Increased yield and amount of soluble sugars allocated to fruits in tomato plants

11412701 · 2022-08-16

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to a Solanum lycopersicum plant comprising in its genome, on chromosome 1, introgressed sequences from Solanum habrochaites, wherein said introgressed sequences confer to the plant an improved phenotype corresponding to both an increased yield and an increased amount of soluble sugars allocated to fruits (Brix*Yield), with respect to a corresponding plant devoid of said sequences, and wherein said introgressed sequences are chosen from those present in the genome of a plant of the seeds ToPATYIELD NCIMB accession number 42567. The introgressed sequences are preferably characterized by defined alleles of different SNPs. on chromosome 1, inter alia allele T of SNP IL2_3605 (SEQ ID No. 9) and/or allele A of IL2_6411 (SEQ ID No. 12). The invention is also directed to parts of these plants with improved phenotype, as well as progeny, to the use of these plants for introgressing the improved phenotype in another genetic background, as well as to different methods for obtaining tomato plants or seeds with increased yield and brix*yield.

Claims

1. A Solanum lycopersicum plant comprising in its genome, on chromosome 1, introgressed sequences from Solanum habrochaites, wherein said introgressed sequences confer on the plant an improved phenotype in terms of both an increased fruit yield and an increased amount of soluble sugars allocated to fruits relative to a Solanum lycopersicum plant devoid of said introgressed sequences, and wherein said introgressed sequences (a) are present in the chromosomal region of chromosome 1 of said Solanum lycopersicum plant beginning with the nucleotide identified as SNP SL10332_112 located at position 61 of SEQ ID NO: 1 and extending through the chromosomal region to SEQ ID NO: 13 ending with the nucleotide identified as SNP EE_2225 located at position 61 of SEQ ID NO: 13; and (b) are Solanum habrochaites sequences present in the chromosomal region of chromosome 1 of deposited Solanum lycopersicum seeds having NCIMB accession number 42567, beginning with the nucleotide identified as SNP SL10332_112 located at position 61 of SEQ ID NO: 1 and extending through the chromosomal region to SEQ ID NO: 13 ending with the nucleotide identified as SNP EE_2225 located at position 61 of SEQ ID NO: 13.

2. The S. lycopersicum plant according to claim 1, having no statistically significant decrease in total soluble solids relative to a S. lycopersicum plant devoid of said introgressed sequences.

3. The S. lycopersicum plant according to claim 1, wherein said plant is indeterminate.

4. The S. lycopersicum plant according to claim 1, wherein the introgressed sequences from S. habrochaites are heterozygously present in the genome of the plant.

5. The S. lycopersicum plant according to claim 1, characterized by the presence in the genome of said S. lycopersicum plant of the following alleles: allele T at position 61 of SEQ ID No.1, allele C at position 61 of SEQ ID No.2, allele C at position 61 of SEQ ID No.3, allele G at position 61 of SEQ ID No.4, allele G at position 61 of SEQ ID No.5, allele A at position 61 of SEQ ID No.6, allele G at position 61 of SEQ ID No.7, allele T at position 61 of SEQ ID No.8, allele T at position 61 of SEQ ID No.9, allele G at position 61 of SEQ ID No.10, allele C at position 61 of SEQ ID No.11, allele A at position 61 of SEQ ID No.12 and allele Tat position 61 of SEQ ID No.13.

6. The plant according to claim 1, wherein said plant is a progeny of seeds of NCIMB accession number 42567.

7. A plant part of the S. lycopersicum plant according to claim 1, wherein said plant part comprises cells comprising in their genome on chromosome 1 the introgressed sequences from S. habrochaites conferring the improved phenotype.

8. Seed of a S. lycopersicum plant, giving rise when grown up to the plant according to claim 1.

9. A tissue culture of regenerable cells of the plant according to claim 1, wherein the regenerable cells are from embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, stems, petioles, roots, root tips, seeds, flowers, cotyledons, and/or hypocotyls, and contain in their genome the introgressed sequences from S. habrochaites on chromosome 1 conferring the improved phenotype.

10. The plant part according to claim 7, wherein the presence of said introgressed sequences on chromosome 1 is characterized by the presence of allele T at position 61 of SEQ ID No.9 and the presence of allele A at position 61 of SEQ ID No.12.

