Caledonia hemagglutinin peptides WLTGKNGL (SEQ ID NO: 3), RNLLWLTGKNGLYPN (SEQ ID NO: 2), VLLENERTL (SEQ ID NO: 5), and ELLVLLENERTLDFH (SEQ ID NO: 4) (described previously in Decker et al., 2009) as well as methionine-for-glycine substituted derivatives WLTMKNML (SEQ ID NO: 8) and RNLLWLTMKNMLYPN (SEQ ID NO: 9) were synthesized by United BioSystems (Herndon, Va.). Ovalbumin H-2K.sup.b immunodominant peptide SIINFEKL (SEQ ID NO: 1) was synthesized by Anaspec (Freemont, Calif.). H-2D.sup.b CLIP-overlapping MRMATPLLM (SEQ ID NO: 6) was synthesized by United Biosystems. Recombinant ovalbumin protein was purchased from InvivoGen. Recombinant eGFP protein was purchased from Biovision (Moutainview, Calif.). Other: AIMp1 (SCYE1, mouse and human), β2-microglobulin (mouse and human), and HLA-DM (human) siGenome SMART Pools and non-targeting siRNA pools were purchased from Thermo Scientific (Wilmington Del.). Purified GFP mRNA was purchased from Stemgent (Cambridge, Mass.).
[0093] Co-Immnunoprecipitation Assay—DC were loaded as indicated and matured for two days before lysis with 1% NP-40 buffer+protease cocktail inhibitor (both from Sigma-Aldrich). Debris was pelleted at 14,000 rpm for 20 minutes at 4° C. in a tabletop microfuge, and subsequent cell lysates were precleared with Protein G plus-Agarose Bead suspension IP04 (EMD Millipore; Darmstadt, Germany) for 1 hour at 4° C. Lysates were then rotated overnight at 4° C. with Protein G plus beads coated with anti-AIMp1 (Lifespan Biosciences) or anti-HLA-A, B, C (BioLegend). Beads were then washed three times in 1% NP-40 buffer, twice in PBS, and immunoprecipitate was collected by boiling in 2% SDS (Sigma-Aldrich) denaturing buffer prior to analysis by PAGE.
[0094] .sup.51Cr Lysis Assay—.sup.51Cr Lysis Assay was performed as described previously (Decker et al., 2006).
[0095] 4T1-luc2 Tumor Model—4T1-luc2 tumor cells were prepared by cloning of the PCR-amplified luc2 cassette from pGL4.10 into the pCDH-CMV-MCS-EF1-Hygro expression vector. Linearized vector was electroporated into 4T1 parental cells, and 100 μg/ml hygromycin selection was applied for two weeks. To generate tumors, Balb/c mice were inoculated intradermally with 2.5×10.sup.5 4 T1-luc2 cells. Tumor growth was monitored by caliper measurement and IVIS every other day. IVIs images were acquired following i.p. injection of 0.5 mg d-luciferin (Regis Technologies, Morton Grove, Ill.) in 100 μl diluent.
