CROSS-LINKED POLYMER MODIFIED NANOPARTICLES
20220211878 · 2022-07-07
Assignee
- OREGON HEALTH & SCIENCE UNIVERSITY (Portland, OR, US)
- PDX Pharmaceuticals, Inc. (Portland, OR, US)
Inventors
- Wassana Yantasee (Lake Oswego, OR, US)
- Worapol Ngamcherdtrakul (Portland, OR, US)
- Jingga Morry (Portland, OR, US)
- David Castro (Portland, OR, US)
- Joe William Gray (Lake Oswego, OR, US)
Cpc classification
A61K49/186
HUMAN NECESSITIES
A61K38/16
HUMAN NECESSITIES
A61K47/551
HUMAN NECESSITIES
A61K47/59
HUMAN NECESSITIES
A61K31/713
HUMAN NECESSITIES
B82Y5/00
PERFORMING OPERATIONS; TRANSPORTING
B82Y30/00
PERFORMING OPERATIONS; TRANSPORTING
A61K47/6849
HUMAN NECESSITIES
A61K47/6855
HUMAN NECESSITIES
A61K49/1857
HUMAN NECESSITIES
A61K47/60
HUMAN NECESSITIES
A61K49/0093
HUMAN NECESSITIES
A61K47/6929
HUMAN NECESSITIES
International classification
A61K31/713
HUMAN NECESSITIES
A61K38/16
HUMAN NECESSITIES
A61K47/55
HUMAN NECESSITIES
A61K47/59
HUMAN NECESSITIES
A61K47/60
HUMAN NECESSITIES
A61K47/68
HUMAN NECESSITIES
A61K47/69
HUMAN NECESSITIES
Abstract
Disclosed herein are nanoconstructs comprising a nanoparticle, coated with additional agents such as cationic polymers, stabilizers, targeting molecules, labels, oligonucleotides and small molecules. These constructs may be used to deliver compounds to treat solid tumors and to diagnose cancer and other diseases. Further disclosed are methods of making such compounds and use of such compounds to treat or diagnose human disease.
Claims
1. A composition comprising: a plurality of multilayer nanoconstructs each comprising: a silica nanoparticle, a silicon nanoparticle, a silver nanoparticle, or a carbon nanotube nanoparticle; polyethylenimine (PEI) bound to an exterior surface of the nanoparticle; and polyethylene glycol (PEG) bound to the PEI and/or to the nanoparticle; and a protein or peptide loaded on the nanoconstructs, wherein the nanoconstructs loaded with the protein or peptide have a hydrodynamic size Z-average diameter of about 200 nm or less.
2. The composition of claim 1, wherein the nanoconstructs loaded with the protein or peptide have a polydispersity index (PDI) of no more than about 0.37.
3. The composition of claim 1, wherein the PDI of the nanoconstructs loaded with the protein or peptide is about 0.2.
4. The composition of claim 1, wherein the nanoparticle is a silica nanoparticle.
5. The composition of claim 4, wherein the silica nanoparticle is a mesoporous silica nanoparticle (MSNP).
6. The composition of claim 1, wherein the nanoparticle is a silicon nanoparticle.
7. The composition of claim 1, wherein the nanoparticle is a silver nanoparticle.
8. The composition of claim 1, wherein the nanoparticle is a carbon nanotube.
9. The composition of claim 1, wherein the plurality of nanoparticles consists essentially of materials selected from the group consisting of: silica, silicon, silver, carbon nanotubes, and combinations of two or more thereof.
10. The composition of claim 1, wherein the PEI of the nanoconstructs is from about 10% to about 30% by weight of the nanoconstructs.
11. The composition of claim 1, wherein the PEI is cross-linked.
12. The composition of claim 11, wherein the PEI is cross-linked using a cleavable cross-linker.
13. The composition of claim 1, wherein the PEI has an average size of 1.8 kDa to 25 kDa.
14. The composition of claim 1, wherein the protein or peptide is conjugated to the functional PEG.
15. The composition of claim 1, wherein the protein or peptide is electrostatically bound to the PEI.
16. The composition of claim 1, wherein the nanoparticles are from about 10 nm to about 90 nm in diameter.
17. The composition of claim 1, wherein the hydrodynamic size Z-average diameter of the nanoconstructs is about 10 nm to about 200 nm.
18. The composition of claim 1, wherein the hydrodynamic size Z-average diameter of the nanoconstructs is about 50 nm to about 200 nm.
19. The composition of claim 1, wherein the hydrodynamic size Z-average diameter of the nanoconstructs is about 90 nm to about 120 nm.
20. The composition of claim 1, wherein protein or peptide is a therapeutic agent.
21. The composition of claim 20, wherein therapeutic agent comprises an antibody or an antigen-binding fragment thereof.
22. The composition of claim 21, wherein therapeutic antibody comprises a monoclonal antibody.
23. The composition of claim 1, wherein the protein or peptide comprises an antibody or an antigen-binding fragment thereof.
24. The composition of claim 1, wherein the protein or peptide comprises a scFv antibody, a monoclonal antibody, an affibody, an aptamer, a peptide, a ligand, or small targeting molecule.
25. The composition of claim 1, wherein the protein or peptide comprises a cytokine.
26. The composition of claim 1, wherein the hydrodynamic diameter of the nanoconstructs loaded with the protein or peptide is about 50 nm to about 100 nm.
27. The composition of claim 1, wherein the nanoconstructs further comprise a small molecule.
28. The composition of claim 27, wherein the small molecule comprises: a chemotherapeutic agent, an oligonucleotide, a small molecule inhibitor, or a label.
29. The composition of claim 1, wherein the plurality of nanoconstructs comprises a targeting agent.
30. The composition of claim 1, wherein the protein or peptide is a targeting agent.
31. The composition of claim 1, further comprising trehalose.
32. The composition of claim 31, wherein the trehalose is from about 1% to about 10% by weight of the plurality of nanoconstructs.
33. The composition of claim 1, further comprising a label attached to the nanoconstructs.
34. The composition of claim 33, wherein the label comprises at least one of a lanthanide, a fluorescent dye, a gold nanoparticle, a quantum dot, a PET tracer, or a MRI contrast agent.
35. A method of labeling a target, comprising contacting the composition of claim 37 with the target under conditions to bind the nanoconstruct to the target.
36. The method of claim 35, wherein the contacting occurs ex vivo.
37. The method of claim 35, wherein the contacting occurs in vivo in a subject.
38. The method of claim 35, wherein the label comprises at least one of a lanthanide, a fluorescent dye, a gold nanoparticle, a quantum dot, a PET tracer, or a MRI contrast agent.
39. The method of claim 35, further comprising: quantifying the amount of target by detecting the label after the nanoconstruct binds to the target.
40. The method of claim 35, further comprising administering the labeled nanoconstruct to a subject and detecting the location of the labeled nanoconstruct after the administering.
41. A method of delivering a protein or peptide to a site in a human or other mammalian subject, the method comprising administering an effective amount of the composition of claim 1 to the human or other mammalian subject under conditions to deliver the nanoconstruct to the site.
42. The method of claim 41, wherein the site is a cell.
43. The method of claim 42, wherein the nanoconstruct is administered under conditions that the nanoconstruct is internalized by the cell.
44. The method of claim 41, wherein the site is a tumor cell.
45. The method of claim 41, wherein the protein or peptide is capable of modulating expression of a target protein.
46. The method of claim 41, wherein the subject is diagnosed with cancer or diagnosed with or is at risk for fibrosis or inflammation, and the effective amount is a therapeutically effective amount.
47. The method of claim 41, wherein the nanoconstruct further comprises a targeting agent.
48. The method of claim 41, wherein administration of the composition reduces reactive oxygen species, bioavailable copper, and/or NOX expression level in the subject or modulates an adverse effect of one or more cytokines.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
REFERENCE TO SEQUENCE LISTING
[0110] The nucleic acid sequences described herein are shown using standard letter abbreviations, as defined in 37 C.F.R. § 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included in embodiments where it would be appropriate. A computer readable text file, entitled “2MU0877.txt (Sequence Listing.txt)” created on or about Jan. 27, 2022, with a file size of 4 KB, contains the sequence listing for this application and is hereby incorporated by reference in its entirety.
DETAILED DESCRIPTION
[0111] Described herein are nanoconstructs for the treatment or diagnosis of disease including cancer, inflammation and fibrosis. The nanoconstruct contains a nanoparticle, such as a mesoporous silica nanoparticles (MSNP), a gold nanoparticle, a silver nanoparticle, an iron oxide nanoparticle, or a carbon nanotube, optionally loaded with a variety of additional agents including, but not limited to, cationic polymers, stabilizers, targeting agents, small molecules or proteins, labels, and/or oligonucleotides. Combinations of various additional agents are also contemplated. For example, the nanoconstruct includes a cationic polymer, stabilizer, targeting agent, and small molecule, label, and/or oligonucleotide. Nanoconstructs may also include more than one type of cationic polymer, stabilizer, targeting agent, small molecule, protein, label, and/or oligonucleotide. For example, nanoconstructs may include multiple, different oligonucleotides and/or small molecules or proteins that act on the same or different targets. The use of such additional agents may provide an additive or synergistic effect for disease treatment when delivered together on a nanoconstruct.
Nanoparticles
[0112] Nanoparticles useful with the compositions and methods of the invention include, without limitation, mesoporous silica nanoparticles (e.g., MSNPs), iron oxide nanoparticles, silver nanoparticles, gold nanoparticles, and carbon nanotubes. Nanoparticles may or may not be porous. Exemplary sizes for the nanoparticle cores are from about 5 nm to about 200 nm, about 5 to about 20 nm, about 30 nm to about 100 nm, about 30 nm to about 80 nm, about 30 nm to about 60 nm, about 40 nm to about 80 nm, about 70 nm to about 90 nm, or about 5 nm, about 10 nm, about 20 nm, about 30 nm, about 40 nm, about 50 nm, about 60 nm, about 70 nm, about 80 nm, about 90 nm, or about 100 nm. Generally, the nanoparticle cores are spherical, although other shapes, such as rods and discs, may also be used.
[0113] Additional components may be attached to nanoparticles by various mechanisms, covalently or noncovalently. For example, cationic polymers may be attached to nanoparticles by charge, e.g., for silica or iron oxide nanoparticles. Alternatively, the surfaces of the nanoparticles may be altered to include reactive moieties for conjugation to cationic polymers and/or other components, or the cationic polymers or other components may include a moiety that binds to the nanoparticles. For example, nanoparticle cores such as silica, silicon, gold, iron oxide, and silver nanoparticles, as well as carbon nanotubes, may be modified with reactive moieties such as thiols, phosphonate, carboxylate, and amines prior to attachment with cationic polymers and other components. Cationic polymers and other components may be modified to include these or other moieties, including but not limited to, maleimide, N-hydroxy succinimidyl (NHS) esters, or azides, prior to binding to the nanoparticle cores. Components may be attached directly to nanoparticles, either on the surface or within pores if present.
Cationic Polymers
[0114] In some embodiments, nanoparticles, such as MSNPs, are coated with cationic polymers or other compounds. The cationic polymer may bind to the surface of the nanoparticle using any appropriate means. In some embodiments, the cationic polymer binds to the nanoparticle via electrostatic interaction. The cationic polymer may be any polymer with a positive charge, such as, but not limited to, polyethylenimine (PEI) (see, e.g., Example III), polyamidoamine, poly(allylamine), poly(diallyldimethylammonium chloride), chitosan, poly(N-isopropyl acrylamide-co-acrylamide), poly(N-isopropyl acrylamide-co-acrylic acid), poly(L-lysine), diethylaminoethyl-dextran, poly-(N-ethyl-vinylpyridinium bromide), poly(dimethylamino)ethyl methacrylate), or poly(ethylene glycol)-co-poly(trimethylaminoethylmethacrylate chloride). Other cationic polymers will be apparent to those of skill in the art, and may be found, for example, in Polymer Handbook, 4th Edition, Edited by: Brandrup, E. H. Immergut, and E. A. Grukle; John Wiley & Sons, 2003).
[0115] The cationic polymers may be linear or branched. In some embodiments, the cationic polymers may range in size from about 500 Da to 25 kDa and may be branched or linear. For example, branched PEI with an average size of 1.8 kDa to 10 kDa may be loaded onto the nanoparticle core. The ratio of cationic polymer to nanoparticle may be varied depending on the desired result. The cationic polymer may be present from 1 to 50 wt. % of polymer per nanoconstruct, e.g., 5 to 40, 10 to 30%, 20 to 30%, 5 to 15%, 5 to 20%, 5 to 25%, 5 to 30%, 10 to 20%, 10 to 25%, or 25 to 40%, e.g., about 5, 10, 15, 20, 25, 30, or 35%. For example, as shown in Example III, PEI per MSNP at a weight ratio of 1:4 during initial coating and at a weight ratio of 1:4 during cross-linking resulted in 14 wt. % PEI per nanoconstruct if 10-kDa PEI was used or 16 wt. % if 1.8-kDa PEI was used (see, e.g., Table 5).
[0116] Endolysosomal escape and gene silencing efficacy is increased by increasing buffering capacity of the nanoparticles. Cross-linking the cationic polymers yields greater buffering capacity as shown in
Stabilizers
[0117] A stabilizer may be conjugated to the nanoparticle and/or the cationic polymer, e.g., by any appropriate means. In some embodiments, a stabilizer is conjugated to an amine or other reactive group of a cross-linked cationic polymer coated on the nanoparticle (e.g., a MSNP). Exemplary stabilizers include, but are not limited to, polyethylene glycol (PEG), dextran, polysialic acid, hyaluronic acid (HA), polyvinyl pyrrolidone (PVP), polyvinyl alcohol (PVA), and polyacrylamide (PAM).
