Method for introducing site-directed RNA mutation, target editing guide RNA used in the method and target RNA-target editing guide RNA complex
11390865 · 2022-07-19
Assignee
Inventors
Cpc classification
C12N15/111
CHEMISTRY; METALLURGY
C12N9/78
CHEMISTRY; METALLURGY
C12N15/1024
CHEMISTRY; METALLURGY
International classification
C12N15/10
CHEMISTRY; METALLURGY
C12N9/78
CHEMISTRY; METALLURGY
Abstract
A method for inducing a site-directed RNA mutation is provided. The method includes repairing an RNA mutation by converting target adenosine, which is located at a target editing site of a target RNA, into inosine. The method for inducing a site-directed RNA mutation involves reacting the target RNA having a target adenosine with a target editing guide, which has been constructed so as to form a complementary strand with target RNA, to form a double-stranded complex, and converting the target adenosine to inosine by causing ADAR to act on the double-stranded complex, inducing A-to-I editing capability. The converted inosine is further translated into guanosine.
Claims
1. A method for introducing a site-directed RNA mutation comprising: reacting a 3′-target RNA represented by formula [XXXVIA]: ##STR00001## with a 5′-target editing guide RNA represented by [XXXVIIA], which comprises a base sequence of SEQ ID NO: 99 (GGGUGGAAUA GUAUACCAUU CGUGGUAUAG UAUCCCACCU) between .sup.jN.sub.n+p and .sup.kN.sub.1: ##STR00002## to obtain a 3′-target RNA-5′-target editing guide RNA complex being represented by formula [XXXVIIIA], which comprises a base sequence of SEQ ID NO: 99 (GGGUGGAAUA GUAUACCAUU CGUGGUAUAG UAUCCCACCU) between .sup.jN.sub.n+p and .sup.kN.sub.1: ##STR00003## obtaining a 3′-edited target RNA represented by formula [XXXIXA]: ##STR00004## in which a target base adenosine (A*) of the resulting 3′-target RNA-5′-target editing guide RNA complex is converted to inosine (I*) by A-I editing by action of double-stranded specific adenosine deaminase (ADAR); wherein, the 3′-target RNA comprises a guide-side target complementary region, a target base adenosine and a terminal-side target complementary region, and in formula [XXXVIA], a symbol of .sup.fN1 . . . .sup.fNm corresponds to the terminal-side target complementary region of the 3′-target RNA and indicates a base sequence constructed from the same or different bases, and a symbol of .sup.fN is a base selected from adenine, cytosine, guanine and uracil, and a symbol of m indicates a number of bases of the terminal-side target complementary region in a range of 40 to 20, a symbol of .sup.gN1.sup.gN2 . . . .sup.gNn-1.sup.gNn corresponds to the guide-side target complementary region of the 3′-target RNA and indicates a base from the same or different bases and a symbol of .sup.gN is a base selected from adenine, cytosine, guanine and uracil, and a symbol of n indicates a number of bases of the guide-side target complementary region in a range of 1 to 10, and A* indicates the target base adenine existing at a target editing position; and the 5′-target editing guide RNA comprises a terminal-side target recognition region, a target editing inducing base, a core-side target recognition region, an ADAR binding core region and a guide-side decoupling region, and in formula [XXXVIIA], X is cytosine, guanine or adenine and corresponds to the target editing inducing base, the base sequence of SEO ID NO:99 corresponds to the ADAR binding core region, a symbol of 3′-.sup.kN.sub.p.sup.kN.sub.p−1 . . . .sup.kN.sub.2.sup.kN.sub.1 corresponds to the guide-side decoupling region of the 5′-target editing guide RNA and indicates a base sequence constructed from the same or different bases, and a symbol of .sup.kN is a base elected from adenine, cytosine, guanine and uracil, and a symbol of p indicates a number of bases of the guide-side decoupling region in a range of 10 or less, a symbol of .sup.hN1 . . . .sup.hNm corresponds to the terminal-side target recognition region of the 5′-target editing guide RNA and indicates a base sequence constructed from the same or different bases, and a symbol of .sup.hN is a base selected from adenine, cytosine, guanine and uracil, and a symbol of m indicates the same meaning as described above, and a number of bases in the terminal-side target recognition region is the same number of bases in the base sequence of the terminal-side target complementary region of the 3′-target RNA, and each base in the terminal-side target recognition region forms a base-pair with the corresponding base of the terminal-side target complementary region of the 3′-target RNA, a symbol of .sup.jN1.sup.jN2 . . . .sup.jNn+p corresponds to a base sequence of a X adjacent partial region and an ADAR adjacent partial region in the core-side target recognition region of the 5′-target editing guide RNA and indicates a base sequence constructed from the same or different bases, and a symbol of .sup.jN is a base selected from adenine, cytosine, guanine and uracil, a symbol of n indicates the same meaning as described above and is the same number of bases in a base sequence of the X adjacent partial region of the core-side target recognition region, a symbol of p indicates the same meaning as described above, and is the same number of bases in a base sequence of the ADAR adjacent partial region of the core-side target recognition region, and a base sequence of the X adjacent partial region forms a base-pair with a base sequence of the guide-side target complementary region of the 3′-target RNA, and a base sequence of the guide-side decoupling region forms a base-pair with a base sequence of the ADAR adjacent partial region in the core-side target recognition region as forming the 3′-target RNA-5′-target editing guide RNA complex.
2. The method according to claim 1, wherein n is 3 and p is 0.
3. The method according to claim 1, wherein, the action of ADAR is derived from intravital ADAR mechanism.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
(58)
(59)
(60)
(61)
(62)
(63)
(64)
(65)
(66)
(67)
(68)
(69)
(70)
(71)
(72)
(73)
(74)
(75)
(76)
(77)
(78)
(79)
(80)
(81)
(82)
(83)
(84)
(85)
(86)
(87)
(88)
(89)
(90)
(91)
(92)
(93)
(94)
(95)
(96)
(97)
(98)
(99)
(100)
(101)
(102)
(103)
(104)
(105)
(106)
(107)
(108)
(109)
(110)
(111)
(112)
(113)
(114)
(115)
(116)
(117)
(118)
(119)
(120)
(121)
(122)
(123)
(124)
(125)
(126)
(127)
(128)
(129)
(130)
MODE FOR CARRYING OUT THE INVENTION
(131) The method for introducing a site-directed RNA mutation according to the present invention includes reacting a target RNA containing a target base adenosine (A) to be subjected to RNA editing or a specific region thereof with a target editing guide RNA to prepare a double-stranded complex, binding ADAR to the formed double-stranded complex to induce its RNA editing capability, thereby converting the target base adenosine present in the target RNA into inosine. The inosine thus converted is further translated into guanosine.
(132) Thus, in the present invention, it is preferable to first select RNA which includes the target base adenosine (A) to be subjected to RNA editing as a target RNA. Such RNAs are preferably selected from naturally occurring RNAs, such as serotonin receptors, glutamate receptors, and membrane voltage-dependent potassium channels. However, any RNA having a target base adenosine can be selected.
(133) When a target RNA to be subjected to RNA editing is selected, a specific region containing the target base adenosine to be subjected to RNA editing is selected from among them. In selecting this specific region, it is preferable to construct the specific region composed of a base sequence of a predetermined length on both sides of the target editing site. In the present invention, in addition to the fragment consisting of only this specific region, it is obviously also possible to use a full-length RNA or partial length RNA containing such a specific region. Thus, as used herein, the term “target RNA” is used to mean not only a fragment consisting of only a specific region but also a full-length RNA or a partial length RNA including a specific region or a partial length.
(134) If a specific region of the target RNA is thus selected, then the target editing guide RNA is designed and constructed so that the specific region substantially pairs with the target RNA to form a complementary strand. Once a specific region of such a target editing guide RNA is designed and constructed, it is preferable to design and construct such that the specific region is bound to the ADAR binding core region.
(135) Thus, the method for introducing a site-directed RNA mutation according to the present invention allows the target RNA that is designed and constructed as described above and the target editing guide to form complementary strands of corresponding specific regions to form a complex to construct a double-stranded structure, and induces the A-I editing capability by the action of ADAR to convert the target base adenosine of the target RNA to inosine.
(136) Hereinafter, the modes of the method for introducing a site-directed RNA mutation of the present invention will be specifically described with reference to the attached drawings. It is to be noted that the method of the present invention described below explains the best modes for carrying out the present invention and does not intend to limit the present invention in any meaning.
(137) The present invention can be roughly classified into two aspects depending on the sequence format of the target RNA to be targeted for RNA editing. The first aspect is the sequence format denoted by 5′-target RNA, and the second aspect is the sequence format denoted by 3′-target RNA. “5′-target RNA” means a target target RNA in which the 5′ end exists on the left side (to the attached drawing) of the target base adenosine (A) of the target RNA to be targeted for RNA editing. “3′-target RNA” means a target RNA in which the 3′ end exists on the left side (to the attached drawing) of the target base adenosine (A) to be edited. In this specification. “5′-target RNA” and “3′-target RNA” are sometimes simply referred to as target RNA without strictly distinguishing them from each other.
(138) Thus, the method for introducing a site-directed RNA mutation according to the first aspect and the second aspect of the present invention will be described with reference to
(139) A method for introducing a site-directed RNA mutation according to the first aspect of the present invention includes reacting 5′-target RNA represented by formula [LA] in
(140) The method for introducing a site-directed RNA mutation according to the second aspect of the present invention is substantially the same as the method for introducing a site-directed RNA mutation according to the first embodiment, and includes reacting 3′-target RNA represented by formula [LVA] in
(141) The 5′-target RNA [LA] of the first aspect used in the present invention consists of a 5′-target side complementary region (10). The 5′-target side complementary region (10) consists of a terminal side target complementary region (12), a guide side target complementary region (14), and a target base adenosine (A) represented by A* (15). Likewise, the 3′-target RNA [LVA] of the second aspect consists of a 3′-target complementary region (50). The 3′-target complementary region (50) consists of a terminal side target complementary region (52), a guide side target complementary region (5), and a target base adenosine (A) represented by A * (55).
(142) In the present invention, the terminal-side target complementary region (12, 52) of the target RNA is a base sequence composed of the same or different bases selected from adenine, cytosine, guanine, and uracil. Although it is not particularly limited, it is generally constructed to have a base sequence of about 40 bases, preferably about 30 bases, and more preferably about 20 bases.
(143) The guide-side target complementary region (14, 54) of the target RNA is a base sequence composed of the same or different bases selected from adenine, cytosine, guanine, and uracil. Although the number of bases is not particularly limited, it is constructed to have a sequence of about 1 to 15, preferably 1 to 12, more preferably 1 to 10, and particularly preferably 1 to 5 bases. When complexing the base sequence of the guide-side target complementary region of any target RNA with the editing guide RNA to be described later, it is preferable to construct it to base pair with the base sequence of the X-adjacent part of the core-side target recognition region of the editing guide RNA.
(144) In the target RNA, A* (15, 55) means the target base adenosine targeted for editing existing at the target editing site (* mark) respectively.
(145) In the present invention, the target editing guide RNA consists of an antisense region (20, 60) and an ADAR binding region (26, 66). The antisense region (20, 60) is constructed to respectively form a complementary strand with the 5′-target RNA of the first aspect or the 3′-target RNA of the second aspect.
(146) Furthermore, the 3′-antisense region (20) of the 3′-target editing guide RNA includes a terminal side target recognition region (22), an X-adjacent part region of a core-side target recognition region (24) and a target editing-inducing base X (25) (marked with triangle) for target-editing-inducing the target base adenosine of 5′-target RNA.
(147) Likewise, the 5′-antisense region (60) of the 5′-target editing guide RNA contains the terminal side target recognition region (62), the X-adjacent part region of the core-side target recognition region (64), and a target editing inducing base X (65) (marked with triangle) for target-editing-inducing the target base adenosine (A) of 3′ target RNA [LVA].
(148) The terminal side target recognition region (22, 62) of the target editing guide RNA of the present invention is a base sequence consisting of the same kind and different kinds of bases selected from adenine, cytosine, guanine, and uracil. Although not particularly limited, it is generally preferable to construct base regions each consisting of about 40, preferably about 30, and more preferably about 20 base sequences. However, the number of constituent bases is the same as the number of bases of the terminal-side target complementary region (12, 52) of the corresponding target RNA, respectively, so that the corresponding bases are paired to form a base pair.
