Assay and method
11390924 · 2022-07-19
Assignee
Inventors
- Stephen James Harris (Waltham-on-the-Wolds, GB)
- Matthew Coates (Waltham-on-the-Wolds, GB)
- Matthew Ronald Gibbs (Waltham-on-the-Wolds, GB)
Cpc classification
G16B40/00
PHYSICS
G16B20/20
PHYSICS
A61K2800/70
HUMAN NECESSITIES
A61Q11/00
HUMAN NECESSITIES
C12Q2600/112
CHEMISTRY; METALLURGY
G16B20/00
PHYSICS
International classification
A61Q11/00
HUMAN NECESSITIES
G16B20/20
PHYSICS
G16B40/00
PHYSICS
Abstract
The present invention relates to an assay for use in a method of determining the oral health status of a canine animal by identifying certain bacteria present or absent in a sample taken from the animal, and applying the information set out herein for each identified bacteria to statistical models in order to determine the oral health status of the animal.
Claims
1. A method for diagnosing and treating gingivitis and/or periodontitis in a canine animal, comprising: Obtaining a first sample from a conscious canine animal; Determining the proportion of gram negative and gram positive bacteria in the first sample; When the first sample comprises a proportion of gram positive bacteria of greater than 0.3 and less than 0.5, diagnosing the canine animal with gingivitis and/or periodontitis; and Treating the canine animal for gingivitis and/or periodontitis by i) brushing the teeth of the animal ii) providing the animal with a professional dental cleaning and/or iii) providing the animal a foodstuff, supplement or chew, wherein the tooth brushing, dental cleaning, foodstuff, supplement or chew are capable of treating the gingivitis and/or periodontitis.
2. The method of claim 1, wherein the sample comprises dental plaque, gingival crevicular fluid or saliva.
3. The method of claim 1, wherein determining the proportion of gram positive and gram negative bacteria in the sample comprises identifying the bacteria using Quantitative PCR, sequencing, antibody binding, fluorescent in situ hybridization or a combination of these.
4. The method of claim 3, wherein from 2 to 20 bacterial species are identified.
5. The method of claim 3, wherein from 3 to 10 bacterial species are identified.
6. The method of claim 1, wherein determining the proportion of gram negative and gram positive bacteria comprises determining the total plaque bacteria of gram negative bacteria and the total plaque bacteria of the gram positive bacteria.
7. The method of claim 1, wherein determining the proportion of gram negative and gram positive bacteria comprises determining the number of counts of each of the gram positive and gram negative bacteria.
8. The method of claim 7, wherein the number of counts is determined by sequencing or colony counts.
9. The method of claim 1, further comprising: Obtaining at least a second further sample from the canine animal; Determining the proportion of gram negative to gram positive bacteria in the further sample; and Repeating the treatment, sampling and determining steps until the proportion of the gram positive bacteria is not greater than 0.3 thereby treating the gingivitis and/or periodontitis.
Description
EXAMPLES
(1) The invention will now be described with reference to the following non-limiting figures and examples in which;
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
EXAMPLE 1
(18) Subgingival plaque samples were collected from 223 dogs with healthy gingiva, gingivitis and mild periodontitis with 72 to 77 samples per health status. DNA was extracted from the plaque samples and subjected to PCR amplification of the V1-V3 region of the 16S rDNA. Pyrosequencing of the PCR amplicons identified a total of 274 operational taxonomic units (OTUs) after bioinformatic and statistical analysis. Porphyromonas was the most abundant genus in all disease stages, particularly in health along with Moraxella and Bergeyella. Peptostreptococcus, Actinomyces, and Peptostreptococcaceae were the most abundant genera in mild periodontitis. Logistic regression analysis identified species from each of these genera that were significantly associated with health, gingivitis or mild periodontitis. Principal component analysis showed distinct community profiles in health and disease. The species identified show some similarities with health and periodontal disease in humans but also major differences. In contrast to human, healthy canine plaque was found to be dominated by Gram negative bacterial species whereas Gram positive anaerobic species predominate in disease.
(19) Sampling Strategy and Study Cohort
(20) The study was approved by the WALTHAM® Centre for Pet Nutrition ethical review committee, and run under licensed authority in accordance with the UK Animals (Scientific Procedures) Act 1986. Owner consent was obtained and an owner survey was completed for all dogs included in the study.
(21) Dental assessments, scoring and subgingival plaque sampling were performed by a single veterinary dentist (L. Milella) to avoid variation in scoring. The study cohort comprised client owned pet dogs presented at a veterinary referral dental clinic. Only dogs under anaesthetic for routine dental treatment or treatment for non-periodontal complications e.g. broken teeth or other non-infectious conditions were screened for inclusion in the study. No dogs were anaesthetised solely for the collection of plaque samples. The periodontal health status of each dog was obtained following the Wiggs & Lobprise scoring system (Wiggs & Lobprise, 1997) and plaque samples taken from dogs regarded as having healthy teeth and gums, gingivitis or mild periodontitis (PD1, <25% attachment loss). Dogs were excluded from the study if they had: 1) Significant veterinary oral care within the preceding 3 months; 2) Regular dental care at home i.e. dogs whose teeth are regularly brushed; 3) Systemic or oral antibiotic treatment any of the previous 3 months and 4) Evidence of any extra-oral bacterial infections in the past month. Breeds thought to exhibit an alternative early onset/aggressive form of periodontitis, were also excluded. These breeds were Greyhounds, Yorkshire Terriers, Maltese and Toy Poodles.
(22) Sub-gingival plaque samples were collected using a sterile periodontal probe and placed in 350 μl TE buffer (50 mM Tris pH 7.6, 1 mM EDTA pH 8.0 & 0.5% Tween 20) prior to storage at −20° C.
(23) Healthy dogs were sampled subgingivally at eighteen sites, targeting the teeth most often affected by PD (upper 103-108 bilaterally and lower 404, 408 and 409 bilaterally), to support plaque volumes in the absence of periodontal pockets. Periodontally diseased dogs were sampled for subgingival plaque at up to twelve diseased sites (103, 104, 108, 404, 408, 409 bilaterally) during their normal periodontal treatment. Information on dog age, breed, size, sex and neuter status was collated.
(24) DNA Extraction & Amplification of 16S rDNA
(25) DNA was extracted from the plaque samples using an Epicentre Masterpure Gram Positive DNA Purification Kit, according to the manufacturer's instructions with an additional overnight lysis. Plaque samples were centrifuged at 5000×g for 10 minutes and the cell pellet resuspended in 150 μl of TE buffer. Following vortexing, 1 μl Ready-Lyse Lysozyme (Epicentre, UK) was added and the lysis mix incubated overnight at 37° C. for 18 hrs overnight. After DNA extraction the DNA pellet was suspended in TE buffer (10 mM Tris-CI and 0.5 mM pH 9.0 EDTA) and quantified and the purity ascertained using a NanoDrop ND1000 spectrophotometer (NanoDrop Technologies Inc).
(26) The V1-V3 region of the 165 rDNA was amplified from subgingival plaque DNA extractions using Extensor Hi-Fidelity PCR Enzyme Mix (AB-0792, Thermo, UK) in a 96-well format. A mix of two universal forward primers was used; FLX_27FYM (CGTATCGCCTCCCTCGCGCCATCAG AGAGTTTGATYMTGGCTCAG) at 9.5 pmol/μl and FLX_27F_Bif (CGTATCGCCTCCCTCGCGCCATCAG AGGGTTCGATTCTGGCTCAG) at 0.5 pmol/μl (where italics represent FLX Titanium Primer A and bold represents 165 sDNA primer sequence). The latter was included to ensure representation of the genus Bifidobacter, a lower concentration was chosen due to the low representation of this genus in previous studies of canine plaque. The DNA was to be sequenced from the reverse primer thus 20 different 7mer MID tags were included in the reverse primer (CTATGCGCCTTGCCAGCCCGCTCAGXXXXXXXTY ACCGCGGCTGCTGG) where italics represent FLX Titanium Primer B, X represents MID sequence and bold represents 16S sDNA reverse primer sequence.
(27) Library Preparation
(28) Library preparation and sequencing was performed by Beckman Coulter Genomics, UK. The 16S rDNA amplicons were purified with Agencourt AMPure XP beads (Beckman Coulter Inc, UK), quantified using the Quant-iT™ PicoGreen® dsDNA Assay Kit (Invitrogen, UK) then pooled into groups of 20 samples prior to Emulsion PCR. Libraries were then sequenced on a Roche Genome Sequencer FLX Titanium System™ using the FLX Titanium B primer only with a target of {tilde over ( )}15,000 unidirectional reads per sample.
(29) Sequence Processing and Analysis
(30) The standard flowgram files (SFF) for each of the 223 samples were initially filtered by selecting reads with at least 360 flows and truncating long reads to 720 flows. Reads were filtered and denoised using the AmpliconNoise software (version V1.21; Quince et al., 2009, 2011). For the initial filtering step, reads were truncated when flow signals dropped below 0.7, indicative of poor quality. A maximum of 20,000 reads per sample were used with exception of a few samples due to the computational demands of the denoising algorithm. Subsequently reads were denoised in three stages; 1) Pyronoise to remove noise from flowgrams resulting from 454 sequencing errors (PyronoiseM parameters −s 60, −c 0.01), 2) Seqnoise to remove errors resulting from PCR amplification (SeqNoiseM parameters −s 25, −c 0.08), 3) Perseus to detect and remove chimeras resulting from PCR recombination. The denoised sequences were then clustered using QIIME, a pipeline for performing microbial community analysis that integrates many third party tools which have become standard in the field. The QIIME script pick_otus.py, which utilises the Uclust software program, was used to cluster sequences with >98% identity. Uclust was run with modified parameters, with gap opening penalty set to 2.0 and gap extension penalty set to 1.0 and —A flag to ensure optimum alignment.
(31) Representative sequences of all observed OTUs that passed the filtering criteria for sequence abundance (see statistical analysis section) across health states were searched against the Canine Oral Microbiome Database (COMD) using BLASTN of NCBI-BLAST 2.2.27+. The COMD sequence database contained 460 published 16S DNA sequences obtained from canine oral taxa (Genbank accession numbers JN713151-JN713566 & KF030193-KF030235). Additionally, representative sequences were searched against the 376,437 sequences in the Silva SSU database release 108. For each representative sequence the best BLAST hit in the COMD database was chosen as the reference sequence. If the alignment did not meet the cut-off criteria of 98% sequence identity and 98% sequence coverage the best hit from the Silva database was chosen. The assignments were checked for redundancies (two or more OTUs assigned to the same reference sequence). Redundancies were resolved by keeping the taxonomy for the OTU with the better match and assigning the next best match to the other OTU.
(32) A multiple sequence alignment (MSA) was constructed by aligning each reference sequence to the Greengenes core set (revision May 3, 2011) with PyNAST using the script align_seqs.py of the Qiime pipeline. The MSA was filtered using the filter_alignment.py script of the Qiime pipeline. The MSA was converted to Phylip interleaved format using ClustalW 2.1. A maximum likelihood tree of 1000 bootstrap replicates was inferred with PhyML 3 revision 20120412. A GTR model of nucleotide substitution was chosen and the proportion of invariant sites was estimated from the data. Evolutionary rates were approximated by a discrete gamma model of eight categories. The tree was visualised and combined with abundance and significance data in iTOL.
(33) A second tree with a reduced amount of taxa was inferred at the genus level. For this purpose all species of the same genus were collated into a single taxon. The 165 sequence of the most abundant species of that genus was used for tree inference using the methods described above. If no genus information was present, taxa forming a Glade in the full tree were grouped together and the new taxon was named e.g. “Actinomyces Glade A”. Abundance information was added up for all members of each summarised taxon and plotted on the tree using iTOL. The tree was complemented with information on the number of original taxa summarised and the number of significant taxa. See table 3 in which taxa were grouped together.
(34) Statistical Analysis
(35) Health and disease associations: The most abundant OTUs (>0.05%) were analysed using logistic regression analyses (Generalised linear model with a binomial distribution and logit link) for proportions, using the count for the OTU out of the total number of sequences and health status was included as a fixed effect. OTUs were classified in a single group of “rare” taxa if either they were present in each health status group at an average proportion below 0.05% or were present in less than two samples. The 0.05% cut-off was selected based on statistical analysis of data from mock communities containing 17 known species sequenced on five separate 454 runs. The mock communities were analysed for presence and absence of species using a false positive rate of 0.3% (i.e. finding species that were not included in the mock community) and false negative rate of 1.7% (i.e. the failure to identify the species that were known to be present) and aimed for a coefficient of variation of <20% (data not shown). As the data were of very low proportions {tilde over ( )}0.1%, a permutation test (1000 repeats) was used to test the robustness of the logistic regression analysis assumptions. The effect of health status for the true data was then compared to the effects from the permutations to give a more robust p-value for the overall effect of health status. The permutation p-values were adjusted according to the false discovery method of Benjamini and Hochberg (1995).