[0118] Stabilizers may have multiple chemically reactive groups, e.g., for attachment to the nanoparticle, cationic polymer, and/or other component. For example (e.g., Example IV), reactive stabilizer, e.g., PEG, derivatives may have two electrophilic moieties, such as maleimide-PEG-N-hydroxysuccinimidyl ester (Mal-PEG-NHS), which contains both a Michael acceptor and an activated ester. The stabilizer, e.g., PEG, used in conjunction with the compositions and methods of the invention generally has a molecular weight ranging between 500 Da-40 kDa, e.g., 2-10 kDa as shown in
Labeling Agents
[0119] In some embodiments, the nanoconstruct may be labeled, e.g., with a lanthanide or fluorescent dye, e.g., as shown in Example XXIV and
[0120] In some embodiments, the labels, such as fluorescent dyes, may be loaded inside the pores of nanoparticles, e.g., amine-MSNPs via nucleophilic acyl substitution, e.g., between one or more nanoparticle-bound amines and an activated ester moiety (such as an NHS ester) appended to a fluorescent dye. Such labels produce nanoconstructs for fluorescence imaging applications as shown in
Targeting Agents
[0121] The nanoconstruct may be delivered specifically or non-specifically. Nanoconstructs may be delivered to a site, e.g., for therapy, analysis, or diagnosis, such as a cell or tissue. The site may be in vivo or ex vivo. In some embodiments, the nanoconstructs may be delivered to tumors via the leaky vasculature of tumors. In some embodiments, the affinity of the cell or tissue, e.g., tumors, for cationic particles may permit nanoconstructs endowed with a positive charge due to the presence of cationic polymers to accumulate at the site, e.g., tumors and disease sites (see, e.g.,
[0122] Exemplary targeting agents include, but are not limited to, monoclonal antibodies, single chain variable fragment (scFv) antibodies, other antigen binding fragments of antibodies, aptamers, small targeting molecules (e.g., ligands that bind to cell surface receptors such as N-acetylgalactosamine, mannose, transferrin, and folic acid), aptamers, carbohydrates, and peptides that have binding affinity to a cell or tissue, e.g., a tumor. The targeting agents may be attached to the nanoparticles, cationic polymer, or stabilizer by any appropriate means. In some embodiments, the targeting agents are trastuzumab (
[0123] The targeting agents may be attached to the nanoconstructs by any means, and suitable conjugation chemistries are known in the art and described herein. In some embodiments (e.g., Example V), the targeting agent is thiolated and subsequently conjugated with Mal-PEG-PEI-MSNP via a thiol-maleimide reaction. In some embodiments (e.g., Example V), the targeting agents are first attached to the PEG stabilizer (e.g., FA or transferrin on PEG-NHS, commercially available) prior to conjugation to the nanoparticle by reaction of an NHS ester and an amine. The targeting agent may be present from 0.1 to 10 wt. % of targeting agent per nanoconstruct, e.g., 0.1 to 1 % or 1 to 5%, e.g., 1 to 10% for antibody or 0.1 to 2% for scFV, e.g., about 1, 2,3, 4, 5, 6, 7, 8, or 9%. For example, the MSNP per trastuzumab may be at the weight ratio of 50:1 to 1:1 (as shown in
Small Molecules and Proteins
[0124] In some embodiments, the nanoconstruct may be loaded with small molecules, proteins (i.e., other than targeting agents), or other therapeutic agents. Small molecules are molecules, typically with a molecular weight less than about 1000 Daltons, or in some embodiments, less than about 500 Daltons, wherein the molecule is capable of modulating, to some measurable extent, an activity of a target molecule. Exemplary small molecules such as peptides, small molecule inhibitors, chemotherapeutics, and other drugs may increase the therapeutic effects of the nanoconstruct, e.g., as shown in
[0125] In some embodiments, chemotherapeutic agents such as paclitaxel, docetaxel, and doxorubicin may be loaded on nanoconstructs by hydrogen bonding with nanoparticle, e.g., MSNP, surface moieties (e.g., hydroxyl or silanol) and/or cationic polymer, e.g., PEI. Hydrophobic drugs (e.g., paclitaxel and docetaxel) can be loaded on the nanoconstructs during or after cationic polymer coating, e.g., with PEI in ethanol, while hydrophilic drugs (e.g., doxorubicin) can be loaded on the nanoconstructs after stabilizer coating, e.g., PEG, in PBS. The small molecule may be present from 0.01 to 50 wt. % of small molecule per nanoparticle, e.g., 0.1 to 30%, 1 to 30%, 1 to 20%, 1 to 10%, 1 to 5%, 0.1 to 1%, 0.5 to 5%, or 0.5 to 10%. For example, small molecule per MSNP is used at a weight ratio of 1:10 to 1:1, which results in 0.1 to 30% by weight of drug per nanoconstruct.
[0126] Exemplary chemotherapeutic agents include, but are not limited to, methotrexate; plicamycin (mithramycin); mitotane; mercaptopolylysine; pyrimidine analogs such as fluorouracil; anthracyclic antibiotics such as doxorubicin; maytansinoids such as ansamitocin; D-arabinosyl nucleosides, such as arabinosyl adenine; alkylating agents such as PAM, I-PAM, altretamine, procarbazine, busulfan, dacarbazine, temozolomide, thiotepa and dacarbazine; purine antagonists such as mercaptopurine; actinomycins such as dactinomycin; mitomycins such as mitomycin C; anti-steroids such as aminoglutethimide; anti-microtubules such as estramustine and vinblastine; anti-androgens such as flutamide; GnRH analogs such as leuprolide; megestrol acetate; estrogen receptor antagonists such as tamoxifen; amsacrine (m-AMSA); asparaginase (I-asparaginase); topoisomerase inhibitors such as etoposide (VP-16); cytokines such as interferon α-2a and interferon α-2b; podophyllotoxin derivatives such as teniposide (VM-26); arabinosyl cytosine; nitrogen mustards such as chlorambucil, cyclophosphamide, uramustine, ifosfamide, melphalan, bendamustine, mustine, and melphalan; nitrosoureas such as carmustine, fotemustine, lomustine, streptozocin, and semustine; platinum based anti-neoplastic agents such as carboplatin, cisplatin, triplatin tetranitrate and oxaliplatin; folate antimetabolites such as pemetrexed, raltitrexed, edatrexate, denopterin and cladribine; nucleoside analogs such as gemcitabine; purine nucleoside antimetabolites such as clofarabine; antimetabolites such as (N-((5-(((1,4-dihydro-2-methyl-4-oxo-6-quinazolinyl) methyl) methylamino)-2-thienyl)carbonyl)-L-glutamic acid); glutamine antagonists such as 6-diazo-5-oxo-L-norleucine; purine analogs such as fludarabine and thioguanine; prodrugs such as capecitabine and methyl aminolevulinate; mitotic inhibitors such as vincristine, vinorelbine, and vindesine; anthracyclines such as daunorubicin, doxorubicin, epirubicin, valrubicin, and idarubicin; anthracenediones such as mitoxantrone; glycopeptide antibiotics such as bleomycin; TNF inhibitors such as etanercept; aminolevulinic acid; tyrosine kinase inhibitors such as dasatinib, imatinib, nilotinib, lapatinib, neratinib, and erlotinib; epidermal growth factor receptor inhibitors such as gefitinib; protein kinase inhibitors such as sunitinib and vandetanib; platelet reducing agents such as anagrelide; proteasome inhibitors such as bortezomib; denileukin diftitox; pentostatin; pegaspargase; alagebrium (3-phenacyl-4,5-dimethylthiazolium; aminophylline; muramyl tripeptide; and mifamurtide. Other therapeutic agents are known in the art.
Oligonucleotides
[0127] In some embodiments one or more oligonucleotides may be attached to the nanoconstruct including, but not limited to, siRNA, miRNA, miRNA mimics, or antisense oligomers. Typically, the oligonucleotides will be capable of altering, e.g., reducing, expression of a target protein, e.g., by RNAi or antisense effect. Alternatively, the oligonucleotide may act as a probe in a cell or tissue of interest. Exemplary oligonucleotides include, but are not limited to, oligonucleotides that silence the expression of PLK1, AKT1/BCL2, HER2, EPS8L1, or HSP47 such as siPLK1, siAKT1/BCL2, siHER2, siEPS8L1, siHSP47, or miR-342-5P (see, e.g., Example XII and XX). Other targets are described herein. The oligonucleotide may be attached by any means. In some embodiments, the negatively charged siRNA is attached to the positively charged cationic polymer on the nanoparticle, e.g., MSNP, using an electrostatic interaction. The oligonucleotides may target one or more genes expressed in a cancer cell, such as one or more genes encoding a protein that promotes cell growth, tumor vascularization, or escape from apoptosis. In some embodiments, a single oligonucleotide may target a plurality of genes with varying potency. In other embodiments, a plurality of oligonucleotides may target a single gene. In further embodiments, a plurality of oligonucleotides may target a plurality of genes.
[0128] Oligonucleotides may be present from about 1% to 10% by weight, e.g., about 2% to about 4% by weight. For example, MSNP per siRNA (NP/siRNA) is used at the weight ratio ranging between about 10:1 to about 100:1 during the binding process, achieving complete binding. Optimal gene knock down efficacy is achieved at NP/siRNA of 25-50 as shown in
[0129] Exemplary siRNA sequences used herein are siHER2, siAKT1/BCL2, siRNA control designated siSCR, and a siRNA against luciferase designated siLUC. Specific sequences are shown in Table 1.
TABLE-US-00001 Table 1 Exemplary siRNA sequences SiRNA siRNA sequence siHER2 Sense: 5′ CACGUUUGAGUCCAUGCCCAAUU 3′ (SEQ ID NO. 1) Antisense: 5′ UUGGGCAUGGACUCAAACGUGUU 3′ (SEQ ID NO. 2) siLUC Sense: 5′ CGGAUUACCAGGGAUUUCAtt 3′ (SEQ ID NO. 3) Antisense: 5′ UGAAAUCCCUGGUAAUCCGtt 3′ (SEQ ID NO. 4) siSCR Sense: 5′ UGGUUUACAUGUCGACUAA 3′ (SEQ ID NO. 5) Antisense: 5′ UUAGUCGACAUGUAAACCA 3′ (SEQ ID NO. 6) siAKT1/ Anti-Akt1: BCL2 5′ AUUCAGUUUCACAUUGCUUGGUGAC 3′ (SEQ ID NO. 7) Anti-Bcl2: 5′ GUCACCAAGAACUGUGACACAGAAGGG 3′ (SEQ ID NO. 8)
[0130] The exemplary siHER2 was selected by measuring the efficacy and specificity with which it reduced HER2 mRNA levels and growth in HER2.sup.+ cell lines but not HER2.sup.− cell lines. The dose of the siHER2 required to inhibit cell growth by 50% (GI50) was <5 nM in 19 out of 20 HER2+ cell lines (14 out of 20 cells did not respond to 30 μg/ml trastuzumab).
[0131] The exemplary siHER2 selected was bound to MSNP-PEI-PEG-Trastuzumab (T-NP) to create a nanoconstruct. The construct increases siRNA protection against enzymatic degradation in blood (
Nanoconstruct Synthesis
[0132] Components may be bound to nanoparticles or other components by any means including covalent and electrostatic binding. Various conjugation chemistries are known in the art and described herein. In some embodiments, one or more of the components are bound to the surface of the nanoparticles. In other embodiments, one or more of the components are bound within the pores of the nanoparticle (e.g., MSNP). In further embodiments, one or more of the components are bound to each other. For example, in some embodiments, a targeting agent may be covalently bound to a stabilizer, which is covalently bound to the cationic polymer (e.g., via an amine), which is in turn electrostatically bound to the exterior of the nanoparticle, and a small molecule is bound to the interior surface of a pore. In some embodiments, the pore has a first opening at a first location on the exterior surface of the nanoparticle (e.g., MSNP) and a second, different opening at a second location on the exterior surface of the nanoparticle. Additional components may be bound anywhere along the length of the inside of the pore.
[0133] While nanoparticles, such as MSNPs, may be acquired commercially or created by any method, in some embodiments MSNPs are formed by combining a first surfactant with a second, different surfactant to form a first mixture, heating up the first mixture and adding a silica precursor to the first mixture to form a second mixture, holding the temperature for a period of time to generate MSNPs, and recovering the MSNPs by centrifugation. Surfactants can be removed by mixing the MSNP in acidic solvent under reflux conditions. In some embodiments, the first mixture may be heated prior to adding the silica precursor. In other embodiments, the first mixture may be at room temperature and the second mixture may be heated. The resulting MSNPs may have uniform or non-uniform particle size with high porosity, e.g., as shown in
[0134] For example, to form uniform MSNPs, cetyltrimethylammonium chloride (CTAC) may be combined with triethanolamine (TEA) in water, and heated to 95° C., while tetraethyl orthosilicate is added as shown in Example I. Variation of the amount of TEA while holding the amount of CTAC constant can be used to alter the size of the resulting MSNPs. In some embodiments, the amount of TEA is between about 100 to about 600 μL, about 200 to about 450 μL, or about 200 to about 350 μL. Non-uniform MSNPs may be created using a strong base, such as NaOH. For example, cetyltrimethyl ammonium bromide (CTAB) may be used as the surfactant and NaOH may be used as the base catalyst as shown in Example II.
[0135] Iron oxide nanoparticles can be purchased (e.g., Feraheme) or synthesized, e.g., as described in Example XXV. Gold and silver nanoparticles can be synthesized following various published protocols or purchased from vendors such as Sigma Aldrich, Nanocs, nanoComposix. Carbon nanotubes can be synthesized following various published protocols or purchased from vendors such as Sigma Aldrich, US Research nanomaterial, and American Elements.
[0136] In some embodiments, functional groups such as, but not limited to, thiol, amine, carboxylate, or phosphonate may be added to the nanoparticles, e.g., MSNPs, during synthesis through the use of one or more reagents, e.g., organosilanes such as, but not limited to, (3-aminopropyl)triethoxysilane and (3-aminopropyl)trimethoxysilane). Organosilanes may be added before or after the surfactants are removed from the MSNPs. Analogous reagents and other organic reagents, such as glutathione, mercaptopropionic acid, DMSA, PEG-thiol, oleic acid, and dextran may be employed to modify iron oxide nanoparticles, silver nanoparticles, gold nanoparticles, and carbon nanotubes. Functionalized nanoparticles can also be purchased directly, e.g., carbon nanotubes having surface modified with carboxylic acid, amide, polyaminobenzene sulfonic acid, octadecylamine, and PEG can be purchased from Sigma Aldrich.
[0137] The resulting nanoparticles, e.g., MSNPs after surface modification, may be of any appropriate size, e.g., from about 20 nm to about 200 nm, about 30 nm to about 100 nm, about 40 nm to about 200 nm, about 50 nm to about 200 nm, about 30 nm to about 80 nm, 40 nm to about 80 nm, about 30 nm, about 40 nm, about 30 nm to about 60 nm, about 50 nm, or about 60 nm. Exemplary hydrodynamic sizes are shown in
Nanoconstruct Formulations and Methods of Use
[0138] Nanoconstructs may be formulated, as is known in the art, for therapeutic, diagnostic, or research use. Typically, such formulations for therapy or diagnosis include the nanoconstructs suspended in a pharmaceutically acceptable carrier. Nanoconstructs may be employed for in vivo or ex vivo use. Effects of the agents contained in the nanoconstruct may occur intracellularly or extracellularly. In particular, nanoconstructs may be employed to deliver oligonucleotides to cells to modulate, e.g., reduce, expression of a gene. Nanoconstructs may also be employed to delivery labels or other agents intracellularly or within an extracellular site.
[0139] The nanoconstructs may be used immediately upon formulation or may be stored. In some embodiments, the nanoconstructs may be lyophilized into dry states using a lyoprotectant, such as a sugar like trehalose. Optimal trehalose and lyophilization conditions may preserve the nanoconstruct in terms of particle size and charge (
[0140] Effective amounts of a nanoconstruct for therapeutic administration will be readily determined by those of ordinary skill in the art, depending on clinical and patient-specific factors.