(149) The X-adjacent part region of the core side target recognition region of the antisense region is a base sequence consisting of the same and different bases selected from adenine, cytosine, guanine, and uracil, constitutes a base sequence consisting of a base sequence of generally 1 to 15, preferably 1 to 12, more preferably 10 or less, particularly preferably 1 to 5 bases, and forms a base pair with the base sequence of guide side target complementary region of the target RNA, respectively. When forming a complex with the target RNA, the base sequence of the X-adjacent portion of the core side target recognition region is constructed so as to base pair with the base sequence of the guide side decoupling region to form a base pair.
(150) The ADAR binding region adjacent to the antisense region is composed of an ADAR adjacent region of the core side target recognition region, an ADAR binding core region, and a guide side decoupling region, each consisting of the same or different bases selected from adenine, cytosine, guanine, and uracil. It is a base region where the number of the bases in the ADAR adjacent region of the core side target recognition region and the guide side decoupling region is generally from 0 to 10, preferably about 5, and each constituent base is constructed so as to base pair with each other to form a base pair.
(151) In the present invention, in order that ADAR can exert A-I editing-inducing capability, the base sequence of the ADAR binding region can be fixed in a certain degree to a specific base sequence or a similar base sequence without greatly modifying the base sequence of the ADAR binding region. On the other hand, in the base sequence of the antisense region of the editing guide RNA, since the target RNA containing the target base A of interest is vastly different in base sequence and has a very diverse base sequence, it is necessary to construct so that the type and length of the base sequence can be freely changed. It is also possible to adjust the A-I editing capability of ADAR by increasing or decreasing the number of bases in the base sequence of the antisense region of the editing guide RNA, particularly the number of bases in the base sequence of the X-adjacent region of the core side target recognition region.
(152) In addition, the ADAR binding core region (28, 68) has an incomplete double-stranded RNA structure with a stem-loop structure composed of the same or different bases selected from adenine, cytosine, guanine, and uracil. This stem-loop structure has two incompletely complementary base sequence structures with a loop structure interposed therebetween, and the base sequence of each single strand is the same or different base sequence. Although the number of the bases is not particularly limited as long as it does not impair the editing inducing capability, it is typically about to 40, and preferably about 20 to 30. Also, in the loop structure, the corresponding constituent bases do not form complementary strands to each other but are composed of 4 to 8, preferably 4 to 5 same or different bases. Furthermore, the base sequence of one single strand of this incompletely complementary double-strand has an ADAR adjacent part of the core side target recognition region at its end, and the base sequence of the other single strand has its end connected to the guide side decoupling regions, respectively.
(153) Furthermore, the ADAR binding core region is a region inducing the action of ADAR by binding with ADAR, and has the function of A-I editing the target base adenosine of the target RNA to convert it into inosine. In other words, RNA editing by ADAR can exert the function of inducing RNA editing capability of ADAR by ADAR being fixed to the ADAR fixing core region of the target editing guide RNA. As the ADAR having A-I editing capability, for example, hADAR1 and hADAR2 can be cited as ADAR, for example.
(154) In the present invention, the target RNA and the target editing guide RNA complementarily complex to form a target RNA-target editing guide RNA complex. Specifically, the target side complementary region of the target RNA and the X-adjacent partial base sequence of the core side target recognition region, which is a part of the antisense region of the target editing guide RNA, are base-paired to form a complementary strand target RNA-target editing guide RNA complex. More specifically, the terminal-side target complementary region of the target RNA and the terminal-side target recognition region of the target editing guide RNA, and the guide-side target complementary region of the target RNA and the core-side target recognition region of the target editing guide RNA are paired to form a complementary strand, respectively, thereby forming a target RNA-target editing guide RNA complex.
(155) More specifically, in the first target editing scheme of the present invention, the corresponding bases of the constituent bases of the terminal side target complementary region (12) of the 5′-target RNA [LA] and the constituent bases of the 3′-terminal-side target recognition region (22) of the 3′-target editing guide RNA [LIA] are base-paired to form base pairs to construct the 5′-target RNA-3′-target editing guide RNA complex [LIIA].
(156) Similarly, in the second target editing scheme of the present invention, the corresponding bases of the constituent bases of the terminal side target complementary region (52) of the 3′-target RNA [LVA] and the constituent bases of the 5′-terminal side target recognition region (62) of the 5′-target editing guide RNA ILIA are base-paired to form base pairs to construct the 3′-target RNA-5′-target editing guide RNA complex [LVIIA].
(157) On the other hand, in the complex [LIIA], the constituent bases of the guide-side target complementary region (14) of the 5′-target RNA [LA] are constructed to base pair with the constituent bases of the X-adjacent part region of the core-side target recognition region (24) of the editing guide RNA, and the constituent bases of the ADAR adjacent part region are constructed to base pair with the constituent bases of the guide side decoupling region (27) to form base pairs.
(158) Similarly, in the complex [LVIIA], the guide-side target complementary region (54) of the 3′-target RNA [LVA] is constructed to base pair with the constituent bases of the X-adjacent part region of the core-side target recognition region (64) of the editing guide RNA [LVIA], and the ADAR adjacent region is constructed to base pair with the constituent bases of the guide side decoupling region (67) to form base pairs.
(159) As described above, the number of bases in the core side target recognition region of the target editing guide RNA is constructed to be the same as the total number of bases in the guide side target complementary region of the target RNA and the guide side decoupling region of the target editing guide RNA. Thus, it is preferable to design the number of bases in the base sequence of the X-adjacent part region of the core-side target recognition region of the target editing guide RNA to be larger than the number of bases in the base sequence of the guide side decoupling region of the ADAR binding region. Adjusting the number of the former in this way allows the A-I editing capability by ADAR to be adjusted.
(160) In the present invention, the target RNA and the target editing guide RNA are complexed to form a double-stranded structure, whereby ADAR acts on the ADAR fixing core region of the target editing guide RNA, induces RNA editing capability to allow the target base adenosine (A) present in the target RNA bound to the complex to be A-I edited and converted to inosine (I).
(161) Furthermore, as described above, the edited target RNA in which the target base adenosine is converted to inosine is translated into guanosine (G). That is, in the present invention, the inosine (I) of each of the RNA-edited 5′-editing target RNA [LIIIA] of 5′-target RNA and 3′-editing target RNA [LVIIIA] of 3′-target RNA is translated into guanosine (G) as represented by 5′-translated target RNA [LIVA] in
(162) In the above target editing scheme, a target editing inducing base X (25, 26) which is positioned at target editing site (marked with triangle) corresponding to a target base A (*) in the target RNA includes any base which does not complement the target base A of cytosine (C), guanosine (G), adenosine (A) and uridine. In view of A-I editing capability, cytosine can be preferably used as the target editing inducing base.
(163) Therefore, the present invention provides a method for introducing a site-directed RNA mutagenesis in which a target editing inducing base (X) corresponding to a target editing site (marked with triangle) is constructed as a base cytosine (C) as a preferable embodiment.
(164) That is, a preferred embodiment of the present invention is characterized by reacting a 3′-target editing guide RNA [LIB] in
(165) Inosine (I) of each edited target RNA which has been A-I edited as described above is translated into guanosine (G) as shown in the 5′-translated target RNA [LIVA] in
(166) Furthermore, when a full length RNA or a partial length RNA longer than the base sequence of the target-side complementary region is used as the target RNA, the method for introducing a site-directed RNA mutation is constructed, as shown in
(167) Likewise, in a preferred embodiment of the present invention, in a method for introducing a site-directed RNA mutation in which cytosine (C) is used as a target editing-inducing base X (25, 65) (marked with triangle) corresponding to a target base adenosine (A) of the target RNA, a 3′-target editing guide RNA represented by formula [LIB] in
(168) The edited target RNA converted to inosine as described above is converted into a 5′-translated target RNA [LIVA] in
(169) As described above, the method for introducing a site-directed RNA mutation according to the present invention can easily convert the target base adenosine contained in the full-length target RNA or the partial length target RNA by A-I editing to the inosine by the action of ADAR Is possible.
(170) Thus, the site-directed RNA mutation introduction method according to the present invention has been comprehensively described. Hereinafter, the site-directed RNA mutation introduction method according to the present invention will be described more specifically with reference to the drawings.
(171) First, the site-directed RNA mutation introduction method of the present invention by the first target editing scheme will be described with reference to
(172) The method for introducing a site-directed RNA mutation of the present invention is constructed from RNA mutation editing in which, as indicated in
(173) A symbol of .sup.bN1.sup.bN2 . . . .sup.bNn−1.sup.bN indicates a base sequence corresponding to the guide-side target complementary region (14) of the 5′-target RNA [LA], and is constructed as a continuous base sequence which is constructed from combination of the same or different bases consisting of any base .sup.bN selected from adenine, cytosine, guanine and uracil, in such a manner that a number of bases is 1 to 15, preferably about 12, more preferably about 10, further preferably about 5.) is reacted with the 3′-target editing guide RNA [IIA] in
(174) a symbol of .sup.dN . . . .sup.dNm indicates a base sequence constructing a terminal-side target recognition region (22) of the 3′-target editing guide RNA, is constructed as a continuous base sequence which is constructed from combination of the same or different bases consisting of any base .sup.dN selected from adenine, cytosine, guanine and uracil, in such a manner that a number of bases which is not particularly limited, is generally 40, preferably 30 and more preferably about 20, as well as the number is equal to a number of constituent base of the base sequence in the terminal-side target complementary region (12) of the 5-target RNA, and constructs base pairs with the base sequence of the terminal-side target complementary region.
(175) a symbol of .sup.eN1.sup.eN2 . . . .sup.eNn+p indicates a base sequence of X adjacent partial region of the core-side target recognition region represented by a symbol .sup.eN1.sup.eN2 . . . .sup.eNn and a base sequence of ADAR adjacent partial region represented by .sup.eN1.sup.eN2 . . . .sup.eNp as well as the X adjacent partial regions consisted of any bases of a symbol .sup.eN selected from adenine, cytosine, guanine and uracil, and indicates a continuous base sequence consisted of the same or different bases in a number of base which is not particularly limited as long as the object and function of the present invention are not impaired of generally 1 to 15, preferably 1 to 12, more preferably 1 to 10, and particularly preferably 5 oe less. The ADAR adjacent partial region indicates a continuous base sequence which is consisted of any bases selected from adenine, cytosine, guanine and uracil and a number of bases is generally 0 to 15, preferably 12 or less, and more preferably 10 or less.), to compose and obtain a 5′-target RNA-3′-target editing guide RNA complex [IIIA] in
(176) However, in the 5′-target RNA [IA], the number marked with a solid triangle represents the number of bases of the base .sup.bN from the target base A. For example, the number 0 means that there is no base of the guide side target complementary region adjacent to the target base A, the number 1 means that one base of the guide side target complementary region adjacent to the target base A, and furthermore, the number n means a base sequence consisting of n bases of the guide side target complementary region adjacent to the target base A. It also has the same meaning in the following description.
(177) Similarly, in the Y-target editing guide RNA [IIA], the number marked with 4 represents the number of bases of the base cN from one end of the ADAR binding core region. For example, the number 0 means that there is no base sequence of the guide side division region adjacent to the target base A, the number 1 means that there is one base in the guide side division region, and the number p means a base sequence consisting of p bases in the guiding side disruption region. It also has the same meaning in the following description.
(178) In addition, in the 3′-target editing guide RNA [IIA], for example, when the number is 0, there is no base in the guide side divided region adjacent to one end of the ADAR binding core region, and then there is no base corresponding to the ADAR adjacent portion of the corresponding core side target recognition region. Therefore, in this case, the core side target recognition region is composed only of the base sequence of the X adjacent region represented by the symbol .sup.eN1 . . . .sup.eNn. On the other hand, when the number is 1, since the number of bases in the guide side decoupling region is one, the base sequence of the core side target recognition region is represented by the symbol .sup.eN1 . . . .sup.eNn+1. When the number is p, the base sequence of the core side target recognition region is represented by the symbol .sup.eN1 . . . .sup.eNn+p. It also has the same meaning in the following description. For example, when the number is 1, that is, in the case of the symbol .sup.eN1, the corresponding base .sup.eN1 of the editing guide RNA composes a base pair with the base .sup.bN1 of the target side complementary region of the target RNA.
