VIRAL VECTORS AND NUCLEIC ACIDS FOR USE IN THE TREATMENT OF PF-ILD AND IPF
20220213503 · 2022-07-07
Inventors
- Sebastian Kreuz (Ingelheim am Rhein, DE)
- Holger Klein (Ingelheim am Rhein, DE)
- Benjamin Strobel (Ingelheim am Rhein, DE)
- Stephan Klee (Ingelheim am Rhein, DE)
- Thorsten Lamla (Ingelheim am Rhein, DE)
- Marc Kaestle (Ingelheim am Rhein, DE)
Cpc classification
C12N2320/32
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
A61K31/7105
HUMAN NECESSITIES
C12N2310/113
CHEMISTRY; METALLURGY
A01K2207/35
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N15/86
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Viral vector comprising: a capsid and a packaged nucleic acid, wherein the nucleic acid either augments the miRNA downregulated in a Bleomycin-induced lung fibrosis model or in an AAV-TGFβ1-induced lung fibrosis model, or wherein the nucleic acid inhibits the miRNA up-regulated in a Bleomycin-induced lung fibrosis model or in an AAV-TGFβ1-induced lung fibrosis model.
Claims
1. Viral vector comprising: a capsid and a packaged nucleic acid, wherein the packaged nucleic acid codes for one or more miRNAs, wherein at least one of the one or more miRNAs comprises the miRNA of Seq ID No. 15, Seq ID No. 17, or Seq ID No. 19.
2. Viral vector according to claim 1, wherein the packaged nucleic acid codes for more than one miRNA, wherein said miRNAs comprise the miRNA of Seq ID No. 15 and the miRNA of Seq ID No. 19 and a miRNA of Seq ID No. 18.
3. Viral vector according to claim 1, wherein the packaged nucleic acid codes for more than one miRNA, wherein said miRNAs comprise the miRNA of Seq ID No. 15 and the miRNA of Seq ID No. 17 and a miRNA of Seq ID No. 18.
4. Viral vector according to claim 1, wherein the packaged nucleic acid codes for more than one miRNA, wherein said miRNAs comprise the miRNA of Seq ID No. 15 and the miRNA of Seq ID No. 17 and the miRNA of Seq ID No. 19.
5. Viral vector according to claim 1, wherein the packaged nucleic acid codes for more than one miRNA, wherein said miRNAs comprise the miRNA of Seq ID No. 15 and the miRNA of Seq ID No. 17.
6. Viral vector according to claim 1, wherein the packaged nucleic acid codes for more than one miRNA, wherein said miRNAs comprise the miRNA of Seq ID No. 15 and the miRNA of Seq ID No. 19.
7. (canceled)
8. Viral vector according to claim 1, wherein the packaged nucleic acid codes for more than one miRNA, wherein said miRNAs comprise the miRNA of Seq ID No. 19 and the miRNA of Seq ID No. 17.
9. Viral vector according to claim 1, wherein the packaged nucleic acid codes for more than one miRNA, wherein said miRNAs comprise the miRNA of Seq ID No. 19 and a miRNA of Seq ID No. 18.
10. Viral vector according to claim 1, wherein the packaged nucleic acid codes for a miRNA having the sequence of Seq ID No. 19, and for a miRNA having the sequence of Seq ID No. 18 and for a miRNA having the sequence of Seq ID No. 17.
11. (canceled)
12. Viral vector according to claim 1, comprising: a capsid and a packaged nucleic acid comprising one or more transgene expression cassettes comprising a transgene that codes for one or more miRNAs selected from the group consisting of the miRNAs of Seq ID Nos. 15, 17, 18 and 19, and for an RNA that inhibits the function of one or more miRNAs selected form the group consisting of the miRNAs of Seq ID Nos. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 34, 35 and 36.
13. Viral vector according to claim 1, comprising: a capsid and a packaged nucleic acid comprising two or more transgene expression cassettes comprising a transgene, wherein the first expression cassette comprises a first transgene that codes for one or more miRNAs selected from the group consisting of the miRNAs of Seq ID Nos. 15, 17, 18 and 19, and wherein the second expression cassette comprises a second transgene that codes for an RNA that inhibits the function of one or more miRNAs selected form the group consisting of miRNAs of Seq ID No 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 34, 35 and 36.
14.-15. (canceled)
16. Viral vector according to claim 12, wherein the transgene expression cassettes comprise a promotor, a transgene and a polyadenylation signal, wherein promotors or the polyadenylation signals are positioned opposed to each other.
17. Viral vector according to claim 1, wherein the vector is a recombinant AAV vector.
18. Viral vector according to claim 1, wherein the vector is a recombinant AAV vector having the AAV-2 serotype.
19. Viral vector according to claim 1, wherein the capsid comprises a first protein that comprises the sequence of Seq ID No. 29 or 30.
20. Viral vector according to claim 1, wherein the capsid comprises a first protein that is 80% identical to a second protein having the sequence of Seq ID No. 82, whereas one or more gaps in the alignment between the first protein and the second are allowed.
21. Viral vector according to claim 1, wherein the capsid comprises a first protein that is 95% identical to a second protein of Seq ID No. 82, whereas a gap in the alignment between the first protein and the second protein is counted as a mismatch.
22. Viral vector according to claim 1, wherein the vector is a recombinant AAV vector having the AAV5 or the AAV6.2 serotype, and wherein the capsid of the recombinant AAV6.2 vector preferably comprises a capsid protein having the sequence of Seq ID No. 82.
23.-25. (canceled)
26. Method of treating a disease selected from the group consisting of PF-ILD, IPF, connective tissue disease (CTD)-associated ILD, rheumatoid arthritis ILD, chronic fibrosing hypersensitivity pneumonitis (HP), idiopathic non-specific interstitial pneumonia (iNSIP), unclassifiable idiopathic interstitial pneumonia (IIP), environmental/occupational lung disease, systemic sclerosis ILD, sarcoidosis, and fibrosarcoma, the method comprising administering to a patient in need thereof a therapeutically active amount of viral vector according to claim 1.
27. (canceled)
28. AAV vector comprising a vector genome that codes for one or more miRNAs selected from the group comprising the miRNA of Seq ID No. 15, the miRNA of Seq ID No. 17, and the miRNA of Seq ID No. 19.
29. AAV vector according to claim 28, wherein said vector genome codes for a miRNA having the sequence of Seq ID No. 15 and for a miRNA having the sequence of Seq ID No. 17 and optionally for a miRNA having the sequence of Seq ID No. 19.
30. AAV vector according to claim 28, wherein said vector genome further codes for an RNA that inhibits the function of one or more miRNAs selected form the group consisting of the miRNAs of Seq ID Nos. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 34, 35 and 36.
31. (canceled)
32. A miRNA mimetic for use in a method of prevention and/or treatment of a fibroproliferative disorder, wherein miRNA comprises the sequence of Seq ID No. 15.
33. A miRNA mimetic of miRNA 212-5p for use in a method according to claim 32, wherein the miRNA mimetic is an oligomer of nucleotides that consist of the sequence of Seq ID No. 15, with the following proviso: the oligomer optionally comprises nucleotides with chemical modifications leading to non-naturally occurring nucleotides that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of Seq ID No. 15; the oligomer optionally comprises nucleotide analogues that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of Seq ID No. 15; the oligomer is optionally lipid conjugated to facilitate drug delivery.
34. A miRNA mimetic for use in a method according to claim 32, wherein said prevention and/or treatment further comprises the administration of a mimetic of a miRNA having the sequence of Seq ID No. 19 or a mimetic of a miRNA having the sequence of Seq ID No. 18, or a mimetic of a miRNA having the sequence of Seq ID No. 17.
35. A miRNA mimetic for use in a method according to claim 32, wherein said prevention and/or treatment further comprises the administration of a mimetic of a miRNA having the sequence of Seq ID No. 17.
36. A miRNA mimetic for use in a method according to claim 32, wherein said prevention and/or treatment further comprises the administration of a miRNA mimetic of miRNA 181a-5p, and wherein the miRNA mimetic is an oligomer of nucleotides that consists of the sequence of Seq ID No. 17, with the following proviso: the oligomer optionally comprises nucleotides with chemical modifications leading to non-naturally occurring nucleotides that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of Seq ID No. 17; the oligomer optionally comprises nucleotide analogues that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of Seq ID No. 17; the oligomer is optionally lipid conjugated to facilitate drug delivery.
37. A miRNA mimetic for use in a method according to claim 32, wherein said prevention and/or treatment further comprises the administration of a mimetic of a miRNA having the sequence of Seq ID No. 19.
38. A miRNA mimetic for use in a method according to claim 32, wherein said prevention and/or treatment further comprises the administration of a miRNA mimetic of miRNA 181b-5p, and wherein the miRNA mimetic is an oligomer of nucleotides that consists of the sequence of Seq ID No. 19, with the following proviso: the oligomer optionally comprises nucleotides with chemical modifications leading to non-naturally occurring nucleotides that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of Seq ID No. 19; the oligomer optionally comprises nucleotide analogues that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of Seq ID No. 19; the oligomer is optionally lipid conjugated to facilitate drug delivery.
39. A miRNA mimetic for use in a method according to claim 32, wherein said prevention and/or treatment further comprises the administration of a mimetic of a miRNA having the sequence of Seq ID No. 17 and a mimetic of a miRNA having the sequence of Seq ID No. 19.
40. A miRNA mimetic for use in a method according to claim 32, wherein said prevention and/or treatment further comprises the administration of a mimetic of a miRNA having the sequence of Seq ID No. 18 and a mimetic of a miRNA having the sequence of Seq ID No. 19.
41. A miRNA mimetic according to claim 32, wherein said prevention and/or treatment further comprises the administration of a mimetic of a miRNA having the sequence of Seq ID No. 17 and a mimetic of a miRNA having the sequence of Seq ID No. 18.
42. A miRNA mimetic for use in a method according to claim 32, wherein the fibroproliferative disorder is IPF or PF-ILD.
43. (canceled)
44. Pharmaceutical composition comprising (i) a miRNA mimetic of a miRNA having the sequence of Seq ID No. 15, or (ii) a miRNA mimetic of a miRNA having the sequence of Seq ID No. 17, or (iii) a miRNA mimetic of a miRNA having the sequence of Seq ID No. 18, or (iv) a miRNA mimetic of a miRNA having the sequence of Seq ID No. 19, and a pharmaceutical-acceptable carrier or diluent.
45. Pharmaceutical composition according to claim 44, comprising both a miRNA mimetic of a miRNA having the sequence of Seq ID No. 15 and either a miRNA mimetic of a miRNA having the sequence of Seq ID No. 17 or a miRNA mimetic of a miRNA having the sequence of Seq ID No. 19, and said pharmaceutical-acceptable carrier or diluent.
46. Pharmaceutical composition according to claim 44 comprising (a) said miRNA mimetic of a miRNA having the sequence of Seq ID No. 15, wherein said miRNA mimetic is a miRNA mimetic of miRNA 212-5p, wherein the miRNA mimetic is an oligomer of nucleotides that consists of the sequence of Seq ID No. 15, with the following proviso: the oligomer optionally comprises nucleotides with chemical modifications leading to non-naturally occurring nucleotides that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of Seq ID No. 15; the oligomer optionally comprises nucleotide analogues that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of Seq ID No. 15; the oligomer is optionally lipid conjugated to facilitate drug delivery; and (b) said miRNA mimetic of a miRNA having the sequence of Seq ID No. 17, wherein said miRNA mimetic is a miRNA mimetic of miRNA 181a-5p, wherein the miRNA mimetic is an oligomer of nucleotides that consists of the sequence of Seq ID No. 17, with the following proviso: the oligomer optionally comprises nucleotides with chemical modifications leading to non-naturally occurring nucleotides that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of Seq ID No. 17; the oligomer optionally comprises nucleotide analogues that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of Seq ID No. 17, the oligomer is optionally lipid conjugated to facilitate drug delivery; and (c) said pharmaceutical-acceptable carrier or diluent.
47. Pharmaceutical composition according to claim 44, comprising (a) said miRNA mimetic of a miRNA having the sequence of Seq ID No. 15, wherein said miRNA mimetic is a miRNA mimetic of miRNA 212-5p, wherein the miRNA mimetic is an oligomer of nucleotides that consist of the sequence of Seq ID No. 15, with the following proviso: the oligomer optionally comprises nucleotides with chemical modifications leading to non-naturally occurring nucleotides that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of Seq ID No. 15; the oligomer optionally comprises nucleotide analogues that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of Seq ID No. 15; and the oligomer is optionally lipid conjugated to facilitate drug delivery, and (b) said miRNA mimetic of a miRNA having the sequence of Seq ID No. 19, wherein said miRNA mimetic is a miRNA mimetic of miRNA 181b-5p, wherein the miRNA mimetic is an oligomer of nucleotides that consist of the sequence of Seq ID No. 19, with the following proviso: the oligomer optionally comprises nucleotides with chemical modifications leading to non-naturally occurring nucleotides that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of Seq ID No. 19; the oligomer optionally comprises nucleotide analogues that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of Seq ID No. 19, the oligomer is optionally lipid conjugated to facilitate drug delivery; and (c) said pharmaceutical-acceptable carrier or diluent.
48. Method of treating a disease selected from the group consisting of PF-ILD, IPF, connective tissue disease (CTD)-associated ILD, rheumatoid arthritis ILD, chronic fibrosing hypersensitivity pneumonitis (HP), idiopathic non-specific interstitial pneumonia (iNSIP), unclassifiable idiopathic interstitial pneumonia (IIP), environmental/occupational lung disease, systemic sclerosis ILD, sarcoidosis, and fibrosarcoma, the method comprising administering to a patient in need thereof a therapeutically active amount of a pharmaceutical composition according to claim 44.
49. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0018]
[0019]
[0020]
[0021]
[0022]
[0023] The closest human homologs of the mouse sequences that are highly similar (albeit not identical) are shown in
[0024] The shown sequences are also compiled in a sequence listing. In case of contradictions between the sequence listing and
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
SUMMARY OF THE INVENTION
[0042] The invention relates to a viral vector comprising: a capsid and a packaged nucleic acid, wherein the nucleic acid augments either (i) the miRNA of Seq ID No. 15 or (ii) miRNA downregulated in a Bleomycin-induced lung fibrosis model or in an AAV-TGFβ1-induced lung fibrosis model, wherein the miRNA comprises miRNA of Seq ID 17, 18 or 19, or (iii) both (i) and (ii). In one embodiment, the miRNA(s) that are downregulated in a Bleomycin-induced lung fibrosis model or in an AAV-TGFβ1-induced lung fibrosis model and which are augmented by the packaged nucleic acid comprise the miRNA of Seq ID No. 19. In another embodiment, the one or more miRNAs which are augmented by the packaged nucleic acid comprise the miRNA of Seq ID No. 19 and the miRNA of Seq ID No. 18 or the miRNA of Seq ID No. 19 and the miRNA of Seq ID No. 17. Augmentation in this context means that the level of the respective miRNA in the transduced cell is increased as a result of the transduction of the target cell, which is preferably a lung cell.