[0141] These and other effective unit dosage amounts may be administered in a single dose, or in the form of multiple daily, weekly or monthly doses, for example in a dosing regimen of twice per week for a 3 week cycle. In additional embodiments, dosages may be administered in concert with other treatment regimens in any appropriate dosage regimen depending on clinical and patient-specific factors. The amount, timing and mode of delivery of compositions of the invention comprising a disease treating effective amount of a nanoconstruct will be routinely adjusted on an individual basis, depending on such factors as weight, age, gender, and condition of the individual, the acuteness of the disease and/or related symptoms, whether the administration is prophylactic or therapeutic, and on the basis of other factors known to effect drug delivery, absorption, pharmacokinetics including half-life, and efficacy.
[0142] Formulations of the invention will ordinarily be selected to approximate a minimal dosing regimen that is necessary and sufficient to substantially prevent or alleviate the symptoms of the disease including cancer, fibrosis and inflammation in the mammalian subject, including humans. Therapeutic dosage and administration protocol will often include repeated dosing over a course of several days or even one or more weeks or years. An effective treatment regimen may also involve prophylactic dosage administered on a day or multi-dose per day basis lasting over the course of days, weeks, months or even years.
[0143] The compositions of the present invention may further include a pharmaceutically acceptable carrier appropriate for the particular mode of administration being employed. Dosage forms of the compositions of the present invention include excipients recognized in the art of pharmaceutical compounding as being suitable for the preparation of dosage units as discussed above. Such excipients include, without intended limitation, binders, fillers, lubricants, emulsifiers, suspending agents, sweeteners, flavorings, preservatives, buffers, wetting agents, disintegrants, effervescent agents and other conventional excipients and additives and/or other additives that may enhance stability, delivery, absorption, half-life, efficacy, pharmacokinetics, and/or pharmacodynamics, reduce adverse side effects, or provide other advantages for pharmaceutical use.
[0144] Some nanoconstructs of the invention are designed for parenteral administration, e.g. to be administered intravenously, intramuscularly, intratumorally, subcutaneously, or intraperitoneally, including aqueous and non-aqueous sterile injectable solutions which, like many other contemplated compositions of the invention, may optionally contain anti-oxidants, buffers, bacteriostats and/or solutes which render the formulation isotonic with the blood of the mammalian subject; and aqueous and non-aqueous sterile suspensions which may include suspending agents and/or thickening agents. The formulations may be presented in unit-dose or multi-dose containers. Additional compositions and formulations of the invention may include polymers for extended release following parenteral administration. The parenteral preparations may be solutions, dispersions or emulsions suitable for such administration. The subject agents may also be formulated into polymers for extended release following parenteral administration. Pharmaceutically acceptable formulations and ingredients will typically be sterile or readily sterilizable, biologically inert, and easily administered. Such materials are well known to those of ordinary skill in the pharmaceutical compounding arts. Parenteral preparations typically contain buffering agents and preservatives, and injectable fluids that are pharmaceutically and physiologically acceptable such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like. Extemporaneous injection solutions, emulsions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described. Preferred unit dosage formulations are those containing a daily dose or unit, daily sub-dose, as described herein above, or an appropriate fraction thereof, of the active ingredient(s).
[0145] In some embodiments, the topical carrier used to deliver the nanoconstruct is an emulsion, gel or ointment. In other embodiments, the therapeutic compounds as described herein may be formulated in a spray formulation.
[0146] Emulsions, such as creams and lotions are a dispersed system comprising at least two immiscible phases, one phase dispersed in the other as droplets ranging in diameter from 0.1 μm to 100 μm. An emulsifying agent is typically included to improve stability. When water is the dispersed phase and an oil is the dispersion medium, the emulsion is termed a water-in-oil emulsion. When an oil is dispersed as droplets throughout the aqueous phase as droplets, the emulsion is termed an oil-in-water emulsion. Emulsions, such as creams and lotions that can be used as topical carriers and their preparation are disclosed in Remington: The Science and Practice of Pharmacy (Loyd V. Allen 22.sup.nd ed. 2012), hereby incorporated herein by reference.
[0147] Ointments may be homogeneous, viscous, semi-solid preparation, most commonly a greasy, thick oil (oil 80%-water 20%) with a high viscosity. The ointment can be used as an emollient or for the application of active ingredients to the skin for protective, therapeutic, or prophylactic purposes where a degree of occlusion is desired.
[0148] A cream is an emulsion of oil and water in approximately equal proportions. It penetrates the stratum corneum outer layer of skin quite well. Cream is generally thinner than ointment, and maintains its shape when removed from its container.
[0149] The vehicle of an ointment/cream is known as the ointment base. The choice of a base depends upon the clinical indication for the ointment. The different types of ointment bases include, but are not limited to: hydrocarbon bases, e.g. hard paraffin, soft paraffin, microcrystalline wax and ceresine; absorption bases, e.g. wool fat, beeswax; Water soluble bases, e.g., macrogols 200, 300, and 400; Emulsifying bases, e.g. emulsifying wax, Vegetable oils, e.g. olive oil, coconut oil, sesame oil, almond oil and peanut oil. The therapeutic compounds are dispersed in the base and later get divided after the drug penetrates into the wound. Ointments/creams can be formulated incorporating hydrophobic, hydrophilic, or water-emulsifying bases to provide preparations that are immiscible, miscible, or emulsifiable with skin secretions. They can also be derived from fatty hydrocarbon, absorption, water-removable, or water-soluble bases. For example, a cream/ointment base can contain the active agent, white petrolatum, water, allantoin, EDTA, Stearyl alcohol, Brij 721, Brij 72, methylcelluloses, isopropyl myristate, Sorbitan monooleate, Polyoxyl 40 stearate, butylated hydroxytoluene, propylene glycol, methylparaben, propylparaben, deionized water to 100%, and buffer to neutral pH among other ingredients.
[0150] In another embodiment, the topical carrier used to deliver a compound of the invention is a gel, for example, a two-phase gel or a single-phase gel. Gels are semisolid systems consisting of suspensions of small inorganic particles or large organic molecules interpenetrated by a liquid. When the gel mass comprises a network of small discrete inorganic particles, it is classified as a two-phase gel. In some embodiments the liquid may be water or another aqueous media and the gel mass is defined as a hydrogel. Hydrogels can include, but are not limited to, alginates, polyacrylates, polyalkylene oxides, and/or poly N-vinyl pyrrolidone. The hydrogel may also be amorphous, i.e. a viscous gel as opposed to a solid such as a formulation of carboxymethylcellulose containing a humectant such as propylene glycol or glycerin. Exemplary amorphous hydrogels include, but are not limited to, maltodextra-beta glucan, acemannan, carboxymethylcellulose, pectin, xanthan gum, collagen, keratin and honey.
[0151] Nanoconstructs may be packaged into biodegradable capsules for oral administration. Alternatively, a nanoconstruct suspension may be installed inside the bladder. This is similar to intravesical chemotherapy, in which the drug administered to the bladder will come into direct contact with cancer cells in the bladder lining.
[0152] The invention disclosed herein will also be understood to encompass diagnostic compositions for diagnosing the risk level, presence, severity, or treatment indicia of, or otherwise managing diseases including, but not limited to, neoplastic diseases by contacting a labeled (e.g., isotopically labeled, fluorescent labeled or otherwise labeled to permit detection of the labeled compound using conventional methods) nanoconstruct to a mammalian subject (e.g., to a cell, tissue, organ, or individual) at risk or presenting with one or more symptom(s) of a cell proliferation disease, such as a cancer, and thereafter detecting the presence, location, metabolism, and/or binding state (e.g., detecting binding to an unlabeled binding partner involved in malignant cell receptor physiology/metabolism) of the labeled compound using any of a broad array of known assays and labeling/detection methods. In exemplary embodiments, a nanoconstruct is isotopically-labeled by having one or more atoms replaced by an atom having a different atomic mass or mass number. Examples of isotopes that can be incorporated into the disclosed compounds include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, fluorine and chlorine, such as .sup.2H, .sup.3H, .sup.13C, .sup.14C, .sup.15N, .sup.18O, .sup.17O, .sup.31p, .sup.32P, .sup.35S, .sup.18F, and .sup.36Cl, respectively. The isotopically-labeled compound is then administered to an individual or other subject and subsequently detected as described above, yielding useful diagnostic and/or therapeutic management data, according to conventional techniques.
[0153] Nanoconstructs may include various therapeutic moieties, such as targeting agents, oligonucleotides, and/or small molecules, and may have intrinsic therapeutic properties. For example, in some embodiments the nanoconstruct (e.g., a nanoconstruct containing a MSNP) may be an antioxidant. The antioxidant nanoconstruct can deliver siRNA that can reduce pro-fibrotic genes such as HSP47 and NOX4 as shown in
[0154] Nanoconstructs containing a lanthanide and/or a fluorescent dye may be used as fluorescent, mass spectrometry, PET, and/or MRI probes for both in vitro and in vivo applications. In vitro, such nanoconstructs can be used to detect or quantify target proteins in tissue specimens or cells by immunofluorescence, flow cytometry, or mass cytometry (see, e.g., Example XXIV). In these applications, the targeting agents on the nanoconstruct will bind specifically with the protein receptors on the cells (e.g., EGFR or HER2 on cancer cells). In vivo, the nanoconstructs labeled with PET tracers, gadolinium chelates, or containing an iron oxide nanoparticle core can be used as PET or MRI contrast agents (see, e.g., Example XXVI) to detect diseases (e.g., cancer or inflammation). Additionally, nanoconstructs can be transfected into cells of interest (e.g., stem cells or immune cells) before such cells are infused to patients. This allows monitoring of these nanoconstruct-contained cells over time by non-invasive methods, such as fluorescence imaging, PET, and MRI.
[0155] Nanoconstructs made from iron oxide, gold, and silver nanoparticles can be used in hyperthermia treatment. Alternating magnetic fields and irradiation have been shown to heat up such nanoparticles, increasing temperature of tumors (e.g., up to 40° C.) in which the nanoconstructs are accumulated. This can enhance cargo release and/or induce cancer cell death.
[0156] The intrinsic properties of the nanoconstructs may have therapeutic benefits for cancer treatment. For example, in some embodiments, the antioxidant property of the nanoconstruct (from MSNP) may modulate reactive oxygen species in cancer cells, resulting in decreased migration and invasion of cancer cells (see, e.g.,
[0157] Additionally, amine groups, e.g., from PEI on nanoconstructs, are known to be highly effective chelators of copper. Copper is believed to be a cofactor for angiogenesis and hence metastasis in cancer (Brewer et al., 2000). Thus, the PEI-nanoconstruct may provide a therapeutic benefit similar to that observed for tetrathiomolybdate (TM, a copper chelator) in its clinical trial on metastatic solid tumor patients (Brewer et al, 2000). In this trial, five out of six TM-treated patients had mild copper deficiency (e.g. as assessed on the basis of a lower serum concentration of ceruloplasmin, a biomarker for total body copper status) and achieved stable disease. We also observed reduced serum ceruloplasmin in agreement with attenuated cancer metastasis and tumor burden with our nanoconstruct (see, e.g., Example XXIII).
[0158] In addition to cancer and fibrosis, the nanoconstructs are capable of delivering oligonucleotides to cells to alter gene expression (e.g., via RNA interference) and can thus also be used to treat other diseases involving aberrant gene expression. Exemplary siRNAs that can be incorporated into nanoconstructs of the invention may target genes listed in Table 2, e.g., to treat the corresponding diseases shown therein.
TABLE-US-00002 TABLE 2 Exemplary diseases that can be treated by gene modulation Category Diseases siRNA target Ophthalmology AMD VEGF, RTP801, VEGF-R1 macular edema VEGF, RTP801 chronic optic nerve proNGF atrophy Genetic pachyonychia Keratin K6A disorder congenita (genetic disease) Oncology chronic lymphocytic Bcl-2 leukemia metastatic lymphoma PLK1, LMP2, LMP7, MECL1 solid tumors HER2, AKT1, AKT1, Bcl-2, AR, Myc, EGFR, Grb7, EPS8L1, RRM2, PKN3, Survivin, HIF1a, Furin, KSP, VEGF, eiF-4E Inflammation acute kidney injury p53 delayed graft function p53 familia adenomatous b-catenin polyposis Metabolic Hypercholestrolemia ApoB, PCSK9 disease Fibrosis liver fibrosis HSP47 cystic fibrosis CFTR Dermatology dermal scarring and CTGF, HSP47 fibrosis Viral Infection Ebola infection SNALP RSV infection RSV nucleocapsids Immunotherapy Cancer CD47, PD-L1, CTLA-4
[0159] The nanoconstructs may be used in the treatment of cancer, e.g., breast cancer. In some embodiments, the tumors may be resistant to monoclonal antibodies, small molecule inhibitors, and/or other chemotherapeutic agents, but still respond to siRNA delivered by nanoconstructs. In further embodiments, the siRNA targets the same genes/proteins that monoclonal antibodies and small molecule inhibitors target, but gene/protein suppression with siRNA is superior to that of antibodies or small molecule inhibitors and overcomes cancer resistance to the antibodies and small molecule inhibitors (see, e.g., Example XIII).
[0160] In some embodiments, more than one therapeutic agent may be used to increase effectiveness of the nanoconstruct. For example,
[0161] As used herein, the terms “treat,” treating,” “treatment,” “therapeutic” and the like refer to reducing or ameliorating a disorder and/or symptoms associated therewith. It will be appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition or symptoms associated therewith be completely eliminated.
[0162] By “effective amount” is meant the amount of an agent required to ameliorate the symptoms of a disease or arrest the progression of a disease relative to an untreated subject or to label a target, e.g., protein, cell, or tissue, sufficiently for detection. The effective amount of an active therapeutic agent for the treatment of a disease or injury varies depending upon the manner of administration, the age, body weight, and general health of the subject.
[0163] Various assays and model systems can be readily employed to determine the therapeutic effectiveness in the treatment of cancer, inflammation, fibrosis and other diseases. For example, effectiveness may be demonstrated using a complete blood count (CBC). The measurements taken in a CBC include a white blood cell count (WBC), a red blood cell count (RBC), the red cell distribution width, the hematocrit, and the amount of hemoglobin. Some signs of cancer which are visible in a CBC include a low hematocrit, a sharp decrease in the number of blood platelets, and a low level of neutrophils. An effective amount of a composition of the present invention may increase the levels measured in a complete blood count by 10%, 20%, 30%, 50% or greater increase, up to a 75-90%, or 95% or greater in comparison to individuals who have not been treated by the compositions described herein. The compositions as described herein may be effective in increasing all or some parts of the complete blood count in comparison to those treated with placebo. Effective amounts may also move the blood protein of an individual towards the optimal category for each type of protein.
[0164] Effectiveness in the treatment of neoplastic diseases may also be determined by a number of methods such as, but not limited to, microscopic examination of blood cells, bone marrow aspiration and biopsy, cytogenetic analysis, biopsy, immunophenotyping, blood chemistry studies, analysis of tumor biomarkers in blood, a complete blood count, lymph node biopsy, peripheral blood smear, visual analysis of a tumor or lesion, or any other method of evaluating and/or diagnosing malignancies and tumor progression known to those of skill in the art.
[0165] Effectiveness of the compositions and methods herein in the treatment of cancer or other disease may be evaluated by screening for markers in the blood depending on the specific cancer.