(179) If the number of constituent bases of the core side target recognition region of the editing guide RNA becomes too small so that the distance from the corresponding base (X) existing in the 3-target recognition region of the target edition guide RNA to the ADAR binding core region is too short, the induction capability of A-I editing by ADAR may decrease and it is not preferable. In addition, even if the number of constituent bases becomes too large and the distance from the corresponding base (X) present in the 3-target recognition region of the target editing guide RNA to the ADAR binding core region becomes too long, the induction capability of A-I editing may decreases and it is not preferable.
(180) In addition, in the ADAR binding region, the symbol NαNβ-NδNχ consists of an incomplete double-stranded RNA structure consisting of a stem-loop structure which corresponds to the base sequence composing the ADAR binding core region (28, 68) of the 3-target editing guide RNA [LIA] and the 5′-target editing guide RNA [LVIA] as described above. That is, the stem-loop structure is composed of two base sequences with a loop structure interposed therebetween and the two base sequences have a structure composed of incompletely complementary double strands including complementary base pairs and mismatch base pairs. The base (N) constituting each single strand is composed of the same or different bases selected from adenine, cytosine, guanine and uracil, and a number of bases of each single strand is generally 10 to 40, and preferably 20 to 30. Also, in the loop structure, the corresponding constituent bases do not form complementary strands to each other and are composed from the same or different bases of 4 to 8, preferably 4 to 5. In this stem-loop structure, one terminal of the incomplete complementary double strand which interposes the loop structure and binds each other may be joined with a base sequence of the ADAR adjacent region of the target recognition region, and the other terminal may be joined with a base sequence of the guide-side decoupling region.
(181) The symbol Nα-Nχ is composed of one base sequence each consisting of the same or different bases selected from adenine, cytosine, guanine and uracil, and this base pair represents an incomplete double-stranded complementary region with single or plural, preferably about two mismatched base pairs. The symbol Nβ-Nδ represents a loop structure composed of similar the same or different bases having 4 to 8, preferably 4 to 5 bases. Also, the symbol Nα-Nχ has a structure in which one terminal thereof is joined with the guide-side target complementary region of the 5′-target RNA or the guide-side decoupling region of the target editing guide RNA and the other terminal is joined with the core side target recognition region of the target editing guide RNA
(182) In the 5′-target RNA-3′-target editing guide RNA complex [IIIA], the symbols .sup.aN1 . . . .sup.aNm and the symbols .sup.dN1 . . . .sup.dNm are constituent base pairs (that is, for example, .sup.aN-.sup.dN), .sup.aNm-.sup.dNm) are shown in a state of being connected with a solid line, and each constituent base pair forms a complementary strand.
(183) That is, the base sequence of the terminal-side target complementary region of the 5′-target RNA represented by the symbol .sup.aN1 . . . .sup.aNm and the base sequence of the terminal-side target recognition region of the 3′-target editing guide RNA represented by the symbol .sup.dN1 . . . .sup.dNm base pair with each other to form base pairs and the base sequence of the guide-side target complementary region of the 5′-target RNA represented by the symbols [.sup.bN1 . . . .sup.bNn] and the base sequence of the X-adjacent portion of the core side target recognition region of the 3-target editing guide RNA represented by the symbol [.sup.eN1 . . . .sup.eNn] base pair with each other to form a base pair and complex. On the other hand, the ADAR binding core region has a structure in which one terminal is joined with the base sequence of the guide side decoupling region and the other terminal is joined with the ADAR adjacent part of the core side target recognition region.
(184) Similarly, the method for introducing a site-directed RNA mutation of the present invention by the second target editing scheme will be described more specifically with reference to
(185) According to the present invention, as in the case of the 3′-target editing guide RNA [IIA] in which the 5′-target RNA is complementary to the 5′-terminal portion, 3′-target RNA is complementary to the 3′-terminal portion at 3′-targeting guide RNA [IIA] as well, the target base adenosine of the 3′-target RNA undergoes A-I editing and is converted to inosine (I).
(186) The method of the present invention of the method according to the second target editing scheme is composed by RNA mutation editing in which, as shown in
(187) In addition, in the first and second target editing schemes, an embodiment in which any of cytosine (C), guanosine (G), adenosine (A) or uridine (U) is disposed at the site (marked with triangle) corresponding to the target editing site (*) can be constructed. In view of inducing A-I editing capability, in general, since cytosine (C) is higher than others, as a preferred embodiment of the invention, an embodiment in which the corresponding base (X) is cytosine (C) can be constructed. This also applies to the following.
(188) Therefore, in the first target editing scheme, the present invention provides the method for introducing a site-directed RNA mutation in which, as shown in
(189) Similarly, the present invention according to the second target editing scheme provides the method for introducing a site-directed RNA mutation in which, as shown in
(190) Furthermore, in the first and second target editing schemes, the present invention can construct a preferred embodiment using a full-length RNA molecule or a partial length RNA molecule including a target RNA fragment as the target RNA.
(191) That is, the present invention of the method for introducing a site-directed RNA mutation according to the first target editing scheme provides the method for introducing a site-directed RNA mutation in which, as shown in
(192) In addition, the present invention of the method for introducing a site-directed RNA mutation according to the second target editing scheme provides the method for introducing a site-directed RNA mutation in which, as shown in
(193) In both of the first and second target editing schemes, the converted inosine present at the target site is translated into guanosine.
(194) In the above target editing scheme, by constructing the RNA base (X) present in the site corresponding to the target editing site to cytosine (C), the present invention according to the first and second target editing schemes provides the method for introducing a site-directed RNA mutation in which, as shown in
(195) The target editing guide RNA including the ADAR binding region used in the present invention can be designed as follows. As described above, Non-Patent Document 7 describes that, based on the glutamate receptor mRNA precursor (GluR-B pre-mRNA) (Non-Patent Document 6) which is specifically edited in vivo by ADAR2, the editing substrate RNA (miniSL RNA) leaving only the region necessary for editing has been constructed. The present inventor has found that it can be constructed as the target editing guide RNA of the present invention by separating the target editing guide RNA and the target RNA by leaving only the ADAR binding region of this editing substrate and dividing at the position shown in the figure. Therefore, since the target editing guide RNA constructed in this way has a complementary region for recognizing the target RNA in addition to the ADAR binding region, it can be applied to any target RNA, so it can be used as a target editing guide of the present invention.
(196) Specifically, in the present invention, the target editing guide RNA was designed for green fluorescent protein mRNA sequence as a model target RNA, and it was confirmed whether A-I mutation can be induced at the target editing site. Therefore, after designing each of RNAs using in vitro transcription reaction, in vitro editing reaction was carried out using purified recombinant ADAR2. As a result, it was found that the editing site was edited depending on the target editing guide RNA. As a result, it was found that target editing guide RNA having the intended function of the present invention can be constructed by such a design
(197) That is, for example, based on the glutamate receptor mRNA precursor (GluR-B pre-mRNA) [XLVIIA] (SEQ ID NO: 100) in
(198) Thus, a preferred embodiment of the present invention according to the first target editing scheme using the target editing guide obtained here is, as shown in
(199) A more preferred embodiment of the present invention according to the first target editing scheme is, as shown in
(200) In addition, a more preferred embodiment of the present invention according to the second target editing scheme is, as shown in
(201) Further, a more preferred embodiment of the present invention can be constructed by introducing cytosine into the corresponding site (marked with triangle) of the target editing site (*). That is, more preferred embodiment of the present invention is, as shown in
(202) In the above first and second target editing schemes, in the present invention, the full-length RNA or the partial length RNA having the 5-target RNA [XXIA] or the 3′-target RNA [XXVIA] as specific regions in the RNA molecule can be used as a matter of course. Thus, in the present invention in this form, as shown in
(203) Further, in the first and second target editing schemes, by changing the base (X) at the site corresponding to the target editing site to RNA base cytosine, a method according to a more preferred embodiment of the present invention is provided.
(204) That is, in a more preferred embodiment of the present invention, as shown in
(205) Furthermore, a more preferred embodiment of the present invention according to the first target editing scheme is a method in which, for example, by using RNA molecules divided at each site of the target RNA (marked with solid triangle) and the target editing guide RNA divided at each site corresponding thereto (the arrows position), it is possible to convert the target base adenosine of the target RNA to inosine shown in
(206) Similarly, by dividing at each site of the target RNA (marked with solid triangle), a more preferred embodiment of the present invention according to the second target editing scheme can be obtained as follows in
(207) Here, an actual model in the present invention will be described. In the present invention, the target editing guide RNA was designed for green fluorescent protein mRNA sequence as a model target RNA, and it was confirmed whether A-I mutation can be induced at the target editing site. After each designed RNAs was synthesized by using in vitro transcription reaction, in vitro editing reaction was carried out using purified recombinant ADAR2. As a result, it became clear that the editing site is edited depending on the target editing guide RNA.
(208) Therefore, when the above-mentioned editing substrate [XLVIIB] is divided by shifting the dividing site one by one, an ADAR binding core region composed of a double strand having the following sequence can be constructed shown in
(209) Therefore, the target editing guide of the present invention can be constructed by binding the target recognition region and the base sequence of the guide-side decoupling region to both ends of the ADAR binding core region, respectively.
(210) For example, an editing substrate (for example, MiniSL RNA [XLA]) including a target editing site (*) is divided into a region including the target editing site and an ADAR binding region at the dividing site (for example, each of arrows 0 to 9 Site), and it can be separated into the target RNA and the target editing guide RNA, respectively. For example, in the case of dividing at the position of the arrow 3, the target editing scheme of the present invention can be expressed as follows in
(211) Even when the 3′-target RNA is used, the target base adenosine is converted to inosine as in the case of the 5′-target RNA. Here, an editing substrate (miniSLr RNA) [XLIA] (SEQ ID NO: 105) designed by exchanging the target editing site of the editing substrate (miniSL RNA) [XLA] (SEQ ID NO: 104) will be described as an example in
(212) For example, when the editing substrate [XLVA] is divided at the sites (0 to 5) indicated by arrows, as shown in the following formulae, the 5′-target editing guide RNAs [XLVA-0] to [XLVA-5] and the 3′-target RNAs [XLVIA-0] to [XLVIA-5] are formed, respectively in
(213) These target RNAs complement each of the above-described target editing guide RNAs [XLVA-0] to [XLVA-5] to form a complex, and the A-I editing capability is induced by the action of ADAR, so that the target base adenosine is converted to inosine, respectively.
(214) These target editing guide RNAs are naturally complexed complementarily to full-length RNA or partial length RNA containing the corresponding respective target RNA, and the target base adenosine is converted to inosine by the action of ADAR. For example, when the target editing guide RNA [XLA-2] divided by arrow 3 is used, it is complementary to the full-length RNA or partial length RNA [XLA-6] containing the corresponding target RNA [XLA-1] to form the 5′-target RNA-3′-target editing guide RNA complex [XLA-7], then induced A-I editing capability by the action of ADAR to convert to the 5′-edited target RNA [XLA-8] and target bases adenosine is converted to inosine as shown in
(215) The present invention can be similarly implemented by using other target editing guides. For example, the case where GFP RNA is used will be described in
(216) The same applies when the target RNA [XLIII-1] is used as full-length RNA or partial length RNA in
(217) Examples of RNA that can be used as a target RNA in the present invention include serotonin receptor, glutamate receptor, and membrane voltage-dependent potassium channel. However, any type of RNA can be used without limitation in the present invention as long as the target base adenosine to be RNA edited exists in the RNA.
(218) In the present invention, when a certain predetermined RNA is selected as the target RNA from the RNAs, a specific region including a target editing site to be subjected to RNA editing can be selected from the selected target RNA. It should be noted that the specific region of the target RNA which can be subjected to RNA editing can be used irrespective of its form, whether it is 5′-target RNA or 3′-target RNA. For example, even when the target editing site is present near the 5′ end and it is difficult to construct a base pair in the complementary region, the target editing site can be replaced with the corresponding side chain on the opposite side to secure a complementary region.