(36) Principal component analysis (PCA) was performed on the log 10 (proportions+0.00003 to allow for zeros) to determine if variability of the most abundant OTUs (>0.05% of total reads) was associated with health status, gender, size and age.
(37) Gram-stain status: The OTUs excluding rares were classified as gram positive or gram negative based on literature searches using the genus name. The number of sequences gram positive or gram negative were then analysed by logistic regression for proportions (adjusting for the total number of sequences and allowing for estimation of over dispersion) with health status as a fixed effect.
(38) Oxygen Requirement: The non-rare OTUs were classified as aerobic, anaerobic or facultative anaerobe based on literature searches using the genus name. The number of sequences of aerobic, anaerobic and facultative anaerobe were then analysed (separately) by logistic regression for proportions (adjusting for the total number of sequences and allowing for estimation of over dispersion) with health status as a fixed effect. All health statuses were significantly different Shannon diversity Index: a linear model was used to analyse the data, with health status as a fixed effect and weighting the variability by health status as there were significant differences in the variability of indexes between health statuses.
(39) Species richness: a linear model was used to analyse all OTUs including the rare sequences with health status as a fixed effect, the total number of sequences as a covariate (to adjust for the differing number of sequences between samples), and weighting the variability by health status (as there were significant differences in the variability of indexes between health statuses.
(40) All analyses were performed in SIMCA-P version 10 (Umetrics).
(41) Results
(42) Study Cohort
(43) Subgingival plaque bacterial communities were sampled from a total of 223 dogs; 72 with healthy gingiva, 77 with gingivitis and 74 with mild periodontitis. Dog size and age are putative risk factors for periodontitis and therefore sample associated metadata was also obtained (see Table 1). The majority of samples were collected from small, medium and large dogs with giant dogs represented at a much lower frequency. As expected the mean age of dogs increased with disease stage and significant differences (p<0.001) were observed in the mean ages of dogs in health compared to gingivitis and gingivitis compared to mild periodontitis using a two-tailed T-test with unequal variance. Lesser significance was observed in health versus gingivitis (p<0.05).
(44) TABLE-US-00017 TABLE 1 Health Gingivitis Mild periodontitis Age 4.5 ± 2.3 years 5.0 ± 2.8 years 7.3 ± 3.1 years Gender 31 female, 41 male 38 female, 39 male 32 female, 42 male Neuter 38 neutered, 15 entire, 46 neutered, 11 entire, 59 neutered, 9 entire, status 19 unknown 20 unknown 6 unknown Size 8 small, 30 medium, 29 12 small, 31 medium, 23 small, 16 medium, large, 3 giant, 2 30 large, 3 giant, 1 31 large, 3 giant, I unknown unknown unknown Breed 57 pure breed, 15 cross 69 pure breed, 8 cross 61 pure breed, 13 cross breeds breeds breeds
Sequence Quality
(45) The 223 canine subgingival plaque samples were analysed by 454-pyrosequencing of the 3′ end of the V1-V3 region and a total of 6,071,129 sequence reads were obtained that passed the sequencing providers initial sequence quality filter. After Pyronoise, Seqnoise and chimera removal using Perseus the number of sequence reads was reduced to 3,110,837. The final number of sequence reads per sample ranged from 2,801 to 30,050 with a median number of reads of 11,682, 12,674 and 15,111 from healthy, gingivitis and mild periodontitis samples respectively.
(46) Bacterial Composition of Canine Plaque
(47) The resulting 3,110,837 sequences were assigned to 6,431 operational taxonomic units (OTUs) using U-Clust within QIIME and a cut-off of ≥98% sequence identity. OTUs were classed and grouped as rare if either they were present in each health status group at an average proportion below 0.05% or were present in less than two samples (see methods for rationale). This reduced the number of OTUs analysed to 274 plus the rare group.
(48) Taxonomic assignment of each of the 274 OTUs resulted in 222 (81%) and 30 (11%) mapping to sequences within COMD (Dewhirst et al., 2012) and Silva respectively with ≥98% identity. The remaining 22 OTUs (8%) shared between 91.4% and 97.7% identity to sequences within the Silva database. The majority of the sequences belonged to seven phyla; Firmicutes (28.5%), Bacteroidetes (26.5%), Proteobacteria (17.36%), Actinobacteria (15.3%), Fusobacteria (3.7%), Spirochaetes (1.9%) and TM7 (1.1%). There were also a further five phyla identified; Synergistetes (0.9%), Chloroflexi (0.7%), SRI (0.4%), Tenericutes (0.09%) Elusimicrobia (0.04%) and a small proportion of the sequences were of unknown phylogeny (0.08%). The rare group accounted for the remaining 3.4% of the sequence reads.
(49) The abundance of each of the 99 genera in plaque samples from healthy dogs and those with gingivitis and mild periodontitis are depicted by the green, orange and red outer bars respectively and the grey bar indicates the number of species (OTUs ≥98% sequence identity) in that genus. Of the 274 species identified, the 26 most abundant accounted for approximately 50% of the sequence reads (see Table 2). Porphyromonas cangingivalis COT-109 (OTU #2517) was the most abundant taxa representing 7.4% of the total number of sequence reads. Moraxella sp. COT-396 (4266) and Actinomyces canis COT-409 (OTU #6029) were the next most abundant representing 3.47% and 3.23% of the sequence reads respectively. Five other species each represented between 2% and 2.8% of the population; Bergeyella zoohelcum COT-186 (OTU #2232), Peptostreptococcus sp. COT_033 (OTU #6027), Peptostreptococcaceae sp. COT_004 (OTU #5570), Porphyromonas gulae COT-052 (OTU #2678), Porphyromonas gingivicanis COT-022 (OTU #5364). A further 18 OTUs represented between 0.85% and 2% of the population and the remaining 248 OTUs ranged in relative abundance from 0.01% to 0.81%
(50) TABLE-US-00018 TABLE 2 Total number Proportion of Percentage of sequence total sequence OTU Species Identity reads reads (%) 2517 Porphyromonas cangingivalis COT-109 99.4 230327 7.40% 4266 Moraxella sp. COT-396 98.9 107867 3.47% 6029 Actinomyces canis COT-409 99.1 100436 3.23% 2232 Bergeyella zoohelcum COT-186 99.1 87570 2.81% 6027 Peptostreptococcus sp. COT-033 99.7 74661 2.40% 5570 Peptostreptococcaceae sp. COT-004 100.0 65764 2.11% 2678 Porphyromonas gulae COT-052 100.0 64382 2.07% 5364 Porphyromonas gingivicanis COT-022 99.7 63838 2.05% 2908 Filifactor villosus COT-031 100.0 60684 1.95% 2905 Actinomyces sp. COT-083 100.0 60238 1.94% 3307 Actinomyces sp. COT-252 100.0 56776 1.83% 2233 Neisseria shayeganii COT-090 100.0 52354 1.68% 5572 Fusobacterium sp. COT-189 99.1 50612 1.63% 3434 Porphyromonas canoris COT-108 100.0 47457 1.53% 3638 Porphyromonas gulae COT-052 99.7 46699 1.50% 2576 Corynebacterium freiburgense COT-403 99.7 41549 1.34% 2463 Peptostreptococcaceae sp. COT-077 100.0 39940 1.28% 1916 Clostridiales sp. COT-028 100.0 39516 1.27% 4116 Fusobacterium sp. COT-169 99.4 39001 1.25% 1678 Pasteurellaceae sp. COT-080 100.0 37073 1.19% 4929 Capnocytophaga sp. COT-339 100.0 36692 1.18% 5804 Erysipelotrichaceae sp. COT-311 100.0 31319 1.01% 368 Peptostreptococcaceae sp. COT-135 100.0 31151 1.00% 6025 Lachnospiraceae sp. COT-036 100.0 29757 0.96% 1773 Moraxella sp. COT-018 100.0 27348 0.88% 5514 Capnocytophaga cynodegmi COT-254 100.0 26402 0.85%
Associations with Health and Disease
(51) Logistic regression analysis identified that 90 of the 274 OTUs had a statistically significant effect of health status after randomisation and multiplicity correction. Of these, 54 showed a significant difference between health and gingivitis, 73 showed a significant difference between gingivitis and mild periodontitis and 87 showed a significant difference between health and mild periodontitis (
