Detection of gene loci with CRISPR arrayed repeats and/or polychromatic single guide ribonucleic acids

11390908 · 2022-07-19

Assignee

Inventors

Cpc classification

International classification

Abstract

A C9orf72 DNA repeat expansion can be detected using a CRISPR Arrayed Repeat Detection System (CARDS). Based upon the compositions and methods supporting this platform primary cell cultures and/or blood cell smears can be tested under conventional clinical diagnostic laboratory conditions to diagnose genetically-based diseases having DNA repeat expansions, including but not limited to ALS. dCas9 constructs are also contemplated as having fluorescent proteins bound to any or all stem loop sequences, wherein detection of a plurality of dCas9 constructs having different colored fluorescent proteins can simultaneously detect at least six (6) different gene target loci.

Claims

1. A composition comprising a nuclease-dead Cas9 (dCas) protein and a single guide ribonucleic acid (sgRNA) comprising at least two fluorescent proteins each bound to a different stem loop, and wherein each of said at least two fluorescent proteins have a different color.

2. The composition of claim 1, wherein said different color is selected from the group consisting of red, green and blue.

3. The composition of claim 1, wherein each of said different stem loop comprises an AU.fwdarw.GC mutation.

4. The composition of claim 1, wherein said different stem loop is selected from the group consisting of an MS2 stem loop, a PP7 stem loop or a boxB stem loop.

5. The composition of claim 4, wherein said M52 stem loop is bound to a MCP-blue fluorescent protein.

6. The composition of claim 4, wherein said PP7stem loop is bound to a PCP-green fluorescent protein.

7. The composition of claim 4, wherein said boxB stem loop is bound to a N22-red fluorescent protein.

8. The composition of claim 1, wherein said sgRNA sequence has three fluorescent proteins, wherein each of said three fluorescent protein are bound to a different stem loop.

9. A method for diagnosing a genetic disease, comprising: a) providing: i) a biological sample comprising a plurality of chromosomes comprising at least one gene target loci; ii) a composition comprising a nuclease-dead Cas9 (dCas9) protein and a single guide ribonucleic acid (sgRNA) computing at least two fluorescent proteins each bound to a different stem loop, wherein each of said at least two florescent proteins have a different color; b) contacting said composition with said plurality of chromosomes; c) forming a dCas9/sgRNA complex on said at least one gene target loci; d) detecting at least one color from said at least two differently corned fluorescent proteins; and e) identifying a repeat expansion sequence within said at least one gene target loci based upon said detected at least one color, wherein said repeat expansion sequence diagnose a genetic disease.

10. The method of claim 9, wherein said at least one gene target loci is selected from the group consisting of two gene target tac, three gene target tac, four gene target loci, five gene target loci and six gene target loci.

11. The method of claim 9, wherein used at least one color is selected from the group consisting of red, green, blue, cyan, yellow, magenta and white.

12. The method of claim 9, wherein said identifying at least two of said at least one gene target loci is simultaneous.

13. The method of claim 9, wherein said different color is selected from the group consisting of red, green and blue.

14. The method of claim 9, wherein each of said different stem loop comprises an AU.fwdarw.GC mutation.

15. The method of claim 9, wherein said different stem loop is selected from the soap consisting of an MS2 stem loop PP7 stem loop or a boxB stem loop.

16. The method of claim 15, wherein said MS2 stem loop is bound to a MCP-blue florescent protein.

17. The method of claim 15, wherein aid PP7 stem loop is bound to a PCP-green fluorescent protein.

18. The method of claim 15, wherein said boxB stem loop is bound to a N22-red fluorescent protein.

19. The method of claim 9, wherein said sgRNA sequence has three fluorescent proteins, wherein each of said three fluorescent proteins are bound to a different stem loop.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) The accompanying figures, which are incorporated into and form a part of the specification, illustrate several embodiments of the present invention and, together with the description, serve to explain the principles of the invention. The figures are only for the purpose of illustrating a preferred embodiment of the invention and are not to be construed as limiting the invention.

(2) The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawings will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.

(3) FIGS. 1A-C shows a schematic overview of a CRISPR system.

(4) FIG. 1A shows a S. pyogenes Cas9 (spCas9) that recognizes a target sequence through Watson-Crick pairing of 20 bases of the sgRNA and recognition of the neighboring PAM sequence (NGG) by the protein. Jinek, M. et al. (2012) “A Programmable Dual-RNA—Guided DNA Endonuclease in Adaptive Bacterial Immunity,” Science 337(6096), 816-821.

(5) FIG. 1B shows a N. meningitidis Cas9 (nmCas9) that utilizes a 24 base guide sequence in its sgRNA and the neighboring PAM sequence GANN (SEQ ID NO: 5) or NNNNGTTN (SEQ ID NO: 6)) for target recognition. Esvelt, K. M. et al. (2013) “Orthogonal Cas9 proteins for RNA-guided gene regulation and editing,” Nat. Meth. 10(11), 1116-1121.

(6) FIG. 1C shows a nuclease-dead dspCas9/sgRNA complex tethered to a repression domain that can be programmed for targeted down regulation of a single or set of genes (Gene X). This may be employed with an orthogonal nuclease-dead dnmCas9/sgRNA complex tethered to an activation domain for targeted upregulation of a different set of genes (Gene Y).

(7) FIG. 2 presents one embodiment of DNA labeling by a CRISPR platform. Normally, Cas9 guided by an associated sgRNA, binds to a target DNA and cuts both strands ˜3 nt to the left of the protospacer-adjacent motif (PAM). However, dCas9 lacks nuclease activity but still binds target DNA. By adding a GFP tag to a dCas9 or an MS2 tag to the sgRNA (for binding by fluorescent protein-tagged phage MS2 coat protein) the target DNA can be located in the cell nucleus.

(8) FIG. 3 illustrates one embodiment of an S. pyogenes Sp dCas9 binding configuration comprising a 20 mer target DNA sequence, an Sp sgRNA sequence and an NGG PAM sequence.

(9) FIG. 4 presents exemplary data showing recognition of telomeric repeat sequences by customized sgRNA in human U2OS cells (an osteosarcoma cell line) using fluorescence imaging with a dCas9-GFP protein.

(10) FIG. 5 presents exemplary data showing the detection of C9orf72 mutant repeats (>1000 repeats) in a fibroblast cell line derived from a patient with the neurodegenerative disease amyotrophic lateral sclerosis (ALS) using a dCas9-GFP protein.

(11) FIG. 5A: A design of a sgRNA targeting a C9orf72 gene hexanucleotide based upon one allele of an ALS c9orf72 gene that contains a very long expansion sequence comprising greater than 1000 repeats of the hexanucleotide GGGGCC (SEQ ID NO: 1).

(12) FIG. 5B: Fluorescence photomicroscopy visualization of methanol-fixed ALS fibroblast cells with dCas9-GFP and a GGGGCC-targeted (SEQ ID NO: 1) sgRNA that resulted in a single focal site (arrow). This means that the non-expanded wild-type allele has an insufficient number of repeats to be detected. Indeed no fluorescent spot was observed in control cells without the expansion (not shown).

(13) FIG. 6 illustrates alternative CARDS strategies for enhancing expansion repeat sequence detection. Left panel: dCas9 is fused with an array of peptides that are epitopes for a single chain variable fragment (scFv) attached to a GFP-decorated bead, resulting in signal amplification. Right panel: The designed single guide RNA (red and blue) has at its 3′ end up to 24 binding sites (green loops) for the phage MS2 coat protein (MCP) tagged with GFP, adding additional signal amplification at the CRISPR-targeted chromosomal labeling site.

(14) FIG. 7 presents exemplary data showing signal-to-noise data in conventional red, green and blue dCAS9 probes. Chen B et al., Cell 155:1479 (2013); Ma et al., PNAS 112:3002 (2015); and Shechner et al., Nature Methods 12:664 (2015).

(15) FIG. 7A: Live U2OS cell imaging of telomeric repeats using conventional probes of dCAS-EGFP (left panel) and gRNASpinach2.

(16) FIG. 7B: Live U2OS cell imaging of telomeric repeats using conventional CAS9 constructs of: i) dCAS9-sgRNA3xRFP (left panel); ii) dCAS9-sgRNA3xGFP (middle panel); and iii) dCAS9-sgRNA3xBFP (right panel).

(17) FIG. 8 presents exemplary data showing the construction and imaging of three embodiments of the CRISPRainbow primary color constructs: i) a blue fluorescent protein (MCP-BFP) attached to an sgRNA MS2 hairpin stem loop; ii) a green fluorescent protein (PCP-GFP) attached to an sgRNA PP7 hairpin stem loop; and iii) a red fluorescent protein (N22-RFP) attached to an sgRNA BoxB hairpin stem loop.

(18) FIG. 9 presents exemplary data showing the construction and imaging of three embodiments of the CRISPRainbow secondary color constructs: i) cyan (MS2 MCP-BFP+PP7 PCP-GFP), ii) yellow (PP7 PCP-GFP+BoxB N22-RFP) or iii) magenta (BoxB N22-RFP+MS2 MCP-BFP).