(219) When a specific region of the target RNA is selected, it is possible to design a corresponding target recognition region of the target editing guide RNA which forms a complementary chain with the specific region. In this way, if the corresponding target recognition region of the target editing guide RNA can be designed, the target editing guide RNA can be easily designed by binding to the ADAR binding core region.
(220) Once the target editing guide RNA can be designed as described above, the target editing guide RNA of the present invention can be synthesized in accordance with a common method. For example, the target editing guide RNA of the present invention can be synthesized by synthesizing a DNA molecule corresponding to the target editing guide RNA, and using the DNA molecule as a template by an in vitro transcription reaction or the like. That is, the target editing guide RNA of the present invention can be constructed by synthesizing synthetic oligo DNAs corresponding to each single strand of the double-strand constituting this target editing guide RNA, synthesizing each single strand by an annealing reaction or the like, and performing in vitro transcription reaction or the like using the synthesized DNA molecule as a template.
(221) Further, in the present invention, the target editing guide RNA (gRNA) can be constructed to correspond to the target complementary region having the target editing site of every target RNA. Thus, the present invention can be easily and universally applied to any target RNA having a target base adenosine.
(222) As the editing guide RNA (gRNA) used in the A-I RNA editing reaction according to the present invention, for example, a 3′-editing guide RNA represented by the general formula [LTA] or a 5′-editing guide RNA represented by the general formula [LVIA] can be mentioned. More specifically, the 3′-editing guide RNA [LIA] is composed of a 3′-target recognition region and an ADAR-binding region. Similarly, the 5′-editing guide RNA [LVIA] is composed of a 5′-target recognition region and an ADAR binding region.
(223) More specifically, the 3′-target recognition region of 3′-editing guide RNA [LIA] is composed of 3′-[terminal side target recognition region-X-core side target recognition region], and the core side target recognition region has a structure in which the 5′ end thereof is bound to the 3′-end of the ADAR binding core region. On the other hand, the 5′-target recognition region of the 5′-editing guide RNA [LVIA] is composed of 5′-[terminal side target recognition region-X-core side target recognition region] and the 3′ terminus of the core side target recognition region is bonded to the 5′-end of the ADAR binding core region. The target recognition region is also referred to as an antisense region.
(224) It should be noted here that in order to improve the editing efficiency, each core side target recognition region has its number of bases greater than the number of bases in the guide side decoupling region of the corresponding ADAR binding region. In other words, the base sequence is preferably designed to be long. That is, the number of the bases in the base sequence of the core side target recognition region is preferably 1 to 10, and preferably 1 to 5.
(225) More specifically, referring to
(226) In other words, one main object of the present invention is to provide a simple gRNA design which induces the original A-I RNA editing activity of hADAR2 and to apply the gRNA to site-directed RNA mutagenesis. gRNA generally consists of a protein binding region that induces an enzyme protein such as Fibrillarin or Cbf5 on the target RNA and an antisense region that mediates target RNA via base pairing. In addition, the most important feature of gRNA is that the protein bound to gRNA is positioned to react effectively with the target site after the antisense gRNA region hybridizes to the target RNA. In order to construct RNA (AD-gRNA) that guides hADAR2 having such a function, attention was paid to the secondary structure of a natural editing substrate.
(227) In the editing reaction of gRNA and hADAR2 according to the present invention, dsRBD mainly regulates substrate RNA binding, and the deaminase domain catalyzes the hydrolytic deamination reaction of adenosine (
(228) In order to verify, the validity of this AD-gRNA design. AD-gRNA induced RNA editing on green fluorescent protein (AcGFP) mRNA (720 nt;
(229) Furthermore, the inventors tested the utility of other infrastructure in AD-gRNA construction using RNA (40 nt) having a hairpin structure which is already reported as a substrate of hADAR2 (Non-Patent Literatures 30, 31) (
(230) The diversity of the functional design of AD-gRNA was expanded. In the case of cis-type substrate such as GluR2 RNA and hairpin substrate, hADAR2 could not edit the site existing on the chain opposite to the original editing site (
(231) In principle, the specificity of AD-gRNA induced-RNA editing depends greatly on the inherent selectivity of the deaminase domain of hADAR2. Thus, the editing pattern of AD-gRNA induced-RNA editing is considered to be similar to that of naturally edited substrates. Indeed, the neighboring specificity of AD-gRNA induced-RNA editing was almost identical to that observed for cis-type substrates (
(232) As a result, the present inventors have successfully developed a highly active AD-gRNA framework by introducing an antisense region to the 5′ side of the ADAR binding region.
(233) In vitro regulation of functional protein expression using AD-gRNA-induced A-I RNA editing will be described. A likely promising application of site-directed RNA mutagenesis seems to be regulating the expression or function of the target protein by introducing specific codons. In order to demonstrate the possibility of such application, codon repair experiments were carried out using AD-gRNA in vitro editing and in vitro translation system. In this experiment, Rluc-W104X obtained by converting nucleotide 311 of Renilla luciferase (Rluc) mRNA to adenosine (A311) and converting Trp104 codon (UGG) to stop codon (UAG) was used as a reporter (
(234) First, AD-gRNA with codon transformation was designed based on the 5′-antisense framework (ADg-rRluc_A311;
(235) Furthermore, to investigate the possibility of AD-gRNA in a more complex environment, a simultaneous editing reaction was performed (
(236) Subsequently, intracellular RNA mutagenesis was performed based on the AD-gRNA strategy. The most important advantage of AD-gRNA is its capability to induce the editing activity of native hADAR2. Thus, induction of the intracellular target RNA mutation does not require foreign protein, and can be achieved only by introduction of AD-gRNA into cells expressing hADAR2. To demonstrate this, the tet-ADAR2 cell line (Non-Patent Literature 32) capable of co-expressing hADAR2 and AcGFP under the control of the doxycycline (Dox) inducible promoter was used as the hADAR2 expression model cell (
(237) In addition, intracellular codon repair experiments were performed to demonstrate that functional expression of intracellular proteins can be regulated by the AD-gRNA strategy. In order to visualize the regulation of functional expression of intracellular proteins induced by AD-gRNA induced codon repair, mutant A173GFP mRNA (GFP-W58X RNA) introduced with a stop codon by mutating G173 in codon Trp 58 was used as a reporter gene (Non-Patent Literatures 25 and 33). Also, ADg-rGFP.A173 was designed to repair this stop codon to the Trp codon, and the corresponding expression plasmid was constructed using the pSUPER neo vector. For expression of hADAR2 and GFP-W58X, an expression plasmid was constructed based on the pcDNA 3.1 vector, which is commonly used for protein expression, and these plasmids were transduced into co-HEK293 cells, and after cultured for 48 hours, intracellular fluorescence was detected with a fluorescence microscope. Positive cells with clear fluorescence were not detected using control cells lacking AD-gRNA expression transduced with GFP-W58X and/or hADAR2 plasmid (
(238) Various methods of intracellular A-I RNA editing as described above can be an important breakthrough for establishing practical site-directed RNA mutagenesis. Previously, artificial gRNA was used to direct the RNA modification activity of natural riboprotein (Non-Patent Literatures 19 to 21). However, A-I RNA editing in vivo is performed only with ADAR protein, and gRNA inducing ADAR has not been found in nature. Thus, it was impossible to directly apply the gRNA strategy according to the conventional method to induction of A-I RNA editing. Site-specific RNA editing was previously accomplished using useful etitases consisting of artificial gRNA and modified ADAR protein (Non-Patent Literatures 22, 23, 24). However, these methods lose the advantage of the conventional gRNA strategy of achieving the objective only by introducing gRNA using the endogenous modification mechanism. Thus, constructing a novel gRNA that can induce the editing activity of endogenous ADAR freely at the target site was believed to construct a site-directed RNA mutation introduction method using the endogenous A-I RNA editing mechanism.
(239) In the present invention, AD-gRNA can be easily designed based on the secondary structure of a natural or artificial editing substrate having a hADAR2 expression site. In the case of GluR2 RNA, the region bound by dsRBD of hADAR2 has been clarified by structural analysis by NMR (Non-Patent Literature 34). Judging from the structural information, the GluR2 RNA is divided into two parts, one divided part is considered to be a target RNA having an editing site, and the other is considered to be a prototype type AD-gRNA consisting of an ADAR binding region and an antisense region (
(240) The AD-gRNA of the present invention was constructed using a basic skeleton in which a dividing line between both RNA components was immobilized at a position 3 nucleotides (nt) downstream of the target editing site (
(241) Normally, the antisense region is located on the 3′ side of this design based on the GluR2 RNA, but in the design of AD-gRNA, the position can be located both 3′ and 5′ sides of the ADAR binding region. It is believed that the position of the antisense region is considered to be interchangeable as a result of increased rotational freedom of the ADAR binding region caused by loss of phosphodiester bond in the target RNA. This concept is supported by different editing behavior of ADg-rGFPex as observed when the sequence is additionally introduced to the 3˜ side that base pairing with the target RNA is caused, and that the degree of rotational freedom of the ADAR binding region is suppressed (
(242) Because hADAR2 preferentially edits adenosine in dsRNA, simple antisense RNA also has strong potential to be used as guide RNA. The antisense region of ADg-GFP_A200 shows the capability to induce A-I editing (
(243) However, nonspecific editing can occur in the antisense region depending on the surrounding sequence of the target. Specifically, in the dsRNA structure, nt 11 bases apart from the target base adenosine are located on the sterically same surface. Thus, adenosine present at this position may be nonspecifically edited by induced ADAR. In addition, the editing pattern induced by AD-gRNA is highly dependent on hADAR2 specific properties. For example, if a target site is present in a contiguous adenosine sequence, adenosine adjacent to that target site is edited simultaneously (
(244) According to the present invention, this result of successfully modifying the ADAR binding region (
(245) Target selectivity and efficiency are considered to be the two most important requirements for being generally applicable mutagenesis methods. The AD-gRNA according to the present invention was effective both in vitro and intracellularly, and showed site-selective activity, but by further optimizing it, it is expected that it is possible to improve the activity of AD-gRNA according to its intended use. The diversity of functional adjustment by the design of the present invention is very useful for improving editing efficiency and avoiding nonspecific editing.
(246) Intracellular site-directed RNA editing can be accomplished simply by expressing AD-gRNA in hADAR2 expressing cells. Moreover, it is evident that in the codon repair experiments (in vitro and intracellular) according to the present invention, the AD-gRNA strategy of the present invention can be applied to change codons and ultimately change the function of the target protein. Theoretically, 12 amino acids (Ser, Thr, His, Lys, Arg. Asp, Glu, Asn, Gln, Tyr, Ile and Met/start) out of all 20 amino acids can be changed by the A-I mutation generated in the coding region of mRNA. These codon transformations include metal chelating sites (generally His, Asp and Glu) and phosphorylation sites (Ser, Thr and Tyr), so that A-I RNA editing is likely to strongly control the functions of various intracellular proteins such as enzyme catalysts and protein phosphorylation signal transduction. Thus, the AD-gRNA strategy of the present invention has great potential as a new site-directed RNA mutation induction method applicable to control of various biological processes.
(247) In summary, the novel gRNA system of the present invention can induce A-I mutation by guiding hADAR2 to the target site. AD-gRNA can specifically introduce the A-I mutation at the target site programmed into the antisense region. Moreover, the method for introducing a site-directed RNA mutation of the present invention can be accomplished merely by introducing gRNA into ADAR expressing cells. Thus, the gRNA strategy of the present invention provides a basic framework that is simple in design, easy to use, and necessary for establishing general RNA mutation induction.
(248) Hereinafter, the present invention will be described in more detail with reference to examples, but the following examples are intended to more specifically explain the present invention, and do not limit the present invention in any sense in any way. Of course, any improvements, modifications, etc. derived or originated from the following examples are included in the scope of the present invention.