[0166] Within additional aspects of the invention, combinatorial disease treating formulations and coordinate administration methods are provided which employ an effective amount of a nanoconstruct and one or more secondary or adjunctive agent(s) that is/are combinatorially formulated or coordinately administered with the nanoconstruct to yield a combined, multi-active disease treating composition or coordinate treatment method.
[0167] Exemplary combinatorial formulations and coordinated treatment methods in this context employ the nanoconstruct, in combination with one or more secondary anti-tumor agent(s), or with one or more adjunctive therapeutic agent(s) that is/are useful for treatment or prophylaxis of the targeted (or associated) disease, condition and/or symptom(s) in the selected combinatorial formulation or coordinate treatment regimen. For most combinatorial formulations and coordinate treatment methods of the invention, a nanoconstruct is formulated, or coordinately administered, in combination with one or more adjunctive therapeutic agent(s), to yield a combined formulation or coordinate treatment method that is combinatorially effective or coordinately useful to treat neoplastic diseases and one or more symptom(s) of a secondary disease or condition in the subject. Exemplary combinatorial formulations and coordinate treatment methods in this context employ a nanoconstruct, in combination with one or more secondary or adjunctive therapeutic agents selected from, e.g., chemotherapeutic agents, anti-inflammatory agents, doxorubicin, vitamin D3, cytarabine, daunorubicin, cyclophosphamide, gemtuzumab ozogamicin, idarubicin, mercaptopurine, mitoxantrone, thioguanine, aldesleukin, asparaginase, carboplatin, etoposide phosphate, fludarabine, methotrexate, etoposide, dexamethasone, and choline magnesium trisalicylate. In addition, secondary therapies can include, but are not limited to, radiation treatment, hormone therapy and surgery.
[0168] In exemplary embodiments, a nanoconstruct and another agent will each be present in a disease treating/preventing amount (i.e., in singular dosage which will alone elicit a detectable alleviation of symptoms in the subject). Alternatively, the combinatorial formulation may comprise one or both nanoconstruct and another agent (wherein the other agent is not a nanoconstruct) in sub-therapeutic singular dosage amount(s), wherein the combinatorial formulation comprising both agents features a combined dosage of both agents that is collectively effective in eliciting the desired response.
[0169] To practice coordinated administration methods of the invention, a nanoconstruct may be administered, simultaneously or sequentially, in a coordinated treatment protocol with one or more of the adjunctive therapeutic agents contemplated herein. Thus, in certain embodiments a compound is administered coordinately with another agent and any other secondary or adjunctive therapeutic agent contemplated herein, using separate formulations or a combinatorial formulation as described above (i.e., comprising both a nanoconstruct and another agent). This coordinate administration may be done simultaneously or sequentially in either order, and there may be a time period while only one or both (or all) active therapeutic agents individually and/or collectively exert their biological activities. In another embodiment, such coordinated treatment methods are derived from protocols for the administration of one or more chemotherapeutics.
[0170] The pharmaceutical compositions of the present invention may be administered by any means that achieve their intended therapeutic or prophylactic purpose. Suitable routes of administration for the compositions of the invention include, but are not limited to, conventional delivery routes, devices and methods including injectable methods such as, but not limited to, intravenous, intramuscular, intraperitoneal, intraspinal, intrathecal, intracerebroventricular, intraarterial, subcutaneous and intranasal routes. Additional means of administration comprise topical application.
[0171] Aspects and applications of the invention presented here are described in the drawings and detailed description of the invention. Unless specifically noted, it is intended that the words and phrases in the specification and the claims be given their plain, ordinary, and accustomed meaning to those of ordinary skill in the applicable arts.
[0172] In the following examples, and for the purposes of explanation, numerous specific details are set forth in order to provide a thorough understanding of the various aspects of the invention. It will be understood, however, by those skilled in the relevant arts, that the present invention may be practiced without these specific details. In other instances, known structures and devices are shown or discussed more generally in order to avoid obscuring the invention. It should be noted that there are many different and alternative configurations, devices and technologies to which the disclosed inventions may be applied. The following examples are illustrative of disclosed methods. In light of this disclosure, those of skill in the art will recognize that variations of these examples and other examples of the disclosed method would be possible without undue experimentation.
EXAMPLES
Example I
Synthesis of Uniform Nanoparticle Cores
[0173] The sol-gel synthesis of mesoporous silica nanoparticle cores (MSNPs) was modified from previous reports (L. Pan et al., 2012; I. Slowing et al., 2007). For 47-nm MSNPs, nanoparticle (NP) (S-47), 0.15 M cetyltrimethylammonium chloride (CTAC) and 350 μL of triethanolamine (TEA) were mixed in 125 mL of water at 95° C. Then, 3 mL of tetraethyl orthosilicate (TEOS) was added, and the mixture was stirred for one hour. All chemicals were purchased from Sigma Aldrich, USA.
[0174] After mixing, the pellets were recovered from suspension by centrifugation, washed with a copious amount of ethanol, and dried overnight. The particles were then resuspended and refluxed in acidic methanol (0.6 M HCl in methanol) overnight to remove CTAC and TEA. Bare MSNPs were then washed with ethanol and dried in a desiccator overnight. MSNP (dry) size was measured with TEM (Phillips/FEI CM120/Biotwin TEM, Hillsboro, Oreg.) and hydrodynamic size with Zetasizer (ZS-90/Malvern, Malvern, U.K.). Varying the amount of TEA from 200-450 μl per 125 mL of reaction solution while holding the CTAC concentration constant at 0.15 M resulted in MSNP of different particle sizes; e.g., from 61±7 nm to 47±4 nm and 34±3 nm (dry size by TEM) as shown in
[0175] Multiple individual batches of mesoporous silica nanoparticles were created to determine the reproducibility of nanoparticle synthesis. As shown in Table 3, the hydrodynamic size of the S-47 MSNP core is highly reproducible, e.g., with a relative standard deviation (RSD) of 2.4% from 6 batches.
TABLE-US-00003 TABLE 3 Reproducibility of nanoparticle synthesis. Hydrodynamic Size, Batch Z-average ± SD (nm) 1 61.1 ± 0.7 2 58.1 ± 0.6 3 59.7 ± 0.5 4 57.7 ± 0.9 5 60.8 ± 0.8 6 58.8 ± 0.3 Average 59.4 % Relative standard 2.4 deviation
Example II
Synthesis of Non-Uniform Nanoparticle Cores
[0176] Non-uniform MSNPs (O-87) were synthesized in the presence of a strong base. 6 mM cetyltrimethyl ammonium bromide (CTAB) was dissolved in 240 mL of aqueous solution of pH 11.0 (adjusted by 2 M NaOH). When the temperature stabilized at 80° C., 2.5 mL of TEOS was added, and the reaction continued for 2 hours. After mixing, the pellets were recovered from suspension by centrifugation, washed with a copious amount of ethanol, and dried overnight. The particles were then resuspended and refluxed in acidic methanol (0.6 M HCl in methanol) overnight to remove CTAB. Bare MSNPs were then washed with ethanol and dried in a desiccator overnight. MSNP (dry) size was measured with TEM (Phillips/FEI CM120/Biotwin TEM, Hillsboro, Oreg.) and hydrodynamic size with Zetasizer (ZS-90/Malvern, Malvern, U.K.). These non-uniform nanoparticle cores were 87±14 nm in size (see, e.g.,
[0177] MSNPs prepared from Examples I and II were then coated layer-by-layer with cross-linked or non-cross-linked PEI, PEG, and targeting antibody. The nanoconstructs were then loaded with siRNA cargo as entailed in Examples III-VI. The characterization of compositions, size, and charge of the nanoconstructs are summarized in Example VII.
Example III
Polyethylenimine (PEI) Attachment to MSNPs and Cross-Linking Methods
[0178] MSNPs prepared as described in Examples I and II were coated with PEI by shaking 10 mg MSNPs and 2.5 mg PEI in ethanol solution for 3 hours at room temperature. Next, the PEI-MSNP, was pelleted down. The material then underwent PEG attachment in Example IV or PEI cross-linking first prior to PEG attachment. For the PEI cross-linking method, the PEI-MSNP was re-suspended in ethanol solution containing 0 or 2.0 mg PEI (10 kDa) and 0.1-0.5 mg/ml DSP (DSP; dithiobis [succinimidyl propionate]; Lomant's Reagent) as a crosslinker. The solution was shaken for another 40 minutes. The particles were pelleted down, washed, and resuspended in PBS (pH 7.2). The hydrodynamic sizes of materials made under these various cross-linking conditions are shown in
Example IV
Polyethylene Glycol (PEG) Attachment to MSNPs
[0179] Mal-PEG-NHS was used to attach PEG on the nanoparticles (via an NHS ester). For PEG loading, 50 mg of mal-PEG-NHS was conjugated to the primary amine of PEI-MSNP (10 mg as MSNP) from Example III (using either cross-linked or non-cross-linked PEI-MSNP) in PBS buffer under shaking (20 hr, RT).
[0180] PEG:MSNP ratios. To reduce the usage of expensive Mal-PEG-NHS, Mal-PEG-NHS can be first dissolved in DMF or added as a dry powder directly to the PEI-MSNP suspension in PBS to limit the hydrolysis of NHS and enhance the PEG loading efficacy and reduce the reaction time. This reduces the Mal-PEG-NHS by 5 fold to a 1:1 weight ratio of Mal-PEG-NHS per MSNP and reduces the reaction time from 20 hr to 1.5 hr. For example, 10 mg of PEI-MSNP were re-suspended in 1 ml PBS. Then, 10 mg of Mal-PEG-NHS (as a powder) were added into the PEI-MSNP solution. The mixture was then vortexed for one minute and sonicated for five minutes to ensure re-suspension. The mixture was then further shaken for 1.5 hours. The resulting nanoconstructs were subsequently recovered by centrifugation and washed as aforementioned. This dry powder method avoids the use of potentially harmful DMF solvent and hence is preferable. It yields similar PEG loading (e.g., about 18%, Table 5) and siRNA protection (
[0181] Molecular weights of PEG. Different molecular weights of PEG were also optimized. PEGs with different molecular weights (2, 5, 7.5 and 10 kDa) were tested. The role of PEG is to provide a stealth layer to the nanoparticle, hence higher density of PEG loading (brush-like conformation) is more desirable than lower density of PEG loading (random coil conformation).
Example V
Conjugation of Targeting Agents (Antibody, Antibody Fragment, Folic Acid) on MSNP-PEI-PEG
[0182] Antibody. Antibody conjugation of MSNP-PEI-PEG utilized a thiol-maleimide reaction modified from the literature (P. Yousefpour et al., 2011, M. N. Koopaei et al., 2011). First, antibody (e.g., trastuzumab (T), cetuximab (C), or rituximab (R)) was thiolated with Traut's reagent (2-iminothiolane) in PBS (pH 8.0) under shaking with 50-fold molar excess of Traut's reagent for 2 hours and then purified by Zeba spin column—MW-40,000 (Thermo Fisher Scientific). Thiolated antibody was then mixed with MSNP-PEI-PEG at an antibody:nanoparticle mass ratio of 1:1 to 1:50. The reaction was completed overnight at 4° C. under shaking conditions (300 rpm). The material was pelleted down, resuspended in PBS, and washed with a copious amount of PBS.
[0183] Antibody fragment (scFV). Antibody fragment can be conjugated to the nanoparticle in a similar manner with antibody. Bacteria expressing a HER2 scFv clone (Poul et al., 2000) were grown overnight followed by expansion on the second day and stimulation with IPTG (thiogalactopyranoside) to produce scFv protein. The culture was subsequently pooled, and periplasmic bound scFv was extracted and purified on a Ni-NTA column according to manufacturer's protocol. Concentration of scFv was determined using a Nanodrop UV-Vis spectrometer, and purity was verified by gel electrophoresis.
[0184] Folic acid. NHS ester-PEG-Folic acid (FA) was obtained commercially from Nanocs. NHS-PEG-FA was attached on the nanoparticles (via an NHS ester) in a similar manner as Example IV. 2.5 mg of NHS-PEG(5 kD)-FA was conjugated to the primary amine of cross-linked PEI-MSNP (10 mg) from Example III in PBS buffer under shaking (1.5 hours, RT). NHS-PEG(5 kD) (5-20 mg) was added to further stabilize (bind with) the remaining amine active surface for another hour.
Example VI
siRNA Loading on Targeting Agent Conjugated MSNP-PEI-PEG or MSNP-PEI-PEG
[0185] The loading of siRNA was achieved by mixing trastuzumab-conjugated MSNP-PEI-PEG (designated as T-NP) or MSNP-PEI-PEG (NP) and siRNA at nanoparticle/siRNA (NP/siRNA) mass ratio of 10 to 100 in PBS solution (0.5 to 1 hour, room temp, 200 rpm shaking), which resulted in complete binding (no siRNA left in the supernatant) as monitored by fluorescent method and gel electrophoresis (see Example VII). Likewise, the loading of siRNA on HER2 scFV-NP and FA-NP were performed in a similar manner.
Example VII
Characterization of Nanoconstructs
[0186] After surface modification, the nanoconstructs had a hydrodynamic size of ˜100 nm for the three uniform-sized core materials (S-34, S-47, S-61) and 200 nm for the non-uniform-sized core material (O-87) in water as shown in Table 4 and the size distribution histograms are shown in
TABLE-US-00004 TABLE 4 TEM size, hydrodynamic size, and zeta potential of six different nanoconstructs. Hydrodynamic Material MSNP core size (DLS) Zeta (MSNP size (nm) Surface Size charge core) by TEM.sup.(a) modification.sup.(b) (nm).sup.(c) PDI.sup.(d) (mV) O-87 87 ± 14 T-NP.sup.10 214 ± 22 0.22 22 ± 0.5 S-61 61 ± 7 T-NP.sup.10 113 ± 1.0 0.20 18 ± 0.4 T-NP.sup.10C 131 ± 0.3 0.20 19 ± 3.7 S-47 47 ± 4 T-NP.sup.10C 117 ± 0.5 0.19 25 ± 0.1 T-NP.sup.1.8C 117 ± 2.4 0.20 19 ± 4.0 S-34 34 ± 3 T-NP.sup.10C 133 ± 4.1 0.37 19 ± 4.0 .sup.(a)Core size measured in dry state, average size of 50 particles. .sup.(b)“10” stands for 10-kDa PEI; “1.8C” and “10C” stand for cross-linked 1.8-kDa and cross-linked 10-kDa PEI, respectively. All PEI-MSNP were then conjugated with 5-kDa PEG, and trastuzumab (T). .sup.(c)Average of three measurements; the z-average diameter and polydispersity index (PDI) values were defined according to International Standard on DLS (ISO13321). .sup.(d)PDI ranges from 0 to 1; smaller number indicates narrower size distribution; e.g., PDI < 0.05 is considered monodisperse (one size only), while PDI > 0.5 indicates a broad distribution of particle sizes.