11. A method for detecting and/or selecting S. lycopersicum plants according to claim 1, said method comprising detecting of the following markers: allele T at position 61 of SEQ ID No.1, allele C at position 61 of SEQ ID No.2, allele C at position 61 of SEQ ID No.3, allele G at position 61 of SEQ ID No.4, allele G at position 61 of SEQ ID No.5, allele A at position 61 of SEQ ID No.6, allele G at position 61 of SEQ ID No.7, allele T at position 61 of SEQ ID No.8, allele T at position 61 of SEQ ID No.9, allele G at position 61 of SEQ ID No.10, allele C at position 61 of SEQ ID No.11, allele A at position 61 of SEQ ID No.12 and allele Tat position 61 of SEQ ID No.13, in a genetic material sample of the plant to be selected, whereby the presence of the markers allows for detecting and/or selecting of said plant.

Description

LEGEND OF THE FIGURES

(1) FIG. 1: this figure illustrates the yield of several introgression lines from the population mentioned in example 2. ToPATYIELD is among the few plants having an increased brix*yield compared to the recurrent parent Moneyberg. Brix*yield measurements of individual plans are shown by grey dots, Mean and ANOVA for each introgression line are indicated in rectangles. All rectangles above the horizontal grey line (crossing the Y axes at ˜24000) indicate lines with significantly higher brix*yield values (p<0.05).

(2) FIG. 2: this figure illustrates the mean values of Brix*Yield for three different hybrids compared to a control corresponding to a cross between HAZ3 (proprietary inbred line of S. lycopersicum) and Moneyberg without any wild species DNA. Hybrid 3 was created by crossing HAZ3 and the ToPATYIELD. Hybrids 1 and 2 were created by crossing HAZ3 and other introgression lines carrying a genomic fragment from other wild species at the bottom end of chromosome 1. Only hybrid 3 has a brix*yield which is significantly higher than the control (p<0.01).

EXAMPLES

Example 1: Introgression of a Genomic Fragment from Lycopersicum pennellii LA 716 into an Indeterminate Lycopersicum esculentum Genetic Background

(3) In a first step, a determinate Lycopersicum esculentum (=S. lycopersicum) plant was created according to the method described by Eshed and Zamir in 1995 with the M82 determinate Lycopersicum esculentum as recurrent parent and Lycopersicum pennellii LA716 as introgression donor.

(4) As a results of such first step, the M82 Lycopersicum esculentum plant obtained contained the expected LA716 introgression fragment on the lower arm of chromosome 1 and showed the expected increase in yield both in inbred or in hybrid combination.

(5) It is well known by the man skilled in the art that the crossing of an inbred determinate line with an inbred indeterminate line produces an indeterminate hybrid plant. As such, in a second step, the M82 L. esculentum plant containing the LA716 introgression fragment on the lower arm of chromosome 1 was crossed to a an indeterminate proprietary line, to produce an indeterminate hybrid plant, which yield was measured over three seasons both in South of France and in Israel.

(6) As a check, a hybrid was made between the first M82 inbred not containing the LA716 introgression fragment and the second proprietary inbred line.

(7) There was no yield difference between the two hybrids, demonstrating that the LA716 introgression fragment does not provide any yield increase in an indeterminate Lycopersicum esculentum plant.

Example 2: Introgression of a Genomic Fragment from Lycopersicum Habrochaites

(8) The present inventors created an introgression line population by crossing a wild species donor S. habrochaites (HABR1) and the indeterminate Lycopersicum esculentum recurrent parent Moneyberg.

(9) After several backcrosses to the indeterminate recurrent parent Moneyberg, a population made of 62 introgression lines (IL) covering the S. habrochaites genome of HABR1 was obtained.

(10) Identification of the S. habrochaites Genomic Fragment Affecting Yield

(11) Phenotypic Data:

(12) The IL population was screened for yield. Various parameters affecting yield like flowering time, percentage of fruit set, time for ripening, number of fruits per cluster and the number of ripe clusters in a season were measured during the growth season, in order to identify to what elements might be due an increase in yield.