(19) FIG. 10 presents exemplary data showing the construction and imaging of one embodiment of the CRISPRainbow tertiary color construct: white three (MS2 MCP-BFP+PP7 PCP-GFP+BoxB N22-RFP).

(20) FIG. 11 presents exemplary data showing a wide spectrum of colors generated by embodiments of CRISPRainbow constructs.

(21) FIG. 11(A): Primary colors for DNA labeling. Two MS2 (top left), two PP7 (top middle) or two boxB (top right) elements were inserted into a human telomere-specific sgRNA to generate primary colors. Shown beneath each sgRNA is live cell labeling of telomeres in human U2OS cells following co-expression of dCas9, the indicated sgRNA, and the cognate fluorescent protein. (The “overlay” images are on the live cell phase contrast micrographs in this and all other image figures in this paper.) Scale Bar: 5 μm.

(22) FIG. 11(B): Secondary colors. MS2 and PP7 (top left), PP7 and boxB (middle left) or boxB and MS2 (bottom left) were inserted into the sgRNA so as to generate cyan, yellow or purple respectively, when bound by the cognate fluorescent proteins. Images at the right of each secondary color design are the telomere labeling images obtained after co-expression of dCas9, the indicated sgRNA, and the cognate pair of fluorescent proteins, Scale Bar: 5 μm.

(23) FIG. 11(C): A tertiary “color”. boxB, MS2 and PP7 were inserted into the sgRNA to generate white (left). Images at the right are telomere labeling following co-expression of dCas9, the triple element-bearing sgRNA, and the three cognate fluorescent proteins. Scale bar: 5 μm. Data in all panels are representative of experiments performed at least three times.

(24) FIG. 12 presents exemplary data showing simultaneous labeling of multiple independent gene loci. Shown is a cell following co-expression of dCas9, the three sgRNAs and the cognate fluorescent proteins. Each repeated sequence was labeled by co-expression of dCas9, the three indicated sgRNAs, and the three cognate fluorescent proteins. Scale Bar: 5 μm. Data in all panels are representative of experiments performed at least three times.

(25) FIG. 12(A): Simultaneous labeling of three (3) independent gene loci. MCP-3XBFP—A human chromosome 9 repeated sequence (blue). PCP-3XGFP—A human chromosome 3 repeated sequence (green). N22-3X RFP—A telomeric repeated sequence (red). Each repeated sequence was labeled by co-expression of dCas9, the three indicated sgRNAs, and the three cognate fluorescent proteins. Scale Bar: 5 μm.

(26) FIG. 12(B): Simultaneous labeling of four (4) independent gene loci. MCP-3XBFP—A human chromosome 9 repeated sequence (blue). PCP-3XGFP—A human chromosome 13 repeated sequence (green). N22-3XRFP—A telomeric repeated sequence (red). PCP-3XGFP/N223XRFP—A human chromosome 3 repeated sequence (yellow).

(27) FIG. 13 presents exemplary data showing diversity in C3, C9, C13 and telomere range and direction movements.

(28) FIG. 14 presents exemplary data demonstrating live tracking of multiple DNA loci simultaneously. Unique sites in chromosome 3, 9 and 13 as well as telomeres were labeled simultaneously using the CRISPRainbow colors blue, green, red and yellow respectively. The exemplary data also show independent intrachromosomal movements for C3-1, C3-2 and C3-3. The movements of these loci were recorded at 50 ms per frame for 10 seconds (200 total frames). All trajectories were shifted to start from the origin (0, 0) for easy comparison of the movement vectors. Scale bar: 5 μm. Data are representative of experiments performed at least three times.

(29) FIG. 15 presents exemplary data of photobleaching recovery for live cell imaging using a sgRNA-PP7 PCP-GFP dCAS9 construct.

(30) FIG. 16 presents exemplary data showing the localization of six chromosome-specific loci simultaneously. Scale bar: 3 μm. Data in all panels are representative of experiments performed at least three times.

(31) FIG. 16(A): Construct pCRISPRainbow-sgRNA-Cx-C14-C7-C1-C13-C3 for co-expression of six (6) sgRNAs each differentially labeled with a single, or combination of, fluorescent proteins.

(32) FIG. 16(B): pCRISPRainbow-sgRNA-Cx-C14-C7-C1-C13-C3, dCas9, MCP-3XBFP, PCP-3XmNeonGreen and N22-3XRFP were co-transfected into U2OS cells. Each CRISPRainbow color was dedicated to one chromosome locus: blue for chromosome X, green for chromosome 14, red for chromosome 7, cyan for chromosome 1, yellow for chromosome 13 and magenta for chromosome 3 respectively.

(33) FIG. 17 presents one embodiment of a TetR doxycycline inducible sgRNA construct using CRISPRainbow dCAS9 constructs, referred to herein as, “Broccoli”, and one embodiment of a conventional mCherry-DD dCAS9 construct whose activity is blocked by Shield 1.

(34) FIG. 18 presents exemplary data showing TetR doxycycline inducible sgRNA construct stability in U2OS cells.

(35) FIG. 19 presents exemplary data showing the effect of the presence or absence of dCAS9 on sgRNA stability in U2OS cells.

(36) FIG. 20 presents exemplary data showing the effect of actinomycin D on sgRNA stability in TetR doxycycline inducible CRISPRainbow constructs.

(37) FIG. 21 presents exemplary data showing the on-target efficiency of a CRISPRainbow “Broccoli” construct as compared to a conventional mCherry-dCAS9 label at various low intensity blue fluorescent protein (BFP) background levels.

(38) FIG. 22A presents exemplary data showing the on-target efficiency of a CRISPRainbow “Broccoli” construct as compared to a conventional mCherry-dCAS9 label at various high intensity blue fluorescent protein (BFP) background levels.

(39) FIG. 22B presents a comparative analysis between the data on-target efficiencies presented in FIG. 21 and FIG. 22A.

(40) FIG. 23 presents exemplary data showing the effect of dCAS9 concentration on the efficiency of sgRNA on-target intensity.

(41) FIG. 24 presents exemplary data showing a complete analysis of the different factors believed to play a role in sgRNA on-target intensity efficiency.

(42) FIG. 25 presents exemplary data showing the effect of sgRNA mutations on sgRNA on-target residence time.

(43) FIG. 26 presents exemplary data showing the effect of sgRNA nucleotide mismatches on CAS9 cleavage efficiency.

(44) FIG. 27 presents exemplary data showing the detection of telomeric repeat sequences in a human patient.

(45) FIG. 27A: Telomere detection of patient-derived fibroblast (FTD #26).

(46) FIG. 27B: Detection of GGGGCC (SEQ ID NO: 1) (G4C2) telomeric repeats in an FTD patient-derived fibroblast.

DETAILED DESCRIPTION OF THE INVENTION

(47) The present invention is related to the field of clinical diagnostics of genetic diseases. In particular, the genetic diseases are associated with repeat expansion sequences located in a non-coding region. A Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) sequence detection platform is provided that detects only the repeat expansion sequences. The CRISPR detection platform can diagnose genetic diseases using routine laboratory procedures within an hour of taking a biological sample. dCas9 constructs are also contemplated as having fluorescent proteins bound to any or all stem loop sequences, wherein detection of a plurality of dCas9 constructs having different colored fluorescent proteins can simultaneously detect at least six (6) different gene target loci.

(48) I. Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)

(49) A. The CRISPR Platform

(50) Clustered regularly interspaced short palindromic repeat (CRISPR) RNA sequences and CRISPR-associated (Cas) genes generate catalytic protein-RNA complexes that utilize the incorporated RNA to generate sequence-specific double strand breaks at a complementary DNA sequence. Bhaya et al., (2011). The Cas9 nuclease from Streptococcus pyogenes (hereafter, Cas9) can be guided to specific sites in the human genome through base-pair complementation between a 20 nucleotide guide region of an engineered single-guide RNA (sgRNA) and a genomic target sequence. Mali et al., (2013b); Cho et al., (2013); Cong et al., (2013); and Jinek et al., (2013). A catalytically-inactive programmable RNA-dependent DNA-binding protein (dCas9) can be generated by mutating the endonuclease domains within Cas9 which can modulate transcription in bacteria or eukaryotes either directly or through an incorporated effector domain. Qi et al., (2013); Bikard et al., (2013); Gilbert et al., (2013a); Mali et al., (2013a); Konermann et al., (2013); Maeder et al., (2013); and Perez-Pinera et al., (2013).

(51) CRISPR-based defense systems are found broadly in bacterial and archaeal systems. Type II systems employ a single protein, Cas9, to facilitate RNA-guided cleavage of a target DNA sequence complementary to the sgRNA and the protospacer adjacent motif (PAM) recognized by Cas9, where both elements must be recognized to achieve efficient DNA cleavage. Sorek, R. et al. (2013) “CRISPR-Mediated Adaptive Immune Systems in Bacteria and Archaea,” Annu. Rev. Biochem. 82(1), 237-266; and Hsu, P. D. et al. (2013) “DNA targeting specificity of RNA-guided Cas9 nucleases,” Nat. Biotechnol. 31(9), 827-832, see also FIG. 1A.