TABLE-US-00005 TABLE 5 Composition of T-siRNA-NP (all reported as percent by mass of nanoparticle) % PEI % PEG % Anti- NP/siRNA mass Surface (by (by body (by ratio (fluorescent Material modification TGA) TGA) BCA) method) S-47 T-NP.sup.10C 13.5 18.2 3 Complete at S-47 T-NP.sup.1.8C 15.9 6.1 3 NP/siRNA of 10 and above
Example VIII
Gene Knockdown Efficacy of siRNA on Various Nanoconstructs
[0187] The LM2-4luc+/H2N cell line (over-expressing luciferase and HER2; J. M. du Manoir et al., 2006) was used for initial assessment of the nanoparticles for gene silencing efficacy when delivering siRNA against luciferase (siLUC). Cells were plated at 3000 cells/well in a 96-well plate. One day after seeding, cells were treated with siLUC-nanoparticles. The nanoparticles were loaded with siLUC at NP/siRNA ratio of 25 or 50 by mass. They were applied to each well at a fixed dose of 30 nM siLUC. The commercially available transfection agent, DharmaFECT™ (Dharmacon, Lafayette, Colo.), with the same siLUC dose served as a positive control. Non-targeting or scrambled siRNA (siSCR) was used throughout as a negative control. After overnight incubation (˜20 hours), cells were washed once to remove the nanoconstructs and replenished with a complete media. At 48 hours post-treatment, cells were lysed and analyzed for luciferase activity by the Luciferase Glow Assay Kit (Thermo Fisher Scientific, Waltham, Mass.) and protein concentration by the BCA protein assay kit (Thermo Fisher Scientific), following manufacturer's protocols. Luciferase activity of the lysate was normalized with the corresponding protein concentration in the same well and reported as a percentage of the untreated or siSCR controls. All treatments were performed with replicates.
[0188] NP/siRNA ratio. We compared different nanoconstructs (four core sizes, loaded with PEI of 1.8-kDa or 10-kDa, cross-linked or not cross-linked) for luciferase silencing efficacy as shown in
[0189] Core size. Without cross-linking, smaller particles had reduced silencing efficacy compared to larger particles (e.g., see S-61 vs. O-87, both were modified with 10-kDa PEI, designated as T-NP.sup.10 in
[0190] Cross-linking. In
[0191] In addition, when compared to the PEI-siRNA polyplex (without MSNP core), T-NP was superior in terms of size and luciferase silencing efficacy, as shown in
Example IX
Buffering Capacity of Cross-Linked-PEI Nanoconstructs
[0192] Internalized nanoparticles ultimately end up in perinuclear lysosomal vesicles. siRNAs must escape from these vesicles to the cytosol to silence expression. Increasing the buffering capacity of small nanoparticles in order to increase siRNA endosomal release based on the proton sponge effect principle was achieved by PEI cross-linking.
[0193] As outlined in Example III, the optimal PEI cross-linking condition was 0.1 mg/ml of DSP with 2 mg (free) PEI added to the binding solution. For measuring buffering capacity of cross-linked and non-cross-linked materials, the nanoparticles were suspended at 0.2 mg/mL in 150 mM NaCl (pH 9, pH adjusted with 0.05 M NaOH). Upon stabilization at pH 9.0, 5 μL of 0.05 M HCl was added and the solution was continuously stirred. When reaching steady state, the pH was recorded and the acid was added again. The process was repeated until the pH plateaued at around 3.0. The solution pH was then reported as a function of the amount of acid added.
[0194]
Example X
Serum Protection Assay
[0195] siRNA-nanoparticles were incubated with 50 v/v % human serum in PBS for a specified period of time (0, 0.5, 1, 2, 4, 8, 24, and 48 hours) at 37° C. under continuous shaking. At the end of each time point, the sample was mixed with proteinase K (200 μg/mL) and frozen at −80° C. to stop the enzymatic reaction. For the analysis, samples were thawed and mixed with 1.0 wt. % SDS in order to release siRNA from the nanoparticles. The sample was then mixed with an equal amount of 2× loading buffer and loaded into a 15% TBE-urea gel (BioRad). The gel ran at 100 V for the first 20 minutes and 150 V for another hour. The gel was then stained with SyBR Gold (Life Technologies) following the manufacturer's protocol and viewed in a UV chamber. The band intensity was analyzed by ImageJ software (National Institutes of Health, Bethesda, Md.). The fraction of intact siRNA was reported as a function of time that the siRNA-nanoparticles were in 50% serum. These results were compared to those obtained for free siHER2 without nanoparticles.
[0196]
[0197] The higher siRNA protection for T-siHER2-NP.sup.10C compared to T-siHER2-NP.sup.1.8C is likely due to the higher PEG content of T-siHER2-NP.sup.10C, e.g., 18.2% vs. 6.1% (Table 5). PEG provides a steric blocking effect (Z. Zhang et al., 2007; R. Gref, 2000) that reduces enzymatic degradation of siRNA (S. Mao et al., 2006). In a separate experiment (
Example XI
Cellular Uptake Analysis
[0198] Cells were harvested and resuspended in 1 million cells/150 μL/tube. Each tube was mixed with 150 μL of siSCR (tagged with Alexa-488) nanoconstructs in PBS (containing 100 μg nanoparticle). Upon nanoconstruct addition, cells were placed on a rocker in the cell incubator (37° C., 5% CO.sub.2) for 0.5 or 2.0 hours. Cells were then washed (centrifuge at 115 g, 5 min) with 1 mL FACS buffer (1× Phosphate Buffered Saline (Ca/Mg++ free)+1 mM EDTA+25 mM HEPES pH 7.0+1% FBS (Heat-Inactivated) three times. Cells were then resuspended in 550 μL of FACS buffer, transferred to a 5-mL tube, and kept on ice until analysis. For cells stained with free antibody (for gating purpose), antibody labeling was performed on ice and under rocking conditions. Cells were stained with primary antibody (trastuzumab or rituximab: 2 μg per tube) for an hour, washed with PBS, stained with secondary antibody (Anti-human Alexa 488: 2 μg per tube) for 45 minutes, then washed 2 times with PBS, and re-suspended in 550 μL of FACS buffer before analysis. All tubes were counter-stained for cellular DNA with 2 μL of 5 mM DRAQ5 (Cell Signaling) for 15 minutes on ice. All tubes (except antibody-labeled cells for gating purpose) were then incubated with 500 μL of Trypan Blue (0.4% in PBS) to quench fluorescence outside of the cells, and subjected to flow cytometry analysis. 10,000 events (cells) were analyzed for each sample. The intensity was processed with FlowJo software (NIH, Bethesda, Md.).
[0199] The specificity with which trastuzumab-conjugated nanoconstructs were taken up by cells that over-express the HER2 protein was assessed. The nanoconstruct contained a scrambled siRNA and conjugated with trastuzumab (designated hereafter as T-siSCR-NP.sup.1.8C and T-siSCR-NP.sup.10C) or with rituximab targeting CD20 (designated as R-siSCR-NP.sup.1.8C and R-siSCR-NP.sup.10C). Cellular uptake of T-siSCR-NP.sup.10C and T-siSCR-NP.sup.1.8C in HER2+ breast cancer cells, BT474 and SKBR3, and the HER2− cell line MCF-7 was measured at 0.5 or 2.0 hours post exposure to the nanoconstructs. The siSCR was tagged with the fluorescent reporter, Alexa 488, for these experiments to enable quantitative analysis of siSCR uptake. R-siSCR-NP.sup.10C and R-siSCR-NP.sup.1.8C served as a negative control since BT474, SKBR3 and MCF-7 cells do not over-express CD20. The amount of Alexa 488-tagged siSCR inside individual cells was measured using flow cytometry.
[0200] As another example, cetuximab (anti-EGFR antibody) was used as a targeting agent on the nanoconstruct, named C-NP, in a similar manner as T-NP. C-NP also showed preferential uptake to EGFR+ cells over EGFR− cells (
Example XII
HER2 Protein Knockdown and Cell Viability
[0201] HER2+ breast cancer cells (BT474, SKBR3 and HCC1954) were seeded in a 96-well plate for 24 hours prior to treatment. Nanoconstructs were loaded with siHER2 or siSCR at NP/siRNA 50. siRNA dose was fixed at 60 nM. Media was switched to complete media after overnight incubation. Three days after treatment with nanoconstructs, cells were fixed and analyzed for HER2 protein expression by immunofluorescence. HER2 mRNA and β-actin mRNA levels were analyzed at 48 hours post-treatment using the Quantigene 2.0 Reagent System (Panomics) following the manufacturer's protocol. The HER2 mRNA level was then normalized with β-actin mRNA (housekeeping gene) and reported as the percentage of the siSCR control. Cell viability and apoptosis were analyzed four days post-treatment using the CellTiter-Glo® Luminescent Assay (Promega) and the Caspase-Glo® 3/7 Assay Systems (Promega), respectively. Caspase activity was normalized with the cell viability. Both were reported as a percentage of the untreated control.
[0202] The efficiency of T-siHER2-NP.sup.10C in inhibiting HER2 mRNA levels and HER2 protein expression in the HER2+ breast cancer cell lines, BT474, SKBR3, and HCC1954 was assessed. As shown in
[0203] Treatment with T-siSCR-NP.sup.10C reduced HER2 levels and killed HER2+ breast cancer cells, indicating that the antibody (T) on the nanoconstruct not only serves as a cell targeting agent but also has therapeutic effect.
[0204] Cell viability after treatment with T-siHER2-NP.sup.10C was also measured in a panel of HER2+ breast cancer cells, HER2− breast cells, and HER2− non-breast cells.
[0205]
[0206] Overall, T-siHER2-NP.sup.10C demonstrated better HER2 knock-down and cancer cell killing efficacy than T-siHER2-NP.sup.1.8C. Encouragingly, the T-siHER2-NP.sup.10C (
Example XIII
Overcoming Drug Resistant Cancer with siHER2
[0207] The efficacy of T-siHER2-NP.sup.10C in intrinsically trastuzumab-resistant HER2+ cell lines (HCC1954 and JIMT1), in a parental HER2+ cell line (BT474) that responds to trastuzumab and lapatinib, and in BT474-R, a derivative cell line that was made lapatinib-resistant by long-term treatment with 1 μM lapatinib was also assessed.
Example XIV
Blood Compatibility (Hemolysis, Coagulation, and Platelet Aggregation)
[0208] The T-siHER2-NP.sup.1.8C and T-siHER2-NP.sup.10C were assessed for hemolysis, thrombogenesis, and platelet aggregation, and the results were benchmarked with FDA-approved nanoparticle products: Abraxane (Paclitaxel-albumin nanoparticles) and Feraheme (iron oxide nanoparticles used as a MRI contrast agent). Nanoparticles were tested at 1× and 5× of the intended human blood level. Studies of blood compatibility were performed following or with minor modification from the Nanotechnology Characterization Laboratory's (Frederick, Md.) published protocols.
[0209] Hemolysis. Human blood was collected in the presence of EDTA, and serum was removed. Red blood cells were suspended at 1×10.sup.9 cells per mL and exposed to nanoparticle (final concentrations of 70 or 350 μg/mL for 1× or 5×, respectively) for 4 hours and 37° C. Following centrifugation, absorbance of hemoglobin in the supernatants (at 542 nm) was measured and used to quantify percent hemolysis. Abraxane (Celgene) at 94 μg/mL for 1 × and 470 μg/mL for 5× was used. As shown in
[0210] Coagulation (thrombogenesis) assay. Platelet-poor plasma (PPP) was obtained following a two-step centrifugation of isolated blood (diluted in 3.2% sodium citrate, 1:10). After the first spin at (2150 g, 10 min), the top portion of plasma (˜75% of the total volume) was collected without disturbing the plasma at the bottom. The collected portion was centrifuged again at the same speed for 10 minutes, and the top portion (˜75% of the total volume) was collected as PPP. Nanoconstructs were mixed with 0.15 mL PPP to the final concentration of 70 or 350 μg/mL. The tubes were incubated for 30 minutes at 37° C. After 30-minute incubation, 0.05 mL of APTT-xl reagent was added and incubated for 3 minutes in the Trinity Biotech KC-4 coagulation analyzer. After which, 8.3 mM CaCl.sub.2 was added and the time until the onset of coagulation was recorded. Abraxane at 1× and 5× doses was used as a control. Likewise, Feraheme (AMAG Pharmaceuticals) at 102 μg/ml for 1× and 510 μg/ml for 5×, was also used in parallel.
[0211] Platelet aggregation assay. Platelet-rich plasma (PRP) was obtained following centrifugation of isolated blood (diluted in 3.2% sodium citrate, 1:10). The isolated blood was centrifuged at 200 g for 20 minutes. The supernatant (which contains PRP) was collected and maintained at room temperature prior to treatment. Following a 1-min incubation at 37° C. (baseline), reactions were initiated by addition of nanoparticle (70 or 350 μg/mL) or collagen related peptide (CRP; 100 μg/ml) and monitored for three minutes for optical density via an aggregometer (Chrono-log Corp). Abraxane at 1× and 5× as entailed above was also used as a benchmark.
Example XV
Immune Response-Peripheral Blood Mononuclear Cell (PBMC) Cytokine Release Assay
[0212] A PBMC cytokine release assay was conducted according to the recommendations and method by the Nanotechnology Characterization Lab (NCL) of NCl for immunological studies of nanoparticles. The in vitro cell based assay evaluated cytokine production by PBMCs (200,000 cells/well) following a 24-hour exposure to the test materials. Test materials included nanoconstructs with and without siHER2 to investigate the potential impact of siRNA mediated immune response. Following incubation, cell culture supernatants were collected and analyzed for IL-1β, IL-6, IFN-α, and TNF-α by a cytometry bead array (Milliplex Magnetic Bead) following the manufacturer's protocol. Abraxane and Feraheme were used as drug benchmarks since there is no siRNA based nanoconstruct drug in the market.
[0213] The effect of T-siHER2-NP.sup.1.8C and T-siHER2-NP.sup.10C on immune response was evaluated upon treating peripheral blood mononuclear cells (PBMCs) isolated from human blood with these nanoconstructs. PBMCs have been reported to respond to siRNA transfection with a sequence-specific TLR 7/8 dependent induction of IFN-α and TNF-α (R. Broering et al., 201; M. Zamanian-Daryoush, 2008). The TLR7/8 agonist, R848, was used as a direct positive control since TLR7 and TLR8 are located within the endosomes (A. Chaturvedi, S. K. Pierce, 2009) where nanoconstructs and siRNA are expected to reside.