(52) TABLE-US-00019 TABLE 3 Overall Health status p- value (adjusted for Pair-wise p-value % Average Proportion Fold Change multi- between Health states OTU Species Identity H G PD1 H/G H/PD1 G/PD1 plicity) H v G H v PD1 G v PD1 279 uncultured Actinomyces 96.88 0.0000 0.0002 0.0010 0.1000 0 0.1 0.0064 0.1255 0.0026 <0.001 sp. GU227175 3157 Bacteroides sp. COT-040 100.00 0.0086 0.0050 0.0030 1.6000 3.2 2.1 0.0064 0.0231 <0.001 0.0057 6013 Odoribacter denticanis COT- 99.71 0.0002 0.0010 0.0020 0.2000 0.1 0.7 0.0064 <0.001 <0.001 0.1065 084 2232 Bergeyella zoohelcum COT- 99.14 0.0548 0.0260 0.0080 2.1000 6.5 3.1 0.0064 0.001 <0.001 0.002 186 5389 Capnocytophaga canimorsus 100.00 0.0065 0.0040 0.0010 1.5000 5.5 3.7 0.0064 0.0762 <0.001 <0.001 COT-235 5514 Capnocytophaga cynodegmi 100.00 0.0124 0.0100 0.0030 1.2000 3.6 3 0.0064 0.3334 <0.001 <0.001 COT-254 3849 Capnocytophaga sp. COT- 100.00 0.0084 0.0020 0.0007 5.3000 11.9 2.3 0.0064 <0.001 <0.001 0.1246 295 4929 Capnocytophaga sp. COT- 100.00 0.0296 0.0040 0.0040 6.7000 7.2 1.1 0.0064 <0.001 <0.001 0.8919 339 5624 Cloacibacterium sp. COT-320 99.14 0.0020 0.0010 0.0003 2.1000 7.7 3.6 0.0064 0.0021 <0.001 0.0016 5324 Chloroflexi bacterium COT- 100.00 0.0021 0.0040 0.0090 0.5000 0.2 0.5 0.0064 0.0206 <0.001 <0.001 306 3793 Helcococcus sp. 99.43 0.0010 0.0050 0.0100 0.2000 0.1 0.5 0.0064 <0.001 <0.001 0.0049 COT-069 6025 Lachnospiraceae bacterium 100.00 0.0036 0.0060 0.0170 0.6000 0.2 0.4 0.0064 0.051 <0.001 <0.001 COT-036 5844 Lachnospiraceae bacterium 99.71 0.0030 0.0020 0.0006 1.2000 5.1 4.2 0.0064 0.2696 <0.001 <0.001 COT-106 4905 Peptococcus sp. COT-044 99.71 0.0027 0.0050 0.0120 0.5000 0.2 0.4 0.0064 0.0479 <0.001 <0.001 5883 Filifactor alocis COT-001 99.71 0.0003 0.0005 0.0030 0.5000 0.1 0.2 0.0064 0.2332 <0.001 <0.001 3747 Filifactor sp. COT-164 100.00 0.0004 0.0010 0.0050 0.3000 0.1 0.2 0.0064 0.034 <0.001 <0.001 5570 Peptostreptococcaceae 100.00 0.0109 0.0150 0.0350 0.7000 0.3 0.4 0.0064 0.2292 <0.001 <0.001 bacterium COT-004 908 Peptostreptococcaceae 100.00 0.0026 0.0050 0.0120 0.5000 0.2 0.4 0.0064 0.0221 <0.001 <0.001 bacterium COT-019 1476 Peptostreptococcaceae 100.00 0.0037 0.0040 0.0090 1.0000 0.4 0.5 0.0064 0.8728 <0.001 <0.001 bacterium COT-021 281 Peptostreptococcaceae 99.71 0.0001 0.0006 0.0010 0.1000 0 0.4 0.0064 0.0014 <0.001 <0.001 bacterium COT-067 2819 Peptostreptococcaceae 99.71 0.0001 0.0005 0.0010 0.2000 0.1 0.4 0.0064 0.0017 <0.001 <0.001 bacterium COT-155 4774 Peptostreptococcaceae 100.00 0.0004 0.0040 0.0110 0.1000 0 0.4 0.0064 0.0024 <0.001 <0.001 bacterium COT-030 2463 Peptostreptococcaceae 100.00 0.0006 0.0080 0.0270 0.1000 0 0.3 0.0064 0.0059 <0.001 <0.001 bacterium COT-077 2539 Clostridiales bacterium 99.71 0.0007 0.0030 0.0070 0.3000 0.1 0.4 0.0064 0.0017 <0.001 <0.001 COT-027 1916 Clostridiales bacterium 100.00 0.0026 0.0110 0.0220 0.2000 0.1 0.5 0.0064 <0.001 <0.001 <0.001 COT-028 4926 Clostridiales bacterium 100.00 0.0002 0.0020 0.0030 0.1000 0.1 0.7 0.0064 <0.001 <0.001 0.0448 COT-388 5566 Schwartzia sp. COT-063 99.71 0.0002 0.0030 0.0050 0.1000 0.1 0.6 0.0064 <0.001 <0.001 0.0485 2677 Erysipelotrichaceae 99.71 0.0005 0.0010 0.0040 0.4000 0.1 0.3 0.0064 0.0573 <0.001 <0.001 bacterium COT-302 5007 Lautropia sp. COT-175 99.71 0.0096 0.0070 0.0030 1.4000 3.2 2.2 0.0064 0.0678 <0.001 0.0033 4615 Brachymonas sp. COT-015 99.43 0.0054 0.0040 0.0010 1.4000 3.6 2.6 0.0064 0.0538 <0.001 <0.001 5022 Comamonas sp. COT-270 100.00 0.0015 0.0004 0.0002 3.3000 9.3 2.8 0.0064 <0.001 <0.001 0.0305 2233 Neisseria shayeganii 100.00 0.0328 0.0170 0.0030 1.9000 9.5 5 0.0064 0.0014 <0.001 <0.001 COT-090 2139 uncultured Neisseria 99.71 0.0060 0.0010 0.0001 4.6000 41.8 9.1 0.0064 <0.001 <0.001 0.0271 FM872599 4901 Cardiobacterium sp. 100.00 0.0048 0.0030 0.0010 1.5000 4.4 3 0.0064 0.0506 <0.001 <0.001 COT-177 4266 Moraxella sp. COT-396 98.86 0.0661 0.0350 0.0090 1.9000 7.6 4 0.0064 <0.001 <0.001 <0.001 1678 Pasteurellaceae bacterium 100.00 0.0237 0.0120 0.0030 2.0000 9.3 4.6 0.0064 <0.001 <0.001 <0.001 COT-080 4930 Pasteurella canis COT-273 100.00 0.0047 0.0020 0.0010 2.5000 4.3 1.7 0.0064 <0.001 <0.001 0.0609 3811 Pasteurellaceae bacterium 98.28 0.0005 0.0002 0.0001 2.1000 7.5 3.5 0.0064 0.0068 <0.001 0.007 COT-271 3222 Treponema denticola 99.71 0.0028 0.0050 0.0070 0.6000 0.4 0.7 0.0064 0.0287 <0.001 0.0327 COT-197 5414 Synergistales bacterium 99.71 0.0001 0.0001 0.0007 1.2000 0.2 0.1 0.0064 0.7476 <0.001 <0.001 COT-179 349 Synergistales bacterium 98.86 0.0006 0.0020 0.0040 0.3000 0.2 0.6 0.0064 <0.001 <0.001 0.0282 COT-180 3928 Synergistales bacterium 99.71 0.0000 0.0001 0.0009 0.1000 0 0.2 0.0064 0.0905 0.0022 <0.001 COT-244 3912 SR1 bacterium COT-380 100.00 0.0011 0.0007 0.0002 1.5000 6.5 4.2 0.0064 0.0559 <0.001 <0.001 3006 Actinomyces suimastitidis 96.87 0.0002 0.0004 0.0020 0.5000 0.1 0.2 0.0104 0.2597 <0.001 <0.001 AJ277385 2517 Porphyromonas cangingivalis 99.43 0.1047 0.0790 0.0450 1.3000 2.3 1.8 0.0104 0.0753 <0.001 0.004 COT-109 2906 Porphyromonas sp. COT-290 100.00 0.0097 0.0060 0.0030 1.7000 3.1 1.9 0.0104 0.0139 <0.001 0.016 107 uncultured Acetoanaerobium 99.71 0.0010 0.0020 0.0060 0.6000 0.2 0.3 0.0104 0.2774 <0.001 <0.001 HM277905 477 Peptostreptococcaceae 99.71 0.0004 0.0030 0.0050 0.2000 0.1 0.6 0.0104 0.0013 <0.001 0.0209 bacterium COT-068 5567 uncultured 93.71 0.0000 0.0003 0.0007 0.1000 0.1 0.5 0.0104 0.0052 <0.001 0.0088 Saccharofermentans EU381658 3071 uncultured Flavonifractor 98.86 0.0002 0.0010 0.0020 0.2000 0.1 0.6 0.0104 0.0031 <0.001 0.0339 FJ365194 2999 uncultured TM7 F1879268 97.41 0.0000 0.0001 0.0005 0.2000 0 0.2 0.0104 0.1184 <0.001 <0.001 3805 Conchiformibius steedae 99.43 0.0028 0.0006 0.0001 4.4000 19.7 4.5 0.0104 <0.001 <0.001 0.0459 AF328156 5219 Synergistales bacterium 99.71 0.0001 0.0007 0.0009 0.2000 0.2 0.7 0.0104 <0.001 <0.001 0.1685 COT-138 5486 uncultured Actinomyces 96.02 0.0004 0.0004 0.0020 0.9000 0.3 0.3 0.014 0.8218 <0.001 <0.001 JF203363 4401 Capnocytophaga sp. 99.71 0.0016 0.0006 0.0001 2.8000 14.7 5.3 0.014 <0.001 <0.001 0.0075 COT-329 5917 Catonella sp. COT-257 100.00 0.0014 0.0008 0.0004 1.8000 3.5 2 0.014 0.0129 <0.001 0.019 5573 Peptostreptococcaceae 100.00 0.0001 0.0006 0.0010 0.1000 0.1 0.5 0.014 0.0031 <0.001 0.0133 bacterium COT-129 5813 Synergistales bacterium 100.00 0.0033 0.0060 0.0070 0.5000 0.5 0.9 0.014 0.0026 <0.001 0.3083 COT-178 5383 [Eubacterium] nodatum 99.71 0.0000 0.0001 0.0006 0.3000 0 0.1 0.014 0.2527 <0.001 <0.001 COT-045 3155 uncultured Actinomyces 96.59 0.0000 0.0000 0.0007 0.2000 0 0 0.018 0.6623 0.0816 0.0033 HM336429 368 Peptostreptococcaceae 100.00 0.0056 0.0090 0.0140 0.6000 0.4 0.6 0.018 0.0483 <0.001 0.021 bacterium COT-135 6321 Prevotella sp. COT-372 100.00 0.0014 0.0004 0.0003 3.7000 4.1 1.1 0.0211 <0.001 <0.001 0.8096 4924 Schwartzia sp. COT-213 98.86 0.0000 0.0000 0.0009 1.2000 0 0 0.0211 0.9082 <0.001 <0.001 1418 Erysipelotrichaceae 99.71 0.0003 0.0010 0.0020 0.4000 0.2 0.5 0.0211 0.023 <0.001 0.0045 bacterium COT-381 4647 Treponema sp. COT-351 99.72 0.0001 0.0003 0.0008 0.1000 0.1 0.4 0.0211 0.0102 <0.001 0.0026 2167 Bacteroidia bacterium 99.71 0.0002 0.0006 0.0020 0.4000 0.1 0.3 0.0232 0.1237 <0.001 <0.001 COT-187 5649 Parvimonas sp. COT-101 99.43 0.0005 0.0020 0.0030 0.3000 0.2 0.7 0.0232 0.002 <0.001 0.0682 1776 Peptostreptococcaceae 100.00 0.0004 0.0007 0.0020 0.6000 0.3 0.4 0.0232 0.2099 <0.001 0.0025 bacterium COT-124 1163 Lautropia sp. COT-060 100.00 0.0066 0.0030 0.0020 2.1000 2.9 1.4 0.0232 0.0039 <0.001 0.3209 1406 Pasteurella dagmatis COT- 100.00 0.0050 0.0060 0.0010 0.8000 3.5 4.4 0.0232 0.3167 <0.001 <0.001 092 4114 Corynebacterium mustelae 100.00 0.0053 0.0070 0.0020 0.8000 2.6 3.3 0.0232 0.2333 0.0026 <0.001 COT-419 149 Corynebacterium canis 99.72 0.0020 0.0090 0.0110 0.2000 0.2 0.8 0.0267 <0.001 <0.001 0.3379 COT-421 1479 Campylobacter sp. COT-011 100.00 0.0082 0.0080 0.0050 1.0000 1.7 1.7 0.0297 0.9003 0.0017 0.002 6026 Escherichia coli COT-277 99.71 0.0010 0.0006 0.0003 1.8000 3 1.7 0.0297 0.0115 <0.001 0.0687 4534 Clostridiales bacterium 100.00 0.0004 0.0010 0.0040 0.3000 0.1 0.3 0.0325 0.0738 <0.001 <0.001 COT-038 6024 Acholeplasmatales bacterium 100.00 0.0001 0.0002 0.0006 0.7000 0.2 0.3 0.0325 0.3626 <0.001 <0.001 COT-375 1372 Globicatella sp. COT-107 100.00 0.0088 0.0040 0.0030 2.2000 2.7 1.2 0.0369 0.0024 <0.001 0.4696 6043 Parvimonas sp. COT-035 99.43 0.0004 0.0020 0.0090 0.2000 0 0.2 0.0369 0.0632 <0.001 <0.001 5021 Moraxella sp. COT-328 100.00 0.0027 0.0020 0.0002 1.4000 14.9 10.6 0.0369 0.2247 <0.001 <0.001 811 Lachnospiraceae bacterium 99.43 0.0008 0.0010 0.0004 0.7000 2 2.8 0.0369 0.1519 0.0161 <0.001 COT-161 214 Neisseria canis AY426973 100.00 0.0000 0.0003 0.0000 0.0000 0 11 0.0369 0.377 0.5199 <0.001 4265 Desulfovibrionales 100.00 0.0002 0.0020 0.0020 0.1000 0.1 1 0.0369 <0.001 <0.001 0.8891 bacterium COT-009 5681 uncultured Capnocytophaga 100.00 0.0004 0.0010 0.0001 0.4000 3.2 7.3 0.0392 0.0089 0.0185 <0.001 HM333068 2577 Leptotrichia sp. COT-345 100.00 0.0023 0.0050 0.0020 0.4000 1.5 3.5 0.0392 0.0031 0.2767 <0.001 3358 Aquaspirillum sp. COT-091 99.14 0.0053 0.0040 0.0006 1.2000 9.3 7.7 0.0411 0.4646 <0.001 <0.001 564 Stenotrophomonas sp. 98.86 0.0110 0.0050 0.0030 2.1000 3.5 1.7 0.0411 0.0045 <0.001 0.1232 COT-224 138 uncultured TM7 EF614904 98.00 0.0002 0.0005 0.0006 0.4000 0.3 0.8 0.0411 0.0085 <0.001 0.4009 1158 Actinomyces hyovaginalis 97.63 0.0001 0.0020 0.0030 0.0000 0 0.7 0.0488 0.0133 0.006 0.1989 X69616 4778 Clostridiales bacterium 99.71 0.0000 0.0006 0.0010 0.1000 0 0.6 0.0488 0.011 0.0025 0.0893 COT-141 3319 uncultured TM7 DQ815554 97.41 0.0003 0.0003 0.0007 0.9000 0.4 0.4 0.0488 0.8595 <0.001 <0.001
(53) Of the most abundant health associated species, Moraxella sp. COT 396 (QIIME OTU #4266, 6.61%), Bergeyella zoohelcum COT-186 (OTU #2232, 5.48%), Neisseria shayeganii COT-090 (OTU #2233, 3.28%) and Pasteurellaceae sp. COT-080 (OTU #1678, 2.37%) were significantly more abundant in health and gingivitis than in mild periodontitis and were also significantly more abundant in health than gingivitis (See table 3). Capnocytophaga sp. COT-339 (OTU #4929, 2.96%), Stenotrophomonas sp. COT-224 (OTU #564, 1.1%) were also significantly more abundant in health than in gingivitis and mild periodontitis but the relative abundance in gingivitis and mild periodontitis were not significantly different. Again, Porphyromonas cangingivalis COT-109 (OTU #2517, 10.47%) and Capnocytophaga cynodegmi COT-254 (OTU #5514, 1.24%) were significantly more abundant in health and gingivitis than in mild periodontitis but the relative abundance in health and gingivitis did not significantly differ.