(13) Fruit weight (i.e. the summed weight of all harvested fruit) and the Total Soluble Solids (TSS) content of fruit were measured immediately after fruit harvest. The yield is measured throughout the growing season: the plants are grown in greenhouses which are visited several times by the inventors who harvested the tomato clusters when 50% of the fruits of a given tomato cluster are ripe. At the end of the growing season, the weight of all fruits is summed, to provide the plant yield. The growing season varies according to local practices, for example in Israel, there are two growing seasons, one from August/September to February/March and a second one from March to August. The plant according to the invention shows a yield increase over the season versus plants not containing the introgression fragment, irrespective of the season or the location.

(14) Brix*Yield value per plant was evaluated by multiplying the total weight of the harvested fruit per plant and the average Total Soluble Solids (TSS) of five ripe fruits per plant, measured by a refractometer. Whereas the parameter thus measured is TSS*Yield, it can be assimilated to Brix*Yield, given the correlation between Brix and TSS, and because the data really informative is the % increase of this TSS*Yield or Brix*Yield and not the absolute level of TSS*Yield or Brix*Yield. The extent of % increase of TSS*Yield and of Brix*Yield are expected to be very similar.

(15) The line called ToPATYIELD was identified as having a higher brix*yield compared to the recurrent parent (Moneyberg) and was selected for further analysis. At this point, the inventors have demonstrated that a S. habrochaites genomic fragment from HABR1 (the wild parent) could provide an increase of the brix*yield value in indeterminate tomatoes. The next steps were to identify the genomic fragment responsible for such phenotype.

(16) Molecular Marker Identification:

(17) Genomic DNA from tomato leaves was extracted using Qiagen DNeasy plant DNA extraction kit.

(18) SNP Set Selection

(19) On basis of public domain SNP datasets such as what can be found in EUSOL, in the sol genomics network or in the PGSB Plant Genome and Systems Biology dedicated to tomato, a SNP selection has been performed and a first set of 384 SNP created:

(20) The selection of the SNPs was performed applying the following filter steps: Filter 1: SNP score and design ability: One SNP per loci/contig was selected, having an Illumina score of 0.7 or higher (in accordance to Illumina's standards). Filter 2: Repetitiveness: Sequences were BLASTed against plant repetitive sequence databases, and SNPs with hits in these regions were de-selected. Filter 3: Genotypic information: In cases were genotypic information was available, from public domain resources, SNPs showing no segregation across samples were de-selected. Filter 4: Unique SNP information: Deselection for the identical SNP/loci derived from different datasets. SNP sequences having more than 90% BLAST overlap were considered as identical. Filter 5: Genome coverage and distribution: The selected SNPs were inspected for their genome coverage and distribution. This was done by BLAST-placing the SNP sequences in the WGS (Whole Genome Sequencing) and subsequently identifying the chromosome location and SNP position.

(21) SNP Genotyping

(22) High-throughput SNP genotyping was carried out with the GoldenGate assays and the BeadXpress reader from Illumina. The genotypes of the ILs and the two parental lines were screened with the 384 markers in a single plate. SNP genotyping data was scored using the Illumina GenomeStudio genotyping software with a no-call threshold of 0.25.

(23) Illumina GoldenGate Technology Details

(24) A SNP set was designed for the Illumina GoldenGate assay, which used locus and allele-specific oligos with cy3/cy5 labeling to detect SNP alleles at each locus. These custom Oligo Pool Assay (OPA) sets were then run on the Illumina BeadXpress Reader as 384-plex VeraCode assays. Veracode uses cylinder microbeads with an internal barcode to differentiate bead types which correspond to different SNP loci (384 bead types are used for a 384-plex SNP set), and each microbead was coated with oligos that contain a unique address that hybridizes with the labeled products. During scanning on the BeadXpress Reader, the beads were aligned in a groove plate, and the bead codes and cy3/cy5 signal intensities were measured across replicated sets of beads to assign the SNP alleles. This procedure allowed a rapid, high-quality SNP calling of 96 samples by 384 SNPs without requiring fixed arrays. The GenomeStudio software from Illumina was used for clustering alleles based on the ratio of the cy3/cy5 signal intensities to call the three genotype classes. This was done first with the 384 SNP identified, but in order to increase the precision of the analysis, a second additional set of 384 other SNP markers was created, similarly to the process described for the first set, leading to a 768 SNP markers set altogether).

