Vaccine compositions
11406698 · 2022-08-09
Assignee
Inventors
Cpc classification
C12N2770/24134
CHEMISTRY; METALLURGY
A61K2039/58
HUMAN NECESSITIES
C07K16/1081
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61K2039/55561
HUMAN NECESSITIES
C12N2710/14143
CHEMISTRY; METALLURGY
A61K47/26
HUMAN NECESSITIES
C12N2770/36134
CHEMISTRY; METALLURGY
A61K9/0019
HUMAN NECESSITIES
C12N2770/24151
CHEMISTRY; METALLURGY
A61K47/42
HUMAN NECESSITIES
A61K2039/55572
HUMAN NECESSITIES
International classification
A61K47/26
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
A61K47/42
HUMAN NECESSITIES
A61K47/18
HUMAN NECESSITIES
Abstract
The present disclosure provides vaccine compositions for prophylaxis and treatment of Zika virus infections comprising Zika virus antigens in immunogenic compositions, and in combination of Zika antigens with one or more arbovirus antigens such as Chikungunya virus and Japanese encephalitis virus antigens, methods of preparation and production of such compositions for use as vaccines for eliciting immune response in mammals against the above mentioned pathogens.
Claims
1. An immunogenic composition comprising a structural antigen of Zika virus and a structural antigen of Chikungunya virus, wherein the structural antigen of Zika virus comprises an amino acid sequence encoded by the sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or the amino acid sequence as set forth in SEQ ID NO: 3 or SEQ ID NO: 4; and a pharmaceutically acceptable buffer; wherein the Zika virus and the Chikungunya virus are subjected to inactivation such that the composition is rendered non-infectious, and wherein the composition elicits an immune response to Zika virus and Chikungunya virus in mammals.
2. The composition according to claim 1, wherein the Zika virus and/or the Chikungunya virus is a whole virus.
3. The composition according to claim 2, wherein the inactivation was performed by exposure of the whole virus to one or more treatments selected from the group consisting of a treatment with a chemical inactivating agent, treatment with a physical inactivating agent, treatments with an irradiating agent, and heat treatments.
4. The composition according to claim 3, wherein the chemical inactivating agent is selected from the group consisting of formalin (formaldehyde), beta propiolactone (BPL) and hydrogen peroxide.
5. The composition according to claim 3, wherein the irradiating agent comprises gamma irradiation or UV irradiation.
6. The composition according to claim 1, wherein the Zika virus and/or the Chikungunya virus is purified and inactivation is carried out before or after purification.
7. The composition according to claim 1, wherein the Zika antigen comprises one or more antigens selected from envelope (E) protein, membrane (M) protein, and prME protein, obtained or derived from the Zika virus.
8. The composition according to claim 1, wherein the Chikungunya antigen comprises one or more antigens selected from the group consisting of capsid protein, E1 protein, E2 protein, and 6k protein, obtained or derived from the Chikungunya virus.
9. The composition according to claim 1, wherein the Zika antigen and/or the Chikungunya antigen are expressed as virus like particles in a prokaryotic or eukaryotic expression system.
10. The composition according to claim 1, wherein the composition elicits Th1 and/or Th2 immune response to infection by Zika virus and Chikungunya virus.
11. The composition according to claim 1, wherein the buffer is selected from the group consisting of a phosphate buffer, a sodium chloride buffer, a citrate buffer, a phosphate citrate buffer, a borate buffer, a tris(hydroxymethly)aminomethane (Tris) containing buffer, a succinate buffer, and buffers containing glycine or histidine as one of the buffering agents.
12. The composition according to claim 11, wherein the phosphate buffer comprises sodium phosphate at concentration of 5 mM up to 200 mM of phosphate ions at a pH of 6.5 to 9, or the sodium chloride buffer comprises sodium chloride at a concentration of 50 mM to 200 mM.
13. The composition according to claim 1, wherein the composition further comprises an adjuvant.
14. The composition according to claim 13, wherein the adjuvant is selected from the group consisting of: an aluminum salt; inulin; algammaulin; monophosphoryl lipid A (MPL); resiquimod; muramyl dipeptide (MDP); N-glycolyl dipeptide (GMDP); polylC; CpG oligonucleotide; aluminum hydroxide with MPL; water in oil emulsion; oil in water emulsion; and combinations thereof.
15. The composition according to claim 14, wherein the composition comprises aluminum hydroxide at a concentration of from 0.1 mg to 1.5 mg of aluminum per vaccine dose.
16. The composition according to claim 1, which comprises 2-phenoxyethanol at a concentration of 2.5 to 5 mg/mL.
17. The composition according to claim 1, wherein the composition is in a liquid or a lyophilized form.
18. The composition according to claim 1, wherein the composition is contained within pre-filled syringes, microneedle patch, needle-free patch, and/or inhalation or nasal sprays.
19. An Immunogenic composition comprising: one or more recombinant antigens of a structural protein of a Zika virus and one or more recombinant antigens of a structural protein nucleic acid of a Chikungunya virus, and a pharmaceutically acceptable buffer, wherein the structural protein of Zika virus comprises an amino acid sequence encoded by the sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or the amino acid sequence as set forth in SEQ ID NO: 3 or SEQ ID NO: 4; and wherein the composition elicits an immune response to infection by Zika virus and Chikungunya virus in a mammal.
20. The composition according to claim 19, wherein the one or more recombinant antigens are selected from the envelope (E) protein, membrane (M) protein, and prME protein, obtained or derived from the Zika virus, and one or more recombinant antigens are selected from capsid protein, E1 protein, E2 protein, and 6k protein, obtained or derived from the Chikungunya virus.
21. The composition according to claim 19, wherein the one or more recombinant antigens are expressed as virus like particles in a prokaryotic or eukaryotic expression system.
22. The composition according to claim 19, which elicits Th1 and/or Th2 immune response against infection by Zika virus and by Chikungunya virus in the mammal.
23. The composition according to claim 19, wherein the buffer is selected from the group consisting of a phosphate buffer, a sodium chloride buffer, a citrate buffer, a phosphate citrate buffer, a borate buffer, a tris(hydroxymethly)aminomethane (Tris) containing buffer, a succinate buffer, and buffers containing glycine or histidine as one of the buffering agents.
24. The composition according to claim 23, wherein the phosphate buffer comprises sodium phosphate at concentration of 5 mM up to 200 mM of phosphate ions at a pH of 6.5 to 9 or the sodium chloride buffer comprises sodium chloride at a concentration of 50 mM to 200 mM.
25. The composition according to claim 19, wherein the composition comprises an adjuvant.
26. The composition according to claim 25, wherein the adjuvant is selected from the group consisting of an aluminum, inulin, algammaulin, monophosphoryl lipid A (MPL), resiquimod, muramyl dipeptide (MDP), N-glycolyl dipeptide (GMDP), polylC, CpG oligonucleotide, aluminum hydroxide with MPL, water in oil emulsion, oil in water emulsion, and combinations thereof.
27. The composition according to claim 26, wherein the adjuvant comprises aluminum hydroxide at a concentration of 0.1 mg to 1.5 mg of aluminum per vaccine dose.
28. The composition according to claim 19, wherein the composition comprises 2-phenoxyethanol at a concentration of 2.5 to 5 mg/mL.
29. The composition according to claim 19, which is aqueous or lyophilized.
30. The composition according to claim 19, which is contained within pre-filled syringes, microneedle patch, needle-free patch, and/or inhalation or nasal sprays.