(54) The most abundant disease associated species included Peptostreptococcaceae sp. COT-004 (OTU #5570, 3.5%) and Lachnospiraceae sp. COT-036 (OTU #6025, 1.7%) which were significantly more abundant in mild periodontitis than health and gingivitis and did not significantly differ in their relative abundance in health and gingivitis. Clostridiales sp. COT-028 (OTU #1916, 2.2%), Peptostreptococcaceae sp. COT-135 (OTU #368, 1.4%), Peptostreptococcaceae sp. COT-077 (OTU #2463, 2.7%), Peptococcus sp. COT-044 (OTU #4905, 1.2%), Peptostreptococcaceae sp. COT-019 (OTU #908, 1.2%) and Peptostreptococcaceae sp. COT-030 (OTU #4774, 1.1%) were also significantly more abundant in mild periodontitis than in health and gingivitis but were also more abundant in gingivitis than health. Corynebacterium canis COT-421 (OTU #149, 1.1%) was significantly more abundant in mild periodontitis and gingivitis than health but gingivitis and mild periodontitis samples were not significantly different.
(55) Principal component analysis was used to investigate correlations of OTUs with health status, age, size and gender. The first component explained 14.7% and the second component 9.5% of the variability in the OTU log.sub.10 proportions (see
(56) Gram-Stain Status and Oxygen Requirements
(57) The probable Gram-stain status was determined by literature searches followed by logistic regression analysis of proportions of Gram positive or Gram negative non-rare OTUs; this showed that health, gingivitis and mild periodontitis groups were significantly different. Samples from dogs with mild periodontitis had a significantly higher proportion of Gram positive OTUs than those from dogs with gingivitis (P<0.001) and healthy gingiva (P<0.001). Gingivitis samples had a significantly higher proportion of Gram positive OTUs than samples from the healthy group (P=0.003; see
(58) The probable oxygen requirements were also determined by literature searches and analysed by logistic regression for proportions of aerobes, facultative anaerobes and anaerobes. Clear differences in oxygen requirements were observed between the bacterial population in healthy, gingivitis and mild periodontitis samples. Samples from dogs with healthy gingiva had significantly higher proportions of aerobes than gingivitis and periodontitis samples (P=0.006 & P<0.001 respectively) and gingivitis samples had a significantly higher proportion of aerobes than samples from dogs with mild periodontitis (P<0.001; see
(59) Species Richness and Diversity
(60) A linear model was used to compare the number of operational taxonomic units (OTUs) including rare OTUs in health, gingivitis and mild periodontitis. This showed that all health status were significantly different (see
(61) A linear model was used to analyse the Shannon diversity index data and showed that all health status were significantly different (see
(62) As a whole the most predominant phyla observed were the Bacteroidetes, Proteobacteria, Firmicutes and Actinobacteria from which 26 of the most abundant species made up 49.8% of all sequences. The proportions of these phyla shifted between disease stages with the Proteobacteria and Bacteroidetes being most abundant in plaque from the healthy cohort and the Firmicutes being more abundant in the mild periodontitis cohort. Comparisons with the human oral microbiota become most striking at the genus & species level. Whilst Streptococcus spp. are abundant in healthy humans they are rare in dogs; the lack of cariogenic Streptococcus spp. is presumably the reason dental caries is a rarely observed disease in dogs. Of note in this respect is the pH of canine saliva (pH 8.5), which is considerably more alkaline than that of human saliva (pH 6.5 to 7.5). It is possible that this difference in pH contributes to the lack of Streptococci in the dog oral cavity along with the lower level of sugars in the diet. The latter would be consistent with the recent observation that the human oral microflora evolved to a more cariogenic nature following the introduction of processed sugars to the diet during the industrial revolution (Adler et al. 2013). In healthy dogs Porphyromonas cangingivalis Canine Oral Taxon (COT)-109, Moraxella sp. COT-396 and Bergeyella zoohelcum COT-186 were the most abundant species. The latter two are also abundant in human health but the abundance of a Porphyromonad in healthy dogs is in contrast to the human oral microbiome where P. gingivalis has been synonymous with the red complex and human periodontal disease. The abundance of Porphyromonas, Moraxella and Bergeyella in healthy dogs was also observed in a recent 454 pyrosequencing study of 6 dogs.
(63) With respect to canine periodontal disease the Actinomyces, Peptostreptococcaceae and Porphyromonas species predominated. The most abundant species being P. cangingivalis COT-109 (again), Peptostreptococcus sp. COT-033, Actinomyces sp. COT-374, Peptostreptococcaceae XI [G-1] sp. COT-004 and Peptostreptococcaceae XIII [G-2] sp. COT-077. Fusobacterium and Treponema spp associated with human periodontal disease where present but at lower abundance and only one Treponema spp. (T. denticola) was significantly associated with mild periodontitis (Griffen et al., 2012). This difference in the apparent importance of Treponemes in the disease state may be as a result of an earlier stage of Periodontitis being surveyed in this study than the human one. It is also accentuated by the large number of different Treponeme species identified in our analysis (16) leading to fragmentation of the abundance. Indeed, if grouped at the genus level the Treponeme species make up 2.15% of the total in disease.
(64) Relatively few species were associated solely with gingivitis (Leptotrichia sp. COT-345, Neisseria canis AY426973 and an uncultured Capnocytophaga sp. HM333068). The abundance of health associated species did not always follow a linear reduction in abundance in gingivitis through to PD1, for many their abundance was also relatively high in gingivitis. This was also true for mild periodontitis associated species making it challenging to differentiate a health/gingivitis associated species from a health associated species or a gingivitis/periodontitis associated species from a periodontitis associated species. Presumably certain health associated species can compete in the gingivitis environment but not in periodontitis and vice versa for periodontitis associated species.
(65) In human plaque Gram-positive bacteria have traditionally been regarded as health associated and anaerobic Gram-negative bacteria as disease associated. Griffen's recent survey noted that this may be an over simplification with at least one Gram-positive bacteria (Filifactor alocis) being abundant in human disease (Griffen et al., 2012). Our observations in dog are in contrast to those from the human oral microbiome with Gram negative species being significantly more abundant in healthy plaque samples and Gram positives significantly more abundant in periodontitis plaque samples. The lack of Streptococci in dog results in the health associated species being dominated by Gram-negative aerobes. In contrast to health, the abundance of periodontitis associated Firmicutes, particularly Peptostreptococcaceae spp., means that Gram-positive anaerobes predominate in the periodontitis associated species. The environmental pressures that drive selection of species presumably include nutrient sources, oxygen stress, pH and immunological factors. We hypothesise that the major health associates may be aerobic early colonisers that are able to metabolise salivary carbohydrates such as mucins and proline rich proteins. With chronic gingivitis and periodontitis, uncontrolled inflammation and bacterial activity result in the destruction of gingival tissue leading to anaerobic periodontal pockets containing protein rich gingival crevicular fluid and immunological agents. This may then drive the rise in abundance of proteolytic anaerobic Clostridiales and Peptostreptococcaceae and Porphyromonads known for their ability to resist host defenses and utilise host oxidative immune responses (Mydel et al., 2006). The ability of the Gram negative anaerobe Porphyromonas cangingivalis to predominate in all three health states suggests that it is both metabolically flexible enough to colonise in health and able to compete against other Porphyromonas spp. in the disease environment. Its ability to prosper in health which is traditionally considered to be a more aerobic environment is interesting given that Porphyromonads are strict anaerobes.
EXAMPLE 2
Data and Models Used for Predicting Oral Health Status
(66) The data set used consisted of 454 sequencing data from 223 dog (H=72, G=77 & PD1=74) sub-gingival plaque samples pooled from multiple teeth of the same health state from the same individual.
(67) Health State
(68) The primary output of interest was the classification of cases into one of three health categories. These were: H: Animals diagnosed as Healthy G: Animals diagnosed with Gingivitis, and P: Animals diagnosed with Periodontitis
(69) In the predictive modelling process, in addition to this 3-way classification, several alternative outputs were also investigated for the purpose of simplifying the models, for understanding which bacterial markers were indicative of each classification and for possible use in ‘two-stage’ predictive models. The primary set of outputs used was: H/G/P H/Not-H (aggregating G and P into a single class) P/Not-P (aggregating G and H into a single class) H/G (excluding P) G/P (Excluding H)
Gingivitis Score
(70) An output of secondary interest was the average Gingivitis score obtained from sampled teeth. Although the individual teeth receive a discrete score taking the values 0, 1, 2 or 3, the average score is a continuous variable ranging from 0 to 3, which has an impact on the types of predictive models used and the approach to assessing the performance of the models. The Test Set Performance was assessed in terms of the regression R-squared value (the percentage of the variability in the output variable explained by the model). Since the R-squared can be difficult to interpret, the Residual Standard Deviation, which provides an indication of the mean distance between the observed and predicted values, was also calculated.
(71) In addition to the actual (continuous) mean Gingivitis score, the score rounded to the nearest integer value was also used as an output in some models. This was treated as purely categorical, which allows the performance to be assessed in the same way as for the Health State models. Since the initial results of this exercise were not very promising, no further optimisation of these models was performed.
(72) Inputs/Predictors
(73) Several sets of predictors were used in the predictive modelling. The following predictor variants were used:
(74) Counts: These are the original count variables, comprising prevalence counts for individual bacterial species and genera.
(75) Proportions: These are the counts transformed to proportions by dividing by the total count for each animal (‘row-wise’ transformation).
(76) Binary (count>1): These are binary presence/absence scores obtained using counts less than or equal to one to define “absent” and counts greater than one as “present”.
(77) Binary (count>7): These are binary presence/absence scores obtained using counts less than or equal to seven to define “absent” and counts greater than seven as “present”.
(78) Relative Counts & Proportions: These are obtained by dividing the counts and proportions by the mean value for the whole predictor (‘column-wise’ transformation).
(79) Relative Counts & Proportions Truncated: These are obtained by taking the Relative values and “truncating” any values greater than 1 by setting them equal to 1. This transformation results in values ranging from 0 to 1 (with, typically, a large number of truncated values).
(80) Relative Counts & Proportions 3-level Categorical: These are categorical variables obtained by taking the Relative values and setting them into three categories using threshold values of 0.0005 (0.05% of the mean) and 0.1 (10% of the mean). These were then used as categorical predictors in the models.
(81) Based on the results from the above separate modelling exercises, a further set of models was fitted using a subset of predictors identified as those selected by the earlier models. These are listed in table 4. These predictors were drawn from the Count, Proportion and Binary predictor sets, but omitted the Relative predictors. This allowed the models to select any combination of these predictors. For a subset of output variables, a further set of 3-level categorical predictors (those selected by the earlier models) were added to this set to allow the creation of models that included a combination of continuous/binary and categorical predictors.