Example 2—Characterization of AIMp1 Release and Till-Polarization of Mouse DC
[0096] Previous work implied the existence of a TLR- and IFN-independent mechanism of DC T.sub.H1 polarization initiated by loading with antigenically homologous MHC class I and II determinants (Decker et al., 2009). To determine whether AIMp1 played a role in this process, the inventors loaded DC with homologous class I and II antigenic determinants and assayed for T.sub.H1 polarization and AIMp1 release. Mouse DC secreted 10-fold more IL-12p70 (
Example 3—Human System DC AIMp1/sCTLA-4 Release
[0097] When human DC were homologously-loaded with the model GFP antigen (GFP mRNA and recombinant GFP protein), a significant increase in the AIMp1/sCTLA-4 ratio was observed (
[0098] To verify the importance of MHC binding to the function of this unique T.sub.H polarization cue, the inventors utilized H2-DM.sup.−/− DC. The H2-DM molecular chaperone is responsible for removing the CLIP peptide of the invariant chain from the MHC class II binding pocket. In the absence of H2-DM, CLIP is bound almost irreversibly to the class II binding pocket in the I-A.sup.b haplotype, thereby abrogating the ability to load exogenous antigen (Martin et al., 1996; Miyazaki et al., 1996). The inability to load exogenous antigen is the primary molecular deficit of H2-DM.sup.−/− DC. H2-DM.sup.−/− DC have no known defects in TLRs, NLRs, or other PRRs and have previously been shown to respond appropriately to TLR agonism (Strong et al., 1997). Very interestingly, H2-DM.sup.−/− DC have also been reported to display a T.sub.H2 polarized phenotype physically dependent upon the presence of bound CLIP peptide (Rohn et al., 2004). When loaded with homologous mRNA and lysate, H2-DM.sup.−/− DC displayed no differential secretion of AIMp1 or sCTLA-4 nor stimulated enhanced generation of activated CD8.sup.+ T-cells in vivo when loaded with SIINFEKL (SEQ ID NO: 1) and Ova (
[0099] Because H2-DM.sup.−/− DC permanently maintain CLIP within the MHC Class II binding groove, the only theoretical manner by which to stimulate T.sub.H1 polarization in H2-DM.sup.−/− DC by the cue described herein would be via loading of a class I binding peptide with significant homology to CLIP, i.e. with amino acid sequence overlapping the MHC class II bound-CLIP sequence LPKSAKPVSQMRMATPLLMRPMSM (SEQ ID NO: 14) (Ghosh et al., 1995). To test this hypothesis, the inventors designed a class I peptide predicted to bind H-2D.sup.b and possessing full sequence overlap with CLIP (MRMATPLLM, SEQ ID NO: 6). The inventors then loaded H2-DM.sup.−/− DC with either this CLIP-specific H-2D.sup.b class I peptide or the well-established H-2.sup.b class I SIINFEKL (SEQ ID NO: 1) peptide as a control. Substantial AIMp1 release was observed in a dose-dependent fashion only from the cells loaded with H-2D.sup.b CLIP (
[0100] To determine the degree of class I and II sequence homology required for perturbation of AIMp1 and sCTLA-4 secretion, the inventors utilized two different pairs of homologous binding peptides that were identical save for the substitution of two non-anchor glycine residues with methionines (
[0101] To further determine in the human system if T.sub.H1 polarization resulting from sequence overlap between class I and II epitopes could occur independently from traditional MHC binding, the inventors utilized siRNA against either β2-microglobulin or HLA-DM, significantly impacting the ability of, respectively, MHC class I or MHC class II to be loaded with peptide antigen. When the ability to load either class I or class II was impeded, DC lost the ability to modulate AIMp1 and CTLA-4 secretion in response to homologous class I and II peptide loading (
Example 4—Physiologic Relevance of Sequence-Dependent Mechanism
[0102] To ascertain physiologic relevance of this newly-characterized mechanism, the inventors characterized the ability of homologous antigenic loading to break tolerance to normal immunologic self. The inventors generated multiple homologously-loaded DC vaccines against wild type tissues including the seminal vesicle (SV) and prostate, intertwined but antigenically distinct urogenital organs easily visualized by MRI. Wild type mice were given 1-4 intraperitoneal (i.p) injections (
