Producing astrocytes using small molecules
11413286 · 2022-08-16
Assignee
Inventors
Cpc classification
A61K31/437
HUMAN NECESSITIES
C12N5/0622
CHEMISTRY; METALLURGY
A61K31/4439
HUMAN NECESSITIES
C12N2501/01
CHEMISTRY; METALLURGY
A61K35/30
HUMAN NECESSITIES
C12N2501/999
CHEMISTRY; METALLURGY
A61K31/444
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
C12N2501/115
CHEMISTRY; METALLURGY
A61K31/135
HUMAN NECESSITIES
A61K31/506
HUMAN NECESSITIES
International classification
A61K31/506
HUMAN NECESSITIES
A61K31/437
HUMAN NECESSITIES
A61K31/444
HUMAN NECESSITIES
A61K35/30
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
A61K31/135
HUMAN NECESSITIES
Abstract
Disclosed herein are methods of reprograming autologous tissues or cells into astrocytes or astroglial progenitor cells using one or more small molecule compounds only without any transgenes. Also disclosed are methods of preventing or treating neurodegenerative diseases or neurological disorders associated with dysfunction of astrocytes, such as Alzheimer's Disease, by transplanting the astrocytes or astroglial progenitor cells produced by the methods disclosed herein into the brain of a subject suffering from the neurodegenerative disease or neurological disorder.
Claims
1. A method of reprogramming or converting somatic tissue or cells directly into astrocytes or astroglial progenitor cells, comprising contacting the somatic tissue or cells with one or more small molecules to obtain astrocytes or astroglial progenitor cells, wherein the one or more small molecules include at least one TGF-β inhibitor, and wherein the one or more small molecules are a combination of VPA (V), CHIR99021 (C), 616452 (6), tranylcypromine (T), and OAC1 (O), a combination of VPA (V), CHIR99021 (C), A-83-01 (A), tranylcypromine (T), and OAC1 (O), or a combination of VPA (V), CHIR99021 (C), SB-431542 (S), tranylcypromine (T), and OAC1 (O).
2. The method of claim 1, wherein the somatic tissue or cells are autologous tissue or cells.
3. The method of claim 1, wherein the somatic tissue or cells are human somatic tissue or cells.
4. The method of claim 1, wherein the somatic tissue or cells are fibroblasts, urinary cells or blood cells.
5. The method of claim 1, wherein the astrocytes or astroglial progenitor cells contain both anterior and posterior subtypes.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) This application contains at least one drawing executed in color. Copies of this application with color drawing(s) will be provided by the Office upon request and payment of the necessary fees.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
DETAILED DESCRIPTION
(15) The following description of the invention is merely intended to illustrate various embodiments of the invention. As such, the specific modifications discussed are not to be construed as limitations on the scope of the invention. It will be apparent to one skilled in the art that various equivalents, changes, and modifications may be made without departing from the scope of the invention, and it is understood that such equivalent embodiments are to be included herein.
(16) Expression of lineage-specific factors has been shown to induce cell fate change, including reprogramming somatic cells to induced pluripotent stem cells (iPSCs) (Takahashi and Yamanaka, 2006) and converting one type of somatic cells to another (Davis et al., 1987). The latter is also called direct reprogramming or conversion. Extensive efforts have been devoted into converting somatic cells, like fibroblasts, into different types of neural cells, such as neural stem cells (Kim et al., 2011; Han et al., 2012; Lujan et al., 2012), neurons (Vierbuchen et al., 2010; Caiazzo et al., 2011; Pang et al., 2011; Yoo et al., 2011), and oligodendrocytes (Najm et al., 2013; Yang et al., 2013). Direct reprogramming of somatic cells into astrocytes using defined transcription factors has been reported (Caiazzo et al., 2015). However, the conventional technologies have certain restrictions. For example, the process of inducing human iPSCs from somatic cells such as fibroblasts and then converting human iPSCs to astrocytes is a lengthy process and takes about 90 days or even longer. Direct reprogramming of somatic cells into astrocytes using certain transcription factors involves introducing transgenes and therefore leaves “footprint” of residual transgenes or other contaminants.
(17) Introducing exogenous factors in reprogramming has raised various concerns, including the risk of insertional mutagenesis and genetic alteration associated with retroviral delivery (Hawley, 2008), low reprogramming efficiency associated with episomal transfection (Okita et al., 2008). Cocktails of small molecules were shown to convert mouse or human fibroblasts into neurons (Hu et al., 2015; Li et al., 2015). However, no chemical reprogramming has been reported to change fibroblasts, or any other mature cell types, to astrocytes yet.
(18) The technology and methods disclosed herein solves the problems in the art by direct reprogramming or converting somatic cells such as fibroblasts into astrocytes using one or more small molecules without the requirement of producing any intermediate stem cells and without introducing any transgene or contaminant. The process of direct reprogramming disclosed herein takes much shorter time, e.g., less than or about 30 days, than the conventional technology, e.g., 90 days.