(82) Table 4—Subset of ‘Best’ Predictors
(83) This list shows the subset of ‘best’ predictor variables identified from the early-stage modelling and used in later stages to allow the creation of models including more than one predictor type. The variable prefixes identify the variable type and should be interpreted as follows:
(84) TABLE-US-00020 1. pr_g_Moraxella 2. pr_Peptostreptococcaceae_XIII_[G- 2]_sp._COT-077 3. pr_Filifactor_sp._COT-064 4. pr_g_Capnocytophaga 5. ct_Escherichia_coli 6. pr_Porphyromonas_sp._COT-290 7. ct_Neisseria_sp._COT-049 8. ct_Filifactor_sp._COT-163 9. pr_Selenomonas_sputigena_COT-342 10. pr_Corynebacterium_sp._cluster 88112 11. ct_g_Leucobacter 12. ct_Xenophilus_sp._COT-174 13. pr_Peptostreptococcaceae_XI_[G- 1]_sp._COT-004 14. ct_Peptostreptococcaceae_XIII_[G- 1]_sp._COT-030 15. ct_Fusobacterium_sp._COT-189 16. ct_Peptostreptococcaceae_XI_[G- 6]_sp._COT-068 17. ct_g_Odoribacter 18. ct_g_Schwartzia 19. pr_g_Globicatella 20. ct_Peptostreptococcaceae_XI_[G- 2]_sp._COT-047 21. ct_g_Granulicatella 22. pr_g_Catonella 23. pr_g_Prevotella 24. pr_Clostridiales_III_[G-3]_sp._COT-388 25. ct_Clostridiales_[F-2.G-1]_sp._COT- 100_PO005 26. pr_g_Curtobacterium 27. pr_Parvimonas_sp._COT-101 28. ct_g_Filifactor 29. pr_g_Atopobium 30. pr_g_Corynebacterium 31. ct_Capnocytophaga_canimorus_COT-235 32. pr_g_Treponema 33. ct_Peptostreptococcaceae_XI_[G- 6]_sp._COT-067 34. ct_Catonella_sp._COT-257 35. ct_g_Parvimonas 36. pr_g_bacterium_cp04.17 37. pr_Peptostreptococcaceae_XI_[G- 4]_sp._COT-019 38. pr_Treponema_denticola_COT-197 39. pr_g_Peptostreptococcus 40. pr_Moraxella_sp._COT-017 41. ct_Peptostreptococcaceae_XIII_[G- 2]_sp._COT-077 42. pr_Spirochaeta_sp._COT-379 43. pr_Wolinella_succinogenes 44. pr_Proprionibacterium_sp._COT-300 45. pr_g_Xanthomonadaceae_bacterium 46. pr_g_Tannerella 47. ct_Actinomyces_sp. 48. ct_g_Streptococcus 49. ct_Filifactor_villosus_COT-031 50. ct_Actinomyces_sp. Cluster 7595 51. ct_Peptostreptococcaceae_XI_[G- 1]_sp._COT-006 52. pr_Lachnospiraceae_XIVa_[G-3]_sp. 53. pr_Peptostreptococcaceae_XIII_[G- 1]_sp._COT-030 54. pr_Cardiobacterium_sp._COT-176 55. pr_Peptostreptococcaceae_XI_[G- 4]_sp._COT-021 56. ct_Capnocytophaga_canimorsus 57. pr_Pasteurella_canis_COT-273 58. pr_Moraxella_sp._COT-018 59. ct_Anaerovorax_sp._COT-125 60. pr_Fusobacterium_sp._COT-189 61. ct_g_Prevotella 62. pr_g_Fusobacterium 63. ct_Peptostreptococcaceae_XI_[G- 7]_sp._COT-155 64. ct_Spirochaeta_sp._COT-314 65. pr_Peptostreptococcaceae_XI_[G- 6]_sp._COT-068 66. pr_Pasteurellaceae_sp._COT-271 67. pr_g_Arcobacter 68. pr_Treponema_sp._COT-233 69. ct_Prevotella_sp._COT-195 70. pr_g_Propionivibrio 71. ct_g_Escherichia 72. ct_Parvimonas_sp._COT-101 73. ct_Proprionibacterium_sp._COT-296 74. pr_Treponema_sp._COT-200 75. ct_Frigovirgula_sp._COT-007 76. pr_g_Odoribacter 77. pr_g_Schwartzia 78. pr_Lachnospiraceae_XIVa_[G-6]_sp._COT- 106 79. ct_g_Arcobacter 80. pr_g_Lautropia 81. ct_Lachnospiraceae_XIVa_[G-2]_sp._COT- 062 82. ct_Porphyromonas_sp._COT-361 83. pr_Prevotella_sp._COT-298 84. ct_Catonella_sp._COT-025 85. pr_Parvimonas_sp._COT-035 86. pr_g_Xenophilus 87. pr_Chryseobacterium_sp._COT-320 88. pr_g_Actinomyces 89. pr_Actinomyces_sp._COT-252 90. ct_Actinomyces_sp. Cluster 7596 91. ct_g_Actinomyces 92. ct_Filifactor_sp._COT-064 93. pbn_Erysipelotrichaceae_[G-3]_sp._COT- 302 94. bn_Capnocytophaga_canimorus_COT-235 95. bn_Porphyromonas_macacae_COT-192 96. bn_Neisseria_weaveri_COT-269 97. bn_Neisseria_sp._COT-049 98. bn_Actinobaceria_sp._COT-376 99. bn_Treponema_denticola_COT-197 100. bn_Lachnospiraceae_XIVa_[G-6]_sp._COT- 161 101. bn_Porphyromonas_gulae_II_COT-052 102. bn_Proprionibacterium_sp._COT-365 103. bn_Schwartzia_sp._COT-063 104. bn_Capnocytophaga_sp._COT-362 105. bn_Filifactor_sp._COT-064 106. bn_Filifactor_sp._COT-163 107. bn_Peptostreptococcaceae_XI_[G- 6]_sp._COT-067 108. bn_g_Solobacterium 109. bn_Porphyromonas_sp._COT-361 110. bn_Prevotella_sp._COT-195 111. bn_Proprionibacterium_sp._COT-296 112. bn_Treponema_sp._COT-198 113. bn_g_Atopobium 114. bn_g_Leucobacter 115. bn_g_Lautropia 116. bn_g_Parvimonas 117. bn_Capnocytophaga_canimorsus 118. bn_Lachnospiraceae_XIVa_[G-6]_sp._COT- 106 119. bn_Treponema_sp._COT-351 120. bn_Actinomyces_catuli 121. bn_Bacteroides_denticanoris_COT-183 (Prevotella_sp?) 122. bn_Parvimonas_sp._COT-102 123. bn_g_Arcobacter 124. bn_Peptostreptococcaceae_XIII_[G- 1]_sp._COT-030 125. bn_g_Staphylococcus 126. bn_Peptostreptococcaceae_XI_[G- 1]_sp._COT-006 127. bn_Porphyromonas_gulae_I_COT-052 128. bn_g_Xanthomonadaceae_bacterium 129. bn_g_Schwartzia 130. bn_Cardiobacterium_sp._COT-176 131. bn_Actinomyces_bowdenii 132. bn_g_Leptotrichia 133. bn_Treponema_sp._COT-359 134. bn_g_Xenophilus 135. bn_Lachnospiraceae_XIVa_[G-2]_sp._COT- 062 136. bn_Frigovirgula_sp._COT-007 137. bn_Wolinella_succinogenes 138. bn_g_Curtobacterium 139. bn_Chryseobacterium_sp._COT-320 140. bn_Bacteroidia_[G-5]_sp._COT-187 141. bn_Synergistales_[G-1]_sp._COT-178 142. bn_g_Propionibacteriaceae_bacterium 143. bn_Selenomonas_sputigena_COT-342 144. bn_Streptococcus_minor_COT-116 145. bn_Porphyromonas_sp._COT-182 146. b7_Clostridiales_III_[G-3]_sp._COT-388 147. b7_Escherichia_coli 148. b7_g_Parvimonas 149. b7_Capnocytophaga_canimorsus 150. b7_Peptostreptococcaceae_XIII_[G- 1]_sp._COT-030 151. b7_Desulfovibrionales_sp._COT-009 152. b7_Peptostreptococcaceae_XI_[G- 7]_sp._COT-155 153. b7_Fusobacterium_sp._COT-169 154. b7_Anerovorax_sp._COT-066 155. b7_Lachnospiraceae_XIVa_[G-3]_sp. 156. b7_g_bacterium_cp04.17 157. b7_Filifactor_alocis_COT-001 158. b7_Peptostreptococcaceae_XI_[G- 1]_sp._COT-258 159. b7_Peptostreptococcaceae_XI_[G- 3]_sp._COT-104 160. b7_Clostridiales_[F-2.G-1]_sp._COT- 100_PO005 161. b7_Selenomonas_sputigena_COT-342 162. b7_g_Moraxella 163. b7_g_Phascolarctobacterium 164. b7_Peptostreptococcaceae_XIII_[G- 2]_sp._COT-077 165. b7_Leucobacter_sp._COT-288 166. b7_g_Atopobium 167. b7_g_Propionivibrio 168. b7_Spirochaeta_sp._COT-314 169. b7_g_CDC_Group_NO-1 170. b7_Catonella_sp._COT-257 171. b7_Corynebacterium_sp._cluster 88112 172. b7_g_Catonella 173. b7_Fusobacterium_sp._COT-189 174. b7_Peptostreptococcaceae_XI_[G- 3]_sp._COT-034 175. b7_Treponema_sp._COT-233 176. b7_g_Chryseobacterium 177. b7_Actinomyces_catuli 178. b7_Peptostreptococcaceae_XI_[G- 6]_sp._COT-067 179. b7_Proprionibacterium_sp._COT-365 180. b7_g_Xenophilus 181. b7_Capnocytophaga_sp._COT-339 182. b7_g_Treponema 183. b7_Prevotella_sp._COT-282 184. b7_g_Clostridiales_III_[G-3]_sp._COT- 388_1P046 185. b7_Porphyromonas_gulae_I_COT-052 186. b7_g_Escherichia 187. b7_g_Solobacterium 188. b7_Streptococcus_minor_COT-116 189. b7_g_Leptotrichia 190. b7_Pasteurellaceae_sp._COT-271 191. b7_g_Staphylococcus 192. b7_Filifactor_sp._COT-163 193. b7_Peptostreptococcaceae_XI_[G- 1]_sp._COT-006 194. b7_bacterium_cp04.17 195. b7_Porphyromonas_macacae_COT-192 196. b7_Spirochaeta_sp._COT-379 197. b7_Stenotrophomonas_sp._COT-224 198. b7_Parvinnonas_sp._COT-035 199. b7_Capnocytophaga_sp._COT-362 ct_ Counts pr_ Proportions bn_ Binary predictors using a cut-off of 1 b7_ Binary predictors using a cut-off of 7 g_ Indicates that the variable relates to a genus, rather than an individual species
Predictive Modelling
Standard Model Types
(85) A standard set of models (as known to the person skilled in the art) was applied to each combination of predictors and output variables. The classification model types used were: General Stepwise Discriminant Analysis with maximum of 10 predictors General Stepwise Discriminant Analysis with maximum of 5 predictors Classification Trees Classification Trees with v-fold cross-validation Multivariate Adaptive Regression Splines Boosted Classification Trees Random Forests
(86) The model types used for the prediction of Gingivitis score (a continuous output variable) were: General Stepwise Regression Analysis with maximum of 10 predictors General Stepwise Regression Analysis with maximum of 5 predictors Regression Trees Regression Trees with v-fold cross-validation Multivariate Adaptive Regression Splines Boosted Regression Trees Random Forests Two-stage Models
(87) Because of the limited success of the attempts a two-stage approach to produce models capable of performing a (H/G/P) classification was investigated. This involved developing a set of models trained for simpler two-way classification and combining some of the best-performing two-way models to produce a final three-way (H/G/P) classification, in the following combinations: H/Not-H with G/P P/Not-P with H/G H/Not-H with P/Not-P
(88) These results provide evidence that it is possible to use the bacterial species found in canine sub-gingival plaque to diagnose oral health state.