[0043] The invention further relates to a viral vector comprising: a capsid and a packaged nucleic acid, wherein the nucleic acid augments either (i) the miRNA of Seq ID No. 15 or (ii) miRNA downregulated in a Bleomycin-induced lung fibrosis model or in an AAV-TGFβ1-induced lung fibrosis model, wherein the miRNA comprises miRNA of Seq ID 17, 18 or 19, or (iii) both (i) and (ii) and wherein the nucleic acid further inhibits miRNA selected form the group consisting of miRNAs of Seq ID No 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 16 or the closest human homolog of respective sequences in case of miRNAs with partial sequence conservation.
[0044] Inhibition in this context means that the function of the respective miRNA in the transduced cell is reduced or abolished by complementary binding as a result of the transduction of the target cell.
[0045] In one embodiment of the invention relates to a viral vector comprising: a capsid and a packaged nucleic acid that codes for one or more miRNA that are downregulated in a Bleomycin-induced lung fibrosis model or in an AAV-TGFβ1-induced lung fibrosis model:
a) In one preferred embodiment, the one or more miRNA encoded by the packaged nucleic acid comprise the miRNA of Seq ID No. 15. In another embodiment, the one or more miRNAs encoded by the packaged nucleic acid comprise (i) the miRNA of Seq ID No. 15 and the miRNA of Seq ID No. 17 or (ii) the miRNA of Seq ID No. 15 and the miRNA of Seq ID No. 19 or (iii) the miRNA of Seq ID No. 15 and the miRNA of Seq ID No. 19 and the miRNA of Seq ID No. 18, or (iv) the miRNA of Seq ID No. 15 and the miRNA of Seq ID No. 17 and the miRNA of Seq ID No. 18, or (v) the miRNA of Seq ID No. 15 and the miRNA of Seq ID No. 17 and the miRNA of Seq ID No. 19.
b) In one embodiment, the one or more miRNA encoded by the packaged nucleic acid comprise the miRNA of Seq ID No. 19. In another embodiment, the one or more miRNAs encoded by the packaged nucleic acid comprise (i) the miRNA of Seq ID No. 19 and the miRNA of Seq ID No. 18 or (ii) the miRNA of Seq ID No. 19 and the miRNA of Seq ID No. 17 or (iii, preferred) the miRNA of Seq ID No. 19 and the miRNA of Seq ID No. 17 and the miRNA of Seq ID No. 18.
c) In one embodiment, the one or more miRNA encoded by the packaged nucleic acid comprise the miRNA of Seq ID No. 17. In another embodiment, the one or more miRNAs encoded by the packaged nucleic acid comprise (i) the miRNA of Seq ID No. 17 and the miRNA of Seq ID No. 18 or (ii) the miRNA of Seq ID No. 17 and the miRNA of Seq ID No. 19.
[0046] It is understood that the nucleic acid usually comprises coding and non-coding regions and that the encoded miRNA downregulated in a Bleomycin-induced lung fibrosis model or in an AAV-TGFβ1-induced lung fibrosis model results from transcription and subsequent maturation steps in target cell transduced by the viral vector.
[0047] It is understood that the nucleic acid usually comprises coding and non-coding regions and that the encoded RNA inhibiting the function of one or more miRNA that is upregulated in a Bleomycin-induced lung fibrosis model or in an AAV-TGFβ1-induced lung fibrosis model results from transcription and potentially, but not necessarily, subsequent maturation steps in target cell transduced by the viral vector.
[0048] Viral vectors according to the present invention are selected so that they have the potential to transduce lung cells. Non-limiting examples of viral vectors that transduce lung cells include, but are not limited to lentivirus vectors, adenovirus vectors, adeno-associated virus vectors (AAV vectors), and paramyxovirus vectors. Among these, the AAV vectors are particularly preferred, especially those with an AAV-2, AAV-5 or AAV-6.2 serotype. AAV vectors having a recombinant capsid protein comprising Seq ID No. 29, 30 or 31 are particularly preferred (see WO 2015/018860). In one embodiment, the AAV vector is of the AAV-6.2 serotype and comprises a capsid protein of the sequence of Seq ID No. 82.
[0049] The sequence coding for the miRNA thereby augmenting its function and the sequence coding for an RNA that inhibits the function of one or more miRNA may or may not be within the same transgene.
[0050] In one embodiment, the invention relates to viral vector comprising: a capsid and a packaged nucleic acid comprising one or more transgene expression cassettes comprising: [0051] a transgene that codes for one or more miRNAs selected from the group consisting of the miRNAs of Seq ID Nos. 15, 17, 18 and 19, [0052] and a transgene that codes for an RNA that inhibits the function of one or more miRNAs selected form the group consisting of the miRNAs of Seq ID Nos. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 34, 35 and 36.
[0053] Accordingly, the transgene that codes for a miRNA thereby augmenting its level and the transgene that codes for an RNA that inhibits the function of one or more miRNA are contained in different expression cassettes.
[0054] In one embodiment, the invention relates to a viral vector comprising: a capsid and a packaged nucleic acid comprising one or more transgene expression cassettes comprising a transgene that codes [0055] for one or more miRNAs selected from the group consisting of the miRNAs of Seq ID Nos. 15, 17, 18 and 19, and further codes [0056] for an RNA that inhibits the function of one or more miRNAs selected from the group consisting of the miRNAs of Seq ID Nos. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 34, 35 and 36.
[0057] Accordingly, one transgene codes for both a miRNA thereby augmenting its function and for a RNA that inhibits the function of one or more miRNA.
[0058] In another embodiment of the invention a viral vector is provided, wherein the miRNA that is downregulated in a Bleomycin-induced lung fibrosis model or in an AAV-TGFβ1-induced lung fibrosis model is selected from the group consisting of miRNAs of Seq ID No. 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 and 28 or the closest human homolog of respective sequences in case of miRNAs with partial sequence conservation. In this group, the conserved miRNA, namely 17, 18, 19, 20, 21, 22, 24, 25, 26 or their closest human homolog are most preferred. The closest human homolog of the respective sequences is shown in
[0059] In another preferred embodiment of the invention a viral vector is provided, wherein the miRNA that is downregulated in a Bleomycin-induced lung fibrosis model or in an AAV-TGFβ1-induced lung fibrosis model, is selected from the group consisting of miRNAs of Seq ID No. 17, 18, 19, and 20 (mmu-miR-181a-5p, mmu-miR-10a-5p, mmu-miR-181b-5p, and mmu-miR-652-3p, respectively) and most preferred is Seq ID No. 17 (mmu-miR-181a-5p).
[0060] In a further embodiment of the invention a viral vector is provided, wherein the packaged nucleic acid codes for a miRNA having the sequence of Seq ID No. 17, and for a miRNA having the sequence of Seq ID No. 18 and for a miRNA having the sequence of Seq ID No. 19.
[0061] In a further embodiment of the invention a viral vector is provided, wherein the packaged nucleic acid codes for four miRNA having the sequence of Seq ID No. 17, 18, 19, and 20.
[0062] In a further embodiment of the invention a viral vector is provided, wherein the nucleic acid has an even number of transgene expression cassettes and optionally the transgene expression cassettes comprising (or consisting of) a promotor, a transgene and a polyadenylation signal, wherein promotors or the polyadenylation signals are positioned opposed to each other.
[0063] The viral vector is a recombinant AAV vector in one embodiment of the invention and has either the AAV-2 serotype, AAV-5 serotype or the AAV-6.2 serotype in other embodiments of the invention.
[0064] In a different embodiment of the invention a viral vector is provided, wherein the capsid comprises a first protein that comprises the sequence of Seq ID No. 29 or 30 (see WO 2015/018860). [0065] i) In a further embodiment of the invention a viral vector is provided, wherein the capsid comprises a first protein that is 80% identical, more preferably 90%, most preferred 95% to a second protein having the sequence of Seq ID No. 82, whereas one or more gaps in the alignment between the first protein and the second are allowed [0066] ii) In a different embodiment of the invention a viral vector is provided, wherein the capsid comprises a first protein that is 80% identical, more preferably 90%, most preferred 95% identical to a second protein of Seq ID No. 82 whereas a gap in the alignment between the first protein and the second protein is counted as a mismatch. [0067] iii) In a different embodiment of the invention a viral vector is provided, wherein the capsid comprises a first protein that is 80% identical, more preferably 90%, most preferred 95% identical to a second protein of Seq ID No. 82, whereas no gaps in the alignment between the first protein and the second protein are allowed.
[0068] For all embodiments (i) to (iii): For the determination of the identity between a first protein and a reference protein, any amino acid that has no identical counterpart in the alignment between the two proteins counts as mismatch (including overhangs with no counterpart). For the determination of identity, the alignment is used which gives the highest identity score.
[0069] The packaged nucleic acid may be single or double stranded. An alternative especially for AAV vectors is to use self-complementary design, in which the vector genome is packaged as a double-stranded nucleic acid. Although the onset of expression is more rapid, the packaging capacity of the vector will be reduced to approximately 2.3 kb, see Naso et al. 2017, with references.
[0070] A further aspect of the invention is one of the described viral vectors for use in the treatment of a disease selected from the group consisting of PF-ILD, IPF, connective tissue disease (CTD)-associated ILD, rheumatoid arthritis ILD, chronic fibrosing hypersensitivity pneumonitis (HP), idiopathic non-specific interstitial pneumonia (iNSIP), unclassifiable idiopathic interstitial pneumonia (IIP), environmental/occupational lung disease, systemic sclerosis ILD and sarcoidosis, and fibrosarcoma.
[0071] Delivery Strategies for Recombinant AAV Therapeutics are also referred in e.g. Naso et al, 2017.
[0072] A double stranded plasmid vector comprising said AAV vector genome is a further embodiment of the invention.
[0073] A further embodiment of the invention relates to this miRNA inhibitor for use as a medicinal product.
[0074] A further embodiment of the invention is a miRNA mimetic for use in a method of prevention and/or treatment of a fibroproliferative disorder, wherein miRNA has a sequence selected from the group consisting of Seq ID No. 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 37, 38 and 39, preferably selected from the group consisting of Seq ID No. 15, 17 and 19, and most preferred has the sequence of Seq ID No. 15 or 19. In one embodiment, a miRNA mimetic is provided for use in a method of prevention and/or treatment of a fibroproliferative disorder, such as IPF or PF-ILD, wherein miRNA has the sequence of Seq ID No. 19. The prevention and/or treatment preferably further comprises the administration of a mimetic for a miRNA having the sequence of Seq ID No. 17 or of a mimetic for a miRNA having the sequence of Seq ID No. 18. Even more preferably, the prevention and/or treatment comprises the administration of a mimetic for a miRNA having the sequence of Seq ID No. 19, a mimetic for a miRNA having the sequence of Seq ID No. 17 and of mimetic for a miRNA having the sequence of Seq ID No. 18.
[0075] Likewise, in a further embodiment a miRNA mimetic is provided for use in a method of prevention and/or treatment of a fibroproliferative disorder, such as IPF or PF-ILD, wherein the miRNA has the Seq ID No. 15. The prevention and/or treatment preferably further comprises the administration of a mimetic for a miRNA having the sequence of Seq ID No. 17 or of a mimetic for a miRNA having the sequence of Seq ID No. 19. Even more preferably, [0076] the prevention and/or treatment comprises the administration of a mimetic for a miRNA having the sequence of Seq ID No. 15, a mimetic for a miRNA having the sequence of Seq ID No. 19 and of a mimetic for a miRNA having the sequence of Seq ID No. 18, or [0077] the prevention and/or treatment comprises the administration of a mimetic for a miRNA having the sequence of Seq ID No. 15, a mimetic for a miRNA having the sequence of Seq ID No. 17 and of a mimetic for a miRNA having the sequence of Seq ID No. 18, or [0078] the prevention and/or treatment comprises the administration of a mimetic for a miRNA having the sequence of Seq ID No. 15, a mimetic for a miRNA having the sequence of Seq ID No. 17 and of a mimetic for a miRNA having the sequence of Seq ID No. 19.
[0079] A further embodiment of the invention is (i) a miRNA mimetic of a miRNA having the sequence of Seq ID No. 15, or (ii) a miRNA mimetic of a miRNA having the sequence of Seq ID No. 17, or (iii) a miRNA mimetic of a miRNA having the sequence of Seq ID No. 18, or (iv) a miRNA mimetic of a miRNA having the sequence of Seq ID No. 19, for the treatment of a fibroproliferative disorder such as IPF or PF-IL, and a pharmaceutical composition comprising one or more of said miRNA mimetics (i) to (iv) and a pharmaceutical-acceptable carrier or diluent.
[0080] Further embodiments of the invention are miRNA mimetics of miRNA 212-5p (Seq ID No. 15), miRNA 181a-5p (Seq ID No. 17), miRNA 181b-5p (Seq ID No. 19), and miRNA 10a (Seq ID No. 18), respectively for use in the treatment of a fibroproliferative disorder, and wherein the miRNA mimetic is an oligomer of nucleotides that consists of the sequence selected form the group consisting of Seq ID No. 15, Seq ID No. 17, Seq ID No. 19, and Seq ID No. 18, respectively with the following proviso: [0081] the oligomer optionally comprises nucleotides with chemical modifications leading to non-naturally occurring nucleotides that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of the respective miRNA; [0082] the oligomer optionally comprises nucleotide analogues that show the basepairing behavior at the corresponding position (AU and GC) as determined by the sequence of the respective miRNA; [0083] the oligomer is optionally lipid conjugated to facilitate drug delivery.
[0084] Further embodiments of the invention are miRNA mimetics of miRNA 212-5p (Seq ID No. 15), miRNA 181a-5p (Seq ID No. 17), miRNA 181b-5p (Seq ID No. 19), and miRNA 10a (Seq ID No. 18), respectively for use in the treatment of a fibroproliferative disorder, and wherein the miRNA mimetic is an oligomer of nucleotides that consists of the sequence selected form the group consisting of Seq ID No. 15, Seq ID No. 17, Seq ID No. 19, and Seq ID No. 18, respectively with the following proviso: [0085] the oligomer optionally comprises nucleotides with chemical modifications leading to non-naturally occurring nucleotides that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of the respective miRNA; [0086] the oligomer is optionally lipid conjugated to facilitate drug delivery.
[0087] Further embodiment of the invention are miRNA mimetics of miRNA 212-5p (Seq ID No. 15), miRNA 181a-5p (Seq ID No. 17), miRNA 181b-5p (Seq ID No. 19), and miRNA 10a (Seq ID No. 18), respectively for use in the treatment of a fibroproliferative disorder, and wherein the miRNA mimetic is an oligomer of nucleotides that consists of the sequence selected form the group consisting of Seq ID No. 15, Seq ID No. 17, Seq ID No. 19, and Seq ID No. 18, respectively with the following proviso: [0088] the oligomer optionally comprises nucleotide analogues that show the basepairing behavior at the corresponding position (AU and GC) as determined by the sequence of the respective miRNA; [0089] the oligomer is optionally lipid conjugated to facilitate drug delivery.