31. The composition of claim 4, wherein the inactivation comprises a treatment selected from the group consisting of: (a) treatment with formalin at a formalin to virus ratio of 1:500 to 1:4000 (v/v) at 8° C. to 37° C. for 1 to 7 days; (b) treatment with formalin at a formalin to virus ratio of 1:500 to 1:4000 (v/v) at 2° C. to 8° C. for 10 to 30 days; (c) treatment with formalin at a formalin to virus ratio of 1:500 to 1:4000 (v/v) at 25±3° C. for 1 to 7 days; (d) treatment with Beta-propiolactone (BPL) at a BPL to virus ratio of 1:500 to 1:4000 (v/v) at 8° C. to 30° C. for 24 to 48 hours; (e) treatment with BPL at a BPL to virus ratio of 1:500 to 1:4000 (v/v) at 2° C. to 8° C. for 3 to 7 days; (f) treatment with BPL at a BPL to virus ratio of 1:500 to 1:4000 (v/v) at 25±3° C. for 48 hours; (g) treatment with formalin as set forth in a, b, or c, plus treatment with BPL as set forth in d, e, or f; (h) treatment with formalin at a formalin to virus ratio of 1:3000 (v/v) at 15° C. to 30° C. for 24 to 48 hours plus treatment with BPL and BPL to virus ration of 1:3000 (v/v) at 15° C. to 30° C. for 24 hours; (i) treatment with formalin at a formalin to virus ratio of 1:3000 at 25±3° C. for 24 to 48 hours plus treatment with BPL at a BPL to virus ration of 1:3000 (v/v) at 25±3° C. for 24 hours; (j) treatment with hydrogen peroxide at a hydrogen peroxide concentration of 0.1% to 3% at 20° C. to 30° C. for 5 minutes to 120 minutes; and (k) treatment with hydrogen peroxide at a hydrogen peroxide concentration of 0.1% to 1% at 20° C. to 30° C. for 5 minutes to 120 minutes.
32. An immunogenic composition comprising an antigen obtained or derived from a Zika Virus, and a pharmaceutically acceptable buffer, wherein the antigen is rendered non infectious through inactivation and/or is recombinantly engineered from the nucleic acid of a Zika virus; and the antigen contains the amino acid sequence of SEQ ID NO 3 and/or SEQ ID NO 4.
33. The immunogenic composition of claim 32, wherein the Zika virus and the CHIKV virus are inactivated and inactivation comprises a treatment selected from the group consisting of: (a) treatment with formalin at a formalin to virus ratio of 1:500 to 1:4000 (v/v) at 8° C. to 37° C. for 1 to 7 days; (b) treatment with formalin at a formalin to virus ratio of 1:500 to 1:4000 (v/v) at 2° C. to 8° C. for 10 to 30 days; (c) treatment with formalin at a formalin to virus ratio of 1:500 to 1:4000 (v/v) at 25±3° C. for 1 to 7 days; (d) treatment with Beta-propiolactone (BPL) at a BPL to virus ratio of 1:500 to 1:4000 (v/v) at 8° C. to 30° C. for 24 to 48 hours; (e) treatment with BPL at a BPL to virus ratio of 1:500 to 1:4000 (v/v) at 2° C. to 8° C. for 3 to 7 days; (f) treatment with BPL at a BPL to virus ratio of 1:500 to 1:4000 (v/v) at 25±3° C. for 48 hours; (g) treatment with formalin as set forth in a, b, or c, plus treatment with BPL as set forth in d, e, or f; (h) treatment with formalin at a formalin to virus ratio of 1:3000 (v/v) at 15° C. to 30° C. for 24 to 48 hours plus treatment with BPL and BPL to virus ration of 1:3000 (v/v) at 15° C. to 30° C. for 24 hours; (i) treatment with formalin at a formalin to virus ratio of 1:3000 at 25±3° C. for 24 to 48 hours plus treatment with BPL at a BPL to virus ration of 1:3000 (v/v) at 25±3° C. for 24 hours; (j) treatment with hydrogen peroxide at a hydrogen peroxide concentration of 0.1% to 3% at 20° C. to 30° C. for 5 minutes to 120 minutes; and (k) treatment with hydrogen peroxide at a hydrogen peroxide concentration of 0.1% to 1% at 20° C. to 30° C. for 5 minutes to 120 minutes.
34. The composition of claim 14, wherein the aluminum salt comprises aluminum hydroxide, aluminum phosphate or aluminum sulfate phosphate.
35. The composition of claim 26, wherein the aluminum salt comprises aluminum hydroxide, aluminum phosphate or aluminum sulfate phosphate.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4) In both the inactivation procedures, of
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14) Formalin inactivated, alum adsorbed Zika virus vaccine antisera from vaccinated mice neutralized the homologous MR766 Zika virus strain (
(15)
(16)
(17)
(18)
(19) In 9A-9D, individual animal data is plotted. Zika virus antigen was immunogenic even without an adjuvant. Data from other dose ranges were estimated but not included in the graph.
(20)
(21)
(22)
(23) In all cases, in
(24)
(25)
(26) In all cases, in
DETAILED DESCRIPTION OF THE INVENTION
(27) This disclosure concerns formulation of vaccine compositions. The invention discloses in particular, preparation and formulation of vaccine antigens of Zika virus in monovalent compositions and in combination with other arboviruses such as Chikungunya and/or Japanese encephalitis viruses. In particular, the invention discloses compositions for prophylaxis and treatment of Zika virus infections.
(28) One aspect of the invention is that the methods of preparation, formulation and use of Zika antigens as vaccine for eliciting immune response is applicable to any genotype, genotypic variants or any strain of Zika virus wherein one genotype of Zika virus cross neutralizes a heterologous strain efficiently. The Zika virus can be selected from Asian, West African or East African genotype of the virus. Therefore, the methods described in the current invention herein are applicable to Zika virus of any genotype/strain, live attenuated Zika virus, deactivated virus, virus like particles, chimeric virus particles that carry any Zika virus antigens particularly the E protein and the M protein in any heterologous virus backbone, in vectored vaccines and infectious synthetic virus particles derived in vitro or in vivo using the sequence of any Zika virus genome. A chimeric virus has the nucleic acid of a heterologous virus and nucleic acid of Zika virus.
(29) In the context of the immunogenic compositions disclosed herein, in particular the bulk antigen used for preparation of immunogenic compositions, the methods of preparation, formulations and use of Zika vaccine antigens are applicable to any of the aforementioned Zika virus types, that share at least 50% amino acid identity and up to 100% amino acid identity across any region of the genome. In the context of the immunogenic compositions disclosed herein, sequence of Zika virus MR766 strain of African genotype (SEQ ID NO:5 for genomic nucleotide sequence and SEQ ID NO:6 for complete ORF) shares more than 96.5% amino acid identity in the structural Envelope protein with the Asian genotype strain FSS13025 and whose sequence is disclosed in SEQ ID NO:7 and SEQ ID NO:8 for the nucleotide and protein sequences respectively. Vaccine antisera of the MR766 strain cross neutralized the FSS13025 strain with 100% equivalent potency as the homotypic MR766 strain. Also in the context of the disclosure herein, Zika virus prME (SEQ ID NO:3) antisera efficiently cross neutralized the MR766 strain confirming that all Zika viruses are serotypically similar. In the context of the disclosure herein, the vaccine methods developed using any one of the Zika virus strains is applicable to homologous and any heterologous Zika virus strains for use as candidate vaccine.
(30) A cell line that can be propagated in vitro in culture can be used as a host for Zika virus culture. For propagating Zika virus strains, preferably permissive cells which allow the virus to grow well are selected. For example, diploid cell lines such as MRC-5 and WI-38, and serially passaged cell lines such as Vero, BHK-21, CHO cells etc. can be used. For example, Vero cells (ATCC No. CCL-81), BHK-21 (ATCC No. CCL-10), C6/C3 (ATCC No. CRL-1660) etc. can be used. In a preferred embodiment, one such cell line used in the current invention is Vero cells (ATCC No. CCL-81) which has been validated for use as a host cell for vaccine production. The validated Vero cell lines conforms to the Requirements for Biological Substances No. 50 regarding requirements for use of cells for the production of biologicals recommended by the World Health Organization (WHO) thereby confirming these cell lines as qualified for producing a vaccine (WHO Technical Report Series, No. 878, pp 19-52, 1998).
(31) In one aspect of the invention, the method of adaptation of Zika virus to Vero cells increases the virus titer. Zika virus passaged repeatedly in Vero cells increases the virus titer. In the context of virus growth in Vero cells disclosed herein, Zika virus passaged initially in mouse brain or Ae. albopictus C6/36 cells (ATCC No. CRL-160) and then adapted to Vero cells increases virus titers suitable for vaccine production.
(32) For maintenance in cell culture of the above-mentioned cell lines, Vero cells in particular, stationary culture in monolayers, perfusion system culture, shake flasks, roller tube/bottle culture, suspension culture with and without microcarriers, cell factories and cell stacks, bioreactors and disposable bioreactors, wave bioreactors and the like can be adopted. For example, various types of microcarriers are commercially available. Commercially available animal cell culture devices can be used to facilitate the growth of cells to high cell density.