(19) As described in this disclosure, mouse or human fibroblasts were reprogrammed into functional astrocytes, which possess the ability to promote neuronal maturation and synaptic formation, uptake glutamate, and induce calcium signal in response to glutamate stimulation. Although rapid progress has been made in converting somatic cells into other types of neural cells, such as neural stem cells, neurons, and oligodendrocytes, direct reprogramming of somatic cells into astrocytes remains largely behind. Induced neurons can be developed into useful tools for modeling a variety of neurological diseases affecting neurons (Lujan and Wernig, 2012). However, induced neuronal cells would have limitations for modeling disease affecting astrocytes. Although astrocytes could be derived from iPSCs, the differentiation process is lengthy. These limitations could be overcome by inducing astrocytes directly from fibroblasts in a relatively short period of time as described in detail in this disclosure.
(20) Disclosed herein is an example of pure chemical induction of lineage conversion from a mature somatic cell type to astrocytes. A previous study reported the derivation of iPSCs from mouse somatic cells using 6 small molecules VC6TFZ (Hou et al., 2013). Part of this compound cocktail, VC6 was used to convert somatic cells into neural progenitor cells under hypoxia (Cheng et al., 2014). In recent studies, different combinations of small molecules were used to convert somatic cells into neuronal cells (Hu et al., 2015; Li et al., 2015; Zhang et al., 2015). Disclosed herein is a method to reprogram mammalian fibroblasts into astrocytes using small molecule compounds only, without using any transgenes or viral transduction. Moreover, it was unexpectedly found that the TGFβ inhibitor alone was able to induce GFAP-positive cells from MEFs, providing an example that one single compound is able to induce the conversion of one somatic cell type to another.
(21) Previous studies described ways to derive astrocytes from somatic cells by going through iPSC or iNSC/iNPC intermediates (Han et al., 2012; Lujan et al., 2012; Ring et al., 2012; Thier et al., 2012; Cassady et al., 2014). In these studies, astrocytes were derived from MEFs at an efficiency of 0.004% to 2% in up to 70 days. Disclosed herein is a direct reprogramming method that does not go through iPSC or iNSC/iNPC intermediate state. Astrocytes can be converted from MEFs at an efficiency of about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%, in a shorter period of time, such as 20 to 25 days, by the method disclosed herein. Therefore, the direct chemical reprogramming method described in this disclosure provides a more rapid and efficient way to derive astrocytes from fibroblasts.
(22) As disclosed herein, the chemically induced astrocytes can be used to model diseases with astrocyte dysfunction. The working examples demonstrate that when an AxD mutant GFAP was transfected into induced astrocytes, the phenotype of GFAP protein aggregation observed in AxD patient astrocytes was recapitulated. Moreover, these protein aggregates were responsive to ceftriaxone treatment. Therefore, the chemically induced astrocytes disclosed herein can be used as a tool to study neurodevelopment in glial context, and to model a variety of neurological diseases with astrocyte dysfunction. Additionally, induced astrocytes containing disease-causing mutations can be produced by the methods disclosed herein. The induced astrocytes, as well as induced astrocytes containing mutations can be used for detecting, preventing or treating astrocyte-associated diseases.
(23) In one aspect, disclosed herein is a method of reprogramming or converting somatic tissue or cells into astrocytes or astroglial progenitor cells using one or more small molecules only, without introducing any transgenes. In some embodiments, the somatic tissue or cells to be converted into astrocytes or astroglial progenitor cells are autologous tissue or cells. In some embodiments, the somatic tissue or cells that can be converted to astrocytes or astroglial progenitor cells include fibroblasts, urinary cells, blood cells, adipocytes, keratinocytes, and dental pulp cells.
(24) The method includes contacting the somatic tissue or cells with one or more small molecules, wherein the one or more small molecules include at least one TGF-β inhibitor. In some embodiments, the TGF-β inhibitor is an inhibitor of TGF-βR1 (ALK5). The somatic tissue or cells are cultured in the presence of the one or more small molecules under a suitable condition for a period of time sufficient for the somatic tissue or cells to be converted into astrocytes or astroglial progenitor cells.
(25) In some embodiments, a single small molecule is sufficient to induce the conversion to astrocytes or astroglial progenitor cells, and the small molecule is a TGF-β inhibitor. In other embodiments, two or more small molecules are used, and at least one small molecule is a TGF-β inhibitor.
(26) Small molecule TGF-β inhibitors are known in the art (Calone 2012) and many are commercially available. Some examples of TGF-β inhibitors include but are not limited to 616452, A-83-01, SB-431542, SD-208, LY 2109761, GW 788388, LDN-212854, A 77-01, LY2157299, K02288, ML347, and SB-505124 hydrochloride, as shown in Table 1 below.