[0090] In case, the miRNA mimetics are not delivered being packed in lipid based nano particles (LNPs), it is preferred that the oligomer mentioned in the proviso is lipid conjugated to facilitate drug delivery.
[0091] Further embodiments of the invention are miRNA mimetics of miRNA 212-5p (Seq ID No. 15), miRNA 181a-5p (Seq ID No. 17), miRNA 181b-5p (Seq ID No. 19), and miRNA 10a (Seq ID No. 18), respectively for use in the treatment of a fibroproliferative disorder, and wherein the miRNA mimetic is an oligomer of nucleotides that consists of the sequence selected form the group consisting of Seq ID No. 15, Seq ID No. 17, Seq ID No. 19, and Seq ID No. 18, respectively with the following proviso: [0092] the oligomer optionally comprises nucleotides with chemical modifications leading to non-naturally occurring nucleotides that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of the respective miRNA; [0093] the oligomer optionally comprises nucleotide analogues that show the basepairing behavior at the corresponding position (AU and GC) as determined by the sequence of the respective miRNA.
[0094] Further embodiments of the invention are miRNA mimetics of miRNA 212-5p (Seq ID No. 15), miRNA 181a-5p (Seq ID No. 17), miRNA 181b-5p (Seq ID No. 19), and miRNA 10a (Seq ID No. 18), respectively for use in the treatment of a fibroproliferative disorder, and wherein the miRNA mimetic is an oligomer of nucleotides that consists of the sequence selected form the group consisting of Seq ID No. 15, Seq ID No. 17, Seq ID No. 19, and Seq ID No. 18, respectively, with the following proviso: [0095] the oligomer optionally comprises nucleotides with chemical modifications leading to non-naturally occurring nucleotides that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of the respective miRNA.
[0096] Further embodiments of the invention are miRNA mimetics of miRNA 212-5p (Seq ID No. 15), miRNA 181a-5p (Seq ID No. 17), miRNA 181b-5p (Seq ID No. 19), and miRNA 10a (Seq ID No. 18), respectively for use in the treatment of a fibroproliferative disorder, and wherein the miRNA mimetic is an oligomer of nucleotides that consists of the sequence selected form the group consisting of Seq ID No. 15, Seq ID No. 17, Seq ID No. 19, and Seq ID No. 18, respectively.
[0097] These embodiments are preferred in case, the miRNA mimetics are delivered being packed in lipid based nano particles (LNPs). If LNP particles are used for delivery, the dose might be between 0.01 and 5 mg/kg of the mass of miRNA mimetics per kg of subject to be treated, preferably 0.03 and 3 mg/kg, more preferably 0.1 and 0.4 mg/kg, most preferably 0.3 mg/kg. The administration is of the LNP particles preferably systemic, more preferably intravenous.
[0098] The miRNA mimetic can be bound to one or more oligonucleotides that are fully or partially complimentary to the miRNA mimetic and that may or may not form with these oligonucleotides overhang with single stranded regions.
[0099] A further embodiment of the invention relates to a pharmaceutical composition as defined herein above wherein the composition is an inhalation composition.
[0100] A further embodiment of the invention relates to a pharmaceutical composition as defined herein above wherein the composition is intended for systemic, preferably intravenous administration.
[0101] A further embodiment of the invention is a method of treating or preventing of a fibroproliferative disorder, such as IPF or PF-ILD, in a subject in need thereof comprising administering to the subject a pharmaceutical composition as defined above.
[0102] For example, the use of a miRNA inhibitor or a miRNA mimetic can be effected by the aerosol route for inhibiting fibrogenesis in the pathological respiratory epithelium in subjects suffering from pulmonary fibrosis and thus restoring the integrity of the pathological tissue so as to restore full functionality.
[0103] The viral vector is preferably administered as in an amount corresponding to a dose of virus in the range of 1.0×10.sup.10 to 1.0×10.sup.14 vg/kg (virus genomes per kg body weight), although a range of 1.0×10.sup.11 to 1.0×10.sup.12 vg/kg is more preferred, and a range of 5.0×10.sup.11 to 5.0×10.sup.12 vg/kg is still more preferred, and a range of 1.0×10.sup.12 to 5.0×10.sup.11 is still more preferred. A virus dose of approximately 2.5×10.sup.12 vg/kg is most preferred. The amount of the viral vector to be administered, such as the AAV vector according to the invention, for example, can be adjusted according to the strength of the expression of one or more transgenes.
[0104] A further aspect of the invention is the use of viral vectors, miRNA inhibitors and miRNA mimetics according to the invention for combined therapy with either Nintedanib or Pirfenidone.
USED TERMS AND DEFINITIONS
[0105] An expression cassette comprises a transgene and usually a promotor and a polyadenylation signal. The promotor is operably linked to the transgene. A suitable promoter may be selectively or constitutively active in a lung cell, such as an epithelial alveolar cell. Specific non-limiting examples of suitable promoters include constitutively active promoters such as the cytomegalovirus immediate early gene promoter, the Rous sarcoma virus long terminal repeat promoter, the human elongation factor 1a promoter, and the human ubiquitin c promoter. Specific non-limiting examples of lung-specific promoters include the surfactant protein C gene promoter, the surfactant protein B gene promoter, and the Clara cell 10 kD (“CC 10”) promoter.
[0106] A transgene, depending on the embodiment of the invention, either codes for (i) one or more miRNA e.g. a miRNA having the sequence of Seq ID No. 15 or one or more miRNA that are downregulated in a Bleomycin-induced lung fibrosis model or in an AAV-TGFβ1-induced lung fibrosis model}, or (ii) for an RNA that inhibits the function of one or more miRNA that is upregulated in a Bleomycin-induced lung fibrosis model and in an AAV-TGFβ1-induced lung fibrosis model, or for both alternatives (i) and (ii). The transgene may also contain an open reading frame that encodes for a protein for transduction reporting (such as eGFP, see
[0107] An RNA that inhibits the function of one or more miRNA reduces or abolishes the function of its target miRNA by complementary binding. Two different vector design strategies can be applied, as described in
[0110] The term miRNA inhibitor according to the present invention refers to oligomers consisting of a contiguous sequence of 7 to at least 22 nucleotides in length.
[0111] The term nucleotide as used herein, refers to a glycoside comprising a sugar moiety (usually ribose or desoxyribose), a base moiety and a covalently linked group (linkage group), such as a phosphate or phosphorothioate internucleotide linkage group. It covers both naturally occurring nucleotides and non-naturally occurring nucleotides comprising modified sugar and/or base moieties, which are also referred to as nucleotide analogues herein. Non-naturally occurring nucleotides include nucleotides which have sugar moieties, such as bicyclic nucleotides or 2′ modified nucleotides or 2′ modified nucleotides such as 2′ substituted nucleotides. Nucleotides with chemical modifications leading to non-naturally occurring nucleotides comprise the following modifications:
[0112] (i) Nucleotides which have Non-Natural Sugar Moieties,
[0113] Examples are bicyclic nucleotides or 2′ modified nucleotides or 2′ modified nucleotides such as 2′ substituted nucleotides.
[0114] (ii) Nucleotides with Phosphorothioate (PS) and Phosphodithioate (PS2) Modifications
[0115] To improve serum stability and increase blood concentrations as well as improve nuclease resistance of the miRNAs, a sulfur in one or more nucleotides of the miRNA inhibitor or mimic could exchange an oxygen of the nucleotide phosphate group, which is defined as a phosphorothioate (PS). For some sequences, this could be combined or complemented by a second introduction of a sulfur group to an existing PS, which is defined as a Phosphodithioate PS2. PS2 modifications on distinct positions of the sense strand, like on nucleotide 19+20 or 3+12 (counting from the 5′ end), could further increase serum stability and therefore the pharmacokinetic characteristics of the miRNA inhibitor/miRNA mimetic (ACS Chem. Biol. 2012, 7, 1214-1220).
[0116] (iii) Nucleotides with Boranophosphat Modifications
[0117] For some miRNA oligonucleotides, it could be beneficial to exchange one oxygen of the ribose phosphate group against a BH3 group. Boranophosphat modifications on one or more nucleotides could increase serum stability, in case the seed region of miRNA oligonucleotides are not modified by other chemical modifications. Boranophosphat modifications could also increase serum stability of miRNA oligonucleotides (Nucleic Acids Research, Vol. 32 No. 20, 5991-6000).
[0118] (iv) Nucleotides with 2′O-Methyl Modification
[0119] Besides or in addition to phosphate modifications, methylation of the oxygen, bound to the carbon C2 in the ribose ring, could be further options for oligonucleotide modifications. 2′O-methyl ribose modification of the sense strand could increase thermal stability and the resistance to enzymatic digestions.
[0120] (v) Nucleotides with 2′OH with Fluorine Modification
[0121] It may could also beneficial to modify miRNA oligonucleotides with 2′ OH fluorine modification to enhance serum stability of the oligonucleotide and improve the binding affinity of the miRNA oligonucleotide to its target. 2′ OH fluorine modification, exchanges the hydroxyl group of the carbon C2 in the ribose ring against a fluorine atom. Fluorine modifications could be applied on both strands, sense and anti-sense.
[0122] “Nucleotide analogues” are variants of natural oligonucleotides by virtue of modifications in the sugar and/or base moieties. Preferably, without being limited by this explanation, the analogues will have a functional effect on the way in which the oligomer works to bind to its target; for example by producing increased binding affinity to the target and/or increased resistance to nucleases and/or increased ease of transport into the cell. Specific examples of nucleoside analogues are described by Freier and Altman (Nucl. Acid Res., 25: 4429-4443, 1997) and Uhlmann (Curr. Opinion in Drug Development, 3: 293-213, 2000). Incorporation of affinity-enhancing analogues in the oligomer, including Locked Nucleic Acid (LNA™), can allow the size of the specifically binding oligomer to be reduced and may also reduce the upper limit to the size of the oligomer before non-specific or aberrant binding takes place. The term “LNA™” refers to a bicyclic nucleoside analogue, known as “Locked Nucleic Acid” (Rajwanshi et al., Angew Chem. Int. Ed. Engl., 39(9): 1656-1659, 2000). It may refer to an LNA™ monomer, or, when used in the context of an “LNA™ oligonucleotide” to an oligonucleotide containing one or more such bicylic analogues.
[0123] Preferably, a miRNA inhibitor of the invention refers to antisense oligonucleotides with sequence complementary to Certain upregulated miRNA (miRNAs selected from the group consisting of the miRNAs of Seq ID Nos. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 34, 35 and 36.). These oligomers may comprise or consist of a contiguous nucleotide sequence of a total of 7 to at least 22 contiguous nucleotides in length, up to 70% nucleotide analogues (LNA™). The shortest oligomer (7 nucleotides) will likely correspond to an antisense oligonucleotide with perfect sequence complementarity matching to the first 7 nucleotides located at the 5′ end of mature to Certain up regulated miRNA, and comprising the 7 nucleotide sequence at position 2-8 from 5′ end called the “seed” sequence) involved in miRNA target specificity (Lewis et al., Cell. 2005 Jan. 14; 120(1):15-20).
[0124] A Certain upregulated miRNA Target Site Blocker refers to antisense oligonucleotides with sequence complementary to Certain upregulated miRNA binding site located on a specific mRNA. These oligomers may be designed according to the teaching of US 20090137504. These oligomers may comprise or consist of a contiguous nucleotide sequence of a total of 8 to 23 contiguous nucleotides in length. These sequences may span from 20 nucleotides in the 5′ or the 3′ direction from the sequence corresponding to the reverse complement of Certain upregulated miRNA “seed” sequence.
[0125] The term miRNA mimetic of the invention is an oligomer capable of specifically increasing the activity of Certain (mainly downregulated) miRNA wherein the term Certain (mainly downregulated) miRNA means a miRNA that has a sequence selected from the group consisting of Seq ID No. 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 37, 38 and 39, preferably of Seq ID No, 15, 17, 19, 18, and 20, most preferred 15, 17 and 19, even more preferred Seq ID No. 15. The term miRNA mimetic encompasses salts, including pharmaceutical acceptable salts. The miRNA mimetic of a miRNA elevates the concentration of functional equivalents of said miRNA in the cell thereby increasing the overall activity of said miRNA.
miRNA mimetics of miRNA 212-5p, miRNA 181a-5p, miRNA 181b-5p, and miRNA 10a, respectively are intended for use in the treatment of a fibroproliferative disorder, and wherein the miRNA mimetic is an oligomer of nucleotides that consists of the sequence of Seq ID No. 15, of Seq ID No. 17, Seq ID No. 18, and Seq ID No. 19, respectively with proviso (a), (b) and (c), (a) and (c), (a) and (d), or (c) and (d), [0126] (a) the oligomer optionally comprises nucleotides with chemical modifications leading to non-naturally occurring nucleotides that show the basepairing behavior at the corresponding position (AU and GC) as determined by the sequence of the respective miRNA, preferably chemical modifications as set forth under (i) to (v) herein above; [0127] (b) the oligomer optionally comprises nucleotide analogues that show the base-pairing behavior at the corresponding position (AU and GC) as determined by the sequence of the respective miRNA; preferably the nucleotide analogues described by Freier and Altman (Nucl. Acid Res., 25: 4429-4443, 1997) and Uhlmann (Curr. Opinion in Drug Development, 3: 293-213, 2000) or bicyclic analogues described herein above; [0128] (c) the oligomer is optionally lipid conjugated to facilitate drug delivery.
[0129] Lipid conjugated oligomers are well known in the art, see Osborne et al. NUCLEIC ACID THERAPEUTICS Volume 28, Number 3, 2018 with references.
[0130] Oligomer consisting of the sequence of the corresponding miRNA means that the oligomer comprises the sequence of the corresponding miRNA and has as many covalently attached nucleotide building blocks (optionally with chemical modifications) or nucleotide analogues as said miRNA.
[0131] A miRNA mimetic can be bound to one or more oligonucleotides that are fully or partially complimentary to the miRNA mimetic and that may or may not form with these oligonucleotides overhangs with single stranded regions.
[0132] It is preferred that the miRNA mimetic has at least 80%, more preferably at least 90%, even more preferably more than 95% of the biologic effect of the same amount of the natural miRNA as determined by one or more experiments as described under Example 1.11.
miRNA mimetics or miRNA inhibitors can also be delivered as naturally- and non-naturally occurring nucleotides, packed in lipid based nano particles (LNPs). The application comprises the delivery with three classes of LNPs: (i) cationic LNPs, (ii) neutral LNPs and (iii) ionizable LNPs. Whereas cationic LNPs are mainly characterized by a high content of 1,2-dioleyl-3-trimethylammonium propane, 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane, dioctadecylamidoglycylspermine, 3-(N—(N0,N0-dimethylaminoethane)carbamoyl) cholesterol and pegylated modifications. Neutral lipids are mainly characterized by phosphatidylcholine, cholesterol and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamines. Ionizable LNPs are mainly characterized by a major content of 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane and 1,2-dioleyl-3-trimethylammonium propane (see, e.g. Sun, S, Molecules 2017, 22, 1724).