(33) In one aspect of the invention and disclosed herein, the Zika virus is purified for use as candidate vaccine. Purification is achieved by a combination of both physical and chemical methods either before or after inactivation of the virus. Physical methods include any of the following techniques but not limited to: ultracentrifugation, density gradient centrifugation, ultrafiltration, diafiltration and concentration using semi-permeable membranes with suitable molecular cut-off sizes. Purification through chemical means employs methods such as adsorption/desorption through chemical or physiochemical reactions such as ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, gel filtration chromatography such as for example Captocore700™, hydroxyapatite matrix, salting with inorganic salts, one such example being ammonium sulphate.
(34) In a preferred embodiment, the virus is purified on Capto core 700 (GE Healthcare Life Sciences) column chromatography. Inactivation of the virus is achieved either before purification or after purification on Capto core 700 column. The virus harvest before Capto core 700 column can be clarified using membrane filters with different pore sizes, preferably not less than 0.45 μM low protein binding membrane. In a preferred embodiment, the virus harvest can be clarified with a dual membrane of two different pore sizes, for example 1.2 μM followed by 0.45 μM, or 0.8 μM followed by 0.45 μM. The clarified virus harvest is suitable for purification on Capto Core 700 column. The buffers used for purification on Capto core 700 is of optimal pH and ionic strength to maximize the binding of the impurities on the column and elute the virus in the flow through. The virus sample is further concentrated by diafiltration before or after virus inactivation. Diafiltration of the virus sample after inactivation removes the virus inactivating agent from the bulk antigen, and is suitable for formulation.
(35) In one embodiment of the invention, Zika virus in inactivated (killed) for use as a vaccine antigen. Inactivation can be carried out either before or after purification of the virus. In a preferred embodiment, inactivation of Zika virus is carried out after purification of the virus.
(36) Zika virus can be inactivated either by heat, gamma irradiation, ultraviolet light or by chemical means. In a preferred embodiment disclosed herein, Zika virus is chemically inactivated. Chemical inactivating agents were selected from the following list which includes but is not limited to: formalin, beta-propiolactone, glutaraldehyde, N-acetylethyleneimine, binary ethyleneimine, tertiary ethyleneimine, ascorbic acid, caprylic acid, psolarens, detergents including non-ionic detergents etc. wherein the chemical inactivating agent is added to a virus suspension to inactivate the virus.
(37) In a preferred embodiment of the invention, the chemical inactivating agent selected is formalin and/or beta propiolactone (BPL). Formalin is used at any concentration ranging from 1:1000 to 1:4000 v/v of formalin:virus. Beta propiolactone is used at any concentration ranging from 1:1000 to 1:4000 v/v of BPL:virus. The temperature and duration of inactivation is optimized to complete virus inactivation with minimal adverse effect on immunogenicity. This can be achieved with shorter duration of exposure with minimum quantity of the inactivating agent. In the context of virus inactivation, the disclosure herein describes the concentration, temperature and time of exposure of Zika virus to formalin and BPL. In the preferred embodiment of the invention, the inactivation temperature is 25±3° C., most preferably 22° C. for 7 days. At lower temperatures of 2° C. to 8° C., the duration of formalin exposure is longer than 7 days to achieve complete virus inactivation at the aforementioned concentration ranges. Duration of virus exposure to formalin can be reduced to below 48 hours by increasing the temperature of exposure up to 37° C. Hence, effective formalin inactivation of Zika virus can be achieved at any concentration range of formalin from 1:1000 v/v formalin:virus up to 1:4000 v/v formalin:virus by choosing any temperature range from 2° C. to 37° C. and varying the exposure time from 24 hours to more than 10 days at any of the aforementioned concentrations, time and temperature of exposure.
(38) In one embodiment of the disclosure, BPL is used as virus inactivating agent for Zika virus. In a preferred embodiment of the invention, BPL is used at concentrations ranging from 1:1000 v/v BPL:virus up to 1:4000 v/v BPL:virus. At lower temperatures of 2 to 8° C., the duration of BPL exposure is preferred for 3 to 7 days to achieve complete virus inactivation at the aforementioned concentration ranges. Duration of virus exposure to BPL can be reduced to 48 hours or below by increasing the temperature of exposure up to 25±3° C. or even up to 37° C. Hence, effective BPL inactivation of Zika virus can be achieved by choosing any concentration range of BPL from 1:1000 v/v BPL:virus to 1:4000 v/v BPL:virus by choosing any temperature range from 2 to 37° C. and varying the exposure time from 24 hours to more than 10 days at any of the aforementioned concentrations, time and temperature of exposure.
(39) One of embodiments of the current invention disclosed herein is the use of a combination of BPL and formalin at any of the aforementioned conditions, preferably BPL inactivation at 1:3000 v/v of BPL:virus for 24 hours followed by formalin inactivation at 1:3000 v/v formalin:virus for 24 to 48 hours at 15° C. to 30° C., preferably 25±3° C. The use of BPL and formalin combination for Zika virus inactivation is that the mechanism of inactivation being different for formalin and BPL, their combined use reduces their overall concentration and exposure to both the inactivating agents, and also the use of low concentrations of formalin promotes stability of the virus bulk by promoting cross linking of virus epitopes. In another embodiment of the invention, hydrogen peroxide is used for inactivating the Zika virus at concentrations ranging from 0.1 to 3%, preferably 0.1 to 1% at any temperature from 20° C. to 30° C. for 5 to 120 minutes, if not more.
(40) An embodiment of the current invention discloses the use of the prME (pre-membrane and the Envelope protein) of Zika virus as the candidate vaccine antigen to elicit immune response against the Zika virus. The disclosure is applicable to any method of vaccine design wherein the prME or the E protein is expressed in such a manner that the neutralizing Zika antibodies are directed against the said antigens. In a preferred embodiment of the invention, the prME protein is expressed as recombinant virus like particles (VLP) in baculovirus mediated expression in insect cells. Anyone skilled in the art will derive additional embodiments using the above disclosure to design a vaccine candidate using the prME protein as the target Zika antigen such as a DNA vaccine, Virus like particles comprising prME proteins, subunit vaccine comprising the Envelope (E) antigen, live vectored vaccines, chimeric vaccines using the Zika prME on a heterologous nucleic acid backbone wherein in all the above, the anti-Zika antibodies are largely directly against the E protein.
(41) In the current invention disclosed herein, are immunogenic compositions comprising purified recombinant Zika virus antigens comprising the envelope (E) protein, membrane (M) protein and optionally the non-structural 1 (NS1) protein as vaccine antigens for eliciting immune response for prophylaxis of Zika virus infections. In a preferred embodiment, the use of the Zika virus having of the prME gene of sequences SEQ ID NO:1 and SEQ ID NO:2 encoding the structural protein of SEQ ID NO:3 and SEQ ID NO:4 respectively, wherein the expressed and purified prME protein can be used as vaccine antigen for prophylaxis of Zika virus infections.
(42) In a preferred embodiment, Zika virus prME gene is used to generate a recombinant gene construct that can be used to express the prME protein in prokaryotic or eukaryotic expression systems as virus like particles (VLPs), preferably baculovirus mediated expression in insect cells. The methods disclosed herein are applicable to any Zika virus strain that share at least 70% amino acid identity to the aforementioned SEQ ID NO:3 and SEQ ID NO:4
(43) An embodiment of the current disclosure is the choice of pharmaceutically acceptable buffer throughout the bioprocess wherein the buffering agent is selected from a list consisting of any one or more of the following, but not limited to: phosphate buffer; citrate buffer; phosphate citrate buffer; borate buffer; tris(hydroxymethyl)aminomethane (Tris) containing buffer; succinate buffer; buffers containing glycine or histidine as one of the buffering agents. In the most preferred embodiment, phosphate buffer is used, wherein phosphate buffer is sodium phosphate buffer at concentration of 5 mM up to 200 mM of phosphate ions, preferably 10 mM to 100 mM phosphate buffer, most preferably 10 mM to 50 mM phosphate buffer of any pH above 6.50 to pH 9, preferably pH 6.8 to pH 7.8 is used for the upstream and downstream processes. In a preferred embodiment, 10 mM sodium phosphate buffer of pH 7.4±0.2 is used in the preparation of the purified inactivated vaccine bulk of Zika virus antigen, and optionally containing sodium chloride at a concentration from 50 to 200 mM. In another preferred embodiment, sorbitol and L-glycine are optionally added to a final concentration of 1% and 0.5% respectively.
(44) An embodiment of the current invention also discloses the choice of adjuvants that is compatible for formulation with Zika virus antigen.