[0103] The prostate is located adjacent to the SV, sharing borders along its anterior and lateral lobes. DC homologously loaded with wild type prostate mRNA and lysate were administered (
[0104] The generation of vaccine specificity against two antigenically and spatially-related self-tissue systems allowed discernment of immunologic specificity. As shown, when mice were treated with prostate-loaded DC, pathology was exclusively prostate-specific (
Example 5—Physiologic Neoplasia Study
[0105] To determine the ability of this strategy to address physiologic neoplasia, the inventors utilized a variety of different model systems. In the 4T1 breast cancer model, cohorts of mice with day 8 established 4T1 luc2-expressing tumors were given a single dose of homologous vaccine (derived from parental, luc2.sup.− 4 T1 cells) or adjuvant only. While 5 of 6 adjuvant-treated mice developed metastases and died, the vaccinated mice maintained relatively small tumors and demonstrated no obvious morbidity at the conclusion of the experiment (
[0106] To determine the effects of homologous vaccination in a model of high physiologic relevance, the inventors utilized the transgenic Pro-Cat/JOCK1 model in which physiologic autochthonous prostate cancer develops upon induced FGFR1 and β-catenin signaling in prostatic epithelium (Carstens et al., 2014). In this model, mice progress from prostatic hyperplasia (8 weeks) through prostatic intraepithelial neoplasia (mPIN, 12 weeks), adenocarcinoma (24 weeks), and transitional sarcomatoid (60 weeks) stages. After inducing prostate adenocarcinoma for 24 weeks, mice were sacrificed and cancerous prostate was excised to generate adenocarcinoma stage antigenic preparations. Subsequent cohorts of mice were then induced for 24 weeks and vaccinated therapeutically with homologously-loaded vaccine. Vaccinated mice were sacrificed after an additional four months, and cancer progression was determined by blinded pathological scoring of H&E stained prostate. Mice receiving DC loaded with adenocarcinoma-stage antigens progressed through hyperplasia but largely arrested at mPIN, displaying relatively little histopathologic adenocarcinoma (
[0107] Lastly, the inventors tested this approach on spontaneous brain tumors in a large animal system to demonstrate the feasibility and safety of this approach in a clinical veterinary setting. In brief, upon diagnosis of CNS malignancy by MRI, two large (>25 kg) canine veterinary patients were recruited following informed consent of the owners. Instead of receiving standard of care palliative steroids, canines underwent craniotomy and conservative tumor resection. The tumor specimen was subdivided into soluble lysate and mRNA components. Subsequently, canine patients were mobilized with G-CSF (Neupogen) and peripheral blood mononuclear cells (PBMC) were harvested. The adherent monocytic fraction was differentiated into DC which were simultaneously loaded with tumor lysate and mRNA subfractions and matured. DC were then harvested and resuspended in PBS for injection into the vicinity of the deep cervical lymph nodes by means of ultrasound sonography. In conjunction with vaccination, animals were adjuvanted with 12 weeks of human IFN-α administered subcutaneously thrice weekly at two to eight million units per dose. In addition to demonstrating the safety and feasibility of this approach, each animal also exhibited rapid and significant tumor shrinkage at the outset of vaccination. The first animal received a single dose of 5×10.sup.5 vaccine cells and exhibited 50% tumor regression at one-month follow-up (