(52) The Cas9 nuclease from S. pyogenes (hereafter, spCas9) can be targeted to a specific sequence through Watson-Crick pairing between a 20 nucleotide guide region of an engineered single-guide RNA (sgRNA) and a target sequence. The N. meningitidis Cas9 (nmCas9) recognizes a larger PAM element and employs a different (orthogonal) guide RNA. Hou, Z. et al. (2013) “Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis,” P.N.A.S. 110(39), 15644-15649; and Zhang, Y. et al. (2013) “Processing-Independent CRISPR RNAs Limit Natural Transformation in Neisseria meningitidis,” Mol. Cell 50(4), 488-503; see also, FIG. 1B.

(53) A catalytically-inactive programmable, RNA-dependent DNA-binding protein (the nuclease-dead versions of these Cas9 variants: dspCas9 or dnmCas9) can be generated by mutating the RuvC and HNH endonuclease domains within Cas9, which can modulate transcription in bacteria or eukaryotes either directly or through an incorporated effector domain. See, FIG. 1C.

(54) Various systems involving CRISPR-Cas systems have been described. For example, a prokaryotic type II CRISPR-Cas systems can be adapted to enable targeted genome modifications across a range of eukaryotes. Mali, P. et al. (2013). The reference describes an engineered system to enable RNA-guided genome regulation in human cells by tethering transcriptional activation domains either directly to a nuclease-null Cas9 protein or to an aptamer-modified single guide RNA (sgRNA). Using this functionality a transcriptional activation-based assay was developed to determine the landscape of off-target binding of sgRNA:Cas9 complexes and compared it with the off-target activity of transcription activator-like effectors (TALEs).

(55) A CRISPR-associated catalytically inactive Cas9 protein (dCas9) has been described that offers a general platform for RNA-guided DNA targeting. Gilbert, et al. (2013). Here, the reference describes that fusion of dCas9 to effector domains with distinct regulatory functions enables stable and efficient transcriptional repression or activation in human and yeast cells, with the site of delivery determined solely by a coexpressed short guide (sg)RNA. The reference employs a lentiviral delivery system to introduce the elements into the cells.

(56) A single or a plurality of sgRNAs can direct dCas9 fused to a VP64 transcriptional activation domain to increase expression of endogenous human genes targeting gene transcriptional activation and repression in human cell lines and activation in E. coli cells. The results suggest that multiple or a plurality of sgRNA-dCas9-VP64 complexes can function efficiently together in a single cell. Maeder, et al. (2013).

(57) It has been described that the use of a Cas9 nuclease mutant that retains DNA-binding activity and can be engineered as a programmable transcription repressor by preventing the binding of the RNA polymerase (RNAP) to promoter sequences or as a transcription terminator by blocking the running RNAP in bacteria. In addition, a fusion between the omega subunit of the RNAP and a Cas9 nuclease mutant directed to bind upstream promoter regions can achieve programmable transcription activation. Bikard, et al. (2013).

(58) A catalytically dead Cas9 lacking endonuclease activity has been reported that when coexpressed with a guide RNA, generates a DNA recognition complex that can specifically interfere with transcriptional elongation, RNA polymerase binding, or transcription factor binding. This system, which is referred to as CRISPR interference (CRISPRi), can efficiently repress expression of targeted genes in Escherichia coli, with no detectable off-target effects. Qi, et al. (2013).

(59) A catalytically dead Cas9 with a fused activation domain has been reported that when coexpressed with a guide RNA, generates a DNA recognition complex that can specifically activate transcriptional elongation of genes, but that 3 to 4 sgRNAs are required for robust activity. This system, which is referred to as CRISPR-on, was used to activate genes in mouse embryonic stem cells (mESCs), HeLa cells and mouse zygotes. Cheng, A. W. et al. (2013) “Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system,” Cell Res. 23(10), 1163-1171.

(60) A CRISPR targeting process has been described that relies on CRISPR components; is sequence-specific; and, upon simultaneous introduction of a plurality of custom guide RNA (gRNAs), can effect multiplex editing of target loci. The reference describes engineering the type II bacterial CRISPR system to function with custom (sgRNA) in human cells. For the endogenous AAVS1 locus, targeting rates of 10 to 25% in 293T cells was obtained, 13 to 8% in K562 cells, and 2 to 4% in induced pluripotent stem cells. The reference describes the results as establishing an RNA-guided editing tool for facile, robust, and multiplexable human genome engineering. Mali, et al. (2013).

(61) An approach that combines a Cas9 nickase mutant with paired guide RNAs to introduce targeted double-strand breaks has also been reported. Ran, F. A. et al. (2013) “Double Nicking by RNA-Guided CRISPR Cas9 for Enhanced Genome Editing Specificity,” Cell 154(6), 1380-1389. Because individual nicks in the genome are repaired with high fidelity, simultaneous nicking via appropriately offset guide RNAs is required for double-stranded breaks and extends the number of specifically recognized bases for target cleavage. The reference describes that using paired nicking can reduce off-target activity by 50- to 1,500-fold in cell lines and to facilitate gene knockout in mouse zygotes without sacrificing on-target cleavage efficiency. The reference speculates that the versatile strategy enables a wide variety of genome editing applications that require high specificity.

(62) The use of a CRISPR-Cas system from Neisseria meningitides has been reported to demonstrate efficient targeting of an endogenous gene in three hPSC lines using homology-directed repair (HDR). The Cas9 RNA-guided endonuclease from N. meningitidis (NmCas9) recognizes a 5′-GATT-3′ (SEQ ID NO: 7) protospacer adjacent motif (PAM) different from those recognized by Cas9 proteins from S. pyogenes and S. thermophilus (SpCas9 and StCas9, respectively). Similar to SpCas9, NmCas9 is able to use a single-guide RNA (sgRNA) to direct its activity. Because of its distinct protospacer adjacent motif, the N. meningitidis CRISPR-Cas machinery increases the sequence contexts amenable to RNA-directed genome editing. Hou, et al. (2013).

(63) A “CRISPRi system” derived from the Streptococcus pyogenes CRISPR pathway has been reported that requires only the coexpression of a catalytically inactive Cas9 protein (lacking nuclease activity) and a customizable single guide RNA (sgRNA). The Cas9-sgRNA complex binds to DNA elements complementary to the sgRNA and causes a steric block that halts transcript elongation by RNA polymerase, resulting in the repression of the target gene. Larson, M. H. et al. (2013) “CRISPR interference (CRISPRi) for sequence-specific control of gene expression,” Nat. Protoc. 8(11), 2180-2196.

(64) II. dCas9 Sequence Detection Platform

(65) Following its initial discovery in prokaryotic microbes, the CRISPR molecular machinery has been repurposed to allow operation in eukaryotic organisms (e.g., for example, mammals). Generally, two components are involved in the eukaryotic CRISPR system: a DNA endonuclease (Cas9; Cas for CRISPR-associated), and a short RNA sequence termed a single guide (sg) RNA. A ribonucleoprotein complex formed by the association of Cas9 and a sgRNA binds a double-stranded DNA sequence by virtue of sequence complementarity between the sgRNA and the desired target on one or the other DNA strand. A resulting displacement loop forms in the DNA then triggers the endonucleolytic action of Cas9. See, FIG. 2. In gene editing applications, a pair of such cuts is directed to flank the target gene, resulting in its resection.

(66) However, when using a nuclease-inactive version of Cas9, termed dCas9 (d for nuclease-dead), and by attaching a fluorescent reporter to it, it is possible to deploy the CRISPR system as a probe to label specific genomic sequences in living eukaryotic cells. In contrast to the technique of fluorescence in situ hybridization (FISH)—a classical method of considerable utility for many purposes, CRISPR-based labeling offers an advantage of allowing specific chromosomal loci to be spatially mapped in the live cell, and also is very straightforward to carry out as it involves simple DNA transfection of the cells. In a recent further advance, multiple color versions of the CRISPR-based genomic labeling method were developed. Ma et al. Multicolor CRISPR Labeling of Chromosomal Loci in Human Cells. PNAS 112: 3202-3207 (2015).

(67) In one embodiment, the present invention contemplates that a dCas9-GFP fusion protein may be produced by coupled in vitro transcription-translation from an appropriately designed DNA plasmid. In a separate reaction, a sgRNA is designed to recognize any desired target and is also transcribed from a suitable constructed DNA plasmid. Aliquots of a dCas9-GFP fusion protein and a properly targeted sgRNA are deposited on a cell culture attached to glass coverslips during growth and fixation (i.e., for example, 90% (v/v) methanol). The overlying liquid is then removed, the cells are subjected to a brief rinse with a buffer solution and then immediately examined in a fluorescence microscope.

(68) For example, the present invention may utilize any one of a number of repetitive tandem repeat sequences. See, Table 1.