(45) The antigenic compositions of Zika virus as monovalent vaccine, and with Chikungunya virus and Japanese encephalitis viruses in combination vaccine were formulated in pharmaceutically acceptable carrier for immunization. The use of adjuvant(s) can reduce the amount of antigen required in the formulation Furthermore, for adjuvanted vaccine formulations, suitable adjuvant(s) were selected from the following list, which includes but is not limited to: alum such as aluminum hydroxide, aluminum phosphate, or amorphous aluminum sulphate phosphate; calcium phosphate; inulin of any polymorphic form, preferably gamma inulin; adjuvants containing inulin in combination with other organic and inorganic compounds such as aluminum hydroxide, aluminum phosphate, aluminum sulphate phosphate and calcium phosphate; liposomes, chitosan and complex carbohydrates such as dextran, dextrins, starch, mannans and glucomannans, galactomannans, beta-glucans, heparin, cellulose, hemicellulose, pectins and pectinates, lectins and any other carbohydrates either synthetic or derived from any source, any biodegradable and biocompatible polymers, such as poly lactide and polylactide co-glycolides, (PLG or PLGA); any emulsions including but not limited to oil in water emulsions one such example being squalene or squalene analogues containing oil in water adjuvants, oil in water emulsions containing vegetable oils; any water in oil emulsion; liposomes prepared with cholecalciferol as one of the ingredients along with other lipid soluble compounds; liposomes of other compositions; RIBI adjuvant systems, saponins including but not limited to QS-21, QuilA, tomatine, ISCOMs, ISCOMATRIX etc, lipopeptides, glycopeptides and their analogues, resiquimoid, lipopolysaccharides, lipid A, muramyl dipeptides or their analogues and any peptide based adjuvants, oligonucleotides, any TLR ligands and their analogues as adjuvants, any cytokine, vitamins and non-toxic bacterial toxins, indeed any analogues of all the aforementioned adjuvants and combination of two or more of the aforementioned adjuvants or their analogues that are compatible in vaccine formulation(s). and tested for enhanced immunogenicity. In addition to the above, any other organic and inorganic substances that have good immunopotentiating activity are suitable to be used as adjuvant either singly or in adjuvant combinations to enhance the immunogenicity of the arboviral antigens. The use of adjuvant in the vaccine formulations can reduce the amount of antigen required.
(46) In a preferred embodiment of the invention, aluminum hydroxide was used for dose ranging studies of both formalin and BPL inactivated Zika antigens as well in vaccine combinations of Zika, CHIKV and JEV vaccines due its safety profile for use in target population. Oil based emulsions and polylC gave good immunopotentiating effect to Zika antigen when used as adjuvants. In one embodiment of invention, polylC and other adjuvants that offer both systemic mucosal immunity is particularly advantageous for protection against disease caused by Zika virus infections. PolyIC and the oil based emulsions and the adjuvant combinations disclosed in the invention elicited both Th1 and Th2 responses estimated by the measurement of the Th1 and Th2 cytokines after vaccination. Several of the above mentioned adjuvants also elicit strong mucosal immunity in addition to systemic immunity, one such example being polylC. Zika vaccine antigens either the inactivated or purified recombinant prME proteins are formulated with any of the adjuvants that elicit both systemic and mucosal immunity.
(47) In one embodiment of the current invention, a vaccine preservative is used in the vaccine formulations. The preferred embodiment is 2-phenoxy ethanol at a concentration of 2.5 to 5 mg per dose 2.5 to 5 mg per mL
(48) In one aspect of the current invention disclosed herein are the use of stabilizing agents selected from one or more of the following, but not limited to: lactose, sucrose, trehalose, maltose, mannose, iso-maltose, raffinose, stachyose, lactobiose, sorbitol, mannitol, lactobionic acid, dextran, L-glycine, L-histidine, L-glutamic acid, L-aspartic acid, human serum albumin and combinations thereof, at any suitable concentration that are used to confer stability during the inactivation of Zika virus by any of the aforementioned methods. In a preferred embodiment, the stabilizing agents are selected from any of the following combinations but not limited to: 2% sorbitol and 1% L-glycine; 1% sorbitol and 0.5% L-glycine; 1% mannitol and 0.5% L-glycine; 1% mannitol and 0.5% L-glutamic acid; 1% sorbitol, 0.5% L-glycine, 1% human serum albumin. In a preferred embodiment, the combination of 1% sorbitol and 0.5% L-glycine and 1% mannitol and 0.5% L-glycine are preferred combinations, most preferably, 1% sorbitol and 0.5% L-glycine. One skilled in the art will recognize further embodiments based on the above disclosures.
(49) Lyophilized formulations are one of the methods for preparation of vaccine product. Lyophilized preparations of Zika virus vaccine typically contain purified inactivated Zika virus, a sugar polyol, preferably sorbitol and mannitol, most preferably sorbitol in combination with a glass forming sugar, which is preferably a disaccharide or an oligosaccharide. The preferred disaccharide is selected from the following list but is not limited to: sucrose, trehalose, maltose, mannose, lactose, raffinose, isomaltose, stachyose etc. the preferred embodiment of the disclosure is a combination of 1% sorbitol with 5% sucrose, 1% mannitol with 5% sucrose, and 3% sucrose and 2% trehalose, 1% mannitol with 1% L-glycine and or 2% trehalose. Any one of the ordinary skill in the art will devise further embodiments and based on the disclosures above.
(50) The lyophilized formulations can be re-suspended in water for injection or an aqueous buffer that is pharmaceutically acceptable for administration. e.g. as an injectable liquid to a human subject. The lyophilized formulation can also be used as an inhalable powder which will be suitable for inducing mucosal immunity. Additionally, the lyophilized formulation of Zika virus can comprise an adjuvant that confers mucosal immunity preferably from a list of those adjuvants tested in the current invention for Zika virus such as polylC for example.
(51) In the current invention, the disclosure provided herein on the optimal use of Zika virus antigen to elicit robust immune response, the vaccine antigen can be used at 0.10 μg up to 100 μg per dose, wherein the preferred embodiment is any concentration from 0.125 μg up to 40 μg per dose such that the administered vaccine doses elicit antibody titers measurable by assays such as ELISA and PRNT.sub.50. The vaccine can be administered with and without an adjuvant as both the inactivated vaccine and the adjuvanted formulations elicit good immune response.
(52) In yet another disclosure of the invention, the inactivated Zika vaccine candidate inactivated by any of the disclosed methods can be administered as a single dose or in two or more doses to elicit immune response. The methods disclosed in the invention provide the kinetics of immune response after each dose of the vaccine, at dose ranges from 0.125 μg up to 40 μg per dose that offers the flexibility of the choice of the vaccine dose range concentrations and number of doses to suit the target population for vaccination.
(53) The route of vaccine administration can be by any route selected from, but not limited to intramuscular, intradermal, subcutaneous, intravenous, oral, intranasal and transcutaneous routes. In a preferred embodiment of the invention, the preferred route of vaccine administration is intramuscular (IM) route.
(54) The vaccine formulations can be presented in glass vials and injected by needle and syringes, presented in pre-filled syringes in a ready to use presentation or administered by electroporation, microneedle patches, needle free patch, by inhalation or by nasal sprays.
(55) The current invention discloses methods for preparation and use of formulations comprising one or more arbovirus antigens selected from a list that includes Zika virus, Chikungunya virus (CHIKV), and Japanese encephalitis virus (JEV). When used in vaccine combination, the vaccine can elicit immune response against each of the viruses present in a combination vaccine. In a preferred embodiment of the invention comprising a vaccine composition wherein Zika virus antigens and Japanese encephalitis virus antigens are present in a combination vaccine at concentrations ranging from 5 μg to 50 μg of each antigen in a pharmaceutically acceptable formulation without an adjuvant, or preferably with an adjuvant selected from the list of adjuvants disclosed in the current invention, preferably aluminum hydroxide with 0.25 mg to 1.5 mg of aluminum content per vaccine dose is disclosed. In yet another preferred embodiment of the invention a vaccine composition comprising Chikungunya and Zika virus antigens in a formulation comprising 5 μg to 50 μg of each antigen in a pharmaceutically acceptable formulation without an adjuvant, or preferably with an adjuvant selected from the list of adjuvants disclosed in the current invention, preferably aluminum hydroxide with 0.25 mg to 1.5 mg of aluminum content per vaccine dose is disclosed.