[0133] If LNP particles are used for delivery, the dose might be between 0.01 and 5 mg/kg of the mass of miRNA mimetics per kg of subject to be treated, preferably 0.03 and 3 mg/kg, more preferably 0.1 and 0.4 mg/kg, most preferably 0.3 mg/kg. The administration of the LNP particles is preferably systemic, more preferably intravenous.
EXAMPLES
[0134] 1. Materials and Methods
[0135] 1.1 AAV Production, Purification and Quantification
[0136] HEK-293h cells were cultivated in DMEM+GlutaMAX media supplemented with 10% fetal calf serum. Three days before transfection, the cells were seeded in 15 cm tissue culture plates to reach 70-80% confluency on the day of transfection. For transfection, 0.5 μg total DNA per cm.sup.2 of culture area were mixed with 1/10 culture volume of 300 mM CaCl.sub.2 as well as all plasmids required for AAV production in an equimolar ratio. The plasmid constructs were as follows: One plasmid encoding the AAV6.2 cap gene (Strobel B et al., 2015); a plasmid harboring an AAV2 ITR-flanked expression cassette containing a CMV promoter driving expression of a codon-usage optimized murine Tgfb1 gene and a hGh poly(A) signal, whereby the Tgfb1 sequence contains C223S and C225S mutations that increase the fraction of active protein (Brunner A M et al., 1989); a pHelper plasmid (AAV Helper-free system, Agilent). For GFP and stuffer control vector production, the Tgfb1 plasmid was exchanged for an eGFP plasmid, harboring an AAV2 ITR-flanked CMV-eGFP-SV40 pA cassette and AAV-stuffer control plasmid, containing an AAV2 ITR-flanked non-coding region derived from the 3′-UTR of the E6-AP ubiquitin-protein ligase UBE3A followed by a SV40 poly(A) signal, respectively.
[0137] The plasmid CaCl.sub.2 mix was then added dropwise to an equal volume of 2×HBS buffer (50 mM HEPES, 280 mM NaCl, 1.5 mM Na.sub.2HPO.sub.4), incubated for 2 min at room temperature and added to the cells. After 5-6 h of incubation, the culture medium was replaced by fresh medium. The transfected cells were grown at 37° C. for a total of 72 h. Cells were detached by addition of EDTA to a final concentration of 6.25 mM and pelleted by centrifugation at room temperature and 1000×g for 10 min. The cells were then resuspended in “lysis buffer” (50 mM Tris, 150 mM NaCl, 2 mM MgCl.sub.2, pH 8.5). AAV vectors were purified essentially as previously described (Strobel B et al., 2015): For iodixanol gradient based purification, cells harvested from up to 40 plates were dissolved in 8 mL lysis buffer. Cells were then lysed by three freeze/thaw cycles using liquid nitrogen and a 37° C. water bath. For each initially transfected plate, 100 units Benzonase nuclease (Merck) were added to the mix and incubated for 1 h at 37° C. After pelleting cell debris for 15 min at 2500×g, the supernatant was transferred to a 39 mL Beckman Coulter Quick-Seal tube and an iodixanol (OptiPrep, Sigma Aldrich) step gradient was prepared by layering 8 mL of 15%, 6 mL of 25%, 8 mL of 40% and 5 mL of 58% iodixanol solution diluted in PBS-MK (lx PBS, 1 mM MgCl.sub.2, 2.5 mM KCl) below the cell lysate. NaCl had previously been added to the 15% phase at 1 M final concentration. 1.5 μL of 0.5% phenol red had been added per mL to the 15% and 25% iodixanol solutions and 0.5 μL had been added to the 58% phase to facilitate easier distinguishing of the phase boundaries within the gradient. After centrifugation in a 70Ti rotor for 2 h at 63000 rpm and 18° C., the tube was punctured at the bottom. The first five milliliters (corresponding to the 58% phase) were then discarded, and the following 3.5 mL, containing AAV vector particles, were collected. PBS was added to the AAV fraction to reach a total volume of 15 mL and ultrafiltered/concentrated using Merck Millipore Amicon Ultra-15 centrifugal filter units with a MWCO of 100 kDa. After concentration to ˜1 mL, the retentate was filled up to 15 mL and concentrated again. This process was repeated three times in total. Glycerol was added to the preparation at a final concentration of 10%. After sterile filtration using the Merck Millipore Ultrafree-CL filter tubes, the AAV product was aliquoted and stored at −80° C.
[0138] 1.2 Mouse Models and Functional Readouts
[0139] For reporter gene studies, 9-12 week old female C57Bl/6 or Balb/c mice, purchased from Charles River Laboratories, either received 2.9×10.sup.10 vector genomes (vg) of AAV5-CMV-fLuc or 3×10.sup.11 vg of AAV6.2-CMV-GFP, respectively, by intratracheal administration under light anesthesia (3-4% isoflurane). Alternatively, C57Bl/6 mice received 3×10.sup.11 vg of AAV2-L1-CMV-GFP by intravenous (i.v.) administration. Two to three weeks after AAV administration (see figure descriptions), reporter readouts were performed. For luciferase imaging, mice received 30 mg/kg luciferin as a substrate via intraperitoneal administration prior to image acquisition. In the case of GFP reporters, either histological fresh-frozen lung sections were prepared and analyzed for direct GFP fluorescence by fluorescence microscopy or formalin-fixed paraffin embedded slices were prepared for GFP IHC analysis (see detailed description further below).
[0140] For the fibrosis models, male 9-12 week old C57Bl/6 mice purchased from Charles River Laboratories received intratracheal administration of either 2.5×10.sup.11 (vg) of AAV-TGFβ1 or AAV-stuffer, 1 mg/kg Bleomycin or physiological NaCl solution in a volume of 50 μL, which was carried out under light anesthesia. Fibrosis was assessed at day 3, 7, 14, 21 and 28 after AAV/Bleomycin administration. Briefly, to assess lung function, mice were anesthetized by intraperitoneal (i.p.) administration of pentobarbital/xylazine hydrochloride, cannulated intratracheally and treated with pancuronium bromide by intravenous (i.v.) administration. Lung function measurement (i.e. lung compliance, forced vital capacity (FVC)) was then conducted using the Scireq flexiVent FX system. Mice were then euthanized by a pentobarbital overdose, the lung was dissected and weighed prior to flushing with 2×700 μL PBS to obtain BAL fluid for differential BAL immune cell and protein analyses (data not shown). The left lung of each mouse was processed for histological assessment by a histopathologist, whereas the right lung was used for total RNA extraction, as detailed below.
[0141] 1.3 Histology
[0142] For the preparation of histological lung samples, the left lung lobe was mounted to a separation funnel filled with 4% paraformaldehyde (PFA) and inflated under 20 cm water pressure for 20 minutes. The filled lobe was then sealed by ligature of the trachea and immersed in 4% PFA for at least 24 h. Subsequently, PFA-fixed lungs were embedded in paraffin. Using a microtome, 3 μm lung sections were prepared, dried, deparaffinized using xylene and rehydrated in a descending ethanol series (100-70%). Masson's trichrome staining was performed using the Varistain Gemini ES Automated Slide Stainer according to established protocols. For GFP-IHC, enzymatic antigen retrieval was performed and antibodies were diluted at indicated ratios in Bond primary antibody diluent (Leica Biosystems). Slides were stained with the 1:1000 diluted polyclonal Abcam rabbit antis GFP antibody ab290 and appropriate isotype control antibodies, respectively. Slides that had only received antigen retrieval served as an additional negative control. Finally, sections were mounted with Merck Millipore Aquatex medium.
[0143] 1.4 RNA Preparation
[0144] For total lung RNA preparation, the right lung was flash frozen in liquid nitrogen immediately after dissection. Frozen lungs were homogenized in 2 mL precooled Qiagen RLT buffer+1% β-mercaptoethanol using the Peqlab Precellys 24 Dual Homogenizer and 7 mL-ceramic bead tubes. 150 μL homogenate were then mixed with 550 μL QIAzol Lysis Reagent (Qiagen). After addition of 140 μL chloroform (Sigma-Aldrich), the mixture was shaken vigorously for 15 sec and centrifuged for 5 min at 12,000×g and 4° C. 350 μL of the upper aqueous RNA-containing phase were then further purified using the Qiagen miRNeasy 96 Kit according to the manufacturer's instructions. After purification, RNA concentration was determined using a Synergy HT multimode microplate reader and the Take3 module (BioTek Instruments). RNA quality was assessed using the Agilent 2100 Bioanalyzer.
[0145] 1.5 RNA Sequencing
[0146] cDNA libraries were prepared using the Illumina TruSeq RNA Sample Preparation Kit. Briefly, 200 ng of total RNA were subjected to polyA enrichment using oligo-dT-attached magnetic beads. PolyA-containing mRNAs were then fragmented into pieces of approximately 150-160 bp. Following reverse transcription with random primers, the second cDNA strand was synthesized by DNA polymerase I. After an end repair process and the addition of a single adenine base, phospho-thymidine-coupled indexing adapters were coupled to each cDNA, which facilitate sample binding to the sequencing flow cell and further allows for sample identification after multiplexed sequencing. Following purification and PCR enrichment of the cDNAs, the library was diluted to 2 nM and clustered on the flow cell at 9.6 pM, using the Illumina TruSeq SR Cluster Kit v3-cBot-HS and the cBot instrument. Sequencing of 52 bp single reads and seven bases index reads was performed on an Illumina HiSeq 2000 using the Illumina TruSeq SBS Kit v3-HS. Approximately 20 million reads were sequenced per sample.
[0147] For miRNA, the Illumina TruSeq Small RNA Library Preparation Kit was used to prepare the cDNA library: As a result of miRNA processing by Dicer, miRNAs contain a free 5′-s phosphate and 3′-hydroxal group, which were used to ligate specific adapters prior to first and second strand cDNA synthesis. By PCR, the cDNAs were then amplified and indexed. Using magnetic Agencourt AMPure XP bead-purification (Beckman Coulter), small RNAs were enriched. The samples were finally clustered at 9.6 pM and sequenced, while being spiked into mRNA sequencing samples.
[0148] 1.6 Computational Processing and Data Analysis (mRNA-Seq and miRNA-Seq Data Processing)
[0149] mRNA-Seq reads were mapped to the mouse reference genome GRCm38.p6 and Ensembl mouse gene annotation version 86 (http://oct2016.archive.ensembl.org) using the STAR aligner v. 2.5.2a (Dobin et al., 2013). Raw sequence read quality was assessed using FastQC v0.11.2, alignment quality metrics were checked using RNASeQC v1.18 (De Luca D. S. et al., 2012). Subsequently, duplicated reads in the RNA-Seq samples were marked using bamUtil v1.0.11 and subsequently duplication rates assessed using the dupRadar Bioconductor package v1.4 (Sayols-Puig, S. et al., 2016). Read count vectors were generated using the feature counts package (Liao Y. et al., 2014). After aggregation to count matrices data were normalized using trimmed mean of M-values (TMM) and voom transformed to generate log(counts per million) (CPM) (Ritchie M. E., 2015). Descriptive analyses such as PCA and hierarchical clustering were carried out to identify possible outliers. Differential expression between treatment and respective controls at each time points were carried out using limma with a significance threshold of p adj≤0.05 and abs(log.sub.2FC)≥0.5. Two samples out of 124 in total were excluded for not passing QC criteria. miRNA-Seq reads were trimmed using the Kraken package v.12-274 (Davis M. P. A. et al., 2013) and subsequently mapped to the mouse reference genome GRCm38.p6 and the miRbase v. 21 mouse miRNA (http://mirbase.org) using the STAR aligner v. 2.5.2a. Raw sequence read quality was assessed using FastQC v0.11.2 (http://www.bioinformatics.babraham.uk/project/fastqc/), trimming size and biotype distribution assessed using inhouse scripts. After aggregation to count matrices data were normalized using trimmed mean of M-values (TMM) and voom transformed to generate log(counts per million) (CPM). Descriptive analyses such as PCA and hierarchical clustering were carried out to identify possible outliers. Differential expression between treatment and respective controls at each time points were carried out using limma with a significance threshold of p adj≤0.05 and abs(log.sub.2FC)≥0.5.
[0150] 1.7 Integrated Data Analysis (Correlation of Functional Parameters and Expression)
[0151] Spearman's rho between the measured values for lung function and lung weight vs. the voom transformed log(CPM) of each miRNA and mRNA across all samples of both models and all time points.
[0152] 1.8 Determination of Putative miRNA-mRNA Target Pairs
[0153] To determine mRNA targets of miRNAs, a stepwise approach has been carried out. First lowly expressed miRNAs and mRNAs were removed from the expression matrix. Subsequently the Spearman's rho was calculated between voom transformed log(CPM) of each miRNA vs. each mRNA across all samples of both models and all time points, using the corAndPvalue function from WGCNA v. 1.60 (Langfelder & Horvath, 2008) The set of correlation based putative miRNA-mRNA pairs is defined as all combinations with a correlation ≤−0.6. To add sequence based prediction of putative miRNA-mRNA pairs, all combinations with predictions in at least two out of five most cited miRNA target prediction algorithms (DIANA, Miranda, PicTar, TargetScan, and miRDB) available in the Bioconductor package miRNAtap v. 1.10.0/miRNAtap.db v. 0.99.10 (Pajak & Simpson, 2016) were taken as sequence based pairs. The final set of miRNA-mRNA pairs is the intersection of anticorrelation based and sequence based interaction pairs, reducing the number of predictions significantly to a high-confidence subset.
[0154] 1.9 Mouse-Human Conservation of miRNA Sequences
[0155] For all murine and human miRNAs from miRBase 21 seed regions (position 2 to 7) were extracted. For all combinations of murine and human miRNAs global alignments between the seed regions and the mature were calculated using the pairwise Alignment function from the Bioconductor Biostrings package (v2.46.0). We applied the Needleman-Wunsch algorithm using an RNA substitution matrix with a match score of 1 and a mismatch score of 0. We assigned two categories to the miRNA candidates—“conserved” for miRNAs with an alignment score of 6 in the seed region for mouse-human pairs of miRNAs with the same name, “non-conserved” for miRNAs with an alignment score <6 in the seed region for mouse-human pairs of miRNAs with the same name. In addition, miRNAs with an alignment score for the alignment of the respective mature sequences above 20 is assigned to the category “mature high similarity”.
[0156] 1.10 Characterization of miRNAs Based on Gene Set Enrichment of Target Gene Sets
[0157] The functional characterization of miRNAs is carried out using the enrichment function on the predicted mRNA targets from the MetabaseR package v. 4.2.3 and the gene set categories “pathway maps”, “pathway map folders”, “process networks”, “metabolic networks”, “toxicity networks”, “disease genes”, “toxic pathologies”, “GO processes”, “GO molecular functions”, “GO localizations”. The enrichment function performs a hypergeometric test on the overlap of the query gene set and the reference sets from Metabase. The data retrieval for the characterization of miRNA target sets was carried out on Metabase on Mar. 12, 2018.