(69) TABLE-US-00001 TABLE 1 Exemplary Types Of CRISPR Tandem Repetitive  Targets Repeat Genomic Location Sequence Template Telomeres TTAGGG (SEQ ID NO: 8) Pericentromeric ATTCC (Satellite II/III) (SEQ ID NO: 9) Expansions CTG; GGGGCC (SEQ ID NO: 1) Subtelomeric/Acrocentric 10-100 base pairs (chromosome specific)
The present invention also provides compositions and methods for genomic sequence recognition using orthogonal Cas9 variants from three bacterial species; S. pyogenes, N. meningitidis (Nm) and S. thermophilus (St1) which have been used for editing and gene regulation in human cells without cross-talk in cognate sgRNA binding. Esvelt K M, et al. Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat. Methods 10(11): 1116-1121. See, Table 2.

(70) TABLE-US-00002 TABLE 2 Cas9 Orthologs For Sequence Detection Cas9  Target DNA Bacterial  Sequence sgRNA PAM Source Size Source Sequences S. pyogenese  9-20 mers Sp sgRNA NGG (Sp Cas9) NAG NGT N.meningitidis 20-24 mers Nm sgRNA NNNNGATT (Nm Cas9) (SEQ ID NO: 10) NNNNGGTT (SEQ ID NO: 11) NNNGCTT (SEQ ID NO: 12) S. thermophilus  20 mers St1 sgRNA NNAGAAW (St Cas9) (SEQ ID NO: 13) NNGGAAW (SEQ ID NO: 14) NNAGGAW (SEQ ID NO: 15) NNAGGGW (SEQ ID NO: 16)
In one embodiment, a binding configuration of an S. pyogenes dCas9 comprises a 20 mer target DNA sequence, an Sp sgRNA sequence and an NGG PAM sequence. FIG. 3.

(71) In some embodiments, the present invention contemplates a dCas9 nucleic acid detection method that has several advantages over conventional methods (e.g., FISH), in that: i) the present method can be completed in one hour; ii) all steps are carried out at ambient laboratory temperature and no special equipment of any kind is required; iii) the method can be performed by entry-level personnel with no specific background in molecular biology; iv) a separate detergent permeability step is unnecessary because the methanol fixation step renders the cells permeable to the dCas9 and sgRNA reagents; v) no DNA denaturation step is required since the CRISPR machinery recognizes double-stranded DNA; vi) the preparation of the two reagents (dCas9 and sgRNA) is very simple and fast relative to the preparation of fluorescent oligonucleotides, and/or less expensive than their purchase from commercial vendors; for example, the dCas9 coupled transcription-translation reaction takes one hour and the dCas9-GFP does not require purification but is used simply as an aliquot of the total reaction mix and the sgRNA is recovered from the transcription reaction by a simple one-step spin column; and vii) no lengthy annealing step is required since CRISPR binding to the DNA target in fixed cells is extremely rapid.

(72) III. Polychromatic sgRNA Sequences

(73) In one embodiment, the present invention contemplates a dCAS9 protein comprising an sgRNA sequence comprising at least one fluorescent label. In one embodiment, the dCAS9 protein comprises a plurality of fluorescent label binding sites. In one embodiment, the sgRNA sequence is bound to the at least one fluorescent label at an least one fluorescent label binding site. In one embodiment, the plurality of fluorescent label binding sites are located on dCAS9-MS2 binding sites.

(74) In one embodiment, the present invention contemplates an sgRNA sequence comprising a plurality of stem loop sequences. In one embodiment, the sgRNA sequence binds to an at least one fluorescent label at said at least one sgRNA stem loop sequence. In one embodiment, the sgRNA sequence is bound to two fluorescent labels, wherein each of said two fluorescent labels are attached at a different stem loop sequence. In one embodiment, the sgRNA sequence is bound to three fluorescent labels, wherein each of said three labels are attached at a different stem loop sequence. In one embodiment, the fluorescent label has a color including, but not limited to, red, green and blue. In one embodiment, the fluorescent label is a green fluorescent protein. In one embodiment, the fluorescent protein is a red fluorescent protein. In one embodiment, the fluorescent protein is a blue fluorescent protein.

(75) Determining gene and chromosome localization and their dynamics in live cells is believed to complement static, in situ approaches. In one embodiment, the present invention contemplates an in vivo DNA labeling system, “CRISPRainbow”, comprising an sgRNA sequence bound to distinct sets of fluorescent proteins. Although it is not necessary to understand the mechanism of an invention, it is believed that the present invention combinatorially enhances a dCAS9 fusion protein spectral range by which multiple loci can be simultaneously visualized. For example, the data presented herein demonstrate that as many as six different chromosomal loci can be visualized simultaneously in a single living cell. This capability has found that tracking of multiple chromosomal loci in live cells shows that certain cells are quite restricted in their motion while other cells are far more extensive in their 3-D range.

(76) The current emphasis of CRISPR technology is on gene editing and regulation. Hsu et al., Cell 157:1262-1278 (2014). In one embodiment, the present invention contemplates a method that applies CRISPR technology for labeling defined chromosomal loci as a way to resolve the 3-D genome in live cells. Chen et al., Cell 155:1479-91 (2013); Anton et al., Nucleus 5:163-172 (2014); and Ma et al., Proc. Natl. Acad. Sci. USA 112:3002-3007 (2015). Although it is not necessary to understand the mechanism of an invention, it is believed that the advantages of CRISPRainbow complements and extends information based on fluorescence in situ hybridization (FISH) conducted on fixed cells. For example, previous reports engineered three orthologous CRISPR systems for combined multi-color labeling of chromosomal loci in human cells. Ma et al., Proc. Natl. Acad. Sci. USA 112:3002-3007 (2015). The data presented herein introduces an entirely different and more expansive technology, in particular CRISPRainbow, that is based on a spectral range of fluorescently colored sgRNAs for simultaneously labeling multiple genomic loci.

(77) Conventional sgRNAs were engineered for transcription regulation by addition of protein-interacting RNA aptamers for recruiting transcription factors or by carrying functional RNAs targeting to genomic loci. Zalatan et al., Cell 160:339-350 (2015); Konermann et al., Nature 517:583-588 (2015); and Shechner et al., Nat Methods 12:664-670 (2015). In some embodiments, the present invention contemplates improvements to these sgRNA scaffolds (e.g., sequences) that are adapted to recruit (e.g., for example, by either covalent and/or non-covalent binding) fluorescent proteins. In one embodiment, these fluorescent proteins are useful for imaging dCAS9-targeted cells.

(78) CRISPRainbow is an advance that has novel advantages and enables new applications of the basic CRISPR platform. For example, challenges had remained for visualizing multiple genomic loci in live cells simultaneously by CRISPR-based approaches, notwithstanding an introduction of a multicolor CRISPR system based on orthogonal Cas9's. Ma et al., Proc. Natl. Acad. Sci. USA 112:3002-3007 (2015). In the conventional orthogonal Cas9 approach, each Cas9 requires different PAM sequences, which limits the range of target loci, plus the expression of the three Cas9s has to be balanced during multicolor labeling. Esvelt et al. Nat. Methods 10:1116-1121 (2013). Despite the recent reports using S. aureus Cas9, Cpf114 and SpCas9 variants, each having specific PAM sequences, even though they may expand the range of target sequence choice and might be amenable to the orthogonal Cas9-based multiple labeling system, their specificity and efficiency of DNA labeling need to be further determined. Ran et al., Nature 520:186-191 (2015); and Kleinstiver et al., Nature 523:481-485 (2015). In contrast, unlike orthogonal Cas9-based labeling, which requires a cognate sgRNA for each Cas9, in CRISPRainbow a single Cas9 is associated with variously colored sgRNAs. Thus, CRISPRainbow can be thought of as a “spectral code”, and the full polychromatic range should be readily expandable, for example by use of yet a fourth RNA aptamer designed to be bound by, for example, a far-red fluorescent protein. Dean et al., Nat. Chem. Biol 10:512-523 (2014). In principle, adding even one more color to CRISPRainbow would extend the simultaneous live cell detection of genomic loci to fifteen (15) spectrally distinctive colors.

(79) In some embodiments, the present invention contemplates short guide RNA sequences (e.g, close to seed sequence lengths) to facilitate efficient labeling. Jiang et al., Science 348:1477-1481 (2015). Although it is not necessary to understand the mechanism of an invention, it is believed that short guide RNA sequences should make it possible to deploy a nuclease-active Cas9 for labeling due to a lack of cleavage. Fu et al., Nat. Biotechnol. 32:279-284 (2014); Dahlman et al., Nat. Biotechnol. doi: 10.1038/nbt.3390 (2015); and Kiani et al., Nat. Methods doi: 10.1038/nmeth.3580 (2015). In such a format, one can envision a switchable CRISPR platform in which a live cell genomic loci labeling mode with Cas9, instead of dCas9, is then redirected to gene editing by simply changing the expressed sgRNA to a longer form.