(56) In yet another preferred embodiment of the invention, a vaccine composition comprising Chikungunya, Zika and JEV virus antigens in a formulation comprising 5 μg to 50 μg of each antigen in a pharmaceutically acceptable formulation without an adjuvant, or preferably with an adjuvant selected from the list of adjuvants disclosed in the current invention, preferably aluminum hydroxide with 0.25 mg to 1.5 mg of aluminum content per vaccine dose is disclosed. The use of vaccine combination confers a distinct economical advantage for manufacture and distribution of vaccines, provided that immune response is elicited against each of the antigen in the formulation and no antigenic interference is observed to either of the antigen by the presence of an additional antigen. The vaccine antigens can either be administered from a single formulation or administered separately at the same time or in suitable time intervals so as to elicit an immune response to the cognate antigen. The recombinant Zika prME protein can be used in vaccine combination with inactivated JE and CHIKV vaccines in lieu of inactivated Zika virus vaccine.
(57) Recombinant CHIKV VLP obtained by expressing the structural polyprotein of CHIKV comprising largely of the capsid, E2 and E1 and 6K proteins or E2, E1 and 6K polypeptides or E2 and E1 can be used in combination with inactivated Zika and JE vaccines as a combination.
(58) The current invention also discloses the use of Zika virus antibodies for detection of Zika virus by ELISA or in any immunodiagnostic methods where the antibodies find an application for detection or diagnosis of Zika virus infections.
(59) The current invention also discloses herein the use of Zika virus antibodies for prevention and treatment of Zika virus disease.
(60) Abbreviations used in the invention: IM—intramuscular; mcg-microgram; TCID50-50% Tissue Culture Infectious Dose; PFU—Plaque forming unit
EXAMPLES
Example 1: Zika Virus Culture in Vero Cells
(61) Vero cell line (ATCC No. CCL-81) was used as the cell substrate for culture of Zika virus.
(62) Extensively characterized Vero cells obtained from BioReliance, USA was used in pilot scale production. Vero cells were grown in DMEM (Dulbecco's Modified Eagle Medium; Sigma-Aldrich Catalog #D5523 and used as per the manufacturer's instructions) or EMEM (Eagles Minimal Essential Medium) containing 5% fetal bovine serum (FBS) or New Born Calf Serum (NBCS) and incubated at 35° C. to 37° C. until reaching 80-100% confluence of the monolayer. Post-infection, the same medium containing 1% serum was used, or alternatively the virus was cultured in Vero cells adapted to serum free medium. Zika virus also could be grown in MRC-5 cell monolayer which were prepared in growth medium consisting of EMEM buffered to neutral pH with Hepes buffer with 5% serum and statically incubated at 35° C. to 37° C. for 6 to 8 days. Zika virus was cultured routinely in Vero cells. Zika virus MR766 strain (ATCC VR-84) procured from LGC Promochem, Bangalore was adapted to Vero cells by direct inoculation in Vero cells. Alternatively, the virus was adapted in C6/36 Ae. albopictus cells twice by serial passages, and the Zika virus in culture supernatant from these cells was used to infect Vero cells. Serial passage of Zika virus in C6/36 cells cultured at 25° C. to 28° C. increased the virus titer higher than 10e8.0 TCID.sub.50/mL or 10e8.0 PFU/mL. This also obviated the need for subsequent repeat passages in Vero cells to obtain high titers. Virus adaptation by this method is useful to achieve high titers and subsequent higher yield in production. After culture in C6/36 cells, the virus was serially plaque purified twice from Vero cells, and the virus from a single well isolated plaque was amplified and extensively characterized to be free of adventitious agents (all known RNA and DNA viruses, bacteria, fungi, mycoplasma etc) using the NGS (Next Generation Sequencing) platform. The virus genomic RNA was sequenced by NGS platform, and complete nucleotide sequence of MR766 strain is provided in SEQ ID NO:5 and the corresponding deduced amino acid sequence is provided in SEQ ID NO:6. Sequencing showed the intact glycosylation site in the Envelope protein, which otherwise is lost if the cells are extensively passaged in mammalian cells. Zika virus produces cytopathic effect (CPE) in Vero cells, and at the optimal Multiplicity of Infection (MoI) and harvest conditions, virus titers above 10e8.5 TCID50/mL or 10e8.5 PFU/mL could be attained.
Example 2: Zika Virus Purification
(63) For Zika virus culture at pilot scale, the virus culture was systematically scaled up from T-175 flasks to CS1 (cell stack 1), CS10 (cell stack 10) and CS40 (cell stack 40). Multiples of CS40 simultaneously infected with the virus at standardized MoI was used to scale up production. Use of multiples of CS40 enables quick and linear scale up to the desired volumes of production. The harvest volume from each CS40 was approximately 8-10 L. The virus was harvested at days 4-6 or whenever more than 90% CPE was achieved. Alternatively, disposable bioreactors under well standardized conditions of temperature 35° C. to 37° C., pH not less than 7.0, and optimally at pH 7.4, dissolved oxygen at 45 to 75 ppm, preferably 60 rpm and an agitation of 240 to 280 rpm and optimally controlled in-flow and out-flow rate optimized according to the scale of the culture volume from 1 L to 100 L was used to increase the cell density and virus harvest. The viral harvest was clarified either by microfiltration or using dual filters with cut off of 1.2 μM and 0.45 μM. The clarified viral harvest was then passed through Capto Core700 column (GE healthcare Life Sciences) in phosphate buffered saline, pH 7.4. The Zika virus containing fractions in the flow through was optionally concentrated by diafiltration using either 100 kDa or 300 kDa cut off membranes. The concentrated virus fraction was used for virus inactivation. In an alternate method, the clarified viral harvest was inactivated with either BPL or formalin according the methods described in the succeeding sections and then loaded on the column. The purity of the virus was checked on 12.5% SDS-PAGE. There was no significant difference in the yield or in purity in inactivating the virus before and after purification. The virus could also be purified using cellufine sulphate, DEAE-Sephadex CM-sephadex with salt gradient and by gel filtration on Sepharose CL-4B, ceramic hydroxyapatite column with gradient of 0.2M to 0.8M phosphate and in all cases followed by diafiltration using 100 or 300 kDa cut off membranes. The purity of the virus preparation was checked by silver staining of the virus sample in 12.5% of SDS-PAGE gel (See
Example 3: Zika Virus Inactivation
(64) Zika virus sample was inactivated (killed) by various methods for use as vaccine antigens. Formalin inactivation was tested at various concentrations ranging from 1:1000 (formalin:virus, v/v) to 1:4000 (formalin:virus, v/v) at temperature 25±5° C., more specifically at 22° C. and the kinetics of virus inactivation was monitored every 24 hours for up to 10 days, and routinely the virus inactivation was carried out at 25±3° C., preferably at 22° C. for 7 days. The virus inactivation was effective at all concentrations from 1:1000 v/v formalin:virus, up to 1:3500 v/v formalin:virus, at the aforementioned temperatures and time intervals. A ratio of 1:4000 v/v of formalin:virus was effective in virus inactivation at higher temperatures up to 30 to 37° C. for 3 to 7 days. Formalin inactivation was effective at all the aforementioned ratios of formalin to virus at temperatures ranging from 2-8° C. when incubated for time intervals longer than 10 days. Hence formalin inactivation offers flexibility of virus inactivation at any temperature from 2° C. to 37° C. at time intervals ranging from 24 hours to more than 10 days depending upon the conditions used for inactivation. Zika virus inactivation with Beta propiolactone (BPL) was tested under various conditions. Zika virus was completely inactivated at BPL concentrations ranging from 1:1000 (BPL:virus, v/v) up to 1:3500 (BPL:virus, v/v) at temperatures from 25±5° C. for 24 to 48 hours. At higher concentration of BPL or at higher temperatures up to 37° C., complete inactivation was achieved in 24 hours or less, and can be used as a method for quick inactivation of the virus. Zika virus could also be inactivated at the aforementioned concentrations of BPL when incubated at 2 to 8° C. for 3 to 7 days. A combination of BPL inactivation at 1:3500 (BPL:virus, v/v) at 22-25° C. for 48 hours, followed by treatment with low concentrations of formalin from 1:3000 to 1:4000 v/v of formalin:virus for 24 hours was effective in both inactivating and stabilizing the virus. Any concentration of BPL and formalin could be used for both inactivation and stabilizing the virus, as long as inactivation is complete without deleterious effect on immunogenicity. Inactivation was tested from 0.005% up to 3% final concentration of Hydrogen peroxide at 20° C. to 25° C. for a period 2 hours. There was no deleterious effect on the immunogenicity of the virus at lower concentrations of hydrogen peroxide with very brief exposure times within minutes but was deleterious at prolonged concentrations at higher dose ranges tested. The inactivated virus samples after exposure to different time and dose concentrations were titered for infectious virus particles if any, by TCID50/mL from 5 minutes up to 6 hours at intervals of 5, 10, 20, 30 and 60 minutes and at 2, 4 and 6 hours. At higher concentrations, the virus was inactivated within seconds. At each time point, the reaction was stopped by addition of 10 U/mL of catalase that rapidly hydrolyses hydrogen peroxide. The optimum concentration for inactivation was 0.01% final for duration of 60 minutes or less as determined by titration for infectious particles by TCID50/mL and subsequent immunogenicity. Zika virus inactivation with hydrogen peroxide offers the flexibility of duration of exposure at different concentrations for different time points according to the concentration of virus particles in the sample.