(25) Selection of Polymorphic SNPs

(26) SNPs with call rate below 70% or with no polymorphism between donor and recurrent parents were removed from the analysis, resulting in 353 SNPs that were retained as technically valid and polymorphic markers from the first plate and additional 307 SNPs from the second plate. Altogether 660 SNPs were used for further analysis.

(27) Results:

(28) Association analysis of the ToPATYIELD plant identified a set of markers significantly linked to the yield increase. The list of associated markers and their positions are summarized in table 1. The sequences of these SNPs, including the flanking sequences are reported in table 2 and accompanying sequence listing, part of the application.

(29) Results showed that the locus responsible for the yield increase was located in chromosome 1, on an introgression fragment of 6.271 Mbp, between position 91 778 012 and position 98 049 922, such physical position on the genome being based on the version 2.5 of the tomato genome (Bombarely 2011).

(30) TABLE-US-00001 TABLE 1 list of SNPs, their position, and the alleles of the wild parent and recurrent parent SNP SEQ ID No Position Moneyberg ToPATYIELD SL10332_112 1 91778012 C/C T/T EP_1592 2 92005578 T/T C/C EP_1027 3 92495820 T/T C/C EP_1150 4 92738302 T/T G/G EP_1876 5 94343410 A/A G/G EE_4621 6 94819866 G/G A/A SL10522_138 7 95107106 T/T G/G EP_0051 8 95123471 C/C T/T IL2_3605 9 96217112 G/G T/T SL20213_779 10 96487626 A/A G/G SL20071_190 11 97885427 A/A C/C IL2_6411 12 97892448 C/C A/A EE_2225 13 98049922 C/C T/T

(31) TABLE-US-00002 TABLE 2 sequences of the SNPs Sequence of the SNPs; the allele associated with SEQ the yield increase, i.e. the s. habrochaites is ID Nom du SNP mentioned second in the bracket  1 SL10332_112 AGAAACAAATACTTGTTAACAACTTAACATGATGTAATGGTAAATAT GAACACATAGAAA[C/T]GGGGACAAAAAATAAAGGTCTTCTAATGCT CTTCAGATGAAGCAACACTGGTAATGTTAG  2 EP_1592 GAGAAAAAGACCATTAGACAAAGAAAAGGTGTTTTGATAGCTACGG AGAAAAAGAGAAAG[T/C]ATAGAGAAAAAAAGCAAAACAGGGAGAT GAAAGGGGTCTCTAATGGGAGATCCATTCCCT  3 EP_1027 CTGGACAATTTAGAGCTGAATCTTGATATTCTGCCAATTGCTATGGT AATTGCAGCATCA[T/C]AAGAAGCTCAAAGGCTTAAGGCTTGGAGAT TTACTTCATGGAGTGGGGGGAGATTATGGT  4 EP_1150 GTAATAGAGAAACTGAAAGAAAAAAGGGACAAAAATCAAGCTGTCC CGGCATTTACTCTT[T/G]NTTTTCTACCAGCTTTCTCTACTTTTGTCT GATCTTACGAAATGTAACCGCTTCACTCAT  5 EP_1876 TGTCTACAAAATGTGGGAGGTACAAAGAGGGATTTGATTTTAGTGC TGAGAGAGTGACTA[A/G]AAGTATTGATGAGAGCTTGGAGAGGCTG CAGCTTGATTATGTTGATATGTTACAATGTCA  6 EE_4621 CATCAAAATCCAGAACAAGGAAATGAAACGAAGCTTCTTAGATTGT TCTTCTGAAGATTG[G/A]TCCAACTATTAGTTTGGCCTACTTACAAGT TACCGATTAACTTAAGCTTAGGAAGCGAAT  7 SL10522_138 CACAATAAGGTAAACATATCATGCAGTTTGCTGGTTTTGACTCTTAG ATTGAGCAGACAA[T/G]AGGGGGTTGCTGAGGTGGTAAGCACTCTT CACCTCCAACACCAAGGTTGCTGGTAGCAAA  8 EP_0051 ACTCATCAGCAAAAGGAACAGAATCTTGGCTTCTGCTCCTGTTTCT TCACCCTTCACTTC[C/T]CCAAATGAAGAGTCCGAAAAAGCTAAGTT AGCTCAGGTTGCCAAAAGACTACTGAATACT  9 IL2_3605 CATTAGAGCATCTGGTGGATTCAGAAATTCTTTCACTAAAGCTCATG GAATTTCAAACAC[G/T]ATTGGAATCATCCTTCTTCTGGTATATCCAG TCTGGGCATTGATTCTCCACTTTCTATAA 10 SL20213_779 ATTTGTATTTCATCGTAGCAAGTCAGAAGTGTATTTCTGCTTGAAAT GTTTTTTATGTGC[A/G]TTGATTAGTGAAAATACAGAATACTTTCTAA TGGTACACAAAATTATTTTCTTTGTCGAA 11 SL20071_190 TGTAATATAATATGCTTCAACAGTATTTATTCAACATATAGCCATTGA TATCATTCAAAC[A/C]AAGCACTCCCAGTTTCGCATAGAGGTACCAT TTAACCAAACTGGAGGAATAAATTATCTC 12 IL2_6411 TCAGGAAACTCTTCTTAATCTGCTATTGCGGAATTATCTTCACTACA ACTTGTACGATCA[C/A]GCAGAGAAATTGAGGTCAAAGGCCCCCCA TTTTGAAGCTCATTCAAATCAGCAGTTCTGC 13 EE_2225 TTTTCATAGGAAAAAATTGGAGGTTTACAATGAGGTGCTTCGGAGG CTTAAAGAAGAATC[C/T]GACAATAACGACACTTTACAATCTGCTTTT GACGATGAACTTTGGGCTCATTTCAATCGC