(80) A. Signal-To-Noise Considerations

(81) Conventional sgRNA scaffolds used for gene editing proved to be inefficient for DNA labeling and had to be optimized by A.fwdarw.U mutations and stem loop extensions. Chen et al., Cell 155:1479-91 (2013); and FIG. 7A and FIG. 7B. Previous studies using boxB/λ N22 peptide pair used for RNA imaging showed inefficient DNA labeling in the CRISPRainbow system. Daigle et al., Nat Methods 4:633-636 (2007). It was also found that an affinity enhanced λ N22 peptide variant/boxB pair substantially increased the signal to noise ratio. Austin et al., J. Am. Chem. Soc. 124:10966-10967 (2002).

(82) In some embodiments, the present invention contemplates replacing a sgRNA A-U pair with a sgRNA G-C pair in an sgRNA stem loop sequence. Although it is not necessary to understand the mechanism of an invention, it is believed that the A-U to G-C pair replacement results in improved signal to noise ratio as compared to conventional dCAS labeling sgRNAs without the necessity of stem loop extension.

(83) B. Multi-Loci Differential Color Labeling

(84) In one embodiment, the present invention contemplates an sgRNA sequence comprising an A-U pair to G-C pair mutation. In one embodiment, the mutated sgRNA sequence comprises at plurality of hairpin turns (e.g., stem loops). In one embodiment, the stem loops include, but are not limited to MS2, PP7 and BoxB. Daigle et al., Nat Methods 4:633-636 (2007). Although it is not necessary to understand the mechanism of an invention, it is believed that these hairpin turns can establish a broad spectral range for multi-loci labeling. For example, a variety of combinations of these hairpin turns are contemplated such that each sgRNA recruits a different pair of fluorescent proteins (FPs) recognizing two RNA elements. Such hairpin turn combinations can generate the following color combinations as a result of spectral overlapping: i) three primary colors—blue (MS2 MCP-blue fluorescent protein), green (PP7 PCP-green fluorescent protein) or red (BoxB N22-red fluorescent protein) when a single label is bound to an sgRNA sequence (FIG. 8); ii) three secondary colors—cyan (MS2 MCP-BFP+PP7 PCP-GFP), yellow (PP7 PCP-GFP+BoxB N22-RFP) or magenta (BoxB N22-RFP+MS2 MCP-BFP) when pairs of red, green or blue fluorescent proteins are bound to the same sgRNA (FIG. 9); and iii) white—when all three (MS2 MCP-BFP+PP7 PCP-GFP+BoxB N22-RFP) red, green and blue florescent proteins are bound to the same sgRNA sequence (FIG. 10). In one embodiment, the present invention contemplates generation of at least seven (7) fluorescent colors using an sgRNA labeled with a variety of fluorescent label combinations of red, green and blue colors.

(85) The data shown herein depicts various strategies for introducing any one of the three primary colors onto an sgRNA and shows live cell images of telomere labeling. FIG. 11A. In contrast, improved labeling in live cells is observed when using a dual color CRISPRainbow labeled sgRNA. FIG. 11B. Labeling with an sgRNA labeled with all three primary colors is shown as white fluorescence. FIG. 11C.

(86) To further evaluate the reliability of combinatorial colors in the CRISPRainbow system, z-stack images and maximum projections were assessed by capturing signals for pairs of fluorescent proteins simultaneously for the secondary colors. These data show that >97% of the telomere foci are labeled concurrently and that the brightness of each color at the same locus is highly correlative.

(87) C. Multiple Site Labeling

(88) To confirm the specificity of CRISPRainbow in its primary color mode, two distinct genomic loci were evaluated. In particular, telomeric sequences and repeated sequences in chromosome 9 (C9) were assayed. Repeat sequences were labeled with sgRNAs carrying hairpin stem loops including, but not limited to, MS2, PP7 or box B in pair-wise combinations, resulting in bi-color images. (data not shown). In another exemplification, these same two loci (telomeres and the C9 repeat) together with another repeated sequence in the subtelomeric region on the long arm of chromosome 3 (C3), were simultaneously visualized as three independent genomic loci. FIG. 12A. The telomeres and loci on C9 and C13 were readily labeled with the three primary colors (blue, green and red, respectively) while the locus on C3 was labeled by the fourth color, yellow, generated by the combination of green and red on that sgRNA. See, FIG. 12B. The same three loci as in FIG. 12A were targeted but with the C3 locus labeled in this case using a sgRNA carrying both the PP7 and boxB elements.

(89) The simultaneous labeling of these four loci: e.g., telomere repeats, chromosome 3 (C3) repeats, chromosome 9 (C9) repeats, and chromosome 13 (C13) repeats were performed with short sgRNAs with an 11-mer guide RNA sequences for the C3 and C13 labeling because truncated sgRNAs significantly increase the signal to noise ratio compared to 20-mer guide RNA sequences for these two loci.

(90) D. Nuclear Kinetics

(91) To interrogate the intranuclear dynamics of the above four loci in living cells, time-lapse microscopy was used to simultaneously track nuclear movements. The data show that the motion of different chromosomal loci is diverse in both range and direction. See, FIG. 13. Strikingly, the range of observed movement can vary even for different loci within a single chromosome, such as ˜750 nm for C3-1 and ˜250 nm for C3-2 and C3-3. FIG. 14.

(92) Although previous studies have tracked the movements of single chromosomal sites, such as telomeres or integrated lac operator arrays, CRISPRainbow offers the first opportunity to do so in a multiplex mode for a number of endogenous chromosomal loci. Jegou et al., Mol. Biol. Cell 20:2070-2082 (2009). Moreover, although the tracking results shown here were obtained over a very short interval, thus addressing instantaneous dynamics, with sufficient control over photobleaching, CRISPRainbow should enable longer term observations of the 3-D intranuclear positioning of various chromosomal sites, e.g. during progression through interphase, a program of cellular differentiation or in cases of translocations. See, FIG. 15.

(93) E. HexaPlex Gene Loci Targeting

(94) To exemplify the full potential of color range of CRISPRainbow, in one embodiment the present invention contemplates a method for labeling six distinct gene loci targets by detecting six CRISPRainbow sgRNA construct colors simultaneously. Gene loci targets located on chromosomes 1, 3, 7, 13, 14 and X, respectively, were chosen for each CRISPRainbow color using the color combination pattern of three primary colors and three secondary colors. To coordinate the expression of six sgRNAs in a single cell, a single plasmid was created to express all six sgRNAs. FIG. 16A. The location of each chromosomal site could be resolved by its expected CRISPRainbow color: blue for chromosome X, green for chromosome 14, red for chromosome 7, cyan for chromosome 1, yellow for chromosome 13 and magenta for chromosome 3. FIG. 16B.

(95) IV. DNA Expansion Repeat Sequence Detection For Disease Diagnosis

(96) The basis for the improved CRISPR platform described herein, is that the known utility for CRISPR labeling of specific genomic sequences can be modified to identify these sequences. Although it is not necessary to understand the mechanism of an invention, it is believed that such an improvement was possible because a dCas9:sgRNA complex binds double-stranded DNA and thus does not require a DNA denaturation step as is required for FISH. Moreover, it is believed that although a dCas9:sgRNA complex is larger than the oligonucleotides used in FISH, it is likely that after methanol fixation, the CRISPR complex is still able to cross cell membranes.

(97) As an example of the advantages of a dCas9/DNA repeat expansion sequence targeted sgRNA method, it is to be noted that amyotrophic lateral sclerosis (ALS) is currently diagnosed by excluding all other neuromuscular diseases, which typically takes ˜10 months. It has been estimated that ˜10% of ALS patients (once diagnosed) have a c9orf72 repeat expansion. Thus, a rapid assay for such an expansion sequence that can be conducted upon the patient's first clinical visit, when ALS is only one of several possibilities, can accelerate the diagnosis of ALS. Many other repeat-expansion neuromuscular diseases are even more challenging and time-consuming to diagnose than ALS and the usefulness of the presently disclosed method for rapid assessment of these diseases is contemplated herein. La Spada et al. (2010) Repeat expansion disease: progress and puzzles in disease pathogenesis. Nat Rev Genet 11:247-258.

(98) Preliminary data presented herein validates the presently disclosed method by showing the recognition of telomeric repeat sequences by repeat sequence-targeted sgRNA in human U2OS cells (an osteosarcoma cell line). After methanol fixation, incubation of the cells with the dCas9-GFP and sgRNA, followed by a brief wash fluorescence microscopy revealed a pattern of labeling that corresponded to CRISPR labeling of telomeres. See, FIG. 4.

(99) In addition to performing the CARDS assay in human patient and normal subject fibroblasts, the present invention contemplates providing a blood smear cell sample. For example, blood smears can made from a line of transgenic mice bearing a BAC gene construct of human C9orf72 with 500 copies of the GGGGCC (SEQ ID NO: 1) repeat as well as their control line. These blood smears may be treated with methanol and then applied to the presently disclosed CARDS assay as described herein for fibroblasts. The frequency of the C9orf72 expansion signal among the white blood cells can be obtained through multiple experimental repeats and compared with the fibroblast data.

(100) A. Detection of Amyotrophic Lateral Sclerosis (ALS) Expansion Repeat Sequences

(101) The diagnosis of ALS is generally made by exclusion of other neurological diseases and consequently is difficult and time consuming. Therefore, improvements in this area are highly desirable.