Example XVI
Endotoxin (LAL Gel-Clot) Assay of Nanoconstructs
[0214] To ensure sterility of our material production, T-siHER2-NP.sup.1.8C and T-siHER2-NP.sup.10C were tested for lipopolysaccharides or LPS (endotoxin), produced by gram-negative bacterial contamination. About 35% of clinically relevant nanoparticles have been found to carry this contaminant (R. M. Crist et al., 2013). The two nanoconstructs were tested along with Abraxane as an FDA drug benchmark. All were negative for endotoxin (
Example XVII
Mouse Tumor Models and In Vivo Efficacy Studies
[0215] In vivo gene silencing studies were performed in orthotopic mouse tumor models; 4×10.sup.6 HCC1954 cells (unless specified otherwise) were implanted into the mammary fat pads of 5-week-old SCID mice (Charles River, Wilmington, Mass.) and allowed to grow to an average size of about 250 mm.sup.3. Mice were then grouped and proceeded to receive a single injection (tail vein) of the nanoconstructs (T-siHER2-NP.sup.10C or T-siSCR-NP.sup.10C, 1.25 mg/kg siRNA), or the PBS control. The tumors were harvested four days after treatment and analyzed for HER2 protein expression by immunofluorescence as shown in
[0216]
[0217] T-siHER2-NP.sup.10C (S-47 core, about 100 nm in size,
[0218] The nanoconstructs without trastuzumab (siHER2-NP.sup.10C also inhibit tumor growth in the HCC1954 tumor model as shown in
[0219] In another example, BT474-TRgf (BT474 variant developed to be resistant to trastuzumab by serial passaging the cells in mice, Francia et al., 2012) was used to evaluate the efficacy of T-siHER2-NP. While the BT474-TRgf cells were resistant to trastuzumab in vitro (
Example XVIII
Lyophilization of Nanoconstructs for Long Term Storage
[0220] Nanoconstruct suspensions (T-NP or NP) in 0.1 M Tris HCl (pH 7.4) were added to a solution of trehalose to achieve a final concentration of 10 mg/mL MSNP and 0-25 weight % of trehalose per nanoparticle. The well-mixed suspension was frozen slowly from room temperature to −55° C. in a freeze dryer. This was followed by primary and secondary drying. Primary drying (−40° C., 100 μBar, 24 hr) was to sublimate the ice crystals formed during the freezing step. Secondary drying (20° C., 20 μBar, 12 hr) was to eliminate bound water molecules on the nanoconstruct surface. The finished products were in the form of powder in sealed and storable bottles.
[0221] All lyophilized nanoconstructs with trehalose content of 0-10% retained the average size and charge of the freshly made nanoconstruct after 1 min of sonication as shown in
[0222] Further, T-NP lyophilized with 5% trehalose and stored at −20° C. to 37° C. were monitored for their properties over a 24-week storage time.
Example XIX
Reproducibility and Scalability of Nanoconstruct Production
[0223] Many nanoparticle platforms are known to have problems with batch-to-batch reproducibility—especially at a larger scale. MSNP core production via sol-gel chemistry and layer-by-layer surface modification affords very reproducible and scale-able production of the nanoconstruct. Multiple individual batches of mesoporous silica nanoparticles were created to determine reproducibility of nanoparticle synthesis. As shown in Table 6, the size, charge, and silencing efficacy were closely correlated with 2.4% relative standard deviation (RSD) of particle sizes from 6 batches, indicating that the material synthesis is highly reproducible. Scaling-up from 300 mg/batch to 6 g/batch has been accomplished (e.g., by simply increasing the reaction solution from 125 mL to 2.5 L during nanoparticle synthesis), which yielded similar material properties with the smaller batches.
TABLE-US-00006 TABLE 6 Reproducibility of nanoconstruct synthesis before and after surface modification. MSNP core T-NP.sup.10C Hydrodynamic Hydrodynamic Zeta % Luc Size Z- size Z- Potential silencing average ± average ± Average ± efficacy Batch SD (nm) SD (nm) SD (mV) (vs. siSCR) 1 61.1 ± 0.7 115.8 ± 4.0 25.0 ± 0.1 75.7 ± 4.0% 2 58.1 ± 0.6 117.4 ± 0.5 24.9 ± 0.1 80.5 ± 2.8% 3 59.7 ± 0.5 114.5 ± 7.1 25.0 ± 0.1 76.1 ± 2.4% 4 57.7 ± 0.9 123.8 ± 3.3 25.0 ± 0.1 76.6 ± 3.9% 5 60.8 ± 0.8 113.2 ± 2.3 25.0 ± 0.1 76.2 ± 2.8% 6 58.8 ± 0.3 115.6 ± 1.3 25.0 ± 0.1 77.0 ± 2.2% Average 59.4 116.7 25.0 77.0 % Relative 2.4 3.2 0.2 2.3 SD
Example XX
Additional siRNA Targeting Genes Beyond HER2 for Treating Cancer
[0224] The initial screen sought to assess the efficacy of individual siRNAs in HER2.sup.+ breast cancer. SiRNA against AKT (isoforms 1, 2, 3), BCL2, PLK1, GRB7, and EPS8L1, all were benchmarked against the previously optimized siHER2 sequence. Four cell lines were chosen, representing trastuzumab-resistant (HCC1569, HCC1954, JIMT1) and sensitive (BT474) HER2+ breast cancer. For each gene, the siRNA sequences were also varied (Hs_AKT1_5 FlexiTube siRNA (SI002991450), Hs_AKT1_8 FlexiTube siRNA (SI00287742), Hs_AKT1_10 FlexiTube siRNA (SI02757244) and Hs_AKT1_11 FlexiTube siRNA (SI02758406) for AKT1 shown to be efficacious by Qiagen) (Qiagen, Valencia, Calif., USA) as possible. Representative data for BT474 is shown in
[0225] We also evaluated dual targeting siRNA against AKT1/BCL2 (e.g., one siRNA duplex has one strand targeting AKT1 and the other strand targeting BCL2) (Table 1).
[0226] In the four cell lines tested, none of the individual AKT1 or BCL2 siRNAs worked better than the siAKT1/BCL2 (dual-targeting siRNA) or siPLK1. Therefore, the three siRNAs selected from the initial screening are siHER2, siAKT1/BCL2, and siPLK1.
[0227] The cell panel was expanded to include triple negative breast cancer, ER+, and non-breast cells. As shown in
[0228]
Example XXI
Screening of siRNA in Combination with Paclitaxel
[0229] Cells were first treated with 30 nM siRNAs (and commercial DharmaFECT™) followed by 5 nM paclitaxel treatment 24 hours later. Cell viability was determined 3 days later. As shown in Table 7, the combination of siRNA with paclitaxel enhanced the overall reduction in cell viability compared to paclitaxel alone (Scramble 30 Paclitaxel, top row). The % enhancement by various siRNAs with paclitaxel over paclitaxel alone was also summarized in Table 7. In short, knocking down HER2 had the greatest impact on paclitaxel toxicity in BT474 (having highest HER2 level). For other cells, the best efficacy was achieved with paclitaxel+siPLK1. The effect of paclitaxel combined with siAKT1/BCL2 or siEPS8L1 was also significant. The best enhancement by siAKT1/BCL2 (38-41%) appeared to be with basal cells, HCC1954, BT549, and HCC70. EPS8L1 is involved in EGFR signaling and functions in cell migration. As a result, efficacy of EPS8L1 was not restricted to HER2+ cells and proved effective in the two triple negative cell lines tested (both having high EGFR).
TABLE-US-00007 TABLE 7 Screening of siRNA targeting HER2, PLK1, AKT1/BCL2 and EPS8L1 in combination with the chemotherapeutic drug paclitaxel. Cell Viability (% of Scramble Control) Treatments HER2 Positive Triple Negative siRNA Luminal Basal Targets Paclitaxel BT474 SKBR3 HCC1954 BT549 HCC70 Scramble + 58% 39% 55% 59% 70% HER2 − 35% 51% 68% 51% 76% + 26% 33% 49% 40% 49% Enhanced 32% 6% 6% 19% 21% Paclitaxel effect due to gene knockdown AKT1 + − 74% 77% 47% 54% 42% BCL2 + 39% 29% 17% 23% 29% Enhanced 19% 10% 38% 36% 41% Paclitaxel effect due to gene knockdown PLK1 − 33% 14% 6% 15% 33% + 33% 13% 5% 13% 27% Enhanced 25% 26% 50% 46% 43% Paclitaxel effect due to gene knockdown EPS8L1 − 37% 53% 57% 40% 65% + 27% 29% 35% 13% 35% Enhanced 31% 10% 20% 46% 35% Paclitaxel effect due to gene knockdown
Example XXII
Delivery of Other Cargos by Nanoconstructs
[0230] Peptide delivery.
[0231] Co-delivery of antibody, siRNA, and chemotherapeutic. The nanoconstructs (MSNP-PEI-PEG or NP) can also co-deliver antibody, siRNA, and chemotherapeutic drugs to cancer cells.
Example XXIII
Antioxidant and/or Copper Chelating Nanoconstruct for siRNA Delivery
[0232] Another advantage of the MSNP based nanoconstruct is that the MSNP can reduce reactive oxygen species (ROS) in cells triggered by menadione as shown in
[0233] In addition, NOX4 was found to be overexpressed in the majority of breast cancer cell lines, primary breast tumors, and ovarian tumors. The overexpression of NOX4 in normal breast epithelial cells could result in cellular senescence, resistance to programmed cell death, and tumorigenic transformation of the cells (K. A. Graham, 2010), establishing therapeutic utility of the MSNP carrier as a NOX reducer in addition to the therapeutic agents it delivers.
[0234] Antioxidant properties of nanoparticles coupled with siPLK1 can elicit treatment effects in breast cancer metastasis.
[0235] Amine groups, e.g., from PEI on nanoconstructs, are known to be highly effective chelators of copper, which is a cofactor for angiogenesis and hence metastasis in cancer (Brewer et al., 2000). In agreement with our data, the lowest cancer metastasis and tumor burden was achieved with T-siPLK1-NP (
Example XXIV
Lanthanide and Fluorescent Dye Loading on MSNPs
[0236] MSNPs containing phosphonate groups were prepared by adding 3-trihydroxysilylpropyl methylphosphonate in situ during the MSNP synthesis described in Example I and Example II. Specifically, 500 mg of CTAB was dissolved in 240 ml of water (adjusted by 2 M NaOH). After temperature stabilized at 80° C., 2.5 mL of TEOS was added in to solution under stirring condition. After 15 minutes, 635 μL of 3-(trihydroxylsilyl) propyl methyl phosphonate was added. The reaction continued for 2 hours, and the pellets were recovered from suspension by centrifugation, washed with a copious amount of ethanol, and dried overnight. The particles were then resuspended and refluxed in acidic methanol (0.6 M HCl in methanol) overnight to remove CTAB. The resulting phosphonate-MSNPs were then washed with ethanol and dried in a desiccator overnight.
[0237] For lanthanide loading, 5 mg/ml of MSNP was suspended in water. Then 0.01-100 mg/L lanthanides were mixed with the MSNP suspension. The mixture was shaken for two hours. The material was then washed with a copious amount of water, and the material was dried. MSNP can undergo surface modifications (e.g., PEI, PEG, antibody loading as aforementioned) and can be used as a fluorescent probe or a probe for mass spectrometry.
[0238] For characterization, MSNP of known dry weight was mixed with 10 M HNO.sub.3 for acid leaching of lanthanides. The leachate was then subjected to a lanthanide assay with ICP-MS. The amount of each lanthanide loaded on nanoparticle (as wt. %) is shown in
Example XXV
Nanoconstructs Made from Other Inorganic Cores (e.g., Iron Oxide NPs)
[0239] As an alternative to silica, iron oxide (Fe.sub.3O4) nanoparticles (ION) can be used. Surface modification of such nanoparticles can be performed using similar methods to those described for MSNP. For example, a particle called DMSA-ION can be prepared. Specifically, ION were prepared by high temperature reaction of tris(acetylacetonato)iron(III) in the present of stabilizing surfactants—1,2-hexadecanediol, lauric acid and lauryl amine—in benzyl ether. The adduct was purified with ethanol and hexane to obtain precursor ION-lauric acid. The precursor nanoparticles then underwent a ligand exchange reaction from hydrophobic lauric acid to hydrophilic meso-2,3-dimercaptosuccinic acid (DMSA) which renders the nanoparticles water-soluble. The final DMSA-ION were magnetically purified with water, ethanol and acetone. ION of <10 nm by TEM has been achieved (Yantasee et al, 2007).
[0240] At neutral pH, DMSA has a negative charge which allows the ligand to electrostatically bind to positively-charged polyethylenimine (PEI). PEI modification allows the nanoparticles to bind with negative charged siRNA. Under low pH environment of intracellular compartment, DMSA is protonated and release the bound PEI which in turn releases the siRNA. Evaluation of ION based nanoconstruct for delivery of antibody, siRNA, chemotherapeutic, and/or dyes will be performed similar to MSNP nanoconstruct. Their advantages are small size for easy tumor accumulation, biocompatible, and MRI compatible.