(65) The purified Zika virus sample was heat inactivated at temperatures 50° C. to 65° C. for up to 60 min. UV inactivation of the virus was carried out UV exposure at 254 nm for up to 120 minutes. Zika virus was inactivated by gamma irradiation by exposure from 20 kGy (Kilo Gray) up to 35 kGy from a .sup.60Co source at the Gamma Agro Medical Processing Facility at Hyderabad. All the above inactivation methods were carried out in the presence and absence of virus stabilizing agents such as various concentrations of sugars such as sucrose, lactose, trehalose, maltose, mannose among others. The sugar alcohols used for conferring stabilizing effect were sorbitol and mannitol. The amino acids tested were selected from L-Histidine, L-Glutamic acid, L-Glycine and L-Aspartic acid and L-Glutamine and also human serum albumin and a combination of one or more of the aforementioned stabilizing agents. The most effective stabilizing agents were sorbitol at 0.5% to 2%, preferably 1.0% in combination with L-Glycine from 0.5% to 2%, preferably at 0.5%. Mannitol and L-glycine in combination was effective in stabilizing the virus sample during inactivation rather than Mannitol and L-glycine alone.
(66) The Zika virus samples inactivated by all the aforementioned methods for use vaccine antigens were tested for completeness of inactivation by serially passaging the inactivated samples three times serially in Vero cells and testing for infectious virus at the end of inactivation period by TCID.sub.50. In addition to that, the inactivated virus sample after three serial passages in vitro was injected intracranially in 2-day old mice and observed for mortality or growth abnormalities for 21 days and considered completely inactivated when it showed no adverse effects in vitro and in vivo testing. No infectivity was observed with the formalin and beta-propiolactone inactivated virions at the aforementioned range of concentrations and for the various time periods tested. The inactivation kinetics of Zika virus by formalin and BPL as a representative example of one of the methods disclosed above is provided in
Example 4: Recombinant Cloning and Expression of Zika Virus pRME Protein
(67) Synthetic gene of the nucleotide sequence SEQ ID NO:1 encoding the Open Reading Frame (ORF) of the prME protein of SEQ ID NO:3 of Zika virus was synthesized at GenScript, NJ, USA. The gene was PCR amplified with the primers listed below to obtain a ˜2.1 kb fragment of SEQ ID NO:1 encoding the prME protein of SEQ ID NO:3. See
(68) TABLE-US-00001 FVFP: 5′AACTGCTCGAGGAATTCGGATCCAAC 3′ FVRP: 5′ AATGGGCATGCCTGCAGGCGGCCGCTC 3′
(69) The PCR amplified fragments was digested with EcoR1 and Not1 restriction enzymes and cloned into the EcoR1 and Not1 sites of the pFastBac plasmid vector (Life Technologies, Carlsbad, Calif., USA) under the control of the polyhedron promoter by the methods described in the User's manual of Bac to Bac Baculovirus expression system (“An efficient site-specific transposition system to generate baculovirus for high-level expression of recombinant proteins, Life Technologies, USA). In brief, the method utilizes a site specific transposition of the expression cassette such as the recombinant pFastBac vector with the cloned inserts as described above into a baculovirus shuttle vector (bacmid) propagated in E. coli. Recombinant pFastBac vector containing one of the inserts SEQ ID NO:1 or SEQ ID NO:2 cloned under the control of the polyhedron promoter is transformed into competent cells of E. coli Max Efficiency DH10Bac™, that contains a baculovirus shuttle vector (bMON14272) and a helper plasmid (pMON7124) that facilitates transposition to allow efficient re-generation of the recombinant bacmid The recombinant bacmids were selected on ampicillin, gentamicin and kanamycin containing plates by blue/white selection using bluo-gal or X-gal, and IPTG. The recombinant bacmids after confirmation by PCR for the presence of the gene inserts was isolated by standard protocols described in the aforementioned User manual. About 1 μg of the bacmid DNA was used for transfection with Lipofectamine in Spodoptera frugiperda Sf9 insect cells (Life Technologies, Carlsbad, USA) grown in serum free insect cell medium. The methods used for transfection, isolation and titration of P1 viral stocks are exactly as described in the User's manual of Bac-to-Bac Baculovirus Expression system as given above. The P1 stocks were serially amplified twice to obtain high titer P3 stocks for expression of the recombinant prME proteins in Sf9 cells. High titer baculovirus stocks for expression of the prME protein of SEQ ID NO:3 was expressed in 25 mL suspension culture of Sf9 cells and was further scaled up systematically up to 125 mL per 500 mL flask. Baculovirus infected cells from multiple flasks were harvested at 72 hours post-infection, pooled, washed once with 1×PBS, pH 7.6 and lysed in cell lysis buffer containing 10 mM phosphate, pH 7.6 with 50 mM NaCl, 1 mM PMSF and 5 mM EDTA. The cell lysate was centrifuged at 20,000 rpm for 30 minutes to remove the cell debris and the supernatant was concentrated using protein concentrators with 10 kDa cut off membrane. The concentrated sample was layered on pre-equilibrated 20% to 60% sucrose gradient and centrifuged at 100,000×g for 6-8 hours using P28S rotor in Hitachi HIMACultracentrifuge Fractions containing the recombinant Membrane and Envelope protein was isolated and confirmed by Western blot (
Example 5: Vaccine Formulations
(70) Zika virus vaccine antigen of any of the aforementioned methods in the preceding Examples was tested for immunogenicity in laboratory animals with and without adjuvants. High binding (>95%) was observed to aluminum hydroxide (Alhydrogel® 2%, Brenntag) as the adjuvant, used at the dose range of 0.1 mg to 1.5 mg of aluminum (provided as aluminum hydroxide) per dose even when tested at the high antigen dose of 40 mcg. Binding was complete at all the concentrations of Zika virus antigens as well as vaccine combinations with CHIKV and JE antigens discussed in the succeeding sections that were used for testing in mice. Binding to aluminum hydroxide was carried out for three hours at ambient temperature. An aliquot of the formulation was centrifuged at 5000×g for 5 min and the supernatant was tested for completeness of binding by antigen ELISA. The binding of the antigen was complete as it could not be detected in the supernatant by ELISA. The buffer for the adjuvanted formulations was 10 mM phosphate buffer, containing 154 mM NaCl, pH 7.40±0.2 and optionally containing 1% sorbitol and 0.5% L-Glycine. Other buffers used for specific formulations are mentioned below. The adjuvants listed below were tested for comparative immunogenicity and in all cases concentrations are provided per dose of the vaccine. Inactivated Zika virus antigen was tested at 10 μg per dose: a) Inulin (Orafti-HPX, Beneo) was tested at 0.5 mg per dose; gamma inulin was prepared by the methods described in (Cooper and Steele, 1988) b) A combination of aluminum hydroxide and inulin. A combination of inulin and aluminum hydroxide, algammulin was prepared at a ratio of 10:1 (10 mg/mL inulin: 1 mg/mL aluminum as aluminum hydroxide) was tested at 0.5 mg per dose c) Muramyl di peptide (L18-MDP) (tlrl-Imdp, Invivogen) at 10 μg per dose d) MPL (lipid A, monophosphoryl from Salmonella enterica, L-6895-1 MG, Sigma Aldrich) at 25 μg per dose e) Combination of 0.25 mg aluminum (as aluminum hydroxide) and 25 μg of MPL per dose f) Oil in water emulsion (OWEM1) containing 9.75 mg of squalene (53626-100ML, Sigma Aldrich), 11.86 mg of alpha-tocopherol (T3251-5G, Sigma Aldrich), 4.58 mg of Tween-80 (61771205001730, Merck) in 10 mM phosphate buffer, pH 7.4±0.2. g) Oil in water emulsion 3 (OWEM2) containing 9.75 mg squalene, 1.175 mg of tween-80, 1.175 mg Span-85 (S7135-250ML, Sigma Aldrich) in 10 mM citrate buffer, pH 7.0 h) Poly IC (polyinosinic polycytidylic acid, potassium salt, Cat. NO. P9582-5MG, Sigma Aldrich) at 25 μg per dose i) Cholecalciferol (Arachitol, Abbot) at 0.75 mg per dose j) Resiquimod (SML0196-10MG, Sigma Aldrich)+Poly IC, 25 μg each k) Resiquimod (25+Oil in water emulsion 2 containing 9.75 mg squalene, 1.175 mg of tween-80, 1.175 mg Span-85 (S7135-250ML, Sigma Aldrich) in 10 mM citrate buffer, pH 7.0 l) Aluminum 0.25 mg and 0.5 mg per dose provided as aluminum hydroxide
(71) All the above formulations elicited high level of neutralizing antibodies and the results are depicted in
Example 6: Effect of Stabilizing Agents
(72) The stability of the formalin inactivated vaccine bulk for use as non-adjuvanted vaccine antigen was tested for stability with the following concentration of stabilizing agents: a) 2% sorbitol and 1% L-glycine; b) 1% sorbitol and 0.5% L-glycine c) 1% mannitol and 0.5% L-glycine; d) 1% mannitol and 0.5% L-glutamic acid e) 1% sorbitol and 0.5% L-glycine, 1% human serum albumin. Stability testing was done at 37° C. for 2 weeks and the antigen concentration was tested by ELISA before and after exposure at 37° C. 1 μg and 10 μg of the non-adjuvanted formulation with 1% sorbitol and 0.5% L-Glycine was tested for immunogenicity in Balb/c mice as discussed in the succeeding sections.