(102) Approximately 10% of ALS cases are caused by an elongation of the DNA in the gene C9orf72 and this represents causality for a large proportion of ALS patients. DeJesus-Hernandez et al. (2011). Expanded GGGGCC (SEQ ID NO: 1) hexanucleotide repeats in noncoding region of C9ORF72 causes chromosome 9p-linked FTD and ALS. Neuron 72:245-256; and Renton et al., (2011) A hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome 9p21-linked ALS-FTD. Neuron 72:257-268. Although it is not necessary to understand the mechanism of an invention, it is believed that this gene mutation exists in these patients from birth and in all cells. This raises the possibility that the mutation can be detected in early stage in patients suspected of having the ALS mutation, and can be detected using a simple diagnostic composition.

(103) CRISPR-FISH detection of ALS C9orf72 repeats using dCas9-GFP was tested in preliminary experiments where some drawbacks were identified, for example: 1) dCas9-GFP produced from an in vitro transcription/translation system was not able to quantify the optimal ratio of Cas9/sgRNA; and 2) the brightness and photostability of GFP should be comparable to other dyes, such as SNAP tag or HaloTag, which are also useful to detect the degree of ALS C9orf72 repeat expansion. Cas9-GFP, Cas9-SNAP and Cas9-HaloTag proteins were purified by a three-step purification including affinity column chromatography, ion exchange column chromatography and size exclusion chromatography to obtain a final product comprising pure and highly active Cas9 proteins.

(104) Commercially available, self labeling tags, including but not limited to, SNAP tags and HaloTag dyes were also compared for relative brightness, background and sequence-specificity to determine DNA labeling efficiency. For example, SNAP tags included: 1) SNAP-Surface-954; 2) SNAP-Cell-505-Star, 3) SNAP-TMR-Star; 4) SNAP-Cell-Oregon Green; 5) SNAP-Cell-647-SiR (New England Biolabs). Other SNAP dyes were contributed from the HHMI Janelia Farm Research Campus, including: 1) Janelia-SNAP-JF549 and 2) Janelia-SNAP-JF646. Janelia also contributed two HaloTag dyes, for example: 1) Janelia-HaloTag-JF549 and 2) Janelia-HaloTag-JF646.

(105) In one embodiment, the present invention contemplates a method comprising a CRISPR Arrayed Repeat Detection System (CARDS). In one embodiment, a C9orf72 mutation is detected in a patient cell using a simple benchtop laboratory test that takes only ˜1 hour. The simplicity of this system underscores a distinct advantage over the current methods for detecting C9orf72 mutations. In one embodiment, the patient cells are derived from blood samples or oral lining cell samples (e.g., a buccal mucosal sample). Although it is not necessary to understand the mechanism of an invention, it is believed that the present invention vastly reduces the time and cost to diagnose ALS in patients with C9orf72 mutations as compared with the current methods. Most conventional diagnostic methods for ALS involve a combination of neurological symptomology assessments and laboratory procedures that can only be performed in specialized facilities and require several days for completion. Due to a lack of either a biomarker or a unique symptom that can be definitively associated with ALS, this disease is currently diagnosed by exclusion of all other neuromuscular conditions. Therefore, the diagnosis is a tedious process and takes on average ˜10 months from the onset of initial symptoms.

(106) The presently disclosed compositions were then employed with a fibroblast cell line derived from a patient with the neurodegenerative disease amyotrophic lateral sclerosis (ALS). In this patient's form of ALS, one of two alleles of a c9orf72 gene contains a very long expansion sequence in its first intron comprising greater than 1000 repeats of a hexanucleotide GGGGCC (SEQ ID NO: 1). Consequently, a dCas9-GFP and a sgRNA were designed to target a GGGGCC (SEQ ID NO: 1) hexanucleotide repeat in the first intron of the C9orf72 locus. See, FIG. 5A. Incubation of methanol-fixed ALS fibroblast cells with dCas9-GFP and a GGGGCC- (SEQ ID NO: 1) targeted sgRNA resulted in a single focal site (e.g., representing a single fluorescent signal). See, FIG. 5B; arrow. In one embodiment, the sgRNA is an sgRNA-W1 having a sequence of 5′-GCC-GGGGCC-GGGGCC-GGGGC-3′ (SEQ ID NO: 3). In one embodiment, the sgRNA is an sgRNA-C1 having a sequence of 3′-CCCGG-CCCCGG-CCCCGG-GGG-5′ (SEQ ID NO: 4). Although it is not necessary to understand the mechanism of an invention, it is believed that since only one signal is observed means that a non-expanded wild-type allele has an insufficient number of repeats to be detected. Normally, any sensitivity limitation with an analytical method is problematic but in the presently disclosed dCas9 method sensitivity limits constitute an advantage, in that a clinically-meaningful expanded allele is readily detectable. Thus, the data suggests that a detected single signal represents a mutated allele and demonstrate that the method disclosed herein can detect a C9orf72 sequence repeat expansion in patient cells.

(107) B. Sensitivity and Specificity of the CARDS Assay

(108) Although it is not necessary to understand the mechanism of an invention, it is believed that many different variables contribute to achieving optimal results, defined as robust signal detection in >10% of diseased patient cells and ˜0% in non-diseased subject control cells. For example, data determined when using various molar ratio mixtures of sgRNA:dCas9 (1:1, 2:1, 4:1, etc.) can be contrasted and compared. Then different concentrations of the optimal ratio mixture can be applied to cells such the percentage of positive cells at each amount is determined. A percentage versus concentration plot of the mixture can be constructed to obtain a dose response curve. By examining the curve in both patient and control cells, a concentration can be determined at which robust signals can be detected in patient cells but no signal in control cells. Then, the presently disclosed method can reliably distinguish between diseased cells (e.g. for example, C9orf72 fibroblast cells derived from ALS patients) and non-diseased control cell lines. Preliminary data demonstrated ˜1% positive cells in a C9orf72 patient line having 1200 expansion repeats and no positive cells in a control line. Nonetheless, it is contemplated that the present method identifies a positive rate in >10% patient cells and none in control cells.

(109) In other embodiments, the present invention contemplates a fusion dCas9 protein comprising a plurality of GFP proteins, wherein said GFP proteins are attached together with flexible linkers. In one embodiment, the plurality of GFP proteins comprises three GFP proteins. Using such a fusion dCas9 protein with either one or multiple GFPs has the advantage of completing the procedure in a single step. See, FIG. 4 and FIG. 5.

(110) In one embodiment, the present invention contemplates a fusion dCas9 protein comprising a plurality of peptide epitopes. In one embodiment, the fusion dCas9 protein comprises a 24×SunTag epitope. In one embodiment, the 24×SunTag epitope has specific affinity for a single chain variable fragment-GFP fusion protein (scFv-GFP). After a fusion dCas9-epitope peptide and sgRNA are applied to the cells, excess dCas9-peptide/sgRNA complex is washed off. The cells may then be incubated with a scFv-GFP. The scFv-GFP binds to the peptides, bringing numerous GFP molecules to the repeat expansion site and amplifying the signal. See, FIG. 6, left panel.

(111) In one embodiment, the present invention contemplates a sgRNA sequence comprising a plurality of RNA binding sites. In one embodiment, the sgRNA comprises up to twenty-four RNA binding sites (e.g., a 24×MS2 epitope). In one embodiment, the RNA binding site has specific affinity for a phage MS2 coat protein (MCP) tagged with GFP. After a dCas9 protein and sgRNA-24×MS2 are applied to the cells, excess dCas9/sgRNA complex may be washed off. Then the cells are incubated with MS2-GFP fusion proteins. The MS-GFP binds to the MS2 RNA motifs, bringing numerous GFP molecules to the repeat expansion site and amplifying the signal. See, FIG. 6, right panel; Bertrand et al., (1998) Localization of ASH1 mRNA particles in living yeast. Mol Cell 2:437-445; and Tanenbaum et al., (2015) A protein-tagging system for signal amplification in gene expression and fluorescence imaging. Cell 159:635-646.

(112) C. Diagnostic Clinical Compositions

(113) In one embodiment, the present invention contemplates a composition comprising a dCas9 protein, an sgRNA sequence that is complementary to at least a portion of a DNA expansion repeat sequence and a CARDS buffer. Although it is not necessary to understand the mechanism of an invention, it is believed that the dCas9 protein and sgRNA sequences are produced by in vitro translation and transcription.

(114) In one embodiment, the present invention contemplates a composition comprising a pre-formed dCas9:sgRNA complex and a CARDS buffer. Based upon present knowledge of CRISPR biochemistry (i.e., for example, an equilibrium association constant of the Cas9:sgRNA complex) a dCas9 protein and sgRNA expansion repeat targeted sequences can be pre-assembled in vitro into a complex and then applied to the test cells.

(115) V. Kits

(116) In one embodiment, the present invention contemplates a reagent kit for diagnosis of any DNA repeat expansion-based human, animal (veterinary) or plant (agriculture, horticulture, sylviculture) disease or condition. In one embodiment, the kit provides diagnosis of at least twenty-four (24 human) neuromuscular diseases. The kits described herein also comprise reagents for performing extracting DNA from blood cells and detecting the expansion using PCR or Southern blots.