(32) Comparison of Hybrid Combinations:

(33) The Brix*yield value of three hybrids made by crossing introgression lines with an indeterminate proprietary inbred line named HAZ3 was measured similarly to what is described here before.

(34) Hybrid 1 results from the cross of HAZ3 with an introgression line containing a genomic introgression fragment from the bottom arm of chromosome 1 of S. chmielewskii,

(35) Hybrid 2 results from the cross of HAZ3 with an introgression line containing the chromosome 1 genomic introgression fragment from LA716 while Hybrid 3 results from the cross of HAZ3 with ToPATYIELD introgression line containing the genomic introgression fragment of the present invention.

(36) The resulting indeterminate hybrids were grown at three locations (Hazav and Beit Hanan, Israel and St. Remy, France) during three seasons. As control the present inventors used a cross between HAZ3 and Moneyberg without any wild species DNA (Control). Mean values of Brix*Yield for all hybrids were compared to the control. Only the hybrid with the S. habrochaites fragment (Hybrid 3) had a higher Brix*Yield value (p<0.01) (see FIG. 2).

(37) Very interestingly, the genomic fragment in these three IL lines are located in the same region of chromosome 1, but confer different phenotypes, depending on the introgressed sequences and thus introgression donor.

(38) Further Comparison of Hybrid Combinations:

(39) The effect of the S. habrochaites introgression fragment is measured on yield, brix and brix*yield by comparing hybrids made by crossing a proprietary inbred line with ToPATYIELD (“hybrid ToPATYIELD”) or with the recurrent parent Moneyberg (“hybrid Moneyberg»). Values labeled with * are statistically significant (p<0.01). Combined results of trial conducted over two years at Hazav, Israel and one year at St. Remy, France, are reported in table 3.

(40) TABLE-US-00003 TABLE 3 Hybrid Hybrid Moneyberg ToPATYIELD Average fruit weight per 2.941 3.915* plant (kg) Average Brix (%) 4.03 4.22 Average Brix*Yield per 12.431 17.488* plant (%*kg)

Example 3: Further Breeding and Development of Indeterminate Inbred and Hybrid Plants

(41) Creation of BC2S2 Seeds:

(42) The line called ToPATYIELD was crossed with a proprietary indeterminate breeding line to create BC2S2 seeds as described hereafter: the line ToPATYIELD is crossed once with the proprietary indeterminate breeding line and the resulting plant is backcrossed two times to the proprietary indeterminate breeding line. The BC2 plant is self-pollinated once to obtain a BC2S1 and plant which is itself self-pollinated to obtain the BC2S2 seeds.