EXAMPLE 1
(249) Synthesis of 3-Target Editing Guide RNA
(250) The reaction solution containing 100 mM of the synthetic oligo DNA (1) (guide RNA_D 3_tempT7F) and 100 mM of the synthetic oligo DNA (2) (guide RNA D 3_tempR) was treated at 95° C. for 3 min. and subsequently reduced to 25° C. for 15 min, and then annealing reaction was carried out to obtain DNA (guide RNA_D3_tempF/R). Subsequently, 2.5 mM dNTP and 5000 U/mL Klenow fragment were added (final concentration: guide RNA_D3 tempF/R 2 mM, dNTP 0.2 mM, Klenow fragment 2.5 U) and elongated at 25° C. for 30 min, and DNA was purified by phenol/chloroform extraction and ethanol precipitation. RNA (3′-target editing guide RNA 1) was synthesized by in vitro transcription (37° C. for 3 hours) using the obtained DNA as a template and T7-Scribe Standard RNA IVT KIT. Thereafter. DNAse (final concentration: 2 U) was added, the mixture was treated at 37° C. for 15 min. and the RNA was purified by phenol/chloroform extraction and ethanol precipitation. The resulting RNA was purified with 8 M Urea PAGE (8%), extracted by grinding/dipping, and purified by 0.22 mm filter (DURAPORE) and gel filtration (BIO RAD).
(251) In other words, the template DNA used to synthesize 3′-target editing guide RNA in vitro was synthesized using synthetic oligo DNA (1) guide RNA_D3_tempT7F and synthetic oligo DNA (2) guide RNA_D3_tempR. The base sequence of each synthesized oligo DNA used is as follows.
(252) TABLE-US-00001 (SEQ ID NO: 1) (1) guide RNA_D3_tempT7F (48 mer) CTAATACGACTCACTATAGGGTGGAATAGTATACCATTCGTGGTATAG (SEQ ID NO: 2) (2) guide RNA_D3_tempR (44 mer) TGACCACCCTGAGCTGCGGAGGTGGGATACTATACCACGAATGG
EXAMPLE 2
(253) Synthesis of 3′-Target Editing Guide RNA
(254) A reaction solution containing 100 mM of synthetic oligo DNA (3) (guide RNA_D0_tempT7F) and 100 mM of synthetic oligo DNA (4) (guide RNA_D0_tempR) was treated in substantially the same manner as in Example 1 to obtain RNA (3′-editing guide RNA2).
(255) The base sequences of synthetic oligo DNA (3) (guide RNA_D0_tempT7F) and synthetic oligo DNA (4) (guide RNA_D0_tempR) are as follows.
(256) TABLE-US-00002 (SEQ ID NO: 3) (3) guide RNA_D0_tempT7F (51 mer) CTAATACGACTCACTATAGGTGGGTGGAATAGTATACCATTCGTGGTATAG (SEQ ID NO: 4) (4) guide RNA_D0_tempR (44 mer) TGACCACCCTGAGCTGGGTAGGTGGGATACTATACCACGAATGG
EXAMPLE 3
(257) Synthesis of 5-Target Editing Guide RNA
(258) A reaction solution containing 100 mM of synthetic oligo DNA (5) (guide RNA_D3r_tempT7F) and 100 mM of synthetic oligo DNA (6) (guide RNA_D3r_tempR) was treated in substantially the same manner as in Example 1 to obtain RNA (3-editing guide RNA3).
(259) The base sequences of synthetic oligo DNA (5) (guide RNA_D3r_tempT7F) and synthetic oligo DNA (6) (guide RNA_D3r_tempR) are as follows.
(260) TABLE-US-00003 (SEQ ID NO: 5) (5) guide RNA_D3r_tempT7F (45 mer) CTAATACGACTCACTATAGGGAAGCACTGCACGCCGCAGCGGGTG (SEQ ID NO: 6) (6) guide RNA_D3r_tempR (49 mer) AGGTGGGATACTATACCACGAATGGTATACTATTCCACCCGCTGCGGCG
EXAMPLE 4
(261) Synthesis of 5-Target Editing Guide RNA
(262) A reaction solution containing 100 mM of synthetic oligo DNA (7) (guide RNA_D0r_tempT7F) and 100 mM of synthetic oligo DNA (8) (guide RNA_D0r_tempR) was treated in substantially the same manner as in Example 1 to obtain RNA (3′-editing guide RNA 4).
(263) The base sequences of the synthetic oligo DNA (7) (guide RNA_D0r_tempT7F) and the synthetic oligo DNA (8) (guide RNA_D0r_tempR) are as follows.
(264) TABLE-US-00004 (SEQ ID NO: 7) (7) guide RNA_D0r_tempT7F (45 mer) CTAATACGACTCACTATAGGGAAGCACTGCACGCCGCGGTGGGTG (SEQ ID NO: 8) (8) guide RNA_D0r_tempR (52 mer): GGTAGGTGGGATACTATACCACGAATGGTATACTATTCCACCCACCGCGG CG
EXAMPLE 5
(265) Synthesis of GFP RNA (Target RNA)
(266) Amplification was performed using GFP-Gq-TK plasmid as a template, with PCR (1 cycle (98° C. for 10 sec, 55° C. for 30 sec. 68° C. for 30 sec) 30 cycles) in a reaction solution containing 100 mM AcGFP_sRNA 01_T7F01 primer, 100 mM AcGFP_sRNA 01_R01 primer, and 2.5 mM dNTP, 1.25 U/mL Prime Star GXL (final concentration: GFP-Gq-TK Plasmid 4.0 pg/mL, AcGFP_sRNA 01_T7 F/R 0.3 mM, dNTP 0.2 mM, PrimeStar GXL 2.5 U). The amplified PCR product was purified by phenol/chloroform extraction and ethanol precipitation. Using the obtained DNA as a template and T7-Scribe Standard RNA IVT KIT, RNA was synthesized by in vitro transcription (37° C., 3 hours). Thereafter, DNAse (final concentration: 2 U) was added and processed (37° C., 15 min), and RNA was purified by phenol/chloroform extraction and ethanol precipitation. The resulting RNA was purified with 8M Urea PAGE (8%), extracted by grinding/dipping, and purified by 0.22 mm filter (DURAPORE) and gel filtration (BIO RAD).
(267) The base sequence of the AcGFP_sRNA01_T7F01 primer is as follows.
(268) TABLE-US-00005 (SEQ ID NO: 9) CTAATACGACTCACTATAGGGCCACCCTGGTGACCACCC
(269) The base sequence of the AcGFP_sRNA01_R01 primer is as follows.
(270) TABLE-US-00006 (SEQ ID NO: 10) GCGCGCGACTTGTAGTTGCC
EXAMPLE 6
(271) Complex Formation Reaction Between Target Editing Guide RNA and Substrate RNA (Target RNA)
(272) Annealing reaction (80° C. for 3 min.fwdarw.25° C. for 15 min.) of purified target editing guide RNA (final concentration: 0.45 mM) and target RNA (GFP sRNA 01) (final concentration: 0.45 mM) was performed in annealing buffer (150 mM NaCl, 10 mM Tris-HCl (pH 7.6)). After the reaction, formation of complex of target RNA (GFP RNA) and target editing guide RNA was confirmed with 8% Native PAGE.
(273) The base sequence of GFP sRNA 01 is as follows.
(274) TABLE-US-00007 (SEQ ID NO: 11) GFP sRNA 01: 5′-GGGUGAAUGGCCACAAGUUCAGCGUGAGCGGCGAGGGCGAGGGCGAU GCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCU GCCUGUGCCCUGGCCCACCCUGGUGACCACCCUGAGCUACGGCGUGCAGU GCUUCUC-3′
EXAMPLE 7
(275) Complex Formation Reaction Between Target Editing Guide RNA and Substrate RNA (Target RNA)
(276) Annealing reaction (80° C. for 3 min.fwdarw.25° C. for 15 min.) of purified target editing guide RNA (final concentration: 0.45 mM) and target RNA (GFP sRNA 01) (final concentration: 0.45 mM) was performed in annealing buffer (150 mM NaCl, 10 mM Tris-HCl (pH 7.6)). After the reaction, formation of complex of target RNA (GFP RNA) and target editing guide RNA was confirmed with 8% Native PAGE.
EXAMPLE 8
(277) Evaluation of Editing Guide Capability of Editing Guide RNA
(278) The 5-target editing guide RNA 1) purified in Example 1 or the 3′-target editing guide RNA 3 (each final concentration: 0.45 mM) purified in Example 3 and the target RNA (GFP RNA) synthesized in Example 5 (Final concentration: 0.45 mM) were subjected to an annealing reaction (80° C. for 3 min.fwdarw.25° C. for 15 min.) to obtain RNA complexes, respectively. The resulting RNA complex (0.45 mM) was diluted with TE Buffer to 50 mM. After dilution, purified recombinant hADAR2 (final concentration: 0.8 mM) was added to RNA complex (final concentration: 5 nM), and editing reaction was carried out (37° C., 1 hour). After the editing reaction, RNA complex 1 or RNA complex 2 was purified by phenol/chloroform extraction and ethanol precipitation, respectively. The resulting precipitate of each RNA complex was dissolved in 5 mL of TE Buffer and reverse transcription reaction was carried out using Prime Script Reverse Transcription Kit and AcGFP_sRNA_R01 primer (final concentration: 2.5 mM) (rapid quenching at 65° C. for 5 min, 42° C. for 45 min, 70° C. for 15 min.). PCR (1.25 U/mL Prime Star GXL, AcGFP_sRNA_T7F01 primer, cGFP_sRNA_R01 primer, 2.5 mM dNTP) (one cycle (98° C. for 10 sec. 55° C. for 15 sec, 68 sec for 20 sec), 25 cycles) was performed using the obtained cDNA as a template to amplify the double-stranded DNA. After that, DNA base sequence analysis was performed using the amplified DNA and the Big Dye Terminator v3.1 Cycle Sequencing Kit. An editing ratio was calculated from the peak ratio (G/A+G) of A (T) and G (C) of the target editing site of the obtained chromatographic chart. The edit rate of each of RNA complex 1 and RNA complex 2 was 88.1% and 91.2%. In contrast, the control of the target RNA alone was 2.7%.
EXAMPLE 9
(279) The editing ratio was calculated for a complex obtained by subjecting 3′-target RNA [XLVIA-0 to XLVIA-5] and 5′-target editing guide RNA [XLVA-0 to XLVA-5] to annealing reaction in a manner substantially the same as in Example 8. The results are shown in Table 1 below showing the change of the editing rate over time.
(280) TABLE-US-00008 TABLE 1 Time 3′-Target RNA - 3′-Target RNA (XLVA + XLVIA) (min.) 0 1 2 3 4 5 0.5 3.3 3 4.3 3.3 5.3 6.7 5 3.3 7.8 13.5 14.2 25.4 24.4 10 3.4 9.5 22.8 20.9 30.4 37.8 15 3.3 16.3 32.1 30.8 43.7 44.3 30 8.9 25.5 44.6 44.6 57.9 52.4 60 3.2 33.9 59.2 61.9 67.2 65 120 2.3 44.1 70.6 74.9 62.4 67.2 180 3 45.6 73.9 76.8 79.6 74.8
EXAMPLE 10
(281) Materials used in the following examples are as follows. DNA oligonucleotide and synthetic RNA were purchased from Hokkaido System Science Co, Ltd. (Hokkaido, Japan) and Sigma genosys (Hokkaido, Japan). The sequences of all DNA oligonucleotides and synthetic RNAs are listed in Tables 2 to 6.