[0108] In these examples, the inventors have identified the mechanistic underpinnings of a previously unrecognized and somewhat unexpected DC regulatory checkpoint, the full elucidation of which might be of critical importance to achieving clinical goals within the realm of vaccine immunotherapy. Previous and current work indicate that the simultaneous loading of DC with homologous class I and II antigens induces DC T.sub.H1 polarization and an augmentation of downstream CD8.sup.+ T-cell responses in vitro and in vivo (Decker et al., 2006; Decker et al., 2009). Here the inventors demonstrate that this phenomenon is mechanistically-linked to upregulated secretion of AIMp1, an important cytokine with known T.sub.H1 polarizing function, the release of which upregulates IL-12 secretion while concomitantly downregulating secretion of CTLA-4 and its corresponding mRNA transcript. AIMp1 appears to act upstream of both sCTLA-4 and IL-12 as demonstrated by AIMp1 siRNA knockdown and kinetic studies. Importantly, the inventors demonstrated that release of AIMp1 in response to homologous antigenic loading proceeded in a TLR-independent manner. TLR agonism was unable to augment AIMp1 release or diminish CTLA-4 secretion, nor were identically prepared peptide determinants able to stimulate such responses when added in a heterologous fashion. siRNA knockdown of β2-microglobulin or HLA-DM eliminated the ability of DC to respond to homologous class I and II binding peptides. Further, murine DC lacking H2-DM and thus unable to load exogenous antigen were also unable to be polarized or enhance downstream CD8.sup.+ responses though MHC was intact and pattern recognition receptors remained functional (Strong et al., 2011). However, loading of H2-DM.sup.−/− DC with a synthetic class I binding peptide that overlapped the amino acid sequence of Ii CLIP, theoretically the only possible manner by which to load class I and II of these cells in a homologous manner, released wild type ratios of AIMp1/sCTLA-4 and generated CD8.sup.+CD25.sup.+ T-cells in a dose responsive fashion. These results firmly suggest a role for peptide binding of MHC in this method of T.sub.H1 polarization, a unique process not previously described. To further demonstrate T.sub.H1 polarization dependent upon antigenic homology rather than innate PRR, the inventors added two non-anchor amino acid substitutions in a previously characterized (Decker et al., 2009) class II binding peptide so that contiguous class I and II sequence homology of more than three amino acids was interrupted. This minor disruption of homology was sufficient to abrogate polarizing AIMp1/sCTLA-4 ratios. Applying the complimentary amino acid substitutions to the class I peptide, thereby restoring complete sequence homology, was sufficient to restore a high AIMp1/CTLA-4 ratio. Taken together, the data suggest a unique T.sub.H1 polarizing checkpoint in DC dependent upon a high degree of sequence homology between MHC class I and II-bound peptides. In addition to identifying important effector molecules upon which this mechanism depends, the inventors demonstrated physiologic relevance through the generation of tissue-specific vaccines that broke immunological tolerance and eradicated normal immunologic self in the wild type mouse, a phenomenon not previously reported. Further experiments also demonstrated significant activity against neoplastic self in three different model systems, including experiments that suggested activity against oligodendroglioma in a spontaneous, outbred canine model.
[0109] In total, the inventors have used 29 different model systems (Table 1), including whole-cell systems, single-antigen systems, and multiple pairs of overlapping class I and II MHC binding epitopes to demonstrate that homologously-loaded DC exhibit a variety of T.sub.H1-associated characteristics including differential cytokine secretion, surface marker expression, global transcriptional alterations, and the ability to enhance the generation of CD8.sup.+ CTL (Table 2). In each of these 29 different systems, the sole commonality among groups that displayed T.sub.H1 polarization was the high degree of antigenic or amino acid sequence homology between the class I and class II antigens with which DC were loaded.