(43) One will note that the presence of the S. habrochaites genomic fragment is followed through the breeding steps by the use of the molecular markers described here before, especially IL2_6411 and IL2_3605.

(44) Creation of Two New Indeterminate Inbred Lines:

(45) The BC2S2 plants containing the introgression fragment from S. habrochaites on chromosome 1 has been used in crosses with two independent, unrelated indeterminate breeding lines, HAZ Line 1 and HAZ Line 2, generally used for producing indeterminate hybrid tomato plants with round fruits of about 150-200 grams.

(46) In both cases, the BC2S2 plants are crossed once with the HAZ 1 or to the HAZ 2 line, followed by four backcrosses and a self, leading to two indeterminate BC4S1 plants, HAZ-1-BC4S1-ToPATYIELD and HAZ-2-BC4S1-ToPATYIELD, having the genetic background of HAZ-1 or HAZ-2 indeterminate plants and the introgression fragment from S. habrochaites on chromosome 1. Similarly to the creation of the BC2S2 plants, the introgression fragment from S. habrochaites on chromosome 1 is followed through the breeding steps by the use of the molecular markers.

(47) Creation of Four Indeterminate Hybrids:

(48) The two indeterminate BC4S1 plants, HAZ-1-BC4S1-ToPATYIELD and HAZ-2-BC4S1-ToPATYIELD, having the introgression fragment from S. habrochaites on chromosome 1 were crossed with proprietary inbred lines HAZ-A and HAZ-B to create two new hybrids.

(49) In parallel, lines HAZ-1 and HAZ-2 were also crossed with HAZ-A and HAZ-B, so that the hybrids resulting from the various crosses could be compared.

(50) Table 4 below summarizes the name of the hybrids and of the parents and specifies the hybrids having the introgression fragments.

(51) TABLE-US-00004 TABLE 4 HAZ-A HAZ-B HAZ-1 Hybrid 1 / HAZ-1-BC4S1- Hybrid 1 having the / ToPATYIELD introgression fragment HAZ-2 / Hybrid 2 HAZ-2-BC4S1- / Hybrid 2 having the ToPATYIELD introgression fragment

(52) All four hybrids were grown in Yad Natan, Israel, in a greenhouse with drip irrigation system under standard winter growing conditions (from September with planting to February at final harvest. Day length is between 10 and 12 hours of light per day and average temperature in ° C. is based on data from the Israeli Meteorological Services, see table 5).

(53) TABLE-US-00005 TABLE 5 Month Average low Average high September 19.5 31.5 October 16.7 28.5 November 12.5 23.5 December 8.9 18.8 January 7.6 16.7 February 7.5 17.5

(54) Tomato clusters were harvested when 50% of the fruits of a cluster were ripe (full red). The number of fruits on each plants and individual fruit weight in grams were recorded for each cluster. Total yield was calculated as the sum of all individual fruits. Fruit total soluble solid was measured for up to three red fruits per cluster with a digital refractometer. In view of the similarity of these parameters, Brix*Yield (last column) is assimilated to Yield x TSS.

(55) Results are given in table 6 and 7, for two years, (*) indicates statistically significant results (n=15; P<0.05).

(56) TABLE-US-00006 TABLE 6 Result obtained for Year 1 number of fruit size Yield Year 1 fruit/plant (gr) (g/plant) TSS Brix*Yield Hybrid 1 24 191.2 3100 4.008 12430  Hybrid 1 26 208.2  3900* 3.930 15330* introgression fragment Hybrid 2 30 134.7 2450 4.055 9940 Hybrid 2  37* 129.1  3310* 3.863 12790* introgression fragment

(57) TABLE-US-00007 TABLE 7 Result obtained for Year 2 number of fruit size Yield Year 2 fruit/plant (gr) (g/plant) TSS Brix*Yield Hybrid 1 23 140.6 3200 4.04 12930 Hybrid 1 24.9 155*   3900* 4.3  16770* introgression fragment Hybrid 2 27.4 107   2890 4.23 12250 Hybrid 2 31.1 112.4  3480* 4.07  14160* introgression fragment

(58) These tables clearly show that all hybrids having the introgression fragment have an increased yield and an increased Brix*Yield, with respect to the corresponding hybrids not having the introgression fragment.