[0241] In this example, iron oxide nanoparticles have been surface modified in a similar manner as MSNP using aforementioned methods with minor modification. Specifically, iron oxide nanoparticles (commercially available and FDA approved Ferumoxytol or Feraheme) were dispersed in ethanol solution and PEI (10 kDa) was added to the solution at a concentration 25 or 33 wt. % of PEI (10 kDa) per iron oxide. The mixture was subsequently shaken, centrifuged, and washed twice with PBS. Dry mal-PEG(5-kDa)-NHS was then added at a 1:1 ratio by mass of iron oxide to PEI in PBS. The resulting solution was shaken for two hours at room temperature, and was subsequently washed in PBS. Targeting agent (trastuzumab, T) was incorporated in the same manner as Example V. siRNA loading was achieved by mixing the resulting nanoconstructs with siRNA for 1 hour prior to characterization. The final hydrodynamic size of the nanoconstruct was approximately 50-100 nm in average as shown in
Example XXVI
Iron Oxide Nanoconstructs for siRNA Delivery and MRI Contrast Agent
[0242] Nanoconstructs containing iron oxide nanoparticles can be used to deliver siRNA and achieve effective gene silencing. Iron oxide nanoconstructs synthesized by the method of Example XXV were loaded with 50 nM siLUC at a nanoconstruct per siLUC mass ratio of 10 and used to treat LM2-4luc+/H2N cells expressing luciferase similar to Example VIII. Good luciferase knock down efficacy (40-50%) was achieved as shown in
[0243] Iron oxide based nanoconstructs can serve as an MRI contrast agent. T2 relaxivity was calculated by T2 MRI (small animal Bruker BioSpin 11.75T MRI instrument (31 cm horizontal bore), Paravision 5.1 software) as increasing Fe concentrations in PBS. T2 values were found using ImageJ software and plotted as 1/T2 (1/s) vs Fe (mM) to yield relaxivity (R2 coefficient) as the slope (
REFERENCES
[0244] A. Chaturvedi, S. K. Pierce, Traffic (Copenhagen, Denmark) 2009, 10, 621-628. [0245] A. Mantei, S. Rutz, M. Janke, D. Kirchhoff, U. Jung, V. Patzel, U. Vogel, T. Rudel, I. Andreou, M. Weber, A. Scheffold, European journal of immunology 2008, 38, 2616-2625. [0246] D. M. Dykxhoorn, D. Palliser, J. Lieberman, Gene therapy 2006, 13, 541-552. [0247] C. Argyo, V. Weiss, C. Bräuchle, T. Bein, Chemistry of Materials 2013, 26, 435-451. [0248] F. Tang, L. Li, D. Chen, Advanced Materials 2012, 24, 1504-1534. [0249] G. Francia, C. Rodriguez, P. Xu, S. Man, W. Cruz-Munoz, G. Bocci, R. S. Kerbel, J Clin Oncol. 2012 ASCO Annual Meeting [0250] J. Tabernero, G. I. Shapiro, P. M. LoRusso, A. Cervantes, G. K. Schwartz, G. J. Weiss, L. Paz-Ares, D. C. Cho, J. R. Infante, M. Alsina, M. M. Gounder, R. Falzone, J. Harrop, A. C. S. White, I. Toudjarska, D. Bumcrot, R. E. Meyers, G. Hinkle, N. Svrzikapa, R. M. Hutabarat, V. A. Clausen, J. Cehelsky, S. V. Nochur, C. Gamba-Vitalo, A. K. Vaishnaw, D. W. Y. Sah, J. A. Gollob, H. A. Burris, Cancer Discovery 2013, 3, 406-417. [0251] R. K. Ramanathan, S. I. Hamburg, M. J. Borad, M. Seetharam, M. N. Kundranda, P. Lee, P. Fredlund, M. Gilbert, C. Mast, S. C. Semple, A. D. Judge, B. Crowell, L. Vocila, I. MacLachlan, D. W. Northfelt, in AACR 104th Annual Meeting 2013, Washington, DC, 2013. [0252] L. Pan, Q. He, J. Liu, Y. Chen, M. Ma, L. Zhang, J. Shi, Journal of the American Chemical Society 2012, 134, 5722-5725. [0253] I. Slowing, B. G. Trewyn, S. Giri, V. S. Y. Lin, Advanced Functional Materials 2007, 17, 1225-1236. [0254] M. Barok, H. Joensuu, J. Isola, Breast Cancer Research 2014, 16, 1-12. [0255] A. A. Seyhan, U. Varadarajan, S. Choe, W. Liu, T. E. Ryan, Molecular bioSystems 2012, 8, 1553-1570. [0256] M. E. Davis, J. E. Zuckerman, C. H. J. Choi, D. Seligson, A. Tolcher, C. A. Alabi, Y. Yen, J. D. Heidel, A. Ribas, Nature 2010, 464, 1067-1070. [0257] M. E. Davis, Molecular pharmaceutics 2009, 6, 659-668. [0258] P. Yousefpour, F. Atyabi, E. Vasheghani-Farahani, A. A. Movahedi, R. Dinarvand, International journal of nanomedicine 2011, 6, 1977-1990. [0259] M. N. Koopaei, R. Dinarvand, M. Amini, H. Rabbani, S. Emami, S. N. Ostad, F. Atyabi, International journal of nanomedicine 2011, 6, 1903-1912. [0260] R. Broering, C. I. Real, M. J. John, K. Jahn-Hofmann, L. M. Ickenstein, K. Kleinehr, A. Paul, K. Gibbert, U. Dittmer, G. Gerken, J. F. Schlaak, International Immunology 2014, 26, 35-46. [0261] M. Zamanian-Daryoush, J. T. Marques, M. P. Gantier, M. A. Behlke, M. John, P. Rayman, J. Finke, B. R. Williams, Journal of interferon & cytokine research: the official journal of the International Society for Interferon and Cytokine Research 2008, 28, 221-233. [0262] R. Kanasty, J. R. Dorkin, A. Vegas, D. Anderson, Nat Mater 2013, 12, 967-977. [0263] D. Haussecker, Mol Ther Nucleic Acids 2012, 1, e8. [0264] S. Ahmad, S. Gupta, R. Kumar, G. C. Varshney, G. P. S. Raghava, Sci. Rep. 2014, 4. [0265] R. Nahta, F. J. Esteva, Breast cancer research: BCR 2006, 8, 215. [0266] T. Bieber, W. Meissner, S. Kostin, A. Niemann, H. P. Elsasser, Journal of controlled release: official journal of the Controlled Release Society 2002, 82, 441-454. [0267] K. Kunath, A. von Harpe, D. Fischer, H. Petersen, U. Bickel, K. Voigt, T. Kissel, Journal of controlled release: official journal of the Controlled Release Society 2003, 89, 113-125; c M. Breunig, U. Lungwitz, R. Liebl, C. Fontanari, J. Klar, A. Kurtz, T. Blunk, A. Goepferich, The journal of gene medicine 2005, 7, 1287-1298. [0268] T. M. Allen, P. R. Cullis, Science 2004, 303, 1818-1822; b H. Kobayashi, R. Watanabe, P. L. Choyke, Theranostics 2013, 4, 81-89. [0269] T.-M. Ketola, M. Hanzlíková, L. Leppänen, M. Raviña, C. J. Bishop, J. J. Green, A. Urtti, H. Lemmetyinen, M. Yliperttula, E. Vuorimaa-Laukkanen, The Journal of Physical Chemistry B 2013, 117, 10405-10413; b L. Aravindan, K. A. Bicknell, G. Brooks, V. V. Khutoryanskiy, A. C. Williams, Macromolecular bioscience 2013, 13, 1163-1173. [0270] X. Li, Y. Chen, M. Wang, Y. Ma, W. Xia, H. Gu, Biomaterials 2013, 34, 1391-1401. [0271] H. Meng, W. X. Mai, H. Zhang, M. Xue, T. Xia, S. Lin, X. Wang, Y. Zhao, Z. Ji, J. I. Zink, A. E. Nel, ACS Nano 2013, 7, 994-1005. [0272] J. Shen, H. C. Kim, H. Su, F. Wang, J. Wolfram, D. Kirui, J. Mai, C. Mu, L. N. Ji, Z. W. Mao, H. Shen, Theranostics 2014, 4, 487-497; [0273] D. Lin, Q. Cheng, Q. Jiang, Y. Huang, Z. Yang, S. Han, Y. Zhao, S. Guo, Z. Liang, A. Dong, Nanoscale 2013, 5, 4291-4301. [0274] Y.-C. Wang, G. Morrison, R. Gillihan, J. Guo, R. Ward, X. Fu, M. Botero, N. Healy, S. Hilsenbeck, G. Phillips, G. Chamness, M. Rimawi, C. K. Osborne, R. Schiff, Breast Cancer Research 2011, 13, R121. [0275] C. A. Ritter, M. Perez-Torres, C. Rinehart, M. Guix, T. Dugger, J. A. Engelman, C. L. Arteaga, Clinical Cancer Research 2007, 13, 4909-4919; c T. Cooke, J. Reeves, A. Lanigan, P. Stanton, Annals of oncology: official journal of the European Society for Medical Oncology/ESMO 2001, 12 Suppl 1, S23-28. [0276] Z. Zhang, A. E. Berns, S. Willbold, J. Buitenhuis, Journal of colloid and interface science 2007, 310, 446-455. [0277] R. Gref, M. Luck, P. Quellec, M. Marchand, E. Dellacherie, S. Harnisch, T. Blunk, R. H. Muller, Colloids and surfaces. B, Biointerfaces 2000, 18, 301-313. [0278] C. G. Murphy, S. Modi, Biologics: targets & therapy 2009, 3, 289-301. [0279] C. L. Warner, R. S. Addleman, A. D. Cinson, T. C. Droubay, M. H. Engelhard, M. A. Nash, W. Yantasee, M. G. Warner, ChemSusChem 2010, 3, 749-757. [0280] C. M. Rudin, J. L. Marshall, C. H. Huang, H. L. Kindler, C. Zhang, D. Kumar, P. C. Gokhale, J. Steinberg, S. Wanaski, U. N. Kasid, M. J. Ratain, Clinical Cancer Research 2004, 10, 7244-7251 [0281] C. Timchalk, M. G. Warner, Environ. Sci. Technol. 2007, 41, 5114-5119. [0282] C. V. Pecot, G. A. Calin, R. L. Coleman, G. Lopez-Berestein, A. K. Sood, Nat Rev Cancer 2011, 11, 59-67. [0283] D. W. Bartlett, H. Su, I. J. Hildebrandt, W. A. Weber, M. E. Davis, Proceedings of the National Academy of Sciences 2007, 104, 15549-15554. [0284] F. Henjes, C. Bender, S. von der Heyde, L. Braun, H. A. Mannsperger, C. Schmidt, S. Wiemann, M. Hasmann, S. Aulmann, T. Beissbarth, U. Korf, Oncogenesis 2012, 1, e16. [0285] G. J. Brewer, R. D. Dick, D. K. Grover, V. LeClaire, M. Tseng, M. Wicha, K. Pienta, B. G. Redman, T. Jahan, V. K. Sondak, M. Strawderman, G. LeCarpentier, S. D. Merajver, Clinical Cancer Research 2000, 6, 1-10. [0286] H. Maeda, J. Wu, T. Sawa, Y. Matsumura, K. Hori, Journal of controlled release: official journal of the Controlled Release Society 2000, 65, 271-284. [0287] H. Zhang, T. Xia, H. Meng, M. Xue, S. George, Z. Ji, X. Wang, R. Liu, M. Wang, B. France, R. Rallo, R. Damoiseaux, Y. Cohen, K. A. Bradley, J. I. Zink, A. E. Nel, ACS Nano 2011, 5, 2756-2769. [0288] I. Beyer, H. Cao, J. Persson, H. Song, M. Richter, Q. Feng, R. Yumul, R. van Rensburg, Z. Li, R. Berenson, D. Carter, S. Roffler, C. Drescher, A. Lieber, Clinical cancer research: an official journal of the American Association for Cancer Research 2012, 18, 3340-3351. [0289] I. Beyer, Z. Li, J. Persson, Y. Liu, R. van Rensburg, R. Yumul, X. B. Zhang, M. C. Hung, A. Lieber, Molecular therapy: the journal of the American Society of Gene Therapy 2011, 19, 479-489. [0290] J. D. Heidel, Z. Yu, J. Y.-C. Liu, S. M. Rele, Y. Liang, R. K. Zeidan, D. J. Kornbrust, M. E. Davis, Proceedings of the National Academy of Sciences 2007, 104, 5715-5721. [0291] J. E. Zuckerman, C. H. J. Choi, H. Han, M. E. Davis, Proceedings of the National Academy of Sciences 2012, 109, 3137-3142. [0292] J. Lu, M. Liong, S. Sherman, T. Xia, M. Kovochich, A. E. Nel, J. I. Zink, F. Tamanoi, Nanobiotechnology: the journal at the intersection of nanotechnology, molecular biology, and biomedical sciences 2007, 3, 89-95. [0293] J. Morry, W. Ngamcherdtrakul, S. Gu, S. M. Goodyear, D. J. Castro, M. M. Reda, T. Sangvanich, W. Yantasee, Biomaterials 2015, 66, 41-52. [0294] J. M. du Manoir, G. Francia, S. Man, M. Mossoba, J. A. Medin, A. Viloria-Petit, D. J. Hicklin, U. Emmenegger, R. S. Kerbel, Clinical Cancer Research 2006, 12, 904-916. [0295] K. A. Graham, M. Kulawiec, K. M. Owens, X. Li, M. M. Desouki, D. Chandra, K. K. Singh, Cancer Biology & Therapy 2010, 10, 223-231. [0296] K. A. Whitehead, R. Langer, D. G. Anderson, Nature reviews. Drug discovery 2009, 8, 129-138. [0297] K. Takeda, S. Akira, International Immunology 2005, 17, 1-14. [0298] M. A. Poul, B. Becerril, U. B. Nielson, P. Morrisson, J. D. Marks, Journal of Molecular Biology 2000, 301, 1149-1161. [0299] M. H. Schwenk, Pharmacotherapy 2010, 30, 70-79. [0300] M. J. Roberts, M. D. Bentley, J. M. Harris, Advanced drug delivery reviews 2002, 54, 459-476. [0301] O. Boussif, F. Lezoualc'h, M. A. Zanta, M. D. Mergny, D. Scherman, B. Demeneix, J. P. Behr, Proceedings of the National Academy of Sciences 1995, 92, 7297-7301. [0302] R. A. Petros, J. M. DeSimone, Nature reviews. Drug discovery 2010, 9, 615-627. [0303] R. M. Crist, J. H. Grossman, A. K. Patri, S. T. Stern, M. A. Dobrovolskaia, P. P. Adiseshaiah, J. D. Clogston, S. E. McNeil, Integrative biology: quantitative biosciences from nano to macro 2013, 5, 66-73. [0304] R. Nahta, ISRN oncology 2012, 2012, 428062. [0305] S. Gu, Z. Hu, W. Ngamcherdtrakul, D. J. Castro, J. Morry, M. M. Reda, J. W. Gray, W. Yantasee, Oncotarget 2016, DOI: 10.18632/oncotarget.7409. [0306] S. Guo, L. Huang, Journal of Nanomaterials 2011, 2011, 12. [0307] S. Mao, M. Neu, O. Germershaus, O. Merkel, J. Sitterberg, U. Bakowsky, T. Kissel, Bioconjugate chemistry 2006, 17, 1209-1218. [0308] T. H. Chung, S. H. Wu, M. Yao, C. W. Lu, Y. S. Lin, Y. Hung, C. Y. Mou, Y. C. Chen, D. M. Huang, Biomaterials 2007, 28, 2959-2966. [0309] W. Li, F. Nicol, F. C. Szoka Jr., Advanced Drug Delivery Review 2004, 56, 967-985. [0310] W. Ngamcherdtrakul, J. Morry, S. Gu, D. J. Castro, S. M. Goodyear, T. Sangvanich, M. M. Reda, R. Lee, S. A. Mihelic, B. L. Beckman, Z. Hu, J. W. Gray, W. Yantasee, Advanced Functional Materials 2015, 25, 2646-2659. [0311] W. Yantasee, C. L. Warner, T. Sangvanich, R. S. Addleman, T. G. Carter, R. J. Wiacek, G. E. Fryxell, C. Timchalk, M. G. Warner, Environmental Science & Technology 2007, 41, 5114-5119.
[0312] The invention is further described in the following numbered embodiments:
[0313] Embodiment 1. A multilayer nanoconstruct comprising a cationic polymer bound to an exterior surface of a nanoparticle, wherein the cationic polymer is cross-linked.
[0314] Embodiment 2. The nanoconstruct of embodiment 1, further comprising a stabilizer bound to the cationic polymer or nanoparticle, wherein the stabilizer prevents aggregation of the nanoconstruct in solution.
[0315] Embodiment 3. The nanoconstruct of embodiment 1 or 2, wherein the nanoparticle is mesoporous.
[0316] Embodiment 4. The nanoconstruct of any one of embodiments 1-3, wherein the nanoparticle is a silica nanoparticle, a silicon nanoparticle, an iron oxide nanoparticle, a gold nanoparticle, a silver nanoparticle, or a carbon nanotube.
[0317] Embodiment 5. The nanoconstruct of any one of embodiments 1-4, wherein the nanoconstruct has a hydrodynamic diameter of from about 10 to about 200 nm.
[0318] Embodiment 6. The nanoconstruct of embodiment 5, wherein the nanoparticle has a diameter of 5 to 90 nm.