[0158] 1.11 Functional Characterization of miRNAs in Cellular Assays
[0159] miRNAs were characterized regarding their impact on the cellular production of the proinflammatory cytokine IL-6 and the pro-fibrotic processes fibroblast proliferation, fibroblasts-to-myofibroblasts transition (FMT), collagen expression and epithelial-tomesenchymal transition (EMT). Unless stated differently in the Figures or Figure Legends, A549, NHBEC (normal human bronchial epithelial cells) or NHLF (normal human lung fibroblast) cells were transiently transfected with miRNA mimetic at a concentration of 2 nM for single miRNAs or 2+2 nM for miRNA combinations. For the latter condition, 4 nM miRNA controls were used. Twenty-four hours later, TGFβ1 was added to the cells at 5 ng/mL concentration and cells were incubated for 24 h (IL-6, proliferation assays and collagen mRNA expression) or 72 h (collagen protein expression, FMT and EMT assays). For the measurement of gene expression, total RNA was extracted from the cells using the Qiagen RNeasy Plus 96 Kit and reversely transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). IL-6 gene expression was detected by a Taqman qPCR assay (Hs00174131_m1). IL-6 protein was quantified in the cell supernatant using the MSD V-PLEX Proinflammatory Panel 1 Human kit. To assess cell proliferation, cells were grown in presence of TGFβ1 for 24 h and assayed using a WST-1 proliferation assay kit (Sigma/Roche). FMT was assessed by growing NHLF cells as described above, followed by fixation and fluorescent immuno-staining of Collagen 1a1. Images were taken using an IN Cell Analyzer 2000 high-content cellular imaging system and collagen was quantified and normalized to cell number (identified by DAPI-stained nuclei). EMT assessment relied on the same principle, however, using NHBEC cells and immuno-staining of E-cadherin.
[0160] Immunoblots were done according to standard methods using novex gels and according buffers from ThermoFisher and electrophoresis devices from BioRad. All primary antibodies were ordered from Cell Signaling Technology.
[0161] All cellular assays were performed with either primary lung epithelial cells or primary lung fibroblasts derived from human patient material. Thus, by the heterogeneity of each individual patient donor, e.g. its genetics, environment, cause of disease/surgery, cell isolation, etc., the derived cell also underlie a certain heterogeneity. Thus, it can happen that there are slight assay-to assay variabilities, which explain a certain standard deviation and different assay windows between equal assay formats. Nevertheless, we used primary cells because they are primary patient material and therefore more relevant for the human disease.
[0162] 2. Results
[0163] AAV-TGFβ1 and Bleomycin administration induce fibrosing lung pathology in mice. Following administration of either AAV-TGFβ1, Bleomycin or appropriate controls (NaCl, AAV-stuffer), longitudinal fibrosis development was measured over a time period of 4 weeks, as illustrated in
[0164] Transcriptional characterization of chronological disease manifestation. In order to dissect the molecular pathways and overall changes in gene expression underlying disease development and progression in the two models of pulmonary fibrosis, RNA was prepared from lung homogenates of each animal and applied to next generation sequencing (NGS) analysis. The number of differentially expressed mRNAs and miRNAs is depicted in
[0165] Identification of miRNAs associated with clinically relevant disease phenotypes. To identify candidate miRNAs likely to be directly associated with disease development, a staggered selection strategy using multiple filter criteria was set up (
[0166] miRNA target prediction (
[0167] Functionality of miRNAs in mir-E backbone (
[0168] miRNA expression in primary human lung fibroblasts (
[0169] Functional characterization of miRNAs in cellular assays (
[0170] Because we also wanted to assess other miRNA combinations, beyond miR-10a+ miR181a-5p+miR-181b-5p, we repeated the former EMT assay, depicted in
[0171] In addition to airway epithelial cells, fibroblasts are considered as a highly relevant cell type for fibrotic processes. By acting as the main source for excessive production of collagen and other extracellular matrix components, fibroblasts directly contribute to lung stiffening associated with impaired lung function and finally loss of structural lung integrity. To further investigate the function of candidate miRNAs during fibroblast activation, transient transfection experiments were carried out in primary human lung fibroblasts under unstimulated and TGFβ-stimulated (pro-fibrotic) conditions. As functional readouts IL6 expression, collagen expression and fibroblast proliferation were assessed in absence or presence of miRNAs. As shown in
[0172]
[0173] In summary, the functional characterization in human airway epithelial cells and human lung fibroblasts demonstrates anti-inflammatory, anti-proliferative and anti-fibrotic effects for selected miRNA candidates. The most pronounced effects across all assay formats were observed for miR-181a, mir-181b and mir-212-5p, whereas mir-10a and mir-212-3p showed similar profiles although at weaker efficiency compared to the aforementioned miRNAs. In the FMT assay we observed positive effects by miR-10a, miR-181a, miR181b and miR-212-5p, whereas a triple combination of mir-10a, mir-181a and mir-181b showed an improved inhibitory effects in the FMT assay, indicating an additive or synergistic effect for this combination. Overall we observed a very potent anti-fibrotic effect of miR-181a-5p on lung epithelial cells and a very potent anti-fibrotic effect of miR-212-5p on fibroblasts, which suggests that the combination of these two miRNAs are very potent anti-fibrotic combination affecting the two most important cell types in pulmonary fibrosis. Therefore, combinations of miRNA candidates, and especially mimetics of miR-181a-5p and miR-212-5p or its respective mimetics, provide a preferred option for the development of therapeutic approaches with superior efficiency profiles compared to single miRNAs.
[0174] Therapeutic applications of miRNAs. To translate the discovery of novel lung-fibrosis associated miRNAs into therapeutic applications, approaches based on vector-mediated expression offer an attractive opportunity for chronic diseases like pulmonary fibrosis by enabling long-lasting expression of miRNAs or miRNA-targeting sequences. As illustrated in
[0175] For the delivery of the aforementioned expression constructs to the lung non-viral as well as viral gene therapy vectors can be applied. However, compared to currently available non-viral delivery systems like e.g. liposomes, viral vectors demonstrate superior properties with regard to efficacy and tissue/cell-type selectivity, as demonstrated in various publications over the past years. Moreover, viral vectors offer great potential for engineering approaches to further improve potency, selectivity and safety properties. In recent years, viral vectors based on Adeno-associated virus (AAV) have emerged as one of the most favorable vector systems for in vivo gene therapy based on their excellent pre-clinical and clinical safety profile combined with highly efficient and stable gene delivery to various target organs and cell-types including fully differentiated and non-dividing cells. Since the discovery of the prototypic AAV serotype AAV2 in 1965 (Atchison et al.), various additional serotypes have been isolated from humans, non-human primates and from phylogenetically distinct species such as pigs, birds and others. To date more than 100 natural AAV isolates have been described, which interestingly differ with regard to tissue tropism. By applying capsid engineering approaches the repertoire of available AAV vectors for gene therapy approaches has been further expanded in recent years. Based on a landmark paper by Limberis et al. (2009), in which a systematic comparison of 27 AAV capsid variants and natural serotypes regarding lung transduction is described, AAV5, AAV6 and AAV6.2 were identified as highly suitable capsids for lung delivery following local routes of administration (e.g. intransal or intratracheal instillation). In addition, an engineered AAV capsid variant based on AAV2 (AAV2-L1) has been described recently as a novel vector enabling specific gene delivery to the lung after systemic vector administration (Körbelin et al., 2016). As described in
LIST OF REFERENCES
[0176] Atchison R W, Casto B C, Hammon W M; Adenovirus-associated defective virus particles; Science. 1965 Aug. 13; 149(3685):754-6 [0177] Brunner A M, Marquardt H, Malacko A R, Lioubin M N, Purchio A F (1989) Site-directed mutagenesis of cysteine residues in the pro region of the transforming growth factor beta 1 precursor. Expression and characterization of mutant proteins; J Biol Chem 264(23): 13660-13664 [0178] Davis M P, van Dongen S, Abreu-Goodger C, Bartonicek N, Enright AJ; Kraken: a set of tools for quality control and analysis of high-throughput sequence data; Methods, 63 (1), (2013), pp. 41-49 [0179] DeLuca D S, Levin J Z, Sivachenko A, Fennell T, Nazaire M D, Williams C, Reich M, Winckler W, Getz G; RNA-SeQC: RNA-seq metrics for quality control and process optimization. Bioinformatics. 2012 Jun. 1; 28(11):1530-2 [0180] Dobin A, Davis C A, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, Gingeras T R; STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013 Jan. 1; 29(1):15-21 [0181] Fellmann C, Hoffmann T, Sridhar V, Hopfgartner B, Muhar M, Roth M, Lai D Y, Barbosa I A, Kwon J S, Guan Y, Sinha N, Zuber J; An Optimized microRNA Backbone for Effective Single-Copy RNAi; Cell Rep. 2013 Dec. 26; 5(6):1704-13 [0182] Scott M. Hammond; An overview of microRNAs; Adv Drug Deliv Rev. 2015 Jun. 29; 87: 3-14 [0183] Hopkins R B, Burke N, Fell C, Dion G, Kolb M; Epidemiology and survival of idiopathic pulmonary fibrosis from national data in Canada; Eur. Respir. J., 48 (1) (2016), pp. 187-195 [0184] Körbelin J, Sieber T, Michelfelder S, Lunding L, Spies E, Hunger A, Alawi M, Rapti K, Indenbirken D, Müller O J, Pasqualini R, Arap W, Kleinschmidt J A, Trepel M; Pulmonary Targeting of Adeno-associated Viral Vectors by Next-generation Sequencingguided Screening of Random Capsid Displayed Peptide Libraries; Mol Ther. 2016 June; 24(6):1050-1061 [0185] Langfelder P, Horvath S; WGCNA: an R package for weighted correlation network analysis; BMC Bioinformatics. 2008 Dec. 29; 9:559 [0186] Ley B, Collard H R (2013); Epidemiology of idiopathic pulmonary fibrosis; Clin. Epidemiol., 5:483-492 [0187] Liao Y, Smyth G K, Shi W; featureCounts: an efficient general purpose program for assigning sequence reads to genomic features; Bioinformatics 30, 923-930 (2014) [0188] Limberis M P, Vandenberghe L H, Zhang L, Pickles R J, Wilson J M; Transduction efficiencies of novel AAV vectors in mouse airway epithelium in vivo and human ciliated airway epithelium in vitro; Mol Ther. 2009 February; 17(2):294-301 [0189] Mathai S C, Danoff S K; Management of interstitial lung disease associated with connective tissue disease; BMJ. 2016 Feb. 24; 352 [0190] Pajak M and Simpson T I (2016); miRNAtap: miRNAtap: microRNA Targets—Aggregated Predictions. R package version 1.10.0. [0191] Raghu G, Collard H R, Egan J J, et al.; ATS/ERS/JRS/ALAT Committee on Idiopathic Pulmonary Fibrosis An official ATS/ERS/JRS/ALAT statement: idiopathic pulmonary fibrosis: evidence-based guidelines for diagnosis and management; Am J Respir Crit Care Med. 2011; 183(6):788-824 [0192] Ritchie M E, Phipson B, Wu D, Hu Y, Law C W, Shi W, Smyth G K; limma powers differential expression analyses for RNA-sequencing and microarray studies; Nucleic Acids Res. 2015 Apr. 20; 43(7) [0193] Sayols S, Scherzinger D, Klein H; dupRadar: a Bioconductor package for the assessment of PCR artifacts in RNA-Seq data; BMC Bioinformatics 17, 428 (2016) [0194] Spagnalo P, Rossi G, Trisolini R, Sverzellati N, Baughman R P, Wells A U. Pulmonary sarcoidosis. Lancet Respir Med. 2018 May; 6(5):389-402. [0195] Strobel B, Duechs M J, Schmid R, Stierstorfer B E, Bucher H, Quast K, Stiller D, Hildebrandt T, Mennerich D, Gantner F, Erb K J, Kreuz S; Modeling Pulmonary Disease Pathways Using Recombinant Adeno-Associated Virus 6.2; Am J Respir Cell Mol Biol. 2015 September; 53(3):291-302. [0196] Strobel B, Miller F D, Rist W, Lamla T. Comparative Analysis of Cesium Chloride- and Iodixanol-Based Purification of Recombinant Adeno-Associated Viral Vectors for Preclinical Applications; Hum Gene Ther Methods. 2015 August; 26(4):147-57 [0197] Naso, W F, Tomkowicz, B, Perry W L, Strohl, W Adeno-Associated Virus (AAV) as a Vector for Gene Therapy; BioDrugs (2017) 31:317-334 [0198] Wu Z, Asokan A, Grieger J C, Govindasamy L, Agbandje-McKenna M, Samulski RJ Single amino acid changes can influence titer, heparinbinding, and tissue tropism in different adeno-associated virus serotypes; J Virol 2006; 80:11393-11397 [0199] Strobel, B. Modeling pulmonary fibrosis by AAV-mediated TGFβ1 Expression: a proof of concept study for AAV-based disease modeling and riboswitch-controlled vector production; Konstanz, Univ., Diss., 2016, 2018, http://kops.unikonstanz.de/handle/123456789/33826 [0200] Xianbin, Y., Gene silencing activity of siRNA molecules containing phosphorodithioate substitutions ACS Chem. Biol. 2012, 7, 1214-1220 [0201] Hall, A., RNA interference using boranophosphate siRNAs: structure-activity relationships, Nucleic Acids Research, 2004, Vol. 32, No. 20 5991-6000 [0202] Freier, S. The ups and downs of nucleic acid duplex stability: structure-stability studies on chemically-modified DNA:RNA duplexes, Nucleic Acids Research (volume 25 issue 22 pages 4429-4443 [0203] Uhlmann, Recent advances in the medicinal chemistry of antisense oligonucleotides, Curr Opinion in Drug Development, vol. 3, no. 2, 2000, pages 203-213 [0204] Rajwanshi. V, The eight stereoisomers of LNA (locked nucleic acid): a remarkable family of strong RNA binding molecules, Angewandte Chemie, International Edition Volume 39, Issue 9 Pages 1656-1659 Journal 2000 [0205] Osborn, M., Improving siRNA Delivery In Vivo Through Lipid Conjugation, Nucleic Acid Therapeutics, Volume 28, Number 3, 2018 [0206] Sun, S Enhancing the Therapeutic Delivery of Oligonucleotides by Chemical Modification and Nanoparticle Encapsulation, Molecules 2017, 22, 1724; doi:10.3390/molecules22101724 [0207] Beckett. T Inhalation of Nebulized Perfluorochemical Enhances Recombinant Adenovirus and Adeno-Associated Virus-Mediated Gene Expression in Lung Epithelium, Human Gene Therapy Methods 23:98-110 (2012), DOI:10.1089/hgtb.2012.014