(282) TABLE-US-00009 TABLE 2 DNA oligonucleotides for in vitro synthesis of ADg-RNA target name sequence (5′.fwdarw.3′) SEQ ID NO: ADg-GFP_A200 ADg-GFP_A200_T7F CTAATACGACTCACTATAGGGTGGAATAGTATAACAATATGC 12 ADg-GFP_A200_RV TGACCACCCTGAGCTGCGG 13 ADg-rGFP_A200 ADg-rGFP_A200_T7F CTAATAGGACTCACTATAGGGAAGCACTGCACGCCGCAGCGGGTGGAATAG 14 ADg-rGFP_A200_RV01 AGGTCGGATACTATAACAACATTTAGCATATTGTTATACTATTCCACCC 15 ADg-rGFP_A200_RV02 AGGTGGGATACTATAACAAGATTTAGC 16 ADg-rRluc_A311 ADg-rRluc_A311_T7F CTAATAGGACTCACTATAGGCTTCAGCAGGTCGAACCAAGGGGTGGAATAGTATAC 17 ADg-rRluc_A311_RV AGGTGGGATACTATACCACGAATGGTATAGTATTCCACCC 18 sADg-GFP_A200 sAD9-GFP_A200_T7F CTAATACGACTGACTATAGGGTGGAATAGTATACCATTCGTGCTATAG 19 sADg-GFP_A200_RV TGACCACCCTGAGGTGCGGAGGTGGGATACTATACCACGAATGG 20 sADg-rGFP_A200 sADg-rGFP_A200_T7F CTAATACGACTCACTATAGGGAAGCACTGCACGCCGCAGCGCGTC 21 sADg-rGFP_A200_RV AGGTGGGATACTATACCACGAATGGTATACTATTCCACCCGCTGCGGCG 22 eSL_AAA eSL_AAA_Eco_FW GCTAGGAATTCCGCCTCGAGTCCGTTAAAGTGGGTGGAATAGTATACCATTCGTGG 23 eSL_AAA_Sph_RV GATAAGCATGCGCCAAGCTTCGTCAGAGTAGGTGGGATACTATACCACGAATGGTATAC 24 eSLr_AAA eSLr_AAA_Eco_FW GCTAGGAATTCCGCCTCGAGTCCGTTTCTGTGGGTGGAATAGTATACCATTCGTGG 25 eSLr_AAA_Sph_RV GATAAGCATGCGCCAAGCTTGGTCTTTGTAGGTCGGATACTATACCACGAATGGTATAC 26 eSL_AAA_T7F CTAATACGAGTCACTATAGGGGGCGAAAGGGGGATG 27 eSL_AAA_RV GCATGCGCCAAGCTTC 28 sADg-rGFP_AAA sADg-rGFP_AAA_T7F CTAATACGACTCACTATAGGGAAGCACTGCACGCC 29 sADg-rGFP_AAA_RV AGGTGGGATACTATACCACGAATGGTATACTATTCCACCCGCAGAGGCGTCCAGTGCTTC 30 ADg (L1) sADg-rGFP_A200_01_T7F CTAATACGACTCACTATAGGGAAGCACTGCACGCCGCAGTGGGTG 31 sADg-rGFP_A200_01_RV GTAGGTGGGATACTATACCACGAATGGTATACTATTCCACCCACTGCGGCG 32 ADg (L2) sADg-rGFP_A200_02_T7F CTAATACGACTGACTATAGGGAAGCACTCCACGCCGCAGTGGGTG 33 sADg-rGFP_A200_02_RV TAGGTGGGATACTATACCACGAATGGTATACTATTCCACCCACTGCGGCG 34 ADG (L4) sADg-rGFP_A200_04_T7F GTAATACGACTCACTATAGGGAAGCACTGCACGCCGCAGCTGGTC 35 sADg-rGFP_A200_04_RV GGTGGGATACTATACCACGAATGGTATACTATTCCACCAGGTGCGGCG 36 ADg (L5) sADg-rGFP_A200_05_T7F CTAATACGACTCACTATAGGGAAGCACTGCACGCCGCAGCTCGTG 37 sADg-rGFP_A200_05_RV GTGGGATACTATACCACGAATGGTATACTATTCCACGAGCTGCGGCG 38 sAD-rGFPex_AAA sADg-rGFPex_AAA_RV CCTGAAGGTGGGATACTATACCACG 39 GFPs RNA GFPs RNA_T7F GTAATACGACTCACTATAGGGTGAATGGCCACAAGTTCAG 40 GFPs RNA_RV TAGCGTGAGAAGCACTGCAC 41 Rluc W104X RNA Rluc W104X_Eco_FW GCTAGGAATTCACCATGGGTTGCAAGGTGTAC 42 Rluc W104X_Bam_RV GAAGGATCCTTACTGCTCGTTCTTC 43 Rluc W1040_FW CTCACCCCTTAGTTCGAGGTG 44 Rluc W104X_R01 CAGCTCGAACTAAGCGGTGAG 45 Rluc W104X_Koz_T7F CTAATACGACTCACTATAGGGACCATGGCTTCCAAGGTGTAC 46 Rluc W104X_R02 TTACTGCTCGTTCTTCAGCACG 47 GFP mut GFPmut RV GAGAAGCACTGCACGCCTTTGCTCAGGCTGCTG 48
(283) TABLE-US-00010 TABLE 3 DNA oligonucleotides for construction of expression plasmid target name sequence (5′.fwdarw.3′) SEQ ID NO: ADg-GFP_A200 ADg-GFP_A200 F1 GGGTGGAATAGTATAACAATATGCTAAATGTTGTTATAGTATCC 49 ADg-GFP_A200 R1 TGACCACCCTGAGCTGCGGAGGTGGGATACTATAACAAC 50 ADg-GFP_A200 F2 CTAAGATCTGGGTGGAATAGTATAACAATATG 51 ADg-GFP_A200 R2 CTAAAGCTTAAAAATGACCACCCTGAGGTGCG 52 ADg-rGFP_A200 ADg-rGFP_A200 F1 GGGAAGCACTCCAGGCCGCAGCGGGTGGAATAGTATAACAATATG 53 ADg-rGFP_A200 R1 AGGTGGGATAGTATAACAACATTTAGCATATTGTTATACTATTC 54 ADg-rGFP_A200 F2 CTAAGATUGGGAAGCACUGCACGCCG 55 ADg-rGFP_A200 R2 CTAAAGCTTAAAAAAGGTGGGATAGTATAAC 56 sADg-GFP_A200 sADgGFP F GCTAGAGATCTGGGTGGAATAGTATACCATTCGTG 57 sADgGFP R GCTAGAAGCTTAAAAATGACCACCCTGAGCTG 58 sADg-rGFP_A200 sADgrGFP F GATAAAGATCTGGGAAGCACTCCACG 59 sADgrGFP R GCTAGAAGGTTAAAAAAGGTGGGATACTATACCACG 60 ADg-rGFP_A173 ADg-rGFP_A173 F GCTATAGATCTCTCACCAGGGTGGGCCAGGGGGTGGAATAGTATAAC 61 ADg-rGFP_A173 R CCGATAAGCTTAAAAGGTGGGATACTATAACAACATTTAGCATATTG 62 TTATACTATTCCACCC GFP mRNA W58X 5′-GFP F CCATGCTCGAGGGGCCGATGGTGAGC 63 5′-GFPW58X R CAGGGTGGGCTAGGGCACAGG 64 3′-GFPW58X F CCTGTGCCCTAGCCCACCCTG 65 3′-GFP R GGTACAAGCTTTCACTTGTACAGCTCATCCA 66
(284) TABLE-US-00011 TABLE 4 DNA oligonucleotides for RT-PCR name sequence (5′.fwdarw.3′) SEQ ID NO: RT oligodT GGCCACGCGTCCACTAGTAC 67 TTTTTTTTTTTTTTTTT nested PCR 1st GFP R1 for GGCCACGCGTCGACTAGTAC 68 edit check nested PCR 2nd GFP R2 for TCACTTGTACAGCTCATCCA 69 edit check nested PCR 1st GFP F for CTAATACGACTCACTATAGG 70 and 2nd edit check GATGGTGAGCAAGGGCGCC
(285) TABLE-US-00012 TABLE 5 DNA oligonucleotides for qPCR target name sequence (5′.fwdarw.3′) SEQ ID NO: ADg-GFP_A200 sADgrGFP F for qPCR GAAGCACTGCACGCCG 71 sADgrGFP R for qPCR GGTGGGATACTATACC 72 ACG GAPDH GapDH F for qPCR CCTGCACCACCAACTG 73 CTTAGC GapDH R for qpCR GATGGCATGGACTGTG 74 GTCATGAC
(286) TABLE-US-00013 TABLE 6 sequences of RNA length NAME (nt) Sequence (5′.fwdarw.3′) SEQ ID NO: ADg-GFP_A200 RNA 66 GGGUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCGCACCUCCGC 75 AGCUCAGGGUGGUCA 3′-antisense RNA 19 CCGCAGCUCAGGGUGGUCA 76 5′-antisense RNA 22 GGGAAGCACUGCACGCCGCAGC 77 ADg-rGFP_A200 RNA 71 GGGAAGCACUGCACGCCGCAGCGGGUGGAAUAGUAUAAGAAUAUGCUAAAUGU 78 UGUUAUAGUAUCGCACCU AD-guide rRluc_A311 RNA 62 GGGUUGAGCAGCUCGAACCAAGGGGUGGAAUAGUAUACCAUUCGUGGUAUAGU 79 AUCCCACCU sADg-GFP_A200 RNA 59 GGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCUCCGCAGCUCAGGG 80 UGGUCA sADg-rGFP_A200 RNA 62 GGGAAGCACUGCACGCCCCAGCCGGUGGAAUAGUAUACCAUUCGUGGUAUAGU 81 AUCCCACCU sADg-rGFP_AAA 62 GGGAAGCAGUGCACGCCUCUGCGGGUGGAAUAGUAUACCAUUCGUGGUAUAGU 82 AUCCCACCU sADg-rGFPex_AAA 85 GGGAAGCACUGCACGCCUCUGCGGGUGGAAUAGUAUACCAUUCGUGGUAUAGU 83 AUCCCACCUUCAGG sADg-rGFP_A200_0 65 GGGAAGCACUGCACGCCGCGGUGGGUGGAAUAGUAUACCAUUCGUGGUAUAGU 84 AUCCCACCUACC ADg (L1) 64 GGGAAGGAGUGCACGCCGCAGUGGGUGGAAUAGUAUACCAUUCGUGGUAUAGU 85 AUCCCACCUAC ADg (L2) 63 GGGAAGCACUGCACGCCGCAGUGGGUGGAAUAGUAUACCAUUCGUGGUAUAGU 86 AUCCCACCUA ADg (L4) 61 GGGAAGCACUGCACGCCGCAGCUGGUGGAAUAGUAUACCAUUCGUGGUAUAGU 87 AUCCCACC ADg (L5) 60 GGGAAGCACUGCACGCCGCAGCUCGUGGAAUAGUAUACCAUUCGUGGUAUAGU 88 AUCCCAC ADg-rGFP_A173 69 GUCACCAGGGUGGGCCAGGGGGUGGAAVAGUAUAACAAUAUGCUAAAUGUUGU 89 UAUAGUAUCCCACCUU sADgGFP 61 GGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCUCCGCAGCUCAGGG 90 UGGUCAUU sADgrGFP 64 GGGAAGCACUGCACGCCGCAGCGGGUGGAAUAGUAUACCAUUCGUGGUAUAGU 91 AUCCCACCUUU GFP RNA 720 AUGGUGAGCAAGGGCGCCGAGCUGUUCACCGGCAUCGUGCCCAUCCUGAUGGA 92 GCUGAAUGGCGAUGUGAAUGGCCACAAGUUCAGCGUGAGCGGCGAGGGCGAGG GCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAG CUGCCUGUGCCCUGGCCCACCCUGGUGACCACCCUGAGCUACGGCGUGCAGUG CUUCUCACGCUACCCCGAUCACAUGAAGCAGCACGACUUCUUCAAGAGCGCCA UGCCUGAGGGCUACAUCCAGGAGCGCACCAUCUUCUUCGAGGALGACGGCAAC UACAAGUCGCGCGCCGAGGUGAAGUUCGAGGGCGAUACCCUGGUGAAUCGCAU CGAGCUGACCGGCACCGAUUUCAAGGAGGAUGGCAACAUCCUGGGCAAUAAGA UGGAGUACAACUACAACGCCCACAAUGUGUACAUCAUGACCGACAAGGCCAAG AAUGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGAUGGCAGCGU GCAGCUGGCCGACCACUACCAGCAGAAUACCCCCAUCGGCGAUGGCCCUGUGC UGCUGCCCGAUAACCACUACCUGUCCACCCAGAGCGCCCUGUCCAAGGACCCC AACGAGAAGCGCGAUCACAUGAUGUACUUCGGCUUCGUGACCGCCGCCGCCAU CACCCACGGCAUGGAUGAGCUGUACAAGUGA GFPs RNA 160 GGGUGAAUGGCCACAAGUUCAGCGUGAGCGGCGAGGGCGAGGGCGAUCCCACC 93 UACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCUGUGGC CUGGCCCACCCUGGUGACCACCCUGAGCUACGGCGUGCAGUGCUUCUCACGCU A Rluc W104X RNA 942 GGGACCAUGGCUUCCAAGGUGUACGACCCCGAGCAACGCAAACGCAUGAUCAC 94 UGGGCCUCAGUGGUGGGCUCGCUGCAAGCAAAUGAACGUGCUGGACUCCUUCA UCAACUACUAUGAUUCCGAGAAGCACGCCGAGAACGCCGUGAUUUUUGUGCAU GGUAACGCUGGCUCGAGGUACCUGUGGAGGCACGUCGUGCCUCACAUCGAGCC CGUGGCUAGAUGCAUCAUGCCUGAUCUGAUCGGAAUGGGUAAGUCCGGCAAGA GCGGGAAUGGCUCAUAUCGCCUCCUGGAUCACUAGAAGUACCUCACCGCUUAG UUCGAGCUGCUGAACCUUCCAAAGAAAAUCAUCUUUGUGGGCCACGACUGGGG GGCUUGUCUGGCCUUUCACUACUCCUACGAGCACCAAGACAAGAUCAAGGCCA UCGUCCAUGCUGAGAGUGUCGUGGACGUGAUCGAGUCCUGGGACGAGUGGCCU GACAUCGAGGAGGAUAUCGCCCUGAUCAAGAGCGAAGAGGGCGAGAAAAUGGU GCUUGAGAAUAACUUCUUCGUGGAGACCAUGCUCCCAAGCAAGAUCAUGCGGA AACUGGAGCCUGAGGAGUUCGCUGCCUACCUGGAGCCAUUCAAGGAGAAGGGC GAGGUUAGACGGCCUACCCUCUCCUGGCCUCGCGAGAUCGCUCUCGUUAAGGG AGGCAAGCCCGACGUCGUCCAGAUUGUCCGCAACUACAACGCCUACCUUUGGG CCAGCGAGGAUCUGCCUAAGAUGUUCAUCGAGUCCGACCCUGGGUUCUUUUCC AACGCUAUUGUCGAGGGAGCUAAGAAGUUCCCUAACACCGAGUUCGUGAAGGU GAAGGGCCUCCACUUCAGCCAGGAGGACGCUCCAGAUGAAAUGGGUAAGUACA UCAAGAGCUUCGUGGAGCGCGUGCUGAAGAACGAGCAGUAA eSL_AAA RNA 196 GGGGGCGAAAGGGGGAUGUGCUGCAAGGCGAUUAAGUUGGGUAACGCCAGGGU 95 UUUCCCAGUCACGACGUUGUAAAACGACGGCCAGUGAAUUCCGCCUCGAGUCC GUUAAAGUGGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCUACUCU GACGAAGCUUGGCGCAUGC eSLr_AAA RNA 196 GGGGGCGAAAGGGGGAUGUGCUGCAAGGCGAUUAAGUUGGGUAACGCCAGGGU 96 UUUCCCAGUCACGACGUUGUAAAACGACGGCCAGUGAAUUCCGCCUCGAGUCC GUUUCUGUGGGUGGAAUAGUAUACCAUUCGUGGUAUAGUAUCCCACCUACAAA GACGAAGCUUGGCGCAUGG GFPmut RNA 154 GGGUGAAUGGCCACAAGUUCAGCGUGAGCGGCGAGGGCGAGGGCGAUGCCACC 97 UACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCUGUGCC CUGGCCCACCCUGGUGACCACCCUGAGCAAAGGCGUACAGUGCUUCUC AcGFP W58X RNA 720 AUGGUGAGCAAGGGCGCCGAGCUGUUCACCGGCAUCGUGCCCAUCCUGAUCGA 98 GCUGAAUGGCGAUGUGAAUGGCCACAAGUUCAGCGUGAGCGGCGAGGGCGAGG GCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUGAUCUGGACCACCGGCAAG CUGCCUGUGCCCUAGCCCACCCUGGUGACCACCCUGAGCUACGGCGUGCAGUG CUUCUCACGCUACCCCGAUCACAUGAAGCAGCACGACUUCUUCAAGAGCGCCA UGCCUGAGGGCUACAUCCAGGAGCGCACCAUCUUUCUUCGAGGAUGACGGCAA CUACAAGUCGCGCGCCGAGGUGAAGUUCGAGGGCGAUACCCUGGUGAAUCGCA UCGAGGUGACCGGCACCGAUUUCAAGGAGGAUGGCAACAUCCUGGGCAAUAAG AUGGAGUACAACUACAACGCCCACAAUGUGUACAUCAUGACCGACAAGGCCAA GAAUGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGAUGGCAGCG UGCAGCUGGCCGACCACUACCAGCAGAAUACCCCCAUCGGCGAUGGCCCUGUG CUGCUGCCCGAUAACCACUACCUGUCCACCCAGAGCCCCCUGUCCAAGGACCC CAACGAGAAGCGCGAUCACAUGAUCUACUUCGGCUUCGUGACCGCCGCCGCCA UCACCCACGGCAUGGAUGAGCUGUACAAGUGA