Example 7: Potency Testing of Vaccine Formulations in Animal Models
(73) Zika vaccine antigen inactivated by the aforementioned methods was tested in Balb/c mice in dose ranges from 0.125 μg up to 40 μg of antigen per dose with 0.25 mg aluminum per dose (as aluminum hydroxide) in a volume of 100 μL (injected in two sites at 50 μL per site) by intramuscular route on days 0, 14, 28. Initial testing on the effect of aluminum (provided as aluminum hydroxide showed that alum adsorbed vaccine gave higher titer of neutralizing antibodies than non-adjuvanted vaccine. About 1 and 10 μg of inactivated vaccine antigen without alum contained 1% sorbitol and 0.5% L-glycine as the excipients to confer stability to the vaccine antigens. Blood was drawn from retro-orbital sinus on days 13, 21 and 35 for estimation of neutralizing antibody titers by PRNT.sub.50, total Ab titer by ELISA, Ab avidity and cytokine profiles. Blood withdrawal and testing after each dose gave data on the potency and safety of single, two doses and three doses of the vaccine preparations. The animals were each challenged on day 36 with 10e5 PFU of Zika virus by intravenous route. The blood samples were monitored for up to 7 days at 24 hour intervals for formalin groups and at two points at 48 hours and 96 hours for BPL inactivation groups for protection against viremia by TCID.sub.50 (50% Tissue Culture Infectious Dose) and the virus titers if any, were expressed as TCID.sub.50/mL. Animal challenge studies showed complete protection from viremia in 1 μg to 40 μg of the dose groups tested. Hence the BPL and formalin inactivated vaccine formulations were further tested at 0.5 μg, and at 0.25 μg 0.125 μg per dose by the IM route in Balb/c mice and were found to be immunogenic even at low dilutions. For the alum adjuvanted formulations, 0.25 mg of aluminum (as aluminum hydroxide) per dose was used as the placebo control and for non-adjuvanted formulations, 10 mM phosphate buffer containing 154 mM NaCl, 1% sorbitol and 0.5% L-Glycine, pH 7.40 was used as the vehicle control. All the formalin and BPL inactivated formulations elicited high level of neutralizing antibodies and protected against viremia as depicted in
(74) A combination vaccine of arbovirus antigens were prepared a the following concentrations and tested in Balb/c mice: a) 10 μg formalin inactivated Zika virus antigen, 20 μg of BPL inactivated Chikungunya virus antigen and 6 μg of formalin inactivated JE antigen in a trivalent vaccine combination b) 10 μg formalin inactivated Zika virus antigen and 20 μg of BPL inactivated CHIKV virus antigen c) 10 μg of formalin inactivated Zika virus antigen and 6 μg of JE virus antigen. Zika virus was inactivated by 1:2500 of formalin:virus v/v by methods disclosed in Example 3. CHIKV was inactivated by 1:1500 of BPL:virus v/v, and JEV by 1:2500 v/v of formalin:virus and tested for completeness of virus inactivation by aforementioned procedures. All the above vaccine combinations were tested with 0.25 mg aluminum (as aluminum hydroxide) per dose in Balb/c mice (8 nos each) with appropriate controls that included either of the aforementioned antigens alone, and also control animals that received equivalent amount of alum. The animals were boosted at 14 and at 21 days after the first immunization. Blood was collected at 7 days after the last booster injection. The sera samples were used for estimation of neutralizing antibody by PRNT.sub.50 for Zika, CHIKV and JEV. The buffer used in all the formulations was 10 mM phosphate buffer, pH 7.2 to 7.6 containing 154 mM NaCl. All the methods disclosed above are applicable to any genotype/genotypic variants/serotypes and strains of Chikungunya virus, Zika virus and Japanese encephalitis viruses. See Table 1 for the results.
(75) TABLE-US-00002 TABLE 1 Neutralizing antibodies elicited by various antigenic formulations as disclosed in the Examples. Neutralizing antibody titers as Log10PRNT.sub.50 Test Groups Zika A CHIKV JE Recombinant Zika prME - 10 μg × 2.8 — — 2 doses Recombinant Zika prME - 20 μg × 3.22 — — 2 doses Hydrogen peroxide inactivated 2.6 — — Zika antigen - 10 μg × 2 doses Gamma irradiated Zika antigen 2.71 — — 10 μg × 2 doses Zika alum adsorbed - 10 μg × 3.06 — — 3 doses Chikungunya alum adsorbed - — 2.808 — 20 μg × 3 doses JE alum adsorbed - 6 μg × — — 3.06 3 doses Zika (10 μg) + CHIKV (20 μg) × 2.95 2.68 — 3 doses Zika (10 μg) + JE (6 μg) × 2.80 — 3.28 3 doses Zika (10 μg) + CHIKV (20 μg) + 2.79 2.63 3.21 JE (6 μg) × 3 doses
(76) Table 1 Legend:
(77) Purified recombinant prME antigen of Zika virus and the hydrogen peroxide inactivated and gamma irradiated Zika virus antigens formulated with 0.25 mg of aluminum per dose elicited neutralizing antibodies in Balb/c mice. The titers are expressed as Log 10PRNT50 values. The vaccine combinations elicited neutralizing antibodies when two or more antigens were administered in a single formulation, and no significant antigenic interference was observed between JE, Zika and CHIKV viruses. The titers were estimated in pooled sera samples from each group.