TABLE-US-00001 TABLE 1 Sequence Seq. ID 40 to 81 In case of divergence with the sequence listing, the table prevails. >Seq_40_mir-10a-5p 23 nt, miR-E backbone, Passenger position tcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgtaccctgtagatccgaatttgtgtagtga agccacagatgtacacaaattcggatctacagggtctgcctactgcctcggacttcaaggggctagaattcga >Seq_41_mir-10a-5p 23 nt, miR-E backbone, Guide position tcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgaacaaattcggatctacagggtatagt gaagccacagatgtataccctgtagatccgaatttgtgtgcctactgcctcggacttcaaggggctagaattcga >Seq_42_mir-10a-5p 22 nt, miR-E backbone, Passenger position tcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgtaccctgtagatccgaatttgttagtgaa gccacagatgtaacaaattcggatctacagggtctgcctactgcctcggacttcaaggggctagaattcga >Seq 43 mir-10a-5p 22 nt, miR-E backbone, Guide position tcgacttataacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgccaaattcggatctacagggtatagtg aagccacagatgtataccctgtagatccgaatttgttgcctactgcctcggacttcaaggggctagaattcga >Seq 44 mir-10a-5p, natural pre-miRNA in miR-E backbone, Human (hsa-mir-10a MI0000266) tcgacttcttaacccaacagaaggctcgagaaggtatattgctgttggatctgtctgtcttctgtatataccctgtagatccgaattt gtgtaaggaattttgtggtcacaaattcgtatctaggggaatatgtagttgacataaacactccgctctctcggacttcaaggggc tagaattcga >Seq 45 mir-10a-5p, natural pre-miRNA in miR-E backbone, Mouse (mmu-mir-10a MI0000685) tcgacttcttaacccaacagaaggctcgagaaggtatattgctgttggacctgtctgtcttctgtatataccctgtagatccgaattt gtgtaaggaattttgtggtcacaaattcgtatctaggggaatatgtagttgacataaacactccgctcactcggacttcaaggggc tagaattcga >Seq_46_mir-181a-5p 23 nt, miR-E backbone, Passenger position tcgacttataacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgaacattcaacgctgtcggtgagttagtg aagccacagatgtaactcaccgacagcgttgaatgtgtgcctactgcctcggacttcaaggggctagaattcga >Seq_47_mir-181a-5p 23 nt, miR-E backbone, Guide position tcgacttataacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgcctcaccgacagcgttgaatgtttagtg aagccacagatgtaaacattcaacgctgtcggtgagttgcctactgcctcggacttcaaggggctagaattcga >Seq_48_mir-181a-5p 22 nt, miR-E backbone, Passenger position tcgacttataacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgaacattcaacgctgtcggtgagtagtg aagccacagatgtactcaccgacagcgttgaatgtgtgcctactgcctcggacttcaaggggctagaattcga >Seq_49_mir-181a-5p 22 nt, miR-E backbone, Guide position tcgacttataacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgatcaccgacagcgttgaatgMagtga agccacagatgtaaacattcaacgctgtcggtgagtgcctactgcctcggacttcaaggggctagaattcga >Seq_50_mir-181a-5p, natural pre-miRNA in miR-E backbone, Human (hsa-mir-181a- 1 MI0000289) tcgacttataacccaacagaaggctcgagaaggtatattgctgttgtgagttttgaggttgcttcagtgaacattcaacgctgtcg gtgagtttggaattaaaatcaaaaccatcgaccgttgattgtaccctatggctaaccatcatctactccactcggacttcaagggg ctagaattcga >Seq_51_mir-181a-5p, natural pre-miRNA in miR-E backbone, Mouse (mmu-mir- 181a-1 MI0000697) tcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgggttgcttcagtgaacattcaacgctgtcggtgagtttg gaattcaaataaaaaccatcgaccgttgattgtaccctatagctaaccctcggacttcaaggggctagaattcga >Seq_52_mir-181b-5p 23 nt, miR-E backbone, Passenger position tcgacttataacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgaacattcattgctgtcggtgggttagtg aagccacagatgtaacccaccgacagcaatgaatgtgtgcctactgcctcggacttcaaggggctagaattcga >Seq_53_mir-181b-5p 23 nt, miR-E backbone, Guide position tcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgccccaccgacagcaatgaatgtttagt gaagccacagatgtaaacattcattgctgtcggtgggttgcctactgcctcggacttcaaggggctagaattcga >Seq_54_mir-181b-5p 22 nt, miR-E backbone, Passenger position tcgacttataacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgaacattcattgctgtcggtgggtagtga agccacagatgtacccaccgacagcaatgaatgtgtgcctactgcctcggacttcaaggggctagaattcga >Seq_55_mir-181b-5p 22 nt, miR-E backbone, Guide position tcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgaccaccgacagcaatgaatgtttagtg aagccacagatgtaaacattcattgctgtcggtgggtgcctactgcctcggacttcaaggggctagaattcga >Seq_56_mir-181b-5p, natural pre-miRNA in miR-E backbone, Human (hsa-mir-181b- 1 M10000270) tcgacttataacccaacagaaggctcgagaaggtatattgctgttgcctgtgcagagattattttttaaaaggtcacaatcaacat tcattgctgtcggtgggttgaactgtgtggacaagctcactgaacaatgaatgcaactgtggccccgcttctcggacttcaagg ggctagaattcga >Seq_57_mir-181b-5p, natural pre-miRNA in miR-E backbone, Mouse (mmu-mir- 181b-1 MI0000723) tcgacttataacccaacagaaggctcgagaaggtatattgctgttgaggtcacaatcaacattcattgctgtcggtgggttgaac tgtgtagaaaagctcactgaacaatgaatgcaactgtggccctcggacttcaaggggctagaattcga >Seq_58_mir-212-5p 23 nt, miR-E backbone, Passenger position tcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgaccttggctctagactgcttacttagtga agccacagatgtaagtaagcagtctagagccaaggctgcctactgcctcggacttcaaggggctagaattcga >Seq_59_mir-212-5p 23 nt, miR-E backbone, Guide position tcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgcgtaagcagtctagagccaaggttagt gaagccacagatgtaaccttggctctagactgcttacttgcctactgcctcggacttcaaggggctagaattcga >Seq_60_mir-212-5p 22 nt, miR-E backbone, Passenger position tcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgaccttggctctagactgcttactagtga agccacagatgtagtaagcagtctagagccaaggctgcctactgcctcggacttcaaggggctagaattcga >Seq_61_mir-212-5p 22 nt, miR-E backbone, Guide position tcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgataagcagtctagagccaaggttagtg aagccacagatgtaaccttggctctagactgcttactgcctactgcctcggacttcaaggggctagaattcga >Seq_62_mir-212-5p, natural pre-miRNA in miR-E backbone, Human (hsa-mir-212 MI0000288) tcgacttataacccaacagaaggctcgagaaggtatattgctgttgcggggcaccccgcccggacagcgcgccggcacctt ggctctagactgcttactgcccgggccgccctcagtaacagtctccagtcacggccaccgacgcctggccccgccctcggac ttcaaggggctagaattcga >Seq_63_mir-212-5p, natural pre-miRNA in miR-E backbone, Mouse (mmu-mir-212 MI0000696) tcgacttcttaacccaacagaaggctcgagaaggtatattgctgttggggcagcgcgccggcaccttggctctagactgcttac tgcccgggccgccttcagtaacagtctccagtcacggccaccgacgcctggcccctcggacttcaaggggctagaattcga >Seq_64_scAAV-CMV-eGFP-mir181b-5p (23 nt in miR-E backbone)-SV40pA, Passenger position cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccg gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcgacccccta aaatgggcaaacattgcaagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagag acctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtg gtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggca gcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggca ccaccactgacctgggacagtgaatccggactctaagaggtaccttaattaagccaccatggtgtccaagggcgaggaactgt tcaccggcgtggtgcccatcctggtggaactggatggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgaa ggcgacgccacatatggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccttggcctaccctcgtga ccacactgacctacggcgtgcagtgatcagcagataccccgaccatatgaagcagcacgacttcttcaagagcgccatgcc cgagggctacgtgcaggaacggaccatcttctttaaggacgacggcaactacaagaccagggccgaagtgaagttcgagg gcgacaccctcgtgaaccggatcgagctgaagggcatcgacttcaaagaggacggcaacatcctgggccacaagctggag tacaactacaacagccacaacgtgtacatcatggccgacaagcagaaaaacggcatcaaagtgaacttcaagatccggcaca acatcgaggacggctccgtgcagctggccgaccactaccagcagaacacccccatcggagatggccccgtgctgctgccc gacaaccactacctgagcacacagagcgccctgagcaaggaccccaacgagaagcgggaccacatggtgctgctggaatt tgtgaccgccgctggcatcaccctgggcatggacgagctgtacaaatgaggcgcgcctcgacttcttaacccaacagaaggc tcgagaaggtatattgctgttgacagtgagcgaacattcattgctgtcggtgggttagtgaagccacagatgtaacccaccgac agcaatgaatgtgtgcctactgcctcggacttcaaggggctagaattcgagacttgtttattgcagcttataatggttacaaataaa gcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgc ggccgagatctccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggcttt gcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg >Seq_65_scAAV-CMV-eGFP-mir181b-5p (23 nt in miR-E backbone)-SV40pA, Guide position cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccg gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcgacccccta aaatgggcaaacattgcaagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagag acctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtg gtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggca gcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggca ccaccactgacctgggacagtgaatccggactctaagaggtaccttaattaagccaccatggtgtccaagggcgaggaactgt tcaccggcgtggtgcccatcctggtggaactggatggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgaa ggcgacgccacatatggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccttggcctaccctcgtga ccacactgacctacggcgtgcagtgatcagcagataccccgaccatatgaagcagcacgacttatcaagagcgccatgcc cgagggctacgtgcaggaacggaccatcttctttaaggacgacggcaactacaagaccagggccgaagtgaagttcgagg gcgacaccctcgtgaaccggatcgagctgaagggcatcgacttcaaagaggacggcaacatcctgggccacaagctggag tacaactacaacagccacaacgtgtacatcatggccgacaagcagaaaaacggcatcaaagtgaacttcaagatccggcaca acatcgaggacggctccgtgcagctggccgaccactaccagcagaacacccccatcggagatggccccgtgctgctgccc gacaaccactacctgagcacacagagcgccctgagcaaggaccccaacgagaagcgggaccacatggtgctgctggaatt tgtgaccgccgctggcatcaccctgggcatggacgagctgtacaaatgaggcgcgcctcgacttcttaacccaacagaaggc tcgagaaggtatattgctgttgacagtgagcgccccaccgacagcaatgaatgtttagtgaagccacagatgtaaacattcattg ctgtcggtgggttgcctactgcctcggacttcaaggggctagaattcgagacttgtttattgcagcttataatggttacaaataaag caatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcg gccgagatctccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttg cccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg >Seq_66_scAAV-CMV-eGFP-mir181b-5p (22 nt in miR-E backbone)-SV40pA, Passenger position cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccg gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcgacccccta aaatgggcaaacattgcaagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagag acctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtg gtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggca gcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggca ccaccactgacctgggacagtgaatccggactctaagaggtaccttaattaagccaccatggtgtccaagggcgaggaactgt tcaccggcgtggtgcccatcctggtggaactggatggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgaa ggcgacgccacatatggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccttggcctaccctcgtga ccacactgacctacggcgtgcagtgcttcagcagataccccgaccatatgaagcagcacgacttcttcaagagcgccatgcc cgagggctacgtgcaggaacggaccatcttctttaaggacgacggcaactacaagaccagggccgaagtgaagttcgagg gcgacaccctcgtgaaccggatcgagctgaagggcatcgacttcaaagaggacggcaacatcctgggccacaagctggag tacaactacaacagccacaacgtgtacatcatggccgacaagcagaaaaacggcatcaaagtgaacttcaagatccggcaca acatcgaggacggctccgtgcagctggccgaccactaccagcagaacacccccatcggagatggccccgtgctgctgccc gacaaccactacctgagcacacagagcgccctgagcaaggaccccaacgagaagcgggaccacatggtgctgctggaatt tgtgaccgccgctggcatcaccctgggcatggacgagctgtacaaatgaggcgcgcctcgacttcttaacccaacagaaggc tcgagaaggtatattgctgttgacagtgagcgaacattcattgctgtcggtgggtagtgaagccacagatgtacccaccgacag caatgaatgtgtgcctactgcctcggacttcaaggggctagaattcgagacttgtttattgcagcttataatggttacaaataaagc aatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcgg ccgagatctccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggcMgc ccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg >Seq_67_scAAV-CMV-eGFP-mir181b-5p (22 nt in miR-E backbone)-SV40pA, Guide position cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccg gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcgacccccta aaatgggcaaacattgcaagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagag acctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtg gtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggca gcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggca ccaccactgacctgggacagtgaatccggactctaagaggtaccttaattaagccaccatggtgtccaagggcgaggaactgt tcaccggcgtggtgcccatcctggtggaactggatggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgaa ggcgacgccacatatggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccttggcctaccctcgtga ccacactgacctacggcgtgcagtgatcagcagataccccgaccatatgaagcagcacgacttatcaagagcgccatgcc cgagggctacgtgcaggaacggaccatcttctttaaggacgacggcaactacaagaccagggccgaagtgaagttcgagg gcgacaccctcgtgaaccggatcgagctgaagggcatcgacttcaaagaggacggcaacatcctgggccacaagctggag tacaactacaacagccacaacgtgtacatcatggccgacaagcagaaaaacggcatcaaagtgaacttcaagatccggcaca acatcgaggacggctccgtgcagctggccgaccactaccagcagaacacccccatcggagatggccccgtgctgctgccc gacaaccactacctgagcacacagagcgccctgagcaaggaccccaacgagaagcgggaccacatggtgctgctggaatt tgtgaccgccgctggcatcaccctgggcatggacgagctgtacaaatgaggcgcgcctcgacttcttaacccaacagaaggc tcgagaaggtatattgctgttgacagtgagcgaccaccgacagcaatgaatgtttagtgaagccacagatgtaaacattcattgc tgtcggtgggtgcctactgcctcggacttcaaggggctagaattcgagacttgtttattgcagcttataatggttacaaataaagc aatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcgg ccgagatctccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggcMgc ccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg >Seq_68_scAAV-CMV-eGFP-mir181b-5p (natural pre-miRNA, human)-SV40pA cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccg gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcgacccccta aaatgggcaaacattgcaagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagag acctctctgggcccatgccacctccaacatccactcgacccatggaatttcggtggagaggagcagaggttgtcctggcgtg gtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggca gcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggca ccaccactgacctgggacagtgaatccggactctaagaggtaccttaattaagccaccatggtgtccaagggcgaggaactgt