Method for Preparing AD-gRNA and Target RNA
(287) First, AD-gRNA was synthesized by the in vitro transcription method. A template dsDNA for in vitro transcription was synthesized by a common method using synthetic oligonucleotides. In general, 1 μM of the forward DNA oligonucleotide containing a T7 promoter sequence and 1 μM of a reverse DNA oligonucleotide were mixed in an annealing buffer (50 mM Tris-HCl [pH 7.6], 50 mM NaCl), after which an annealing reaction was performed by denaturing at 90° C. for 3 min, followed by cooling at room temperature for 15 min. To generate the dsDNA template, the annealed product was elongated using Klenow polymerase (New England BioLabs). The obtained dsDNA was purified by phenol/chloroform extraction and ethanol precipitation. Using this purified dsDNA as a template, an in vitro transcription reaction was performed using the AmpliScribe T7 kit (Epicenter Biotechnologies) according to the manufacturer's protocol. The reaction solution was subjected to phenol/chloroform extraction and ethanol precipitation, and denatured on 5% polyacrylamide gel containing 8 M urea to purify AD-gRNAs. The target RNA was prepared by PCR using dsDNA template by a standard PCR reaction (PrimeSTAR GXL DNA polymerase (Takara Bio)). Subsequently, in vitro transcription and purification were performed as described above. The sequences of all DNA oligonucleotides and RNA samples are shown in Tables 2 to 6.
(288) Preparation Method of Recombinant hADAR2
(289) Recombinant hADAR2 was prepared by amplifying the coding region for human ADAR2 from cDNA clone (clone ID 6014605. Open Biosystems) by PCR, cloning the N-terminal His-Express tagged fusion protein, and transforming it into INVScl yeast cells using the Frozen-EZ Yeast Transformation 11 Kit (Zymo Research). The obtained transformants were cultured in a liquid medium, and the recombinant hADAR2 was purified using a HisTrap HP column (GE Healthcare). Fractions containing hADAR2 were collected and dialyzed against a buffer for storage (10 mM Tris-HCl [pH 7.5], 150 mM NaCl, 5% glycerol, 1 mM DTT) using a 50-kDa molecular weight cutoff Float-A-Lyzer G 2 Spectra/Por). Purified hADAR2 was quantified using DC protein Assay Kit (BioRad) according to the manufacturer's protocol.
EXAMPLE 11
(290) In Vitro Editing Assay
(291) Complexes of gRNAs and target RNA were prepared by heating 900 nM AD-gRNA and 300 nM target RNA at 80° C. for 3 min. and then slowly cooling in an annealing buffer (10 mM Tris-HCl [pH 7.6], 150 mM NaC) to 25° C. at a rate of 1° C./10 sec. The editing reaction was carried out as follows: 5 nM of the obtained complex and purified hADAR2 with various concentrations were mixed in 20 μl of a reaction buffer (20 mM HEPES-KOH [pH 7.5], 100 mM NaCl, 2 mM MgCl 2, 0.5 mM DTT, 0.01% Triton X-100, 5% glycerol, 1 U/μl Murine RNAse Inhibitor [New England BioLabs]), and then incubated at 37° C. for 2 hours. After completion of the reaction, the reacted RNA was subjected to phenol/chloroform extraction/ethanol precipitation. Thereafter, the RNA pellet was dissolved in 5 μl TE buffer. To obtain cDNA from the reacted RNA from the purified RNA, it was reverse transcribed using PrimeScript II Reverse Transcription Kit (Takara Bio). cDNA was PCR-amplified using PrimeSTAR GXL DNA polymerase (Takara Bio) according to a standard protocol. Male and female efficiencies at each site were analyzed by direct sequencing as follows. 10 ng of gel purified PCR product was sequenced with a reverse primer and the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems), and then sequencing chromatography was performed with 3130 Genetic Analyzer (Applied Biosystems). The editing ratio at each site was calculated as follows: A/(A+G) (where A and G are peak heights of adenosine and guanosine measured by Sequence Scanner software ver. 1.0 (Applied Biosystems)).
EXAMPLE 12
(292) In Vitro Codon Repair Experiments Using a Luciferase Reporter Assay Coupled with In Vitro Translation
(293) The reporter for the in vitro codon repair experiment was designed based on Renilla luciferase mRNA (Rluc-WT). This reporter mRNA (Rluc-W104X) was prepared by mutating G 311 to A311 in Trp 104 (UGG) using QuikChange Site-Directed Mutagenesis Kit (Stratagene). With this Rluc-W104X reporter, the full length, wild type Rluc transcript was synthesized and A311 was edited to I 311. In vitro compilation reaction and translation reaction were carried out continuously. First, 5 μM Rluc-W104X and 15 μM ADg-rLuc_A311 were annealed by heating together at 80° C. for 3 min in an annealing buffer and then slow cooling to 25° C. at a rate of 1° C./10 sec. Thereafter, 0.5 μM of the reporter/gRNA complex was treated in a reaction buffer at 37° C. for 2 hours to perform an editing reaction with 1.25 μM hADAR2. In parallel, a control sample (without gRNA) was treated in the same reaction.
(294) The edited RNA sample was extracted with phenol/chloroform and recovered by ethanol precipitation. To assess whether active Rluc could be translated from edited reporter mRNA, an in vitro translation was performed in 20 μl of rabbit reticulocyte lysate, using 1 μg of reporter RNA obtained from the editing reaction. After 1 hour of translation at 37° C., chemiluminescence was performed using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturing protocol, and luminescence was measured with a spectrophotometer. When performing the reaction at the same time, 5 μM Rluc-W104X, 15 μM ADg-rLuc_A311, and 1.25 μM hADAR2 were thoroughly mixed with 20 μl of rabbit reticulocyte lysate and incubated at 37° C. for 20 min. Luciferase assay was then performed under the conditions described above.
EXAMPLE 13
(295) Preparation of AD-gRNA Expression Plasmid
(296) An AD-gRNA expression plasmid was constructed using pSUPER.neo (Oligoengine), which is used for expressing intracellular RNAs such as short hairpin RNAs and miRNAs, based on the HI RNA polymerase III promoter. While preparing DNA insert-encoding AD-gRNAs, tetra uridine was inserted into the 3′ end of the AD-gRNA sequence to terminate pol III transcription at a specified position. Cloning into vectors was facilitated by introducing Hind III and Bgl II restriction sites at the 5′ and 3′ ends, respectively. The DNA inserts were prepared using synthetic oligonucleotides shown in Tables 2 to 6. Each DNA insert was cloned into the pSuper.neo vector and the sequences of the resulting plasmids were confirmed by DNA-sequencing analysis. Finally, expression plasmid used for transcription was prepared using a Plasmid Mini Kit (Qiagen) according to the manufacturer's protocol.
EXAMPLE 14
(297) Cell Culture
(298) HEK 293 cells were collected in Dulbecco's Modified Eagle Medium (DMEM; Sigma) supplemented with 10% fetal bovine serum. Tet-ADAR2 cells, in which hADAR2 and AcGFP were simultaneously expressed from a bidirectional promoter under the control of the Tet-on system, were established in the inventors' laboratory. tet-ADAR2 cells were cultured as monolayers in DMEM supplemented with 10% Tet system-approved fetal bovine serum (Clontech), 1 μg/mL puromycin and 100 μg/mL G418 (Sigma) at 37° C. in the presence of 5% CO.sub.2. The expression of ADAR2 and AcGFP was induced by culturing tet-ADAR2 cells in the above medium supplemented with 5 μg/mL of Dox.