TABLE-US-00002 TABLE 1 Summary of antigenic systems used, species tested, and method of antigen delivery to the DC. Antigen DC Class I Class II Antigen Source Species Species Determinant Determinant Total Cellular Antigen Pools Primary AML Sample 1* Human Human mRNA Lysate Primary AML Sample 2* Human Human mRNA Lysate Primary AML Sample 3* Human Human mRNA Lysate TF-1a Erythroblast Cell Line* Human Human mRNA Lysate FBMD-1 Stromal Cell Line* Mouse Human mRNA Lysate PC-3 Prostate Cancer Cell Line Human Human mRNA Lysate WPMY-1 Prostate Cell Line Human Human mRNA Lysate RAW Macrophage Cell Line Mouse Human/Mouse mRNA Lysate B16 Melanoma Cell Line Mouse Mouse mRNA Lysate 4T-1 Breast Cancer Cell Line Mouse Mouse mRNA Lysate TRAMP-C2 Prostate Cancer Cell Line Mouse Mouse mRNA Lysate beta-TC-6 Pancreatic Beta Cell Line Mouse Mouse mRNA Lysate Primary Seminal Vesicle Mouse Mouse mRNA Lysate Primary Prostate Mouse Mouse mRNA Lysate PROCAT/JOCK Prostatic Adenocarcinoma Mouse Mouse mRNA Lysate Primary Oligodendrocytoma Sample 1 Dog Dog mRNA Lysate Primary Oligodendrocytoma Sample 2 Dog Dog mRNA Lysate Panc02 Pancreatic Cancer Cell Line Mouse Mouse mRNA Lysate Kras.sup.G12D/p53.sup.−/− PDAC Cell Line Mouse Mouse mRNA Lysate THP-1 AML Cell Line Human Human mRNA Lysate LN-18 Glioma Cell Line Human Human mRNA Lysate Single Recombinant Antigen GFP* A. victoria Human Plasmid rProtein GFP A. victoria Human Adenovirus rProtein GFP A. victoria Human/Mouse mRNA rProtein IL-4* Mouse Human Plasmid rProtein HIV Nef HIV Human Adenovirus Peptide Library TRP-2 Mouse Mouse Adenovirus Peptide Ovalbumin Chicken Mouse SIINFEKL rProtein Tc24 T. Cruzi Mouse Adenovirus rProtein Overlapping MHC Binding Peptides B8-166/DR3-162* Influenza Human 8mer Peptide 15mer Peptide A3-172/DR3-162* Influenza Human 9mer Peptide 15mer Peptide A2-443/DR3-440* Influenza Human 9mer Peptide 15mer Peptide B6-166/DR3-162 Gly.fwdarw.Met Synthetic Human 8mer Peptide 15mer Peptide CLIP Mouse Mouse H2-DM.sup.−/− 9mer Peptide CLIP *= previously published system.
TABLE-US-00003 TABLE 2 Select markers and manifestations of homologous DC loading. Surface Markers Cytokines Intracellular Signaling Downstream Events ↑↑↑ CD83 ↑↑↑ IL-12 secretion ↑↑↑ Interferon signaling ↑↑↑ Production of CD8.sup.− T cells ↑↑↑ CD40 ↑↑↑ AIMp1/p43 secretion ↑↑↑ MyD88 ↑↑↑ T cell IFNγ secretion ↓↓↓ MHC class II ↓↓↓ CTLA-4 secretion ↑↑↑ CTL activity ↓↓↓ IL-23 secretion ↓↓↓ Wnt5a secretion
[0110] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
REFERENCES
[0111] The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. [0112] U.S. Pat. No. 5,788,963 [0113] U.S. Pat. No. 8,728,806 [0114] Ahmed et al., J. Virol. 83, 2962-2975, 2009. [0115] Allan et al., J. Immunol. 144, 3980-3986, 1990. [0116] Ausubel, 1996. [0117] Ausubel et al., 1998. [0118] Carstens et al., Cancer Res. 74, 609-620, 2014. [0119] Carvalho et al., Infect Immun. 79, 1638-1646, 2011. [0120] Decker et al., Vaccine 24, 3203-3216, 2006. [0121] Decker et al., Blood 113, 4213-4223, 2009. [0122] Dudda et al., Immunity 38, 742-753, 2013. [0123] Ghosh et al., Nature 378, 457-462, 1995. [0124] Hokey et al., Cancer Res. 65, 10059-10067, 2005. [0125] Jones et al., Vaccine 17, 3065-3071, 1999. [0126] Kim et al., Gene Ther. 15, 677-687, 2008. [0127] Konduri et al., J. Infect Dis. 207, 1764-1772, 2013. [0128] Longhi et al., J. Exp. Med. 206, 1589-1602, 2009. [0129] Lopez et al., J. Infect Dis. 187, 1126-1136, 2003. [0130] Lopez et al., J. Virol. 80, 3128-3134 A, 2006A. [0131] Lopez et al., J. Virol. 80, 4538-4545, 2006B. [0132] Lotze et al., eds. (2001). Dendritic Cells, Second Edition (San Diego: Academic Press). [0133] Ressing et al., J. Immunother. 23, 255-266, 2000. [0134] Rohn et al., Nat. Immunol. 5, 909-918, 2004. [0135] Rossmeisl et al., J. Am. Vet. Med. Assoc. 242, 193-198, 2013. [0136] Sambrook et al., 1989. [0137] Spranger et al., J. Immunol. 185, 738-747, 2010. [0138] Tam and Wick, Immunology 128, 429-438. 2009. [0139] Tripp et al., J. Immunol. 155, 2955-2959, 1995.