EXAMPLE 3
Model 1
(89) TABLE-US-00021 Output Classes P/Not-P Model Type Stepwise Discriminant Function Predictor Set Binary (>1) Selected Model 4 Predictors (Test Performance 83.8%)
Misclassification Matrix
(90) TABLE-US-00022 Test Set Training Set Observed Predicted Class Predicted Class Class P Not-P Total P Not-P Total P 11 11 22 29 23 52 Not-P 0 46 46 7 96 103
Classification Functions
(91) TABLE-US-00023 P Not-P A priori probabilities 0.3355 0.6645 Intercept −3.70073 −2.27400 bn_Capnocytophaga_canimorus_COT-235 1.86706 3.96701 bn_Peptostreptococcaceae_XI_[G- 2.94594 1.14205 6]_sp._COT-067 bn_Porphyromonas_macacae_COT-192 2.37558 1.01832 bn_g_Solobacterium 2.26286 0.16566
EXAMPLE 4
Model 2
(92) TABLE-US-00024 Output Classes P/Not-P Model Type Classification Tree Predictor Set Binary (>1) Selected Model 7 Splits (Test Performance 82.4%)
Misclassification Matrix
(93) TABLE-US-00025 Test Set Training Set Observed Predicted Class Predicted Class Class P Not-P Total P Not-P Total P 12 10 22 37 15 52 Not-P 2 44 46 9 94 103
Tree Structure
(94) TABLE-US-00026 Tree structure 1 (Training Data) Dependent variable: Health State Options: Categorical response, Tree number 1 Node Left Right Size of N in N in class Selected Split Split # branch branch node class P Not-P category Variable constant 1 2 3 155 52 103 Not-P bn_Peptostreptococcaceae_XI_[G-6]_sp._COT-067 0.5 2 4 5 93 15 78 Not-P bn_Treponema_sp._COT-198 0.5 4 6 7 89 11 78 Not-P bn_g_Atopobium 0.5 6 8 9 83 7 76 Not-P bn_Streptococcus_anginosus_COT-117 0.5 8 10 11 80 5 75 Not-P bn_g_Porphyromonadaceae 0.5 10 12 13 79 4 75 Not-P bn_Synergistales_[G-1]_sp._COT-244 0.5 12 78 3 75 Not-P 13 1 1 0 P 11 1 1 0 P 9 3 2 1 P 7 6 4 2 P 5 4 4 0 P 3 20 21 62 37 25 P bn_Capnocytophaga_canimorus_COT-235 0.5 20 31 25 6 P 21 31 12 19 Not-P
EXAMPLE 5
Model 3
(95) TABLE-US-00027 Output Classes H/Not-H Model Type Stepwise Discriminant Function Predictor Set Binary (>1) Selected Model 8 Predictors (Test Performance 76.5%)
Misclassification Matrix
(96) TABLE-US-00028 Test Set Training Set Observed Predicted Class Predicted Class Class H Not-H Total H Not-H Total H 13 6 19 42 10 52 Not-H 10 39 49 15 88 103
Classification Functions
(97) TABLE-US-00029 H Not-H A priori probabilities 0.3355 0.6645 Intercept −9.75622 −11.9690 bn_Actinobaceria_sp._COT-376 3.20990 5.5783 bn_Bacteroides_denticanoris_COT-183 1.43898 3.0533 (Prevotella_sp?) bn_Capnocytophaga_canimorsus 3.76502 2.4305 bn_Lachnospiraceae_XIVa_[G-2]_sp._COT- 1.37525 0.0051 062 bn_Neisseria_weaveri_COT-269 0.71473 −1.3992 bn_Treponema_denticola_COT-197 12.86457 15.3769 bn_Treponema_sp._COT-351 −0.83313 0.7140 bn_g_Schwartzia −0.60100 1.5399
EXAMPLE 6
Model 4
(98) TABLE-US-00030 Output Classes H/Not-H Model Type Classification Tree Predictor Set Best predictors (Counts, Proportions and Binary) Selected Model 6 Splits (Test Performance 79.4%)
Misclassification Matrix
(99) TABLE-US-00031 Test Set Training Set Observed Predicted Class Predicted Class Class H Not-H Total H Not-H Total H 17 2 19 39 13 52 Not-H 12 37 49 4 99 103
Tree Structure
(100) TABLE-US-00032 Tree structure 1 (Training Data) Dependent variable: Health State Options: Categorical response, Tree number 1 Left Right Size of N in class Selected Node # branch branch node N in class H Not-H category Split variable 1 2 3 155 52 103 Not-H pr_g_Peptostreptococcus 2 4 5 71 43 28 H pr_Treponema_sp._COT-200 4 6 7 46 36 10 H ct_Frigovirgula_sp._COT-007 6 8 9 39 34 5 H ct_g_Leucobacter 8 10 11 33 32 1 H pr_g_Odoribacter 10 32 32 0 H 11 1 0 1 Not-H 9 6 2 4 Not-H 7 7 2 5 Not-H 5 12 13 25 7 18 Not-H ct_Peptostreptococcaceae_XIII_[G- 2]_sp._COT-077 12 11 7 4 H 13 14 0 14 Not-H 3 84 9 75 Not-H
Misclassification Matrix for 2-stage Model A
(101) TABLE-US-00033 Test Set Training Set Observed Predicted Class Predicted Class Class H G P Total H G P Total H 17 2 0 19 39 12 1 52 G 8 19 0 27 4 43 4 51 P 4 7 11 22 0 23 29 52
EXAMPLE 7
(102) This example shows the identification of two or more bacteria as claimed using a binary test, combined with the information give n in tables 1 to 5 and the use of statistical models gives a reliable prediction of the health status of an animal.
(103) TABLE-US-00034 Output Training Test Variable Model Type Novel Predictors only Performance Performance Classes Discriminant - bn_Peptostreptococcaceae_XI_[G- 85.8 80.9 P/Not-P Forward 6]_sp._COT-067 Stepwise - 10 bn_Capnocytophaga_canimorus_COT-235 predictors bn_g_Solobacterium bn_Fusobacterium_sp._COT-236 bn_Capnocytophaga_sp._COT-362 bn_Ottowia_sp._COT-014 bn_Neisseria_animaloris_COT-016 bn_Moraxella_sp._COT-328 bn_Peptostreptococcaceae_XIII_[G- 2]_sp._COT-077 bn_Peptostreptococcaceae_XI_[G- 2]_sp._COT-003 Classes Classification bn_Peptostreptococcaceae_XI_[G- 89.7 75.0 P/Not-P Trees 6]_sp._COT-067 bn_Treponema_sp._COT-198 bn_g_Atopobium bn_Streptococcus_anginosus_COT-117 bn_g_Porphyromonadaceae bn_Fusobacterium_sp._COT-189 bn_Streptococcus_anginosus bn_Treponema_sp._COT-351 bn_Capnocytophaga_sp._COT-362 bn_g_Anaerovorax bn_Capnocytophaga_canimorus_COT-235 bn_Erysipelotrichaceae_[G-3]_sp._COT-302 bn_g_Leucobacter bn_g_Lautropia Classes Discriminant - bn_g_Schwartzia 84.5 70.6 H/Not-H Forward bn_Capnocytophaga_canimorsus Stepwise - 10 bn_Treponema_sp._COT-351 predictors bn_Erysipelotrichaceae_[G-3]_sp._COT-302 bn_Actinobaceria_sp._COT-376 bn_Pasteurella_canis_COT-273 bn_Anaerovorax_sp._COT-124 bn_Streptococcus_sp._cluster 2789 bn_Moraxella_sp._COT-018 bn_Chloroflexi_[G-1]_sp._COT-306 Classes Classification pr_g_Peptostreptococcus 83.2 72.1 H/Not-H Trees with v- pr_Treponema_sp._COT-200 fold Classes Discriminant - bn_Peptostreptococcaceae_XIII_[G- 78.7 75.0 H/Not-H Forward 2]_sp._COT-077 Stepwise—3 bn_Capnocytophaga_canimorsus predictors bn_g_Schwartzia Classes Classification bn_Peptostreptococcaceae_XIII_[G- 81.3 77.9 P/Not-P Trees 2]_sp._COT-077 bn_Capnocytophaga_canimorus_COT-235 bn_Peptostreptococcaceae_XI_[G- 6]_sp._COT-067 bn_Neisseria_sp._COT-049 Classes Discriminant - bn_Peptostreptococcaceae_XIII_[G- 86.5 80.9 P/Not-P Forward 2]_sp._COT-077 Stepwise—5 bn_Capnocytophaga_canimorus_COT-235 predictors bn_Peptostreptococcaceae_XI_[G- 6]_sp._COT-067 bn_g_Solobacterium bn_Neisseria_sp._COT-049 Classes Discriminant - b7_Peptostreptococcaceae_XIII_[G- 80.6 76.5 P/Not-P Forward 1]_sp._COT-030 Stepwise—5 b7_g_Parvimonas predictors b7_Filifactor_alocis_COT-001 b7_Peptostreptococcaceae_XI_[G- 1]_sp._COT-258 b7_Peptostreptococcaceae_XI_[G- 3]_sp._COT-104 Classes MAR Splines bn_Lachnospiraceae_XIVa_[G-6]_sp._COT- 91.7 73.5 P/Not-P 106 bn_Neisseria_sp._COT-049 bn_Peptostreptococcaceae_XI_[G- 6]_sp._COT-067 bn_Selenomonas_sputigena_COT-342
EXAMPLE 8
(104) This example shows the identification of two or more bacteria as claimed using a proportional test, combined with the information give n in tables 1 to 5 and the use of statistical models gives a reliable prediction of the health status of an animal.
(105) TABLE-US-00035 Output Training Test Variable Model Type Novel Predictors only Performance Performance Classes Discriminant - rel_pr_Peptostreptococcaceae_XIII_[G- 83.9 75.0 P/Not-P Forward Stepwise - 2]_sp._COT-077 5 predictors rel_pr_Filifactor_sp._COT-064 rel_pr_Peptostreptococcaceae_XI_[G-4]_sp._COT- 019 rel_pr_Selenomonas_sputigena_COT-342 rel_ct_Neisseria_sp._COT-049 Classes Discriminant - rel_pr_Peptostreptococcaceae_XIII_[G- 86.5 79.4 P/Not-P Forward Stepwise - 2]_sp._COT-077 10 predictors rel_pr_Filifactor_sp._COT-064 rel_pr_Peptostreptococcaceae_XI_[G-4]_sp._COT- 019 rel_pr_Selenomonas_sputigena_COT-342 rel_ct_Neisseria_sp._COT-049 rel_ct_Filifactor_sp._COT-163 rel_ct_Frigovirgula_sp._COT-058 rel_pr_Treponema_denticola_COT-197 rel_pr_Erysipelotrichaceae_[G-3]_sp._COT-302 rel_pr_g_Peptostreptococcus
EXAMPLE 9
(106) This example shows that predictive models based on known bacteria are improved once at least one novel bacteria identified as part of the present invention is included in the analysis.
(107) TABLE-US-00036 Output Training Test Variable Model Type Non-Novel Predictors Performance Performance Classes Discriminant - bn_Porphyromonas_macacae_COT-192 81.3 61.8 P/Not-P Forward bn_Neisseria_weaveri_COT-269 Stepwise - 10 bn_Helcococcus_sp._COT-140 predictors bn_Bacteroides_denticanoris_COT-183 bn_Pasteurellaceae_sp._COT-271 bn_Treponema_denticola_COT-197 bn_Synergistales_[G-1]_sp._COT-244 bn_Porphyromonas_gulae_II_COT-052 bn_Helcococcus_sp._COT-069 bn_Moraxella_sp._COT-017 Classes Classification bn_Porphyromonas_macacae_COT-192 70.3 P/Not-P Trees bn_Neisseria_zoodegmatis_COT-349 bn_Porphyromonas_gulae_I_COT-052 bn_Bacteroides_denticanoris_COT-183 bn_Synergistales_[G-1]_sp._COT-180 bn_Frigovirgula_sp._COT-058 bn_Porphyromonas_gulae_II_COT-052 Classes Discriminant - bn_Synergistales_[G-1]_sp._COT-180 81.9 75.0 P/Not-P Forward bn_Neisseria_weaveri_COT-269 Stepwise - 11 bn_Treponema_denticola_COT-197 predictors bn_Bacteroides_denticanoris_COT-183 bn_Porphyromonas_macacae_COT-192 bn_Porphyromonas_gulae_II_COT-052 bn_Helcococcus_sp._COT-140 bn_Porphyromonas_gulae_I_COT-052 bn_Bacteroides_tectus_COT-039 bn_Filifactor_villosus_COT-031 bn_Helcococcus_sp._COT-069 Output Training Test Variable Model Type With addition of Novel Predictor(s) Performance Performance Classes Discriminant - bn_Porphyromonas_macacae_COT-192 80.0 66.2 P/Not-P Forward bn_Neisseria_weaveri_COT-269 Stepwise - 10 bn_Helcococcus_sp._COT-140 predictors bn_Bacteroides_denticanoris_COT-183 bn_Pasteurellaceae_sp._COT-271 bn_Treponema_denticola_COT-197 bn_Synergistales_[G-1]_sp._COT-244 bn_Porphyromonas_gulae_II_COT-052 bn_Helcococcus_sp._COT-069 bn_Moraxella_sp._COT-017 bn_Filifactor_sp._COT-163 Classes Classification bn_Porphyromonas_macacae_COT-192 84.5 70.6 P/Not-P Trees bn_Neisseria_zoodegmatis_COT-349 bn_Porphyromonas_gulae_I_COT-052 bn_Bacteroides_denticanoris_COT-183 bn_Synergistales_[G-1]_sp._COT-180 bn_Frigovirgula_sp._COT-058 bn_Porphyromonas_gulae_II_COT-052 bn_Parvimonas_sp._COT-035 bn_Proprionibacterium_sp._COT-296 bn_Proprionibacterium_sp._COT-365 bn_Pasteurella_dogmatis_COT-092 Classes Discriminant - bn_Synergistales_[G-1]_sp._COT-180 81.9 76.5 P/Not-P Forward bn_Neisseria_weaveri_COT-269 Stepwise - 11 bn_Treponema_denticola_COT-197 predictors bn_Bacteroides_denticanoris_COT-183 bn_Porphyromonas_macacae_COT-192 bn_Porphyromonas_gulae_II_COT-052 bn_Actinobaceria_sp._COT-376
EXAMPLE 10
Novel Proportional Model
(108) TABLE-US-00037 Output Classes P/Not-P Model Type Stepwise Discriminant Function Predictor Set Relative counts and proportions Selected Model 5 Predictors (Test Performance 75%)
Misclassification Matrix
(109) TABLE-US-00038 Training Set Test Set Observed Predicted Class Predicted Class Class P Not-P Total P Not-P Total P 30 22 52 9 13 22 Not-P 3 100 103 4 42 46
Classification Functions
(110) TABLE-US-00039 P Not-P A priori probabilities 0.3355 0.6645 Intercept −3.34369 −0.551900 rel_ct_Neisseria_sp._COT-049 0.35971 0.092469 rel_pr_Filifactor_sp._COT-064 0.31352 0.027470 rel_pr_Peptostreptococcaceae_XI_[G- 0.85807 0.330981 4]_sp._COT-019 rel_pr_Peptostreptococcaceae_XIII_[G- 0.40666 0.041811 2]_sp._COT-077 rel_pr_Selenomonas_sputigena_COT-342 0.33040 0.024742
EXAMPLE 11
Novel Binary Discriminant Model
(111) TABLE-US-00040 Output Classes H/Not-H Model Type Stepwise Discriminant Function Predictor Set Binary (>1) Selected Model 10 Predictors (Test Performance 71%)
Misclassification Matrix
(112) TABLE-US-00041 Training Set Test Set Observed Predicted Class Predicted Class Class H Not-H Total H Not-H Total H 39 13 52 11 8 19 Not-H 11 92 103 12 37 49
Classification Functions
(113) TABLE-US-00042 H Not-H A priori probabilities 0.3355 0.6645 Intercept −9.72349 −10.0961 bn_Actinobaceria_sp._COT-376 1.68931 3.6721 bn_Anaerovorax_sp._COT-124 0.86471 −0.6651 bn_Capnocytophaga_canimorsus 2.92731 1.8613 bn_Chloroflexi_[G-1]_sp._COT-306 5.03974 6.7966 bn_Erysipelotrichaceae_[G-3]_sp._COT-302 −0.08136 1.7031 bn_Moraxella_sp._COT-018 3.56547 1.9579 bn_Pasteurella_canis_COT-273 6.97270 5.0997 bn_Streptococcus_sp._cluster 2789 5.21252 10.0025 bn_Treponema_sp._COT-351 −1.56851 0.5099 bn_g_Schwartzia 0.76941 2.6864
EXAMPLE 12
Novel Binary Classification Tree Model
(114) TABLE-US-00043 Output Classes P/Not-P Model Type Classification Tree Predictor Set Binary (>1) - COT-077 forced Selected Model 5 Predictors (Test Performance 78%)
Misclassification Matrix
(115) TABLE-US-00044 Training Set Test Set Observed Predicted Class Predicted Class Class P Not-P Total P Not-P Total P 35 17 52 14 8 22 Not-P 12 91 103 7 39 46
Tree Structure
(116) TABLE-US-00045 Tree Structure (Spreadsheet in Porto Diagnostic Data - Merged Data (COT-077 first)) Response: Health State Model: C&RT; Size of N in N in class Selected Split Criterion Criterion Child Child node class P Not-P category variable for child 1 for child 2 node 1 node 2 1 155 52 103 Not-P bn_Peptostreptococcaceae_XIII_[G-2]_sp._COT-077 x <= 0.5000 x > 0.5000 2 3 2 51 5 46 Not-P 3 104 47 57 Not-P bn_Capnocytophaga_canimorus_COT-235 x <= 0.5000 x > 0.5000 4 5 4 43 30 13 P bn_Peptostreptococcaceae_XI_[G-6]_sp._COT-067 x <= 0.5000 x > 0.5000 6 7 6 17 7 10 Not-P 7 26 23 3 P 5 61 17 44 Not-P Bn_Neisseria_sp._COT-049 x <= 0.5000 x > 0.5000 10 11 10 40 5 35 Not-P 11 21 12 9 P
Supplementary Information
PMML Files for Selected Models
(117) The following PMML files show the deployment code for each of models 1 to 4.