EXAMPLE 15
(299) Analysis of Intracellular Activity of AD-Guide RNAs
(300) Tet-ADAR2 cells (1.6×10.sup.5) were added to 35-mm dishes containing a medium containing 5 μg/mL Dox. When the cells reached about 80% confluence, they were transfected with 2 μg of AD-gRNA using X-treme GENE HP DNA Transfection Reagent (Roche). After transfection for 72 hours, the editing efficiency at A100 in AcGFP RNA, which was simultaneously expressed with hADAR2 in tet-ADAR2 cells, was analyzed as follows. Total RNA was extracted from the transfected cells using Sepasol RNA I Super G (Nacalai Tesque) according to the manufacturer's protocol. Thereafter, the RNA samples (30 μg) were treated with 10 U DNase I (Takara Bio) at 37° C. for 3 hours, followed by phenol/chloroform extraction and ethanol precipitation. Purified RNA (0.5 μg) was reverse transcribed using the adapter link oligo (dT) 17 primer and Transcriptor High Fidelity cDNA Synthesis Kit (Roche) according to the manufacturer's protocol. Using the obtained total RNA as a template. AcGFP cDNA was amplified by PCR using AcGFP-specific primers (AcGFP_F and AcGFP_R). The efficiency of AI RNA editing at the A100 site was analyzed by direct sequencing, followed by quantification of the relative heights of the A and G peaks, after which each editing ratio was calculated on the basis of the peak height of G divided by that of (A+G).
EXAMPLE 16
(301) Intracellular Codon Repair Experiments with AD-gRNAs
(302) In the in vitro codon repair experiments, the mutant GFP mRNA (AcGFP-W58X) in which G173 was changed to A173 and codon W58 of the stop codon was mutated was designed to determine whether AD-gRNA could regulate functional gene expression in cells. The AcGFP-W58X expression plasmid was constructed based on the pcDNA 3.1 expression vector (Invitrogen). In addition, hADAR2 expression plasmid was constructed by cloning PCR-amplified hADAR2 cDNA into pcDNA 3.1. 100 ng each of hADAR2, AcGFP-W58X and AD-gRNA expression vectors were co-transfected into sub-confluent HEK 293 cells. The editing efficiency was analyzed 72 hours after transfection. The recovery of intracellular GFP fluorescence was analyzed with a fluorescence microscope.
EXAMPLE 17
(303) This example is an example of verifying whether the editing guide RNA according to the present invention functions in cultured cells into which intracellular RNA mutation has been introduced. First, intracellular expression plasmids of four editing guide RNAs (ADg-GFP-A200, ADg-rGFP_A200, sADg-GFP-A200, sADg-rGFP_A200: see
EXAMPLE 18
(304) Since inosine (I) on mRNA is recognized as guanosine (G) at the time of translation, the function of intracellular target protein can be controlled by codon modification by this A-I mutation. Thus, in this example, it was clarified whether the method of introducing a RNA mutation according to the present invention can control expression of protein function.
(305) Specifically, a reporter mRNA (GFP W58X mRNA) in which the 58.sup.th Trp codon (UGG) of GFP mRNA (720 nt) was modified to a stop codon (UAG) was used to mutagenize the stop codon into UIG so as to verify whether mature GFP is translated in cells (
EXAMPLE 19
(306) 4.0×10.sup.5 Tet-ADAR 2 cells were cultured in Tet serum medium containing 1 μg/mL puromycin, 100 μg/mL G418, and 5.0 μg/mL Dox in a collagen-coated 35-mm dish under the conditions of 37° C. and 5.0% CO.sub.2. Cells cultured to 80% confluence were subcultured to a 6-well plate at 1.6×10.sup.5 cells/well. After incubation for 48 hours, each guide RNA expression plasmid (pSuper-guide 3-mini, pSuper-guide 3r-mini, pSuper-guide 3-Glu, pSuper-guide 3r-Glu) was transfected using FuGENE HP Transfection Reagent (Roche), and transfected for 72 hours. Thereafter. RNA was all extracted using 1000 μL of Cepazole RNA I Super G (Nacalai), and DNase treatment was performed for 1 hour at 37° C. using 10 U Recombinant DNase I (TaKaRa). RNA products were all purified by phenol/chloroform treatment, and ethanol precipitation in the presence of sodium acetate. A reverse transcription reaction was carried out for the following conditions: denaturing at 80° C. for 3 min, rapid cooling and annealing at 65° C. for 10 min, elongation reaction at 55° C. for 300 min, and heating at 85° C. for 5 min, using 0.5 μg of total RNA, 2.5 μM Oligo (dT) 17, and Transcriptor First Strand cDNA Synthesis Kit (Roche) to synthesize cDNA. 1st PCR (denaturation at 98° C. for 10 sec, annealing at 55° C. for 15 sec, elongation reaction at 68° C. for 60 sec, 35 cycles) was carried out using the sample diluted 10 times as a template with 0.25 μM AcGFP RNAf T7F01 primer, 0.25 μM 3′-ADP primer, 0.25 U PrimeStar GXL DNA polymerase (TaKaRa). Using the 1st PCR product diluted 400 times as a template, Nested PCR (denaturation at 98° C. for 10 sec, annealing at 55° C. for 15 sec, elongation reaction at 68° C., 60 sec, 24 cycles) was carried out with 0.25 μM RNAf T7F01 primer and 0.25 μM AcGFP-RNAf-R 01 primer. After the PCR reaction, a sequencing reaction (denaturation at 96° C. for 10 sec. annealing at 50° C. for 5 sec, elongation reaction at 60° C. for 30 sec, 25 cycles) was carried out using Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems™) and 0.165 μM RNAf T7F01 primer using the amplification product diluted 10 times. The editing ratio was calculated from the obtained peak height ratio G/(G+A). The subsequent operation (after RNA extraction) was performed in the same manner as described above.
EXAMPLE 20
(307) 1.6×10.sup.5 HEK 293 cells were cultured in serum medium at 35° C./GLASS BASE DISH (Glass 12φ) (Iwaki) for 48 hours under conditions of 37° C. and 5.0% CO.sub.2. Thereafter, 700 ng each of ADAR2 expression plasmid pcDNA3.1 (−) Hygro_His-ADAR2, substrate RNA expression plasmid pcDNA3.1 (−) Hygro_AcGFPW58X and each guide RNA expression plasmid pSuper-neo-guide 3r-miniW 58X or pSuper-neo-guide 3r-GluW 58X were transduced using X-tremeGENE HP DNA Transfection Reagent (Roche) and cultured for 72 hours. After that, the cells were washed with D-PBS (−) (Nacalai) and then observed using a confocal fluorescence microscope.
EXAMPLE 21
(308) In this example, formation of a complex of AD-gRNA and target RNA was confirmed by a gel-mobility shift assay (
EXAMPLE 22
(309) In this example, the construction of AD-gRNA using a framework based on edited GAuR2 RNA was confirmed (
EXAMPLE 23
(310) In this example, editing specificity was analyzed using cis-substrate RNA (
(311) The eSL_AAA RNA was generated by mutating the nucleotide adjacent to the targeted editing site to adenosine and introducing uridine into the complementary position of this mutant adenosine to promote base pairing. eSLr_AAA RNA was generated by replacing three adenosines containing the target base adenosine of eSL_AAA RNA with complementary nt. The actual sequences of eSL_AAA RNA and eSLr_AAA RNA are shown in
(312) Using these substrate RNAs, an in vitro editing reaction with hADAR2 was performed according to the method of
EXAMPLE 24
(313) In this example, in order to evaluate the flanking specificity of AD-gRNA induced RNA compilation, GFP mut RNA was generated by mutating adjacent nt adjacent to A200 in GFP mRNA to adenosine. In
EXAMPLE 25
(314) In the present example, the adjacent specificity of AD-g RNA-induced RNA editing and the effect on editing efficiency when base pairing was additionally introduced were analyzed. The degree of rotational freedom of the ADAR binding site (
EXAMPLE 26
(315) In this example, a simultaneous in vitro editing/translation reaction was performed.
EXAMPLE 27
(316) In this example, ADg-GFP A200 in tet-ADAR 2 cells was subjected to RT-PCR and quantitative PCR (qPCR). Sub-confluent proliferating tet-ADAR2 cells were transfected with the AD-gRNA expression plasmid vector. After incubation for each time, total RNA was extracted and reverse transcription was performed using a random hexamer primer (dN 6 primer) using Transcriptor High Fidelity cDNA Synthesis Kit (Roche). qPCR was performed using qADg_F and qADg_R primers for specific amplification of ADg-GFP-A200 using Power SYBR (R) Green PCR Master Mix (Applied Biosystems). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was also quantified using GAPDA-QF and GAPDH-QR primers as an internal standard for quantifying the total RNA amount. The conditions of qPCR are as follows: preheating for denaturation (95° C. for 10 min) and amplification by LightCycler Nano System (Roche) (95° C., 15 sec; 60° C., 1 min: 55 cycles). Using an analysis software, a tolerance threshold (Ct: crossing threshold) was calculated from the fluorescence amplification plot by the 2nd derivative maximum method. The tolerance threshold difference (ΔCt) of each sample was calculated as follows:
ΔCt=Ct(AD-gRNA)−Ct(GAPDH)
(317) The relative expression level of ADg-RNA was estimated by R=2{circumflex over ( )}-ΔCt and displayed on a graph.
EXAMPLE 28
(318) In this example, hADAR2 expression in tet-ADAR2 cells was analyzed by western blotting (
EXAMPLE 29
(319) This example shows the editing efficiency induced by AD-gRNA in tet-ADAR2 cells.
EXAMPLE 30
(320) This example shows the editing efficiency of AD-gRNA generated at different sites of the editing substrate RNA.
INDUSTRIAL APPLICABILITY
(321) The method for introducing a site-directed RNA mutation according to the present invention can easily design and construct any target RNA in which its target base adenosine is present as well as target editing guide RNA for such target RNA. It is thus possible to easily design and construct a double-stranded complex of a target RNA which induces ADAR function and its target editing guide RNA. Thus, in the present invention, by allowing ADAR to act on such a double-stranded complex, it is possible to induce its RNA editing capability and convert the target base adenosine to inosine. Furthermore, since the present invention can be used not only in vitro but also in living bodies, it can be used as a useful and important tool in research and development of drug discovery.
(322) The method for introducing a site-directed RNA mutation according to the present invention can be applied to mutations of amino acids involved in expression of functions of intracellular proteins such as sugar chain modification sites, phosphorylation sites, and metal coordination, and thus can provide a new methodology to temporarily control the function of intracellular proteins. The present invention provides molecular science technology that can greatly contribute to research and development in the life science field by generalizing an in vivo protein function control method by an RNA mutation introduction technique using target editing guide RNA.
(323) Also, nucleic acid preparations have so far been developed, utilizing the suppression of the expression of a target protein by siRNA or the function control of a target protein by functional RNA called aptamer. On the other hand, we have not yet seen examples of drugs that convert mRNA information and modify the function of the target protein. Thus, the present invention provides novel nucleic acid pharmaceuticals exhibiting unprecedented functions and efficacy having possibility to generate drugs for, for example, neurological disorders, such as anti-muscular dystrophy drugs, anti-multiple sclerosis drugs, anti-Alzheimer's drugs, anti-nervous tissue degenerative drugs, and anti-Parkinson's disease, and anticancer drugs.
EXPLANATION OF REFERENCES
(324) 10 5′-target side complementary region 12 terminal target complementary region 14 guide side target complementary region 20 antisense region 22 terminal target recognition region 24 Core side target recognition region 26 ADAR binding region 27 guide side divided region 28 ADAR binding core region 50 3′-target complementary region 52 terminal target complementary region 54 guide side target complementary region 60 antisense region 62 terminal target recognition region 64 core side target recognition region 66 ADAR binding region 67 guide side divided region 68 ADAR binding core region