(117) In one embodiment, the present invention contemplates a reagent kit comprising a dCas9 protein and at least one DNA repeat expansion sequence-targeted sgRNA. With the provided instructions, data can be obtained from a biological sample including, but not limited to, a blood sample or a buccal mucosal cell smear sample and completed in less than an hour.

(118) In one embodiment, the present invention contemplates a kit comprising: a) a first container comprising a labeled nuclease-dead Cas9 (dCas) protein; b) a second container comprising a single guide ribonucleic acid (sgRNA) sequence that is complementary to at least a portion of a deoxyribonucleic acid repeat expansion sequence; c) a buffer that is compatible with said dCas9 protein and said sgRNA; and d) a sheet of instructions for detecting a deoxyribonucleic acid repeat expansion sequence associate with a genetic disease. In one embodiment, the deoxyribonucleic acid repeat expansion sequence is associated with a genetic disease. In one embodiment, the genetic disease comprises a mutated c9orf72 gene. In one embodiment, the mutated c9orf72 gene results in amyotrophic lateral sclerosis. In one embodiment, the sgRNA sequence comprises a plurality of core repeat sequences. In one embodiment, the plurality of core repeat sequences comprises GGGGCC (SEQ ID NO: 1). In one embodiment, the plurality of core repeat sequences comprises CCCCGG (SEQ ID NO: 2). In one embodiment, the sgRNA is an sgRNA-W1 having a sequence of 5′-GCC-GGGGCC-GGGGCC-GGGGC-3′ (SEQ ID NO: 3). In one embodiment, the sgRNA is an sgRNA-C1 having a sequence of 3′-CCCGG-CCCCGG-CCCCGG-GGG-5′ (SEQ ID NO: 4). In one embodiment, the label is a green fluorescent protein.

(119) In one embodiment, the kit can include one or more containers comprising a vector coding for a nuclease-deficient Cas9 (dCas9) DNA vector comprising an sgRNA targeting sequence fused with a nucleic acid sequence encoding a fluorescent protein. In one container, the fluorescent protein may include, but is not limited to, a green fluorescent protein, a red fluorescent protein, or a blue fluorescent protein.

(120) The kit can optionally include enzymes capable of performing PCR (i.e., for example, DNA polymerase, Taq polymerase and/or restriction enzymes). The kit can optionally include a delivery vehicle for said vectors (e.g., a liposome). The reagents may be provided suspended in the excipient and/or delivery vehicle or may be provided as a separate component which can be later combined with the excipient and/or delivery vehicle. The kit may optionally contain additional therapeutics to be co-administered with the vectors to affect the desired transcriptional regulation.

(121) The kits may also optionally include appropriate systems (e.g. opaque containers) or stabilizers (e.g. antioxidants) to prevent degradation of the reagents by light or other adverse conditions.

(122) The kits may optionally include instructional materials containing directions (i.e., protocols) providing for the use of the reagents in affecting transcriptional regulation of cell cultures and delivery of said vectors to said cell cultures. While the instructional materials typically comprise written or printed materials they are not limited to such. Any medium capable of storing such instructions and communicating them to an end user is contemplated by this invention. Such media include, but are not limited to electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. Such media may include addresses to internet sites that provide such instructional materials.

EXPERIMENTAL

(123) The following examples are provided in order to demonstrate and further illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.

Example 1

Construction of Cas9 Expression Plasmids

(124) Human-codon optimized dCas9 (nuclease-dead) from S. pyogenes (18), N. meningitidis and S. thermophilus (15) were fused to 1XGFP, 2XGFP, 3XGFP, 3XmCherry or 3XTagBFP and subcloned into pHAGE-DEST lentiviral vector. Esvelt K M, et al. Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat. Methods 10(11): 1116-1121; and Kearns N A, et al. (2014) Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development 141(1):219-223.

(125) To optimize the promoters for U2OS and RPE1 cells, the EF1α promoter in the pHAGE-EFla-DEST vector was replaced by EFS, SFFV and CMV-TetO promoters respectively and results in the pHAGE-EFS-DEST, pHAGE-SFFV-DEST and pHAGE-TO-DEST. To optimize the nuclear localization, 2× SV40 NLSs were fused to S. pyogenes dCas9, N. meningitidis dCas9, while up to 6×SV40 NLSs were fused to S. thermophilus dCas9. A list of Cas9 labeled fusion proteins constructed is shown in Table 3.

(126) TABLE-US-00003 TABLE 3 Exemplary Cas9 Labeled Fusion Proteins Promoter dCas9 Fusion protein NLS 1 EF1 α NLS-Sp dCas9-NLS-sfGFP 2X 2 SSFV NLS-Sp dCas9-NLS-sfGFP 2X 3 EFS NLS-Sp dCas9-NLS-sfGFP 2X 4 CMV-TetO NLS-Sp dCas9-NLS-sfGFP 2X 5 CMV-TetO NLS-Sp dCas9-NLS-2XsfGFP 2X 6 CMV-TetO NLS-Sp dCas9-NLS-3XsfGFP 2X 7 CMV-TetO NLS-Sp dCas9-NLS-3XmCherry 2X 8 CMV-TetO NLS-Nm dCas9-NLS-3XsfGFP 2X 9 CMV-TetO NLS-Nm dCas9-NLS-3XmCherry 2X 10 CMV-TetO NLS-St1 dCas9-NLS-3XsfGFP 2X 11 CMV-TetO NLS-St1 dCas9-2XNLS-3XsfGFP 3X 12 CMV-TetO NLS-St1 dCas9-3XNLS-3XsfGFP 4X 13 CMV-TetO NLS-St1 dCas9-3XNLS-3XTagBFP2 4X 14 CMV-TetO NLS-St1 dCas9-3XNLS-3XsfGFP-NLS 5X 15 CMV-TetO NLS-St1 dCas9-3XNLS-3XsfGFP-2XNLS 6X

Example 2

Construction of sgRNA Expression Vectors

(127) The sgRNA expression vector is based on the pLKO.1 lentiviral expression plasmid containing CcdB gene between two BbsI sites for inserting guide sequences into the sgRNAs. Optimized sgRNA for S. pyogenes Cas9 was subcloned into pLKO.1-Hygro, resulting in pLH-Sp sgRNA2. Nm sgRNA mutants for N. meningitidis Cas9 were subcloned into pLKO.1-Hygro, resulting in pLH-Nm sgRNAm1 and pLHNm sgRNA1.1. St1 sgRNA mutants for S. thermophilus Cas9 were subcloned into pLKO.1-Hygro, resulting in pLH-St1 sgRNAm1, pLH-St1 sgRNAm7, pLHSt1 sgRNA1.1, pLH-St1 sgRNA2.1 and pLH-St1 sgRNA3.1. A rapid guide RNA expression plasmids construction protocol was optimized as follows: a pair of oligos (2 μM) were denaturing at 95° C. for 3 min and cooling down to room temperature, and the mixture of oligos (4 nM) and sgRNA vectors (100 ng) were quickly digested by BbsI and ligated by T7 ligase at 37° C. for 10 min in the same tubes, and then directly subjected to transformation using CcdB as counter-selection. The sgRNA vectors and guide RNA sequences are listed in Tables 4 and 5 respectively.

(128) TABLE-US-00004 TABLE 4 Exemplary sgRNA Vectors Vector Name sgRNA expression vector Cassette 1 pLH-Sp sgRNA2 U6 promoter-BbsI-CcdB-BbsI-Sp sgRNA2 2 pLH-Nm sgRNAm3 U6 promoter-BbsI-CcdB-BbsI-Nm sgRNAm3 3 pLH-Nm sgRNA1.1 U6 promoter-BbsI-CcdB-BbsI-Nm sgRNA1.1 4 pLH-St1 sgRNAm1 U6 promoter-BbsI-CcdB-BbsI-St1 sgRNAm1 5 pLH-St1 sgRNAm7 U6 promoter-BbsI-CcdB-BbsI-St1 sgRNAm7 6 pLH-St1 sgRNA1.1 U6 promoter-BbsI-CcdB-BbsI-St1 sgRNA1.1 7 pLH-St1 sgRNA2.1 U6 promoter-BbsI-CcdB-BbsI-St1 sgRNA2.1 8 pLH-St1 sgRNA3.1 U6 promoter-BbsI-CcdB-BbsI-St1 sgRNA\3.1