(118) TABLE-US-00046 Model 1 <?xml version=“1.0” encoding=“Windows-1252” ?> <PMML version=“2.0”> <Header copyright=“STATISTICA Data Miner, Copyright (c) StatSoft, Inc., www.statsoft.com.”/> <DataDictionary numberOfFields=“5”> <DataField name=“Health State” optype=“categorical”> <Value value=“P” NumericValue=“103”/> <Value value=“Not-P” NumericValue=“104”/> </DataField> <DataField name=“bn_Capnocytophaga_canimorus_COT-235” optype=“continuous”/> <DataField name=“bn_Peptostreptococcaceae_XI_[G-6]_sp._COT-067” optype=“continuous”/> <DataField name=“bn_Porphyromonas_macacae_COT-192” optype=“continuous”/> <DataField name=“bn_g_Solobacterium” optype=“continuous”/> </DataDictionary> <GeneralDiscriminantAnalysis functionName=“classification” modelName=“General discriminant analysis” modelType=“generalLinear” targetVariableName=“Health State”> <ParameterList> <Parameter name=“p1” label=“Intercept”/> <Parameter name=“p2” label=“bn_Capnocytophaga_canimorus_COT-235”/> <Parameter name=“p3” label=“bn_Peptostreptococcaceae_XI_[G-6]_sp._COT- 067”/> <Parameter name=“p4” label=“bn_Porphyromonas_macacae_COT-192”/> <Parameter name=“p5” label=“bn_g_Solobacterium”/> </ParameterList> <FactorList> </FactorList> <CovariateList> <Predictor name=“bn_Capnocytophaga_canimorus_COT-235”/> <Predictor name=“bn_Peptostreptococcaceae_XI_[G-6]_sp.COT-067”/> <Predictor name=“bn_Porphyromonas_macacae_COT-192”/> <Predictor name=“bn_g_Solobacterium”/> </CovariateList> <PPMatrix> <PPCell value=“1” predictorName=“bn_Capnocytophaga_canimorus_COT-235” parameterName=“p2”/> <PPCell value=“1” predictorName=“bn_Peptostreptococcaceae_XI_[G-6]_sp._COT- 067” parameterName=“p3”/> <PPCell value=“1” predictorName=“bn_Porphyromonas_macacae_COT-192” parameterName=“p4”/> <PPCell value=“1” predictorName=“bn_g_Solobacterium” parameterName=“p5”/> </PPMatrix> <Extension name=“CorrectDummyCode” value=“1”/> <Extension name=“IncorrectDummyCode” value=“−1”/> <ParamMatrix> <PCell targetCategory=“P” parameterName=“p1” beta=“− 3.70073449195254e+000”/> <PCell targetCategory=“P” parameterName=“p2” beta=“1.86705716305613e+000”/> <PCell targetCategory=“P” parameterName=“p3” beta=“2.94593793157859e+000”/> <PCell targetCategory=“P” parameterName=“p4” beta=“2.37557530180906e+000”/> <PCell targetCategory=“P” parameterName=“p5” beta=“2.26285729194501e+000”/> <PCell targetCategory=“Not-P” parameterName=“p1” beta=“− 2.27399820671763e+000”/> <PCell targetCategory=“Not-P” parameterName=“p2” beta=“3.96700693000221e+000”/> <PCell targetCategory=“Not-P” parameterName=“p3” beta=“1.14204503369275e+000”/> <PCell targetCategory=“Not-P” parameterName=“p4” beta=“1.01832179904648e+000”/> <PCell targetCategory=“Not-P” parameterName=“p5” beta=“1.65660316639435e− 001”/> </ParamMatrix> </GeneralDiscriminantAnalysis> </PMML>
(119) TABLE-US-00047 Model 2 <?xml version=“1.0” encoding=“Windows-1252” ?> <PMML version=“2.0”> <Header copyright=“STATISTICA Data Miner, Copyright (c) StatSoft, Inc., www.statsoft.com.”/> <DataDictionary numberOfFields=“8”> <DataField name=“Health State” optype=“categorical”> <Value value=“P” NumericValue=“103”/> <Value value=“Not-P” NumericValue=“104”/> </DataField> <DataField name=“bn_Capnocytophaga_canimorus_COT-235” optype=“continuous”/> <DataField name=“bn_Peptostreptococcaceae_XI_[G-6]_sp._COT-067” optype=“continuous”/> <DataField name=“bn_Streptococcus_anginosus_COT-117” optype=“continuous”/> <DataField name=“bn_Synergistales_[G-1]_sp._COT-244” optype=“continuous”/> <DataField name=“bn_Treponema_sp._COT-198” optype=“continuous”/> <DataField name=“bn_g_Atopobium” optype=“continuous”/> <DataField name=“bn_g_Porphyromonadaceae” optype=“continuous”/> </DataDictionary> <TreeModel functionName=“classification” modelName=“Classification and regression trees” splitCharacteristic=“binarySplit”> <MiningSchema> <MiningField name=“Health State” usageType=“predicted”/> <MiningField name=“bn_Capnocytophaga_canimorus_COT-235”/> <MiningField name=“bn_Peptostreptococcaceae_XI_[G-6]_sp._COT-067”/> <MiningField name=“bn_Streptococcus_anginosus_COT-117”/> <MiningField name=“bn_Synergistales_[G-1]_sp._COT-244”/> <MiningField name=“bn_Treponema_sp._COT-198”/> <MiningField name=“bn_g_Atopobium”/> <MiningField name=“bn_g_Porphyromonadaceae”/> </MiningSchema> <Node score=“Not-P”> <targetPrediction name=“P” value=“3.35483870967742e−001”/> <targetPrediction name=“Not-P” value=“6.64516129032258e−001”/> <TRUE/> <Node score=“Not-P”> <targetPrediction name=“P” value=“1.61290322580645e−001”/> <targetPrediction name=“Not-P” value=“8.38709677419355e−001”/> <SimplePredicate field=“bn_Peptostreptococcaceae_XI_[G-6]_sp._COT- 067” operator=“lessOrEqual” value=“5.00000000000000e−001”/> <Node score=“Not-P”> <targetPrediction name=“P” value=“1.23595505617978e−001”/> <targetPrediction name=“Not-P” value=“8.76404494382023e−001”/> <SimplePredicate field=“bn_Treponema_sp._COT-198” operator=“lessOrEqual” value=“5.00000000000000e−001”/> <Node score=“Not-P”> <targetPrediction name=“P” value=“8.43373493975904e−002”/> <targetPrediction name=“Not-P” value=“9.15662650602410e−001”/> <SimplePredicate field=“bn_g_Atopobium” operator=“lessOrEqual” value=“5.00000000000000e−001”/> <Node score=“Not-P”> <targetPrediction name=“P” value=“6.25000000000000e−002”/> <targetPrediction name=“Not-P” value=“9.37500000000000e−001”/> <SimplePredicate field=“bn_Streptococcus_anginosus_COT-117” operator=“lessOrEqual” value=“5.00000000000000e−001”/> <Node score=“Not-P”> <targetPrediction name=“P” value=“5.06329113924051e−002”/> <targetPrediction name=“Not-P” value=“9.49367088607595e−001”/> <SimplePredicate field=“bn_g_Porphyromonadaceae” operator=“lessOrEqual” value=“5.00000000000000e− 001”/> <Node score=“Not-P”> <targetPrediction name=“P” value=“3.84615384615385e−002”/> <targetPrediction name=“Not-P” value=“9.61538461538462e−001”/> <SimplePredicate field=“bn_Synergistales_[G-1]_sp._COT-244” operator=“lessOrEqual” value=“5.00000000000000e−001”/> </Node> <Node score=“P”> <targetPrediction name=“P” value=“1.00000000000000e+000”/> <targetPrediction name=“Not-P” value=“0.00000000000000e+000”/> <SimplePredicate field=“bn_Synergistales_[G-1]_sp._COT-244” operator=“greaterThan” value=“5.00000000000000e−001”/> </Node> </Node> <Node score=“P”> <targetPrediction name=“P” value=“1.00000000000000e+000”/> <targetPrediction name=“Not-P” value=“0.00000000000000e+000”/> <SimplePredicate field=“bn_g_Porphyromonadaceae” operator=“greaterThan” value=“5.00000000000000e− 001”/> </Node> </Node> <Node score=“P”> <targetPrediction name=“P” value=“6.66666666666667e−001”/> <targetPrediction name=“Not-P” value=“3.33333333333333e−001”/> <SimplePredicate field=“bn_Streptococcus_anginosus_COT-117” operator=“greaterThan” value=“5.00000000000000e−001”/> </Node> </Node> <Node score=“P”> <targetPrediction name=“P” value=“6.66666666666667e−001”/> <targetPrediction name=“Not-P” value=“3.33333333333333e−001”/> <SimplePredicate field=“bn_g_Atopobium” operator=“greaterThan” value=“5.00000000000000e−001”/> </Node> </Node> <Node score=“P”> <targetPrediction name=“P” value=“1.00000000000000e+000”/> <targetPrediction name=“Not-P” value=“0.00000000000000e+000”/> <SimplePredicate field=“bn_Treponema_sp._COT-198” operator=“greaterThan” value=“5.00000000000000e−001”/> </Node> </Node> <Node score=“P”> <targetPrediction name=“P” value=“5.96774193548387e−001”/> <targetPrediction name=“Not-P” value=“4.03225806451613e−001”/> <SimplePredicate field=“bn_Peptostreptococcaceae_XI_[G-6]_sp._COT- 067” operator=“greaterThan” value=“5.00000000000000e−001”/> <Node score=“P”> <targetPrediction name=“P” value=“8.06451612903226e−001”/> <targetPrediction name=“Not-P” value=“1.93548387096774e−001”/> <SimplePredicate field=“bn_Capnocytophaga_canimorus_COT-235” operator=“lessOrEqual” value=“5.00000000000000e−001”/> </Node> <Node score=“Not-P”> <targetPrediction name=“P” value=“3.87096774193548e−001”/> <targetPrediction name=“Not-P” value=“6.12903225806452e−001”/> <SimplePredicate field=“bn_Capnocytophaga_canimorus_COT-235” operator=“greaterThan” value=“5.00000000000000e−001”/> </Node> </Node> </Node> </TreeModel> </PMML>