(27) TABLE-US-00001 TABLE 1 TGF-β Inhibitors Small Molecule Chemical Name Chemical Structure 616452 (Alk 5 Inhibitor II or RepSox) 2-[5-(6-methylpyridin-2-yl)- 1H-pyrazol-4-yl]-1,5- naphthyridine
(28) In some embodiments, two or more small molecules are used. In combination with a TGF-β inhibitor, at least one of a histone deacetylase (HDAC) inhibitor, a GSK3β inhibitor, a lysine specific histone demethylase 1 (LSD1) inhibitor, and an Oct4-activating compound can be used. Some examples of each category are provided in the tables below.
(29) TABLE-US-00002 TABLE 2 HDAC Inhibitors Small Molecule Chemical Structure Trichostatin A
(30) TABLE-US-00003 TABLE 3 GSK3β Inhibitors Small Molecule Chemical Structure GSK-3 Inhibitor IX
(31) TABLE-US-00004 TABLE 4 LSD1 Inhibitors Small Molecule Chemical Structure Tranylcypromine
(32) OAC compounds have the following structure with each substituent group listed in Table 5:
(33) ##STR00032##
(34) TABLE-US-00005 TABLE 5 OAC Compounds Oct4- Oct4-luc Enhance re- Com- luc fold In- programming pound X Y Z R1 R2 R3 R4 R5 Activity duction efficiency C1 N C C H H H H H Active 4.72 YES C2 CH C C H H H H H Active 4.15 YES C3 CH C C H H F H H Active 3.84 YES C4 CH C C H H MeO H H Active 5.46 ND C5 CH C C H ═N—O—N═ H H Active 2.87 ND C6 CH N C H H MeO H — Active 3.18 ND C7 CH N C H H F H — Active 2.2 ND C8 CH N C H H H H — Active 1.89 ND C9 CH N C H H EtO H — Active 7.22 ND C10 CH N C H H Et H — Active 4.51 ND C11 CH N C H H iso-Pr H — Active 3.78 ND C12 CH N C Cl H Cl H — Active 3.6 ND C13 CH N C H Me Me H — Active 2.78 ND C14 CH N C H EtO H H — Active 2.67 ND C15 CH N C H MeO H H — Active 1.93 ND C16 CH C C H H F
(35) Table 5 shows the Oct4-activating activity of compound C1 and its structural analogs. Compounds that induce Oct4-luc 1.8-fold or more were classified as being “active”, and molecules that induce Oct4-luc less than 1.8-fold were indicated as being “inactive”. ND: not determined.
(36) These inhibitors and compounds are known in the art. Therefore, it is within the purview of one skilled in the art to select a suitable compound from each category and/or to select a suitable combination of different categories. For example, a TGF-β inhibitor is used in combination with a histone deacetylase inhibitor, or in combination with a histone deacetylase inhibitor and a GSK3β inhibitor. Other examples include the combination of a TGF-β inhibitor with a histone deacetylase inhibitor and a GSK3β inhibitor, a TGF-β inhibitor with a histone deacetylase inhibitor and an Oct4-activating compound, or a TGF-β inhibitor with a LSD1 inhibitor and an Oct4-activating compound. The combinations of a TGF-β inhibitor with different categories of at least one of a histone deacetylase inhibitor, a GSK3β inhibitor, a lysine specific histone demethylase 1 (LSD1) inhibitor, and an Oct4-activating compound are for illustration purposes only and are not intended to limit the scope of this invention.
(37) In some embodiments, one or more small molecules include a combination of a histone deacetylase inhibitor VPA (V), a GSK3β inhibitor CHIR99021 (C), a TGF-β inhibitor 616452 (6), A-83-01 (A) or SB-431542 (S), a lysine specific histone demethylase LSD1 inhibitor tranylcypromine (T), and an Oct4-activating compound OAC1 (O). In some embodiments, the combination of the small molecules is “VC6TO,” “VCATO,” or “VCSTO,” which includes the compounds disclosed herein. In a preferred embodiment, the combination comprises at least one small molecule that is a TGF-β inhibitor.
(38) In some embodiments, the concentration of a TGF-β inhibitor, either used alone or in combination with one or more other small molecules, is within a range between 1 μM and 100 μM, between 2 μM and 50 μM, between 3 μM and 30 μM, between 5 μM and 10 μM. In some embodiment, the concentration of a TGF-β inhibitor is about 1 μM, about 2 μM, about 3 μM, about 4 μM, about 5 μM, about 6 μM, about 7 μM, about 8 μM, about 9 μM, about 10 μM, about 11 μM, about 12 μM, about 13 μM, about 14 μM, about 15 μM, about 20 μM, about 25 μM, about 30 μM, about 35 μM, about 40 μM, about 45 μM, or about 50 μM, without causing significant cytotoxicity.