tcaccggcgtggtgcccatcctggtggaactggatggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgaa ggcgacgccacatatggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccttggcctaccctcgtga ccacactgacctacggcgtgcagtgatcagcagataccccgaccatatgaagcagcacgacttatcaagagcgccatgcc cgagggctacgtgcaggaacggaccatcttctttaaggacgacggcaactacaagaccagggccgaagtgaagttcgagg gcgacaccctcgtgaaccggatcgagctgaagggcatcgacttcaaagaggacggcaacatcctgggccacaagctggag tacaactacaacagccacaacgtgtacatcatggccgacaagcagaaaaacggcatcaaagtgaacttcaagatccggcaca acatcgaggacggctccgtgcagctggccgaccactaccagcagaacacccccatcggagatggccccgtgctgctgccc gacaaccactacctgagcacacagagcgccctgagcaaggaccccaacgagaagcgggaccacatggtgctgctggaatt tgtgaccgccgctggcatcaccctgggcatggacgagctgtacaaatgaggcgcgcctcgacttcttaacccaacagaaggc tcgagaaggtatattgctgttgcctgtgcagagattattttttaaaaggtcacaatcaacattcattgctgtcggtgggttgaactgt gtggacaagctcactgaacaatgaatgcaactgtggccccgcttctcggacttcaaggggctagaattcgagacttgtttattgc agatataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtcca aactcatcaatgtatcttaacgcggccgagatctccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaa ggtcgcccgacgcccgggcMgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg >Seq_69_scAAV-CMV-eGFP-mir181b-5p (natural pre-miRNA, mouse)-SV40pA cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccg gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcgacccccta aaatgggcaaacattgcaagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagag acctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtg gtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggca gcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggca ccaccactgacctgggacagtgaatccggactctaagaggtaccttaattaagccaccatggtgtccaagggcgaggaactgt tcaccggcgtggtgcccatcctggtggaactggatggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgaa ggcgacgccacatatggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccttggcctaccctcgtga ccacactgacctacggcgtgcagtgatcagcagataccccgaccatatgaagcagcacgacttatcaagagcgccatgcc cgagggctacgtgcaggaacggaccatcttctttaaggacgacggcaactacaagaccagggccgaagtgaagttcgagg gcgacaccctcgtgaaccggatcgagctgaagggcatcgacttcaaagaggacggcaacatcctgggccacaagctggag tacaactacaacagccacaacgtgtacatcatggccgacaagcagaaaaacggcatcaaagtgaacttcaagatccggcaca acatcgaggacggctccgtgcagctggccgaccactaccagcagaacacccccatcggagatggccccgtgctgctgccc gacaaccactacctgagcacacagagcgccctgagcaaggaccccaacgagaagcgggaccacatggtgctgctggaatt tgtgaccgccgctggcatcaccctgggcatggacgagctgtacaaatgaggcgcgcctcgacttcttaacccaacagaaggc tcgagaaggtatattgctgttgaggtcacaatcaacattcattgctgtcggtgggttgaactgtgtagaaaagctcactgaacaat gaatgcaactgtggccctcggacttcaaggggctagaattcgagacttgtttattgcagcttataatggttacaaataaagcaata gcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcggccga gatctccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgg gcggcctcagtgagcgagcgagcgcgcagctgcctgcagg >Seq_70_scAAV-CMV-eGFP-mir-181a-mir181b-mir10a (all 23 nt in miR-E backbone), Passenger position cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccg gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcgacccccta aaatgggcaaacattgcaagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagag acctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtg gtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggca gcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggca ccaccactgacctgggacagtgaatccggactctaagaggtaccttaattaagccaccatggtgtccaagggcgaggaactgt tcaccggcgtggtgcccatcctggtggaactggatggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgaa ggcgacgccacatatggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccttggcctaccctcgtga ccacactgacctacggcgtgcagtgatcagcagataccccgaccatatgaagcagcacgacttatcaagagcgccatgcc cgagggctacgtgcaggaacggaccatcttctttaaggacgacggcaactacaagaccagggccgaagtgaagttcgagg gcgacaccctcgtgaaccggatcgagctgaagggcatcgacttcaaagaggacggcaacatcctgggccacaagctggag tacaactacaacagccacaacgtgtacatcatggccgacaagcagaaaaacggcatcaaagtgaacttcaagatccggcaca acatcgaggacggctccgtgcagctggccgaccactaccagcagaacacccccatcggagatggccccgtgctgctgccc gacaaccactacctgagcacacagagcgccctgagcaaggaccccaacgagaagcgggaccacatggtgctgctggaatt tgtgaccgccgctggcatcaccctgggcatggacgagctgtacaaatgaggcgcgcctcgacttcttaacccaacagaaggc tcgagaaggtatattgctgttgacagtgagcgaacattcaacgctgtcggtgagttagtgaagccacagatgtaactcaccgac agcgttgaatgtgtgcctactgcctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaagg tatattgctgttgacagtgagcgaacattcattgctgtcggtgggttagtgaagccacagatgtaacccaccgacagcaatgaat gtgtgcctactgcctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaaggtatattgctgt tgacagtgagcgtaccctgtagatccgaatttgtgtagtgaagccacagatgtacacaaattcggatctacagggtctgcctact gcctcggacttcaaggggctagaattcgagacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttca caaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcggccgagatctccactccctc tctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtga gcgagcgagcgcgcagctgcctgcagg >Seq_71_scAAV-CMV-eGFP-mir-181a-mir181b-mir10a (all 23 nt in miR-E backbone), Guide position cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccg gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcgacccccta aaatgggcaaacattgcaagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagag acctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtg gtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggca gcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggca ccaccactgacctgggacagtgaatccggactctaagaggtaccttaattaagccaccatggtgtccaagggcgaggaactgt tcaccggcgtggtgcccatcctggtggaactggatggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgaa ggcgacgccacatatggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccttggcctaccctcgtga ccacactgacctacggcgtgcagtgcttcagcagataccccgaccatatgaagcagcacgacttcttcaagagcgccatgcc cgagggctacgtgcaggaacggaccatcttctttaaggacgacggcaactacaagaccagggccgaagtgaagttcgagg gcgacaccctcgtgaaccggatcgagctgaagggcatcgacttcaaagaggacggcaacatcctgggccacaagctggag tacaactacaacagccacaacgtgtacatcatggccgacaagcagaaaaacggcatcaaagtgaacttcaagatccggcaca acatcgaggacggctccgtgcagctggccgaccactaccagcagaacacccccatcggagatggccccgtgctgctgccc gacaaccactacctgagcacacagagcgccctgagcaaggaccccaacgagaagcgggaccacatggtgctgctggaatt tgtgaccgccgctggcatcaccctgggcatggacgagctgtacaaatgaggcgcgcctcgacttcttaacccaacagaaggc tcgagaaggtatattgctgttgacagtgagcgcctcaccgacagcgttgaatgtttagtgaagccacagatgtaaacattcaac gctgtcggtgagttgcctactgcctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaag gtatattgctgttgacagtgagcgccccaccgacagcaatgaatgtttagtgaagccacagatgtaaacattcattgctgtcggt gggttgc ctactgc ctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaaggtatattgct gttgacagtgagcgaacaaattcggatctacagggtatagtgaagccacagatgtataccctgtagatccgaatttgtgtgccta ctgcctcggacttcaaggggctagaattcgagacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaattt cacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcggccgagatctccactccc tctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtg agcgagcgagcgcgcagctgcctgcagg >Seq_72_scAAV-CMV-eGFP-mir-181a-mir181b-mir10a (all 22 nt in miR-E backbone), Passenger position cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccg gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcgacccccta aaatgggcaaacattgcaagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagag acctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtg gtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggca gcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggca ccaccactgacctgggacagtgaatccggactctaagaggtaccttaattaagccaccatggtgtccaagggcgaggaactgt tcaccggcgtggtgcccatcctggtggaactggatggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgaa ggcgacgccacatatggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccttggcctaccctcgtga ccacactgacctacggcgtgcagtgatcagcagataccccgaccatatgaagcagcacgacttatcaagagcgccatgcc cgagggctacgtgcaggaacggaccatcttctttaaggacgacggcaactacaagaccagggccgaagtgaagttcgagg gcgacaccctcgtgaaccggatcgagctgaagggcatcgacttcaaagaggacggcaacatcctgggccacaagctggag tacaactacaacagccacaacgtgtacatcatggccgacaagcagaaaaacggcatcaaagtgaacttcaagatccggcaca acatcgaggacggctccgtgcagctggccgaccactaccagcagaacacccccatcggagatggccccgtgctgctgccc gacaaccactacctgagcacacagagcgccctgagcaaggaccccaacgagaagcgggaccacatggtgctgctggaatt tgtgaccgccgctggcatcaccctgggcatggacgagctgtacaaatgaggcgcgcctcgacttcttaacccaacagaaggc tcgagaaggtatattgctgttgacagtgagcgaacattcaacgctgtcggtgagtagtgaagccacagatgtactcaccgaca gcgttgaatgtgtgcctactgcctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaaggt atattgctgttgacagtgagcgaacattcattgctgtcggtgggtagtgaagccacagatgtacccaccgacagcaatgaatgt gtgcctactgcctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaaggtatattgctgttg acagtgagcgtaccctgtagatccgaatttgttagtgaagccacagatgtaacaaattcggatctacagggtctgcctactgcct cggacttcaaggggctagaattcgagacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaa ataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcggccgagatctccactccctctctg cgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcg agcgagcgcgcagctgcctgcagg >Seq_73_scAAV-CMV-eGFP-mir-181a-mir181b-mir10a (all 22 nt in miR-E backbone), Guide position cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccg gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcgacccccta aaatgggcaaacattgcaagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagag acctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtg gtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggca gcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggca ccaccactgacctgggacagtgaatccggactctaagaggtaccttaattaagccaccatggtgtccaagggcgaggaactgt tcaccggcgtggtgcccatcctggtggaactggatggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgaa ggcgacgccacatatggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccttggcctaccctcgtga ccacactgacctacggcgtgcagtgatcagcagataccccgaccatatgaagcagcacgacttatcaagagcgccatgcc cgagggctacgtgcaggaacggaccatcttctttaaggacgacggcaactacaagaccagggccgaagtgaagttcgagg gcgacaccctcgtgaaccggatcgagctgaagggcatcgacttcaaagaggacggcaacatcctgggccacaagctggag tacaactacaacagccacaacgtgtacatcatggccgacaagcagaaaaacggcatcaaagtgaacttcaagatccggcaca acatcgaggacggctccgtgcagctggccgaccactaccagcagaacacccccatcggagatggccccgtgctgctgccc gacaaccactacctgagcacacagagcgccctgagcaaggaccccaacgagaagcgggaccacatggtgctgctggaatt tgtgaccgccgctggcatcaccctgggcatggacgagctgtacaaatgaggcgcgcctcgacttcttaacccaacagaaggc tcgagaaggtatattgctgttgacagtgagcgatcaccgacagcgttgaatgtttagtgaagccacagatgtaaacattcaacg ctgtcggtgagtgcctactgcctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaaggta tattgctgttgacagtgagcgaccaccgac agcaatgaatgtttagtg aagccacagatgtaaacattcattgctgtcggtgggt gcctactgcctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgac agtgagcgccaaattcggatctacagggtatagtgaagccacagatgtataccctgtagatccgaatttgttgcctactgcctcg gacttcaaggggctagaattcgagacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaata aagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcggccgagatctccactccctctctgcg cgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgag cgagcgcgcagctgcctgcagg >Seq_74_scAAV-CMV-eGFP-mir-212-5p-mir181b-mir10a (all 23 nt in miR-E backbone), Passenger position cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccg gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcgacccccta aaatgggcaaacattgcaagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagag acctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtg gtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggca gcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggca ccaccactgacctgggacagtgaatccggactctaagaggtaccttaattaagccaccatggtgtccaagggcgaggaactgt tcaccggcgtggtgcccatcctggtggaactggatggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgaa ggcgacgccacatatggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccttggcctaccctcgtga ccacactgacctacggcgtgcagtgatcagcagataccccgaccatatgaagcagcacgacttatcaagagcgccatgcc cgagggctacgtgcaggaacggaccatcttctttaaggacgacggcaactacaagaccagggccgaagtgaagttcgagg gcgacaccctcgtgaaccggatcgagctgaagggcatcgacttcaaagaggacggcaacatcctgggccacaagctggag tacaactacaacagccacaacgtgtacatcatggccgacaagcagaaaaacggcatcaaagtgaacttcaagatccggcaca acatcgaggacggctccgtgcagctggccgaccactaccagcagaacacccccatcggagatggccccgtgctgctgccc gacaaccactacctgagcacacagagcgccctgagcaaggaccccaacgagaagcgggaccacatggtgctgctggaatt tgtgaccgccgctggcatcaccctgggcatggacgagctgtacaaatgaggcgcgcctcgacttcttaacccaacagaaggc tcgagaaggtatattgctgttgacagtgagcgaccttggctctagactgcttacttagtgaagccacagatgtaagtaagcagtc tagagccaaggctgcctactgcctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaagg tatattgctgttgacagtgagcgaacattcattgctgtcggtgggttagtgaagccacagatgtaacccaccgacagcaatgaat gtgtgcctactgcctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaaggtatattgctgt tgacagtgagcgtaccctgtagatccgaatttgtgtagtgaagccacagatgtacacaaattcggatctacagggtctgcctact gcctcggacttcaaggggctagaattcgagacttgtttattgcagatataatggttacaaataaagcaatagcatcacaaatttca caaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcggccgagatctccactccctc tctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtga gcgagcgagcgcgcagctgcctgcagg >Seq_75_scAAV-CMV-eGFP-mir-212-5p-mir181b-mir10a (all 23 nt in miR-E backbone), Guide position cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccg gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcgacccccta aaatgggcaaacattgcaagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagag acctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtg gtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggca gcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggca ccaccactgacctgggacagtgaatccggactctaagaggtaccttaattaagccaccatggtgtccaagggcgaggaactgt tcaccggcgtggtgcccatcctggtggaactggatggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgaa ggcgacgccacatatggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccttggcctaccctcgtga ccacactgacctacggcgtgcagtgcttcagcagataccccgaccatatgaagcagcacgacttcttcaagagcgccatgcc cgagggctacgtgcaggaacggaccatcttctttaaggacgacggcaactacaagaccagggccgaagtgaagttcgagg gcgacaccctcgtgaaccggatcgagctgaagggcatcgacttcaaagaggacggcaacatcctgggccacaagctggag tacaactacaacagccacaacgtgtacatcatggccgacaagcagaaaaacggcatcaaagtgaacttcaagatccggcaca