(120) TABLE-US-00048 Model 3 <?xml version=“1.0” encoding=“Windows-1252” ?> <PMML version=“2.0”> <Header copyright=“STATISTICA Data Miner, Copyright (c) StatSoft, Inc., www.statsoft.com.”/> <DataDictionary numberOfFields=“9”> <DataField name=“Health State” optype=“categorical”> <Value value=“H” NumericValue=“102”/> <Value value=“Not-H” NumericValue=“104”/> </DataField> <DataField name=“bn_Actinobaceria_sp._COT-376” optype=“continuous”/> <DataField name=“bn_Bacteroides_denticanoris_COT-183 (Prevotella_sp?)” optype=“continuous”/> <DataField name=“bn_Capnocytophaga_canimorsus” optype=“continuous”/> <DataField name=“bn_Lachnospiraceae_XIVa_[G-2]_sp._COT-062” optype=“continuous”/> <DataField name=“bn_Neisseria_weaveri_COT-269” optype=“continuous”/> <DataField name=“bn_Treponema_denticola_COT-197” optype=“continuous”/> <DataField name=“bn_Treponema_sp._COT-351” optype=“continuous”/> <DataField name=“bn_g_Schwartzia” optype=“continuous”/> </DataDictionary> <GeneralDiscriminantAnalysis functionName=“classification” modelName=“General discriminant analysis” modelType=“generalLinear” targetVariableName=“Health State”> <ParameterList> <Parameter name=“p1” label=“Intercept”/> <Parameter name=“p2” label=“bn_Actinobaceria_sp._COT-376”/> <Parameter name=“p3” label=“bn_Bacteroides_denticanoris_COT-183 (Prevotella_sp?)”/> <Parameter name=“p4” label=“bn_Capnocytophaga_canimorsus”/> <Parameter name=“p5” label=“bn_Lachnospiraceae_XIVa_[G-2]_sp._COT-062”/> <Parameter name=“p6” label=“bn_Neisseria_weaveri_COT-269”/> <Parameter name=“p7” label=“bn_Treponema_denticola_COT-197”/> <Parameter name=“p8” label=“bn_Treponema_sp._COT-351”/> <Parameter name=“p9” label=“bn_g_Schwartzia”/> </ParameterList> <FactorList> </FactorList> <CovariateList> <Predictor name=“bn_Actinobaceria_sp._COT-376”/> <Predictor name=“bn_Bacteroides_denticanoris_COT-183 (Prevotella_sp?)”/> <Predictor name=“bn_Capnocytophaga_canimorsus”/> <Predictor name=“bn_Lachnospiraceae_XIVa_[G-2]_sp._COT-062”/> <Predictor name=“bn_Neisseria_weaveri_COT-269”/> <Predictor name=“bn_Treponema_denticola_COT-197”/> <Predictor name=“bn_Treponema_sp._COT-351”/> <Predictor name=“bn_g_Schwartzia”/> </CovariateList> <PPMatrix> <PPCell value=“1” predictorName=“bn_Actinobaceria_sp._COT-376” parameterName=“p2”/> <PPCell value=“1” predictorName=“bn_Bacteroides_denticanoris_COT-183 (Prevotella_sp?)” parameterName=“p3”/> <PPCell value=“1” predictorName=“bn_Capnocytophaga_canimorsus” parameterName=“p4”/> <PPCell value=“1” predictorName=“bn_Lachnospiraceae_XIVa_[G-2]_sp._COT-062” parameterName=“p5”/> <PPCell value=“1” predictorName=“bn_Neisseria_weaveri_COT-269” parameterName=“p6”/> <PPCell value=“1” predictorName=“bn_Treponema_denticola_COT-197” parameterName=“p7”/> <PPCell value=“1” predictorName=“bn_Treponema_sp._COT-351” parameterName=“p8”/> <PPCell value=“1” predictorName=“bn_g_Schwartzia” parameterName=“p9”/> </PPMatrix> <Extension name=“CorrectDummyCode” value=“1”/> <Extension name=“IncorrectDummyCode” value=“−1”/> <ParamMatrix> <PCell targetCategory=“H” parameterName=“p1” beta=“− 9.75622064437969e+000”/> <PCell targetCategory=“H” parameterName=“p2” beta=“3.20989889837442e+000”/> <PCell targetCategory=“H” parameterName=“p3” beta=“1.43898462811349e+000”/> <PCell targetCategory=“H” parameterName=“p4” beta=“3.76502266494249e+000”/> <PCell targetCategory=“H” parameterName=“p5” beta=“1.37524971518131e+000”/> <PCell targetCategory=“H” parameterName=“p6” beta=“7.14727034546135e−001”/> <PCell targetCategory=“H” parameterName=“p7” beta=“1.28645669925727e+001”/> <PCell targetCategory=“H” parameterName=“p8” beta=“−8.33126809707693e− 001”/> <PCell targetCategory=“H” parameterName=“p9” beta=“−6.01000099372420e− 001”/> <PCell targetCategory=“Not-H” parameterName=“p1” beta=“− 1.19689712113546e+001”/> <PCell targetCategory=“Not-H” parameterName=“p2” beta=“5. 57825947432191e+000”/> <PCell targetCategory=“Not-H” parameterName=“p3” beta=“3.05332567144992e+000”/> <PCell targetCategory=“Not-H” parameterName=“p4” beta=“2.43051095188849e+000”/> <PCell targetCategory=“Not-H” parameterName=“p5” beta=“5.08135558741085e− 003”/> <PCell targetCategory=“Not-H” parameterName=“p6” beta=“− 1.39921917120777e+000”/> <PCell targetCategory=“Not-H” parameterName=“p7” beta=“1.53768975757821e+001”/> <PCell targetCategory=“Not-H” parameterName=“p8” beta=“7.14047368351369e− 001”/> <PCell targetCategory=“Not-H” parameterName=“p9” beta=“1.53986820729639e+000”/> </ParamMatrix> </GeneralDiscriminantAnalysis> </PMML>
(121) TABLE-US-00049 Model 4 <?xml version=“1.0” encoding=“Windows-1252” ?> <PMML version=“2.0”> <Header copyright=“STATISTICA Data Miner, Copyright (c) StatSoft, Inc., www.statsoft.com.”/> <DataDictionary numberOfFields=“7”> <DataField name=“Health State” optype=“categorical”> <Value value=“H” NumericValue=“102”/> <Value value=“Not-H” NumericValue=“104”/> </DataField> <DataField name=“pr_g_Peptostreptococcus” optype=“continuous”/> <DataField name=“pr_Treponema_sp._COT-200” optype=“continuous”/> <DataField name=“ct_Frigovirgula_sp._COT-007” optype=“continuous”/> <DataField name=“ct_g_Leucobacter” optype=“continuous”/> <DataField name=“pr_g_Odoribacter” optype=“continuous”/> <DataField name=“ct_Peptostreptococcaceae_XIII_[G-2]_sp._COT-077” optype=“continuous”/> </DataDictionary> <TreeModel functionName=“classification” modelName=“Classification and regression trees” splitCharacteristic=“binarySplit”> <MiningSchema> <MiningField name=“Health State” usageType=“predicted”/> <MiningField name=“pr_g_Peptostreptococcus”/> <MiningField name=“pr_Treponema_sp._COT-200”/> <MiningField name=“ct_Frigovirgula_sp._COT-007”/> <MiningField name=“ct_g_Leucobacter”/> <MiningField name=“pr_g_Odoribacter”/> <MiningField name=“ct_Peptostreptococcaceae_XIII_[G-2]_sp._COT-077”/> </MiningSchema> <Node score=“Not-H”> <targetPrediction name=“H” value=“3.35483870967742e−001”/> <targetPrediction name=“Not-H” value=“6.64516129032258e−001”/> <TRUE/> <Node score=“H”> <targetPrediction name=“H” value=“6.05633802816901e−001”/> <targetPrediction name=“Not-H” value=“3.94366197183099e−001”/> <SimplePredicate field=“pr_g_Peptostreptococcus” operator=“lessOrEqual” value=“3.30806684009437e−003”/> <Node score=“H”> <targetPrediction name=“H” value=“7.82608695652174e−001”/> <targetPrediction name=“Not-H” value=“2.17391304347826e−001”/> <SimplePredicate field=“pr_Treponema_sp._COT-200” operator=“lessOrEqual” value=“6.58711443509121e−005”/> <Node score=“H”> <targetPrediction name=“H” value=“8.71794871794872e−001”/> <targetPrediction name=“Not-H” value=“1.28205128205128e−001”/> <SimplePredicate field=“ct_Frigovirgula_sp._COT-007” operator=“lessOrEqual” value=“4.62000000000000e+002”/> <Node score=“H”> <targetPrediction name=“H” value=“9.69696969696970e−001”/> <targetPrediction name=“Not-H” value=“3.03030303030303e−002”/> <SimplePredicate field=“ct_g_Leucobacter” operator=“lessOrEqual” value=“2.31500000000000e+002”/> <Node score=“H”> <targetPrediction name=“H” value=“1.00000000000000e+000”/> <targetPrediction name=“Not-H” value=“0.00000000000000e+000”/> <SimplePredicate field=“pr_g_Odoribacter” operator=“lessOrEqual” value=“8.16526942392993e−003”/> </Node> <Node score=“Not-H”> <targetPrediction name=“H” value=“0.00000000000000e+000”/> <targetPrediction name=“Not-H” value=“1.00000000000000e+000”/> <SimplePredicate field=“pr_g_Odoribacter” operator=“greaterThan” value=“8.16526942392993e−003”/> </Node> </Node> <Node score=“Not-H”> <targetPrediction name=“H” value=“3.33333333333333e−001”/> <targetPrediction name=“Not-H” value=“6.66666666666667e−001”/> <SimplePredicate field=“ct_g_Leucobacter” operator=“greaterThan” value=“2.31500000000000e+002”/> </Node> </Node> <Node score=“Not-H”> <targetPrediction name=“H” value=“2.85714285714286e−001”/> <targetPrediction name=“Not-H” value=“7.14285714285714e−001”/> <SimplePredicate field=“ct_Frigovirgula_sp._COT-007” operator=“greaterThan” value=“4.62000000000000e+002”/> </Node> </Node> <Node score=“Not-H”> <targetPrediction name=“H” value=“2.80000000000000e−001”/> <targetPrediction name=“Not-H” value=“7.20000000000000e−001”/> <SimplePredicate field=“pr_Treponema_sp._COT-200” operator=“greaterThan” value=“6.58711443509121e−005”/> <Node score=“H”> <targetPrediction name=“H” value=“6.36363636363636e−001”/> <targetPrediction name=“Not-H” value=“3.63636363636364e−001”/> <SimplePredicate field=“ct_Peptostreptococcaceae_XIII_[G- 2]_sp._COT-077” operator=“lessOrEqual” value=“2.50000000000000e+000”/> </Node> <Node score=“Not-H”> <targetPrediction name=“H” value=“0.00000000000000e+000”/> <targetPrediction name=“Not-H” value=“1.00000000000000e+000”/> <SimplePredicate field=“ct_Peptostreptococcaceae_XIII_[G- 2]_sp._COT-077” operator=“greaterThan” value=“2.50000000000000e+000”/> </Node> </Node> </Node> <Node score=“Not-H”> <targetPrediction name=“H” value=“1.07142857142857e−001”/> <targetPrediction name=“Not-H” value=“8.92857142857143e−001”/> <SimplePredicate field=“pr_g_Peptostreptococcus” operator=“greaterThan” value=“3.30806684009437e−003”/> </Node> </Node> </TreeModel> </PMML>