(129) TABLE-US-00005 TABLE 5 Exemplary sgRNA Sequences, Targets And PAMs SEQ ID dCas9 Target Guide RNA sequence NO: PAM  1 S. pyogenes DMC4 GTGGCGTGACCTGTGGATGCTG 17 GG  2 S. pyogenes Telo- GGTTAGGGTTAGGGTTAGGG 18 TA TA  3 S. pyogenes Telo- AGGGTTAGGGTTAGGGTTAG 19 GT GT  4 S. pyogenes Telo- GTTAGGGTTAGGGTTAGGGT 20 AG AG  5 S. pyogenes Sp- TTAGGGTTAGGGTTAGGGTT 21 GG Telo  6 S. pyogenes Telo- GGGTTAGGGTTAGGGTT 22 GG 17  7 S. pyogenes Telo- TAGGGTTAGGGTT 23 GG 13  8 S. pyogenes Telo- GTTAGGGTT 24 GG 10  9 S. pyogenes Telo- AGGGTT 25 GG 06 10 S. pyogenes C9-1 TGGAATGGAATGGAATGGAA 26 GG 11 S. pyogenes C9-2 TGTCTGTGAGGAAGCTCCCC 27 GG 12 S. pyogenes C13-1 TAAGCATGGACCATTCCTTC 28 GG 13 S. Pyogenes C13-2 GGGCCAGGACCTCTAAAA 29 GG CCGGGGAAGTGCTGAGTC 30 GG TGGTGGGTGTAGACACGG 31 GG 14 N. Telo- GGTTAGGGTTAGGGTTAGGGTTAG 32 AGGG meningitidis AGGG 15 N. Telo- GTTAGGGTTAGGGTTAGGGTTAGG 33 GGGT meningitidis GGGT 16 N. Nm- TTAGGGTTAGGGTTAGGGTTAGGG 34 GGTT meningitidis Telo 17 N. Telo- TAGGGTTAGGGTTAGGGTTAGGGT 35 GTTA meningitidis GTTA 18 N. C13-1 CTCCATCCTGAAGGAATGGTCCAT 36 GCTT meningitidis 19 S. St1- GGTTAGGGTTAGGGTTAGGG 37 AGGG thermophilus Telo 20 S. C9-1 ATGGAATGGAATGGAATGGA 38 GGAA thermophilus

Example 3

Cell Culture and Transfection

(130) U2OS cells were cultured at 37° C. in Dulbecco-modified Eagle's Minimum Essential Medium (DMEM; Life Technologies) supplemented with 10% (vol/vol) FBS. RPE1 cells were cultured at 37° C. in DMEM:F12 medium supplemented with 10% (vol/vol) FBS. For live imaging, cells were grown on 35 mm glass bottom dishes (MatTek). In experiments with U2OS cells, a total of 150 ng dCas9 and 750 ng sgRNAs plasmid were cotransfected into 35 mm glass bottom dishes using Lipofectamine 2000 (Life Technologies) and the cells were incubated for another 48 hours. For RPE1 cells, a total of 50 ng dCas9 and 250 ng sgRNAs plasmids were co-transfected into 35 mm glass bottom dishes using Lipofectamine LTX (Life Technologies).

Example 4

Fluorescence Microscopy

(131) The microscope stage incubation chamber was maintained at 37° C. (19) and phase-contrast and fluorescence microscopy was performed as described previously. Jacobson M R, Pederson T (1997) RNA traffic and localization reported by fluorescence cytochemistry. Analysis of mRNA Formation and Function, ed Richter J D (Academic, New York), pp 341-359; and Ma H, Reyes-Gutierrez P, Pederson T (2013) Visualization of repetitive DNA sequences in human chromosomes with transcription activator-like effectors. Proc Natl Acad Sci USA 110(52):21048-21053. mCherry was excited at 556/20 nm (wavelength/bandwidth) and its emission was collected in a 630/91 nm channel. sfGFP was excited at 470/28 nm and its emission was collected in a 512/23 nm channel; TagBFP was excited at 387/11 nm and its emission collected using a 464/23 nm filter. Imaging data were acquired and analyzed by MetaMorph acquisition software (Molecular Devices).

Example 5

Mining for Chromosome-Specific Repeats

(132) The human reference genome hg19 was downloaded from the UCSC genome browser (genome.ucsc.edu). The gaps (regions labeled with N's) in chromosomes 9 and 13 were replaced with randomly generated nucleotides. The bioinformatics tool Tandem Repeat Finder was used to identify tandem repeats in chromosomes 9 and 13. Benson G (1999) Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 27(2):573-580.

(133) Highly conserved repeats with copy numbers >100 were selected as candidates for CRISPR labeling. 23-mers in the tandem repeats ending with GG were used for design of Sp sgRNAs for C9-1, C9-2, C13-1, C13-2. 28-mers ending with GCTT were used for design of Nm sgRNAs for C13-1 and 26-mers ending with GGAA were used for design of St1 sgRNA for C9-1.

(134) The detailed parameters for each targeted repeats are as follows. C9-2 is located in a subtelomeric region q34.3 of chr 9 with the location chr9: 140459676-140463065 and contains 115 copies of sgRNA target sites. C13-1 consists of 177 copies of sgRNA target sites, located in the subtelomeric region q34 of chr 13 with the location chr 13: 112930173-112968847. C13-2 consists of three neighboring tandem repeats in q34 of chr 13 chosen to achieve a combined 102 copies of sgRNA target sites with the following locations: chr13: 114793685-114795158 with 22 copies of target sites; chr13: 114848979-114852850 with 57 copies of target sites; chr13: 114903631-114905572 with 23 copies of target sites.

(135) A BLAST alignment tool was used to verify the chromosome specificity of these sgRNA target sites in human genome Kent W J (2002) BLAT-the blast-like alignment tool. Genome Res. 12(4):656-664.

(136) C9-1 was a tandem array of GGAAT repeats, which are highly concentrated in the pericentromeric region of chr 9. Eymery A, Souchier C, Vourc′h C, Jolly C. (2010) Heat shock factor 1 binds to and transcribes satellite II and III sequences at several pericentromeric regions in heat-shocked cells. Exp Cell Res 316(11):1845-1855.

Example 6

Guide RNA Stability In Live Human Cells

(137) The data presented herein evaluates the existence of guide RNAs in live cells by using fluorescence microscopy. A TetR-doxycycline inducible sgRNA construct was designed and created to evaluate the lifetime and stability of sgRNAs in living systems. FIG. 17. The U20S cell line was used to evaluate the stability of these various constructs. FIG. 18. The effect of the presence or absence of the dCAS9 protein was then evaluated. FIG. 19. The effect of actinomycin D was further evaluated on sgRNA stability using the TetR doxycycline inducible dCAS9 constructs. FIG. 20.

(138) In live cells, sgRNA is extremely unstable without Cas9. The half-live of dCas9/sgRNA complexes is within 15 minutes. sgRNA/Cas9 assembly and stability determines sgRNA level. Poor assembly of sgRNA/Cas9 complexes can result from defective sgRNAs (e.g. short target sequence) or Cas9 (e.g. Cas9 mutant). Steady-state sgRNA level is a limiting factor for efficient DNA targeting. sgRNA/Cas9/DNA complexes are dynamic and the stability depends on sgRNA length.

Example 7

CRISPR/Cas9 Target Binding Efficiency

(139) The data presented herein evaluated the efficiency of CRISPR/Cas9 target binding using the Broccoli CRISPRainbow construct as compared to an mCherry DD dCAS9 construct and low intensity and high intensity blue fluorescent protein background levels. FIG. 21 and FIG. 22, respectively. The data showed that the concentration of dCAS9 relative to the sgRNA played a role in determining sgRNA stability. FIG. 23. Further, a complete assessment of other factors believed to play a role in sgRNA on-target intensity efficiency was evaluated. FIG. 24.

Example 8

Effect of Nucleotide Mismatch on sgRNA On-Target Residence Time

(140) The impact of various mutations in the sgRNA sequences was evaluated for their ability to affect stable hybridization to a specific gene target loci. Hsu et al., Nat. Biotechnol. 31:827-32 (2013); and FIG. 25. Further, the effect of how sgRNA nucleotide mismatches effect CAS9 cleavage efficiency was determined in live cells. Kiani et al, Nat Methods 10:1038 (2015); and FIG. 26. The data show that the mismatch binding kinetics is both position and nucleotide dependent.

Example 9

Telomeric Repeat Sequence Detection Using Self-Labeling Fluorescent Tags

(141) In this example, telomere and C9orf72 repeats were detected from patient-derived fibroblast (FTD #26) using Cas9-HaloTag-JF549 and telomere sgRNA or C9orf72 repeats sgRNA, respectively.

(142) The data show a sensitive detection of the telomeres in this fibroblast cell lines which had previously been beyond conventional detection range using Cas9-GFP-based CRISPR-FISH system since the typical fibroblast telomere length are 3-10 kb. See, FIG. 27A. This FTD #26 fibroblast line was also measured to have ˜1000 G4C2 repeat sequences (˜6 kb) associated with an improved range of detection sensitivity using fluorescent dyes. See, FIG. 27B. The percentage of cells containing G4C2 repeats in the cell population was <5%.

(143) The above description, and the figures to which it refers, are provided for the purpose of describing and illustrating certain preferred embodiments or examples of the invention only, and no attempt has been made to exhaustively describe all possible embodiments or examples of the invention. Thus, the following detailed description and the accompanying figures shall not be construed to limit, in any way, the scope of the claims recited in this patent application and any patent(s) issuing there from.

(144) All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates, which may need to be independently confirmed.