[0319] Embodiment 7. The nanoconstruct of any one of embodiments 1-6, wherein the cationic polymer is from about 5% to about 30% by weight of the nanoconstruct.
[0320] Embodiment 8. The nanoconstruct of embodiment 7, wherein the cationic polymer is from about 10% to about 25% by weight of the nanoconstruct.
[0321] Embodiment 9. The nanoconstruct of any one of embodiments 1-8, wherein the cationic polymer is selected from the group consisting of polyethylenimine, chitosan, polypropyleneimine, polylysine, polyamidoamine, poly(allylamine), poly(diallyldimethylammonium chloride), poly(N-isopropyl acrylamide-co-acrylamide), poly(N-isopropyl acrylamide-co-acrylic acid), diethylaminoethyl-dextran, poly-(N-ethyl-vinylpyridinium bromide), poly(dimethylamino)ethyl methacrylate, and/or poly(ethylene glycol)-co-poly(trimethylaminoethylmethacrylate chloride).
[0322] Embodiment 10. The nanoconstruct of embodiment 9, wherein the cationic polymer is polyethylenimine having a molecular weight of from about 0.8 kDa to about 10 kDa.
[0323] Embodiment 11. The nanoconstruct of any one of embodiments 1-10, wherein the cationic polymer is cross-linked by reacting cationic polymer on the surface of the nanoparticle with a cross-linker in the presence of cationic polymer in solution.
[0324] Embodiment 12. The nanoconstruct of any one of embodiments 2-11, wherein the stabilizer is from about 1% to about 30% by weight of the nanoconstruct.
[0325] Embodiment 13. The nanoconstruct of embodiment 12, wherein the stabilizer is from about 5% to about 25% by weight of the nanoconstruct.
[0326] Embodiment 14. The nanoconstruct of any one of embodiments 2-13, wherein the stabilizer is selected from the group consisting of polyethylene glycol, dextran, polysialic acid, hyaluronic acid (HA), polyvinyl pyrrolidone (PVP), polyvinyl alcohol (PVA), and/or polyacrylamide (PAM).
[0327] Embodiment 15. The nanoconstruct of embodiment 14, wherein the stabilizer is polyethylene glycol having a molecular weight of from about 1 kDa to about 20 kDa.
[0328] Embodiment 16. The nanoconstruct of any one of embodiments 1-15, further comprising at least one type of oligonucleotide electrostatically bound to the cationic polymer.
[0329] Embodiment 17. The nanoconstruct of embodiment 16, wherein the at least one type of oligonucleotide is a siRNA, miRNA, miRNA mimic, or antisense oligomer.
[0330] Embodiment 18. The nanoconstruct of embodiment 16 or 17, wherein the at least one type of oligonucleotide is siRNA.
[0331] Embodiment 19. The nanoconstruct of embodiment 18, wherein the siRNA targets one or more genes selected from the group consisting of HER2, AKT1, AKT2, AKT3, EPS8L1, GRB7, AR, Myc, VEGF, VEGF-R1, RTP801, proNGF, Keratin K6A, Bcl-2, PLK1, LMP2, LMP7, MECL1, RRM2, PKN3, Survivin, HIF1α, Furin, KSP, eiF-4E, p53, β-catenin, ApoB, PCSK9, HSP47, CFTR, CTGF, SNALP, RSV nucleocapsids, CD47, PD-L1, and CTLA-4.
[0332] Embodiment 20. The nanoconstruct of any one of embodiments 16-19, wherein the at least one type of oligonucleotide is from about 1% to about 15% by weight of the nanoconstruct.
[0333] Embodiment 21. The nanoconstruct of embodiment 20, wherein the at least one type of oligonucleotide is from about 1% to about 5% by weight of the nanoconstruct.
[0334] Embodiment 22. The nanoconstruct of any one of embodiments 16-21, wherein the at least one type of oligonucleotide comprises two or more different siRNAs loaded onto the nanoconstruct.
[0335] Embodiment 23. The nanoconstruct of any one of embodiments 1-22, further comprising a small molecule or a protein.
[0336] Embodiment 24. The nanoconstruct of embodiment 23, wherein the small molecule is from about 0.5% to about 30% by weight of the nanoconstruct.
[0337] Embodiment 25. The nanoconstruct of embodiment 23 or 24, wherein the small molecule is a chemotherapeutic agent, small molecule inhibitor, or a polypeptide.
[0338] Embodiment 26. The nanoconstruct of embodiment 23 or 24, wherein the small molecule is a label.
[0339] Embodiment 27. The nanoconstruct of embodiment 26, wherein the label is a lanthanide, a fluorescent dye, a gold nanoparticle, a quantum dot, a positron emission tomography (PET) tracer, and/or a magnetic resonance imaging (MRI) contrast agent.
[0340] Embodiment 28. The nanoconstruct of embodiment 23, wherein the protein is a cytokine.
[0341] Embodiment 29. The nanoconstruct of any one of embodiments 1-28, further comprising a targeting agent.
[0342] Embodiment 30. The nanoconstruct of embodiment 29, wherein the targeting agent is an antibody, a scFv antibody, an affibody, an aptamer, a peptide, and/or small targeting molecule.
[0343] Embodiment 31. The nanoconstruct of embodiment 29 or 30, wherein the targeting agent is from about 0.1% to about 10% by weight of the nanoconstruct.
[0344] Embodiment 32. The nanoconstruct of embodiment 31, wherein the targeting agent is from about 0.3% to about 5% by weight of the nanoconstruct.
[0345] Embodiment 33. The nanoconstruct of any one of embodiment 30-32, wherein the small targeting molecule is a carbohydrate or ligand.
[0346] Embodiment 34. The nanoconstruct of any one of embodiments 1-33, wherein the nanoconstruct is lyophilized.
[0347] Embodiment 35. The nanoconstruct of embodiment 34, wherein the nanoconstruct is lyophilized with trehalose.
[0348] Embodiment 36. The nanoconstruct of embodiment 35, wherein the trehalose is from about 1% to about 10% by weight of the nanoconstruct.
[0349] Embodiment 37. The nanoconstruct of any one of embodiments 1-36, wherein the exterior surface of the nanoparticle comprises thiol, amine, carboxylate, and/or phosphonate functional groups.
[0350] Embodiment 38. A method of delivering an agent to a site in a human or other mammalian subject comprising administering an effective amount of the nanoconstruct of any one of embodiments 1-37 comprising the agent to the human or other mammalian subject under conditions to deliver the nanoconstruct to the site.
[0351] Embodiment 39. The method of embodiment 38, wherein the site is a cell.
[0352] Embodiment 40. The method of embodiment 39, wherein the nanoconstruct is administered under conditions that the nanoconstruct is internalized by the cell.
[0353] Embodiment 41. The method of any one of embodiments 38-40, wherein the subject is suffering from a disease or condition characterized by over-expression of one or more genes relative to expression of the one or more genes in a healthy subject.
[0354] Embodiment 42. The method of embodiment 41, wherein the disease or condition is selected from the group consisting of AMD, macular edema, chronic optic nerve atrophy, pachyonychia congenital, chronic lymphocytic leukemia, metastatic lymphoma, metastatic cancer, solid tumors, acute kidney injury, delayed graft function, familia adenomatous polyposis, hypercholesterolemia, liver fibrosis, cystic fibrosis, dermal scarring, Ebola infection, RSV infection, and inflammation.
[0355] Embodiment 43. The method of embodiment 41 or 42, wherein the nanoconstruct is administered in an amount sufficient to treat the subject having the disease or condition.
[0356] Embodiment 44. The method of any one of embodiments 38-43, wherein the agent is a label.
[0357] Embodiment 45. The method of embodiment 44, wherein the label is a lanthanide, a fluorescent dye, a PET tracer, or a MRI contrast agent.
[0358] Embodiment 46. The method of any one of embodiments 38-43, wherein the agent is a therapeutic agent.
[0359] Embodiment 47. The method of embodiment 46, wherein the therapeutic agent is a nucleic acid capable of modulating expression of a target protein.
[0360] Embodiment 48. The method of embodiment 47, wherein the nucleic acid is a siRNA, miRNA, miRNA mimic, or antisense oligomer, and expression of the target protein is reduced.
[0361] Embodiment 49. The method of embodiment 46, wherein the therapeutic agent is a chemotherapeutic agent, a small molecule inhibitor, an antibody, a peptide, and/or a cytokine.
[0362] Embodiment 50. The method of any one of embodiments 38-49, wherein the subject is diagnosed with cancer, and the effective amount is a therapeutically effective amount.
[0363] Embodiment 51. The method of embodiment 50, wherein the cancer is resistant to a monoclonal antibody or a small molecule inhibitor.
[0364] Embodiment 52. The method of embodiment 51, wherein the therapeutic agent is an oligonucleotide that targets expression of a protein inhibited by the monoclonal antibody or the small molecule inhibitor.
[0365] Embodiment 53. The method of any one of embodiments 38-52, wherein the nanoconstruct further comprises a targeting agent.
[0366] Embodiment 54. The method of embodiment 53, wherein the targeting agent is an antibody, a scFv antibody, an affibody, an aptamer, a peptide, and/or small targeting molecule.
[0367] Embodiment 55. The method of any one of embodiments 38-54, wherein the subject is diagnosed with or is at risk for fibrosis or inflammation.
[0368] Embodiment 56. The method of any one of embodiments 38-55, wherein the nanoconstruct reduces reactive oxygen species, bioavailable copper, and/or NOX expression level in the subject,
[0369] Embodiment 57. The method of any one of embodiments 38-56, wherein the agent is administered in an amount sufficient to reduce tumor migration or inflammation in the human or other mammalian subject.
[0370] Embodiment 58. The method of any one of embodiments 38-57, wherein the nanoconstruct modulates an adverse effect of one or more cytokines.
[0371] Embodiment 59. The method of any one of embodiments 38-58, wherein the nanoconstruct is administered subcutaneously, topically, systemically, intravesically, orally, intratumorally, or intraperitoneally.
[0372] Embodiment 60. A method of making a nanoconstruct comprising: providing a nanoparticle coated with a cationic polymer, and cross-linking the cationic polymer to make the nanoconstruct.
[0373] Embodiment 61. The method of embodiment 60, wherein the nanoparticle is a silica nanoparticle, a silicon nanoparticle, an iron oxide nanoparticle, a gold nanoparticle, a silver nanoparticle, or a carbon nanotube.
[0374] Embodiment 62. The method of embodiment 60 or 61, wherein the cationic polymer is cross-linked in the presence of free cationic polymer.
[0375] Embodiment 63. The method of embodiment 62, wherein the cationic polymer is cross-linked in the presence of a stoichiometric excess of the free cationic polymer.
[0376] Embodiment 64. The method of any one of embodiments 60-63, wherein the cationic polymer is selected from the group consisting of polyethylenimine, chitosan, polypropyleneimine, polylysine, polyamidoamine, poly(allylamine), poly(diallyldimethylammonium chloride), poly(N-isopropyl acrylamide-co-acrylamide), poly(N-isopropyl acrylamide-co-acrylic acid), diethylaminoethyl-dextran, poly-(N-ethyl-vinylpyridinium bromide), poly(dimethylamino)ethyl methacrylate, and/or poly(ethylene glycol)-co-poly(trimethylaminoethylmethacrylate chloride).
[0377] Embodiment 65. The method of embodiment 64, wherein the cationic polymer is polyethylenimine having a molecular weight of from about 0.8 kDa to about 10 kDa.
[0378] Embodiment 66. The method of any one of embodiments 60-65, wherein the cationic polymer is cross-linked using dithiobis[succinimidyl propionate] (DSP), 3,3′-dithiobis(sulfosuccinimidyl propionate (DTSSP), or dimethyl 3,3′-dithiobispropionimidate (DTBP).
[0379] Embodiment 67. The method of embodiment 66, wherein the cationic polymer is cross-linked using DSP.
[0380] Embodiment 68. The method of any one of embodiments 60-67, further comprising attaching a stabilizer to the nanoconstruct.
[0381] Embodiment 69. The method of embodiment 68, wherein the stabilizer is selected from the group consisting of polyethylene glycol, dextran, polysialic acid, HA, PVP, PVA, and PAM.
[0382] Embodiment 70. The method of embodiment 69, wherein the stabilizer is polyethylene glycol having a molecular weight of from about 1 kDa to about 20 kDa.
[0383] Embodiment 71. The method of embodiment 70, wherein the method comprises incubating maleimide-polyethylene glycol-N-hydroxysuccinimidyl ester (Mal-PEG-NHS) with the nanoconstruct at a weight ratio of from about 0.5:1 to about 5:1.
[0384] Embodiment 72. The method of any one of embodiments 60-71, further comprising attaching a targeting agent to the nanoconstruct.
[0385] Embodiment 73. The method of any one of embodiments 60-72, further comprising admixing the nanoconstruct with at least one type of oligonucleotide that binds noncovalently to the cationic polymer.
[0386] Embodiment 74. The method of embodiment 73, wherein the at least one type of oligonucleotide is a siRNA, miRNA, miRNA mimic, or antisense oligomer.
[0387] Embodiment 75. The method of any one of embodiments 60-74, further comprising admixing a small molecule or protein with the nanoparticle or the nanoconstruct so that the small molecule or protein binds to the nanoconstruct.
[0388] Embodiment 76. The method of embodiment 75, wherein the small molecule or protein is a chemotherapeutic agent, a label, a peptide, and/or a cytokine.
[0389] Embodiment 77. The method of any one of embodiments 60-76, further comprising lyophilizing the nanoconstruct.
[0390] Embodiment 78. The method of embodiment 77, wherein the nanoconstruct is lyophilized with trehalose.
[0391] Embodiment 79. A method of labeling a target comprising contacting the nanoconstruct of any one of embodiments 1-37 with the target under conditions to bind the nanoconstruct to the target.
[0392] Embodiment 80. The method of embodiment 79, wherein the target is a cell or protein.
[0393] Embodiment 81. The method of embodiment 80, wherein the nanoconstruct is internalized by the cell.
[0394] Embodiment 82. The method of embodiment 80 or 81, wherein the nanoconstruct binds to the exterior of the cell.
[0395] Embodiment 83. The method of any one of embodiments 79-82, wherein the label is a lanthanide, a fluorescent dye, a gold nanoparticle, a quantum dot, a PET tracer, and/or a MRI contrast agent.
[0396] Embodiment 84. The method of any one of embodiments 79-83, further comprising quantifying the amount of target by detecting the label after the nanoconstruct binds to the target.
[0397] Embodiment 85. The method of any one of embodiments 79-84, further comprising administering the labeled target to a subject and detecting the location of the target after the administering.
[0398] Embodiment 86. The method of any one of embodiments 79-85, wherein the nanoconstruct further comprises a therapeutic agent.
[0399] Embodiment 87. The method of embodiment 84 or 85, wherein the detecting is by fluorescence, magnetic resonance, or PET.
[0400] Embodiment 88. The method of any one of embodiments 79-87, wherein the nanoparticles is an iron oxide nanoparticle.