acatcgaggacggctccgtgcagctggccgaccactaccagcagaacacccccatcggagatggccccgtgctgctgccc gacaaccactacctgagcacacagagcgccctgagcaaggaccccaacgagaagcgggaccacatggtgctgctggaatt tgtgaccgccgctggcatcaccctgggcatggacgagctgtacaaatgaggcgcgcctcgacttcttaacccaacagaaggc tcgagaaggtatattgctgttgacagtgagcgcgtaagcagtctagagccaaggttagtgaagccacagatgtaaccttggctc tagactgatacttgcctactgcctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaaggt atattgctgttgacagtgagcgccccaccgacagcaatgaatgtttagtgaagccacagatgtaaacattcattgctgtcggtgg gttgcctactgcctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaaggtatattgctgtt gacagtgagcgaacaaattcggatctacagggtatagtgaagccacagatgtataccctgtagatccgaatttgtgtgcctact gcctcggacttcaaggggctagaattcgagacttgtttattgcagatataatggttacaaataaagcaatagcatcacaaatttca caaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcggccgagatctccactccctc tctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtga gcgagcgagcgcgcagctgcctgcagg >Seq_76_scAAV-CMV-eGFP-mir-212-5p-mir181b-mir10a (all 22 nt in miR-E backbone), Passenger position cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccg gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcgacccccta aaatgggcaaacattgcaagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagag acctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtg gtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggca gcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggca ccaccactgacctgggacagtgaatccggactctaagaggtaccttaattaagccaccatggtgtccaagggcgaggaactgt tcaccggcgtggtgcccatcctggtggaactggatggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgaa ggcgacgccacatatggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccttggcctaccctcgtga ccacactgacctacggcgtgcagtgatcagcagataccccgaccatatgaagcagcacgacttatcaagagcgccatgcc cgagggctacgtgcaggaacggaccatcttctttaaggacgacggcaactacaagaccagggccgaagtgaagttcgagg gcgacaccctcgtgaaccggatcgagctgaagggcatcgacttcaaagaggacggcaacatcctgggccacaagctggag tacaactacaacagccacaacgtgtacatcatggccgacaagcagaaaaacggcatcaaagtgaacttcaagatccggcaca acatcgaggacggctccgtgcagctggccgaccactaccagcagaacacccccatcggagatggccccgtgctgctgccc gacaaccactacctgagcacacagagcgccctgagcaaggaccccaacgagaagcgggaccacatggtgctgctggaatt tgtgaccgccgctggcatcaccctgggcatggacgagctgtacaaatgaggcgcgcctcgacttcttaacccaacagaaggc tcgagaaggtatattgctgttgacagtgagcgaccttggctctagactgcttactagtgaagccacagatgtagtaagcagtcta gagccaaggctgcctactgcctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaaggta tattgctgttgacagtgagcgaacattcattgctgtcggtgggtagtgaagccacagatgtacccaccgacagcaatgaatgtgt gcctactgcctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgac agtgagcgtaccctgtagatccgaatttgttagtgaagccacagatgtaacaaattcggatctacagggtctgcctactgcctcg gacttcaaggggctagaattcgagacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaata aagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcggccgagatctccactccctctctgcg cgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgag cgagcgcgcagctgcctgcagg >Seq_77_scAAV-CMV-eGFP-mir-212-5p-mir181b-mir10a (all 22 nt in miR-E backbone), Guide position cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccg gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcgacccccta aaatgggcaaacattgcaagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagag acctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtg gtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggca gcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggca ccaccactgacctgggacagtgaatccggactctaagaggtaccttaattaagccaccatggtgtccaagggcgaggaactgt tcaccggcgtggtgcccatcctggtggaactggatggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgaa ggcgacgccacatatggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccttggcctaccctcgtga ccacactgacctacggcgtgcagtgcttcagcagataccccgaccatatgaagcagcacgacttcttcaagagcgccatgcc cgagggctacgtgcaggaacggaccatcttctttaaggacgacggcaactacaagaccagggccgaagtgaagttcgagg gcgacaccctcgtgaaccggatcgagctgaagggcatcgacttcaaagaggacggcaacatcctgggccacaagctggag tacaactacaacagccacaacgtgtacatcatggccgacaagcagaaaaacggcatcaaagtgaacttcaagatccggcaca acatcgaggacggctccgtgcagctggccgaccactaccagcagaacacccccatcggagatggccccgtgctgctgccc gacaaccactacctgagcacacagagcgccctgagcaaggaccccaacgagaagcgggaccacatggtgctgctggaatt tgtgaccgccgctggcatcaccctgggcatggacgagctgtacaaatgaggcgcgcctcgacttcttaacccaacagaaggc tcgagaaggtatattgctgttgacagtgagcgctaagcagtctagagccaaggttagtgaagccacagatgtaaccttggctct agactgatactgcctactgcctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaaggta tattgctgttgacagtgagcgaccaccgacagcaatgaatgtttagtgaagccacagatgtaaacattcattgctgtcggtgggt gcctactgcctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaaggtatattgctgttgac agtgagcgccaaattcggatctacagggtatagtgaagccacagatgtataccctgtagatccgaatttgttgcctactgcctcg gacttcaaggggctagaattcgagacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaata aagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcggccgagatctccactccctctctgcg cgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgag cgagcgcgcagctgcctgcagg >Seq_78_scAAV-CMV-eGFP-mir-181a-mir181b-mir10a (natural pre-miRNAs in miR- E backbone), Human cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccg gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcgacccccta aaatgggcaaacattgcaagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagag acctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtg gtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggca gcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggca ccaccactgacctgggacagtgaatccggactctaagaggtaccttaattaagccaccatggtgtccaagggcgaggaactgt tcaccggcgtggtgcccatcctggtggaactggatggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgaa ggcgacgccacatatggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccttggcctaccctcgtga ccacactgacctacggcgtgcagtgatcagcagataccccgaccatatgaagcagcacgacttatcaagagcgccatgcc cgagggctacgtgcaggaacggaccatcttctttaaggacgacggcaactacaagaccagggccgaagtgaagttcgagg gcgacaccctcgtgaaccggatcgagctgaagggcatcgacttcaaagaggacggcaacatcctgggccacaagctggag tacaactacaacagccacaacgtgtacatcatggccgacaagcagaaaaacggcatcaaagtgaacttcaagatccggcaca acatcgaggacggctccgtgcagctggccgaccactaccagcagaacacccccatcggagatggccccgtgctgctgccc gacaaccactacctgagcacacagagcgccctgagcaaggaccccaacgagaagcgggaccacatggtgctgctggaatt tgtgaccgccgctggcatcaccctgggcatggacgagctgtacaaatgaggcgcgcctcgacttcttaacccaacagaaggc tcgagaaggtatattgctgttgtgagttttgaggttgcttcagtgaacattcaacgctgtcggtgagtttggaattaaaatcaaaac catcgaccgttgattgtaccctatggctaaccatcatctactccactcggacttcaaggggctagaattcgatcgacttcttaacc caacagaaggctcgagaaggtatattgctgttgcctgtgcagagattattttttaaaaggtcacaatcaacattcattgctgtcggt gggttgaactgtgtggacaagctcactgaacaatgaatgcaactgtggccccgcttctcggacttcaaggggctagaattcgat cgacttcttaacccaacagaaggctcgagaaggtatattgctgttggatctgtctgtcttctgtatataccctgtagatccgaatttg tgtaaggaattttgtggtcacaaattcgtatctaggggaatatgtagttgacataaacactccgctctctcggacttcaaggggct agaattcgagacttgtttattgcagatataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcact gcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcggccgagatctccactccctctctgcgcgctcgctcgctca ctgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagct gcctgcagg >Seq_79_scAAV-CMV-eGFP-mir-181a-mir181b-mir10a (natural pre-miRNAs in miR- E backbone), Mouse cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccg gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcgacccccta aaatgggcaaacattgcaagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagag acctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtg gtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggca gcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggca ccaccactgacctgggacagtgaatccggactctaagaggtaccttaattaagccaccatggtgtccaagggcgaggaactgt tcaccggcgtggtgcccatcctggtggaactggatggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgaa ggcgacgccacatatggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccttggcctaccctcgtga ccacactgacctacggcgtgcagtgatcagcagataccccgaccatatgaagcagcacgacttatcaagagcgccatgcc cgagggctacgtgcaggaacggaccatcttctttaaggacgacggcaactacaagaccagggccgaagtgaagttcgagg gcgacaccctcgtgaaccggatcgagctgaagggcatcgacttcaaagaggacggcaacatcctgggccacaagctggag tacaactacaacagccacaacgtgtacatcatggccgacaagcagaaaaacggcatcaaagtgaacttcaagatccggcaca acatcgaggacggctccgtgcagctggccgaccactaccagcagaacacccccatcggagatggccccgtgctgctgccc gacaaccactacctgagcacacagagcgccctgagcaaggaccccaacgagaagcgggaccacatggtgctgctggaatt tgtgaccgccgctggcatcaccctgggcatggacgagctgtacaaatgaggcgcgcctcgacttcttaacccaacagaaggc tcgagaaggtatattgctgttgggttgcttcagtgaacattcaacgctgtcggtgagtttggaattcaaataaaaaccatcgaccg ttgattgtaccctatagctaaccctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaaggt atattgctgttgaggtcacaatcaacattcattgctgtcggtgggttgaactgtgtagaaaagctcactgaacaatgaatgcaact gtggccctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaaggtatattgctgttggacc tgtctgtcttctgtatataccctgtagatccgaatttgtgtaaggaattttgtggtcacaaattcgtatctaggggaatatgtagttga cataaacactccgctcactcggacttcaaggggctagaattcgagacttgtttattgcagcttataatggttacaaataaagcaat agcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcggccg agatctccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccg ggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg >Seq_80_scAAV-CMV-eGFP-mir-212-5p-mir181b-mir10a (natural pre-miRNAs in miR-E backbone), Human cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccg gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcgacccccta aaatgggcaaacattgcaagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagag acctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtg gtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggca gcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggca ccaccactgacctgggacagtgaatccggactctaagaggtaccttaattaagccaccatggtgtccaagggcgaggaactgt tcaccggcgtggtgcccatcctggtggaactggatggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgaa ggcgacgccacatatggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccttggcctaccctcgtga ccacactgacctacggcgtgcagtgatcagcagataccccgaccatatgaagcagcacgacttatcaagagcgccatgcc cgagggctacgtgcaggaacggaccatcttctttaaggacgacggcaactacaagaccagggccgaagtgaagttcgagg gcgacaccctcgtgaaccggatcgagctgaagggcatcgacttcaaagaggacggcaacatcctgggccacaagctggag tacaactacaacagccacaacgtgtacatcatggccgacaagcagaaaaacggcatcaaagtgaacttcaagatccggcaca acatcgaggacggctccgtgcagctggccgaccactaccagcagaacacccccatcggagatggccccgtgctgctgccc gacaaccactacctgagcacacagagcgccctgagcaaggaccccaacgagaagcgggaccacatggtgctgctggaatt tgtgaccgccgctggcatcaccctgggcatggacgagctgtacaaatgaggcgcgcctcgacttcttaacccaacagaaggc tcgagaaggtatattgctgttgcggggcaccccgcccggacagcgcgccggcaccttggctctagactgcttactgcccggg ccgccctcagtaacagtctccagtcacggccaccgacgcctggccccgccctcggacttcaaggggctagaattcgatcgac ttataacc caacagaaggctcgagaaggtatattgctgttgcctgtgcagagattattttttaaaaggtcacaatcaacattcattg ctgtcggtgggttgaactgtgtggacaagctcactgaacaatgaatgcaactgtggccccgcttctcggacttcaaggggctag aattcgatcgacttcttaacccaacagaaggctcgagaaggtatattgctgttggatctgtctgtcttctgtatataccctgtagatc cgaatttgtgtaaggaattttgtggtcacaaattcgtatctaggggaatatgtagttgacataaacactccgctctctcggacttca aggggctagaattcgagacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatt tttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaacgcggccgagatctccactccctctctgcgcgctcgc tcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggcMgcccgggcggcctcagtgagcgagcgagcgc gcagctgcctgcagg >Seq_81_scAAV-CMV-eGFP-mir-212-5p-mir181b-mir10a (natural pre-miRNAs in miR-E backbone), Mouse cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccg gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccgctcgacccccta aaatgggcaaacattgcaagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagag acctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtg gtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggca gcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattc accagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggca ccaccactgacctgggacagtgaatccggactctaagaggtaccttaattaagccaccatggtgtccaagggcgaggaactgt tcaccggcgtggtgcccatcctggtggaactggatggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgaa ggcgacgccacatatggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccttggcctaccctcgtga ccacactgacctacggcgtgcagtgatcagcagataccccgaccatatgaagcagcacgacttatcaagagcgccatgcc cgagggctacgtgcaggaacggaccatcttctttaaggacgacggcaactacaagaccagggccgaagtgaagttcgagg gcgacaccctcgtgaaccggatcgagctgaagggcatcgacttcaaagaggacggcaacatcctgggccacaagctggag tacaactacaacagccacaacgtgtacatcatggccgacaagcagaaaaacggcatcaaagtgaacttcaagatccggcaca acatcgaggacggctccgtgcagctggccgaccactaccagcagaacacccccatcggagatggccccgtgctgctgccc gacaaccactacctgagcacacagagcgccctgagcaaggaccccaacgagaagcgggaccacatggtgctgctggaatt tgtgaccgccgctggcatcaccctgggcatggacgagctgtacaaatgaggcgcgcctcgacttcttaacccaacagaaggc tcgagaaggtatattgctgttggggcagcgcgccggcaccttggctctagactgcttactgcccgggccgccttcagtaacagt ctccagtcacggccaccgacgcctggcccctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctc gagaaggtatattgctgttgaggtcacaatcaacattcattgctgtcggtgggttgaactgtgtagaaaagctcactgaacaatg aatgcaactgtggccctcggacttcaaggggctagaattcgatcgacttcttaacccaacagaaggctcgagaaggtatattgc tgttggacctgtctgtcttctgtatataccctgtagatccgaatttgtgtaaggaattttgtggtcacaaattcgtatctaggggaata tgtagttgacataaacactccgctcactcggacttcaaggggctagaattcgagacttgtttattgcagcttataatggttacaaat aaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttaac gcggccgagatctccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccggg ctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg >Seq ID No. 83 mir-Ren713, neutral control, miR-E backbone tcgacttataacccaacagaaggctcgagaaggtatattgctgttgacagtgagcgcaggaattataatgcttatctatagtgaa gccacagatgtatagataagcattataattcctatgcctactgcctcggacttcaaggggctagaattcga >Seq ID No. 84, mir-181a stem-loop, miR-E context tcgacttataacccaacagaaggctcgagaaggtatattgctgtttgagttttgaggttgcttcagtgaacattcaacgctgtcgg tgagtttggaattaaaatcaaaaccatcgaccgttgattgtaccctatggctaaccatcatctactccatcggacttcaaggggct agaattcga >Seq ID No. 85, mir-212 stem-loop, miR-E context tcgacttcttaacccaacagaaggctcgagaaggtatattgctgttcggggcaccccgcccggacagcgcgccggcaccttg gctctagactgcttactgcccgggccgccctcagtaacagtctccagtcacggccaccgacgcctggccccgcctcggactt caaggggctagaattcga