(59) Moreover, it can be observed that the increased yield and increased Brix*Yield is not accompanied by a statistically significant decrease of the brix (TSS).

Example 4: Introgression of a Genomic Fragment from Lycopersicum hirsutum LA1777 into an Indeterminate Lycopersicum esculentum Genetic Background

(60) The Monforte et al, 2000 publication discloses tomato plants, comprising an introgression fragment from the S. habrochaites accession LA1777 on chromosome 1, allegedly imparting increased yield and brix*yield of the plants, especially at the heterozygous stage. This document however only relates and describes tomato plants having determinate growth habits.

(61) In order to assess the possibility to use the LA1777 introgression in indeterminate tomatoes, so that it can also confer the same increased yield and brix*yield phenotype not only in determinate tomatoes, but also in indeterminate ones, the present inventors assessed the brix*yield increase in a hybrid cross leading to a tomato plant with an indeterminate habit by crossing a plant carrying the LA1777 introgression (namely the Near Isogenic Line TA523 referred to in Monforte et al) with an indeterminate line (4131).

(62) As a control, a hybrid cross was made between the very same plant not carrying the LA1777 introgression (namely from line E6203, as TA523 is a NIL comprising a single introgression from LA1777) and the same indeterminate line (4131).

(63) All growth, harvest and phenotyping were done as described in example 3. Tomato clusters were harvested when 50% of the fruits of a cluster were ripe (full red). The number of fruits on each plants and individual fruit weight in grams were recorded for each cluster. Total yield was calculated as the sum of all individual fruits (gram per plant). Fruit total soluble solid was measured for up to three red fruits per cluster with a digital refractometer. In view of the similarity of these parameters, Brix*Yield (last column) is assimilated to Yield x TSS. The trial included three replicates of five plants per genotype (i.e. a total of 15 plants per genotype), and seven clusters.

(64) The results are presented in table 8.

(65) TABLE-US-00008 TABLE 8 Brix*Yield summary (i.e. total fruit weight multiplied by sugar content total amount of carbohydrates allocated to the fruit) Brix*Yield for Brix*Yield for E6203 × 4131 TA523 × 4131 Cluster 1 3068.73 2797.76 Cluster 2 2407.72 3181.39 Cluster 3 2932.89 2955.12 Cluster 4 3652.37 3541.73 Cluster 5 3704.32 3839.68 Cluster 6 3165.55 3651.9 Cluster 7 2962.12 1969.73 Mean of the 21893.7 21937.31 clusters

(66) The data clearly demonstrate that the LA1777 introgression does NOT lead to any statistically significant brix*yield increase in tomatoes having an indeterminate growth habit.

REFERENCES

(67) Bernacchi et al. 1998a. Advanced backcross QTL analysis in tomato. I. Identification of QTLs for traits of agronomic importance from Lycopersicum hirsutum. Theor. Appl. Genet. 97: 381-397 Bernacchi et al. 1998b Advanced backcross QTL analysis of tomato. II. Evaluation of near-isogenic lines carrying single-donor introgressions for desirable wild QTL-allele derived from Lycopersicum hirsutem and L. pimpinellifolium. Theor. Appl. Genet. 97: 170-180 Eshed and Zamir 1995, An introgression line population of Lycopersicum pennellii in the cultivated tomato enables the identification and fine mapping of yield-associated QTL. Genetics 141: 1147-1162 Eshed and Zamir. 1996. Less-than-additive epistatic interactions of quantitative trait loci in tomato. Genetics 143 1807-1817. Monforte A. J. & Tanksley S. D. 000. Fine mapping of a quantitative trait locus (QTL) from Lycopersicon hirsutum chromosome 1 affecting fruit characteristics and agronomic traits: breaking linkage among QTLs affecting different traits and dissection of heterosis for yield. Theor Appl Genet 100:471-479. Stevens, M., and Rick, C. M. 1986. Genetics and Breeding. In: The Tomato Crop. A scientific basis for improvement, pp. 35-109. Atherton, J., Rudich, G. (eds.). Chapman and Hall, New York.