Example 8: Passive Immunization Studies
(78) The proof of concept that neutralizing antibodies are important immune correlates of protection against Zika virus infection was demonstrated by single injection of rabbit polyclonal Zika antisera with known titer, about 200 μL of antisera diluted 1:1 with PBS was injected intraperitoneally in Balb/c mice and challenged 8-24 hours later with 10e5 PFU of Zika virus by intravenous route in a volume of 100 μL. Equal no. of control animals received PBS, pH 7.4 and received the virus injection as the test animals. Blood was collected at 24, 48, 72, 96 and 144 hours post virus challenge for detection of viremia in both the group of animals. Passive immunization offered complete protection against viremia and infectious virus could not be detected by TCID50. See
Example 9: Assays for Neutralizing Antibody Titers
(79) Animal sera from all the aforementioned vaccine testing in mice described in Example 7 which include all the monovalent Zika vaccines inactivated with different inactivating agents and formulated with different adjuvants, vaccine antisera from dose ranging studies as well combination vaccines with CHIKV and JEV described in the preceding sections were assayed for neutralizing antibodies by 50% Plaque Reduction Neutralization Test (PRNT.sub.50) by standardized procedures. Briefly, one day prior to the assay, 6-well plates were seeded with 2.5×10.sup.3 Vero cells (ATCC CCL-81) per well and the plates were incubated at 37° C. in a 5% CO.sub.2 incubator. To 4-fold dilutions of the sera samples in MEM containing equal volume of the standardized Zika virus strain (10.sup.5 pfu/mL) was added and incubated at 37° C. with 5% CO.sub.2 for 90 min. The cells were washed twice with 1×PBS pH 7.4 (10 mM phosphate with 150 mM NaCl) and 0.30 ml of each dilution of the serum-virus mixture was added to the corresponding well and incubated for 90 min at 37° C. in a 5% CO.sub.2 incubator. Each assay was carried out in triplicates. The cells were overlaid with 2 ml of 0.85% methyl cellulose in MEM with 1% penicillin-streptomycin and 1% L-glutamine. The plates were incubated at 37° C. in a 5% CO.sub.2 incubator for 4 days. At the end of incubation, the plaques were fixed with 10% formalin, washed with 1×PBS, pH 7.4 and were visualized with 0.1% crystal violet. The highest dilution of serum causing 50% reduction in the number of plaques formed by the control virus sample was estimated as the PRNT.sub.50 titer. Anti-CHIKV and anti-JE antibodies from the vaccine combinations were also estimated PRNT50. All the aforementioned vaccine antigens elicited high level of neutralizing antibodies as depicted in
Example 10: Zika Virus Cross Neutralization Studies
(80) Formalin inactivated vaccine antisera cross neutralized the homologous MR766 virus strain of the African genotype and FSS13025 Zika virus strain (GenBank Acc No. JN860885) of the Asian genotype with EQUAL efficiency with PRNT50 titers of 18105 and 18325 against MR766 and FS13025 strains respectively. (The study BS-3018 was contracted to IBT Bioservices, Gaithersburg, Md., USA). Briefly, both the MR766 and the FS13025 Zika virus strains were diluted to ˜250 PFU in serum-free medium. Both the vaccine antisera and control sera (placebo) were serially diluted in two-fold dilutions. The virus samples were mixed 1:1 with serially diluted sera samples and incubated at 37° C. for 2 hours. Vero cells seeded in 24-well plates were infected with the dilutions for 1 hour and 0.85% methyl cellulose was added to each well and incubated for 3 days. Cells were fixed and analyzed by plaque assay. The plates were scanned and the plaque counts were used to calculate the PRNT.sub.50 titers using a 4PL curve fit. Hence the method of vaccine antigen preparation, formulation and testing are entirely applicable across any genotype of Zika virus as the vaccine with one genotype 100% cross neutralizes the heterologous strain and this also proves that no serotypes of Zika virus exists and that inactivated vaccine of Zika using any strain will be equally protective and potent as vaccine prepared using any genotype, and genotypic variant or indeed any Zika virus strain. This fact was further corroborated when the antibodies raised against the recombinant protein expressed as prME (protein of SEQ ID NO:3) in insect cells cross neutralized the MR766 virus with high efficiency. The protein of SEQ ID No. 3 is derived from the prME sequence of the Zika virus strain H/PF/013, which is the more contemporary strain of the Asian genotype. Cross neutralization of the vaccine antisera of the homologous MR766 strain of nucleotide SEQ ID NO:5 encoding the complete ORF of SEQ ID NO:6 and the heterologous FSS13025 of the SEQ ID NO:7 encoding the complete ORF of SEQ ID NO: 8 is depicted in
Example 11: Antibody ELISA
(81) Briefly, Zika virus antigen was coated at the standardized concentration in coating buffer in 96-well plates overnight at 2 to 8° C. The plate contents were discarded and the wells were blocked with blocking buffer and washed extensively before adding the vaccine antisera at serial dilutions. Each vaccine antisera was assayed in triplicates. The plates were incubated for 90 min at 37° C., before adding secondary antibody (anti mouse-IgG HRPO conjugate) diluted 1:2500 in antibody diluent buffer. Each of the wells were washed five times with washing buffer (PBST, pH 7.4) and three times with PBS (pH 7.4), 30 seconds each. About 100 μl/well of freshly prepared substrate solution was added and incubated at ambient temperature for 10 minutes for color development. The color development was stopped by addition of 50 μL/well stop solution. Absorbance was read at 492 nm and the results recorded. For each assay, antigen blank, primary and secondary antibody blanks were included as controls. Seroconversion cut off value=pre-exposure average titer+(3× standard deviation). The end point dilution of positively seroconverted sample which shows a titer equivalent to the pre-exposure level titer was identified. Reciprocal of the penultimate dilution of end point of a positively seroconverted sample was interpreted as the antibody endpoint titer. Antibody titers to both BPL inactivated and formalin inactivated Zika vaccine formulations were higher with aluminum hydroxide than with antigens alone. Vaccine formulations of the formalin inactivated vaccine at all doses (
Example 12: Antibody Avidity
(82) The quality of antibody responses to the vaccine was estimated by antibody avidity assays. The antigen-antibody binding avidities are the degree of affinity maturation in the B-cells. Higher antibody avidities correlate with neutralizing antibodies in several vaccine studies. Prior to determination of avidity index, titrations with sodium isothiocyanate (NaSCN) from 0 M to 6 M concentration in 0.25 M steps from 0 to 2.0 M were performed. After addition and incubation of primary antisera to the antigen coated plates, the plates were incubated with graded concentrations NaSCN for 15 min with intermittent shaking, washed and developed as in regular ELISA. The optical densities obtained at each of the concentrations were plotted. The highest OD (A) was plotted and halved (A/2), and the distance between the OD curves at A/2 was measured as the NaSCN shift value. The NaSCN shift was higher after the first booster dose compared to the prime dose and remained static or marginally increased further after second booster dose administration indicating that high affinity antibodies developed over time and with booster injections. A reference point in the ELISA titration was taken calculation of avidity index, (AI]) which is the ratio of antibody concentration (measured by absorbance) in ELISA of serum samples treated with and without the chaotropic agent NaSCN. Even at the lowest single dose concentration of 1 μg of formalin inactivated Zika vaccine, antibodies with high affinity binding to the antigen was detected, indicating the vaccine is potent even at low concentrations of the vaccine antigen (See
Example 13: Cytokine Profiling
(83) Both Th1 and Th2 cytokines were estimated in mice sera after administration of two doses of the formalin inactivated Zika antigen formulated with different adjuvants including aluminium hydroxide and in antigen only controls for comparison. The Mouse ELISA kit—Th1/Th2 (Catalog No. 88-7711-44, eBioscience) was used for the estimation of IL-2, IFN gamma, IL-4 and IL-10 by methods exactly as per the kit protocols using the standards provided in the kit. The concentration of the cytokines are expressed in μg/mL. The results for Th1 cytokine levels are depicted in
Example 14: Estimation of Virus Titers
(84) The amount of infectious virus particles in the upstream and downstream bioprocess samples, Zika virus titers for animal challenge studies were measured by TCID50 (50% Tissue Culture Infectious Dose) assay. This assay measures the dilution of the virus sample that generates cytopathic effect (CPE) in 50% of the cells. Vero cells were seeded in 96-well microplates and incubated in 5% CO.sub.2 at 37° C. overnight. The cells were infected with 10-fold serial dilutions of virus sample, followed by incubation for 5 d in 5% CO.sub.2 at 33° C. The cells were visually inspected for CPE and the TCID50 titer was calculated according to the method of Reed and Muench, 1938. The results are presented as a log 10 titer (10×TCID50 units/mL). Alternatively plaque assays were used and the titers were expressed as plaque forming units, PFU/mL. The protocol is similar to PRNT50 assays described in Example 9 except that the incubation of the virus with serially diluted sera samples is not carried out.
REFERENCES
(85) 1. Cooper P D, Steele E J. The adjuvanticity of gamma inulin. Immunol Cell Biol. 1988, 66:345-52. 2. Reed L J. Muench H. A simple method of estimating fifty percent endpoints. Am. J. Epidemiol. (1938) 27 (3): 493-497 4849-0458-9365, v. 1