(39) Upon culturing the somatic tissue or cells in the presence of one or more small molecules for a period of between 7 days and 90 days, between 10 days and 60 days, between 15 days and 45 days or between 20 days and 30 days, the somatic tissue or cells are reprogrammed or converted into functional astrocytes or astroglial progenitor cells. It is within the purview of one skilled in the art to adjust the culturing period to optimize the percentage of conversion, for example, by choosing different combinations of the small molecules. The induced astrocytes or astroglial progenitor cells contain either or both of anterior and posterior subtypes. The induced astrocytes or astroglial progenitor cells can also contain either or both of dorsal and ventral subtypes.
(40) As discussed in the examples below, the one or more small molecules disclosed herein can reprogram or convert somatic tissue or cells to astrocytes or astroglial progenitor cells. The mouse or human induced astrocytes resemble primary astrocytes in astrocytic gene expression and epigenetic status, and exhibit functional properties in promoting neuronal maturation, glutamate uptake and calcium signaling. Moreover, these cells can recapitulate Alexander disease phenotype of protein aggregation when expressing Gfap with a disease-causing mutation. The same compounds can also reprogram human fibroblasts into astroglial progenitor cells that can be further matured into functional astrocytes. Therefore, these induced astrocytes can be used in methods for preventing or treating neurodevelopmental disorders or neurological diseases that are associated with dysfunction of astrocytes. These induced astrocytes can also be used to screen and test candidate drugs for these diseases.
(41) In some embodiments, this disclosure relates to a method of preventing or treating a neurodegenerative disease or a neurological disorder associated with astrocyte dysfunction in a subject. The method entails reprogramming or converting somatic tissue or cells into astrocytes or astroglial progenitor cells using one or more small molecule compounds as disclosed herein, and transplanting the astrocytes or astroglial progenitor cells into the brain of the subject suffering from the neurodegenerative disease or neurological disorder. In some embodiments, the somatic tissue or cells are autologous tissue or cells isolated from the subject to be treated. In some embodiments, the somatic tissue or cells that can be converted to astrocytes or astroglial progenitor cells include fibroblasts, urinary cells, and blood cells. The neurodegenerative diseases or neurological disorders associated with astrocyte dysfunction include, for example, Alzheimer's disease, Alexander disease, Parkinson's disease, Huntington disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis (MS), epilepsy, stroke and cerebral ischemia.
(42) The terms “treat,” “treating,” or “treatment” as used herein with regards to a condition refers to preventing the condition, slowing the onset or rate of development of the condition, reducing the risk of developing the condition, preventing or delaying the development of symptoms associated with the condition, reducing or ending symptoms associated with the condition, generating a complete or partial regression of the condition, or some combination thereof. In some embodiments, treating a condition means that the condition is cured without recurrence.
(43) The working examples below further illustrate various embodiments of this disclosure. By no means the working examples limit the scope of this invention.
Example 1 Materials and Methods
(44) Cell culture. MEFs and TTFs were derived from E13.5 embryos of Oct4-GFP transgenic (OG2) mice (Szabo et al., 2002), wild type or GFAP-GFP transgenic mice (Jackson Laboratory) (Zhuo et al., 1997). These cells were cultured in MEF medium containing DMEM, 10% FBS, 0.1 mM nonessential amino acids, and 2 mM L-glutamine. Mouse primary astrocytes were isolated from P1-2 pups following published protocol (Schildge et al., 2013) and cultured in DMEM containing 10% FBS.
(45) Direct reprogramming mouse fibroblasts into astrocytes. MEFs were plated on 6-well or 12-well plates at a cell density of 3×10.sup.3 cells/cm.sup.2. Cells were cultured in MEF medium for 24 hr, then changed to mouse induced astrocyte medium (iAM) containing knock-out DMEM with 10% knock-out serum replacer, 10% FBS, 2 mM L-glutamine, 0.1 mM NEAA, 0.1 mM β-mercaptoethanol, and 100 ng/ml FGF. Cells were treated with compounds, including 500 nM valproaic acid (VPA) (Stemgent), 3 μM CHIR99021(D&C chemicals), 10 μM SB-431542 (D&C chemicals), 10 μM Tranylcypromine (Stemgent), and 1 μM OAC1(Li et al., 2012) for 10 days, replated onto Matrigel-coated plates (BD Biosciences) and continued with compound treatment for another 15 days. Cells were then switched to mouse astrocyte medium (AM) containing DMEM with 10% heat-inactivated FBS.
(46) Immunocytochemistry. Cells were fixed in 4% paraformaldehyde (PFA) for 10 min, followed by washes in PBS at room temperature (RT). Cells were then blocked with 3% donkey serum in PBS containing 0.01% Triton-X 100 for 1 h at RT, and incubated with primary antibodies overnight at 4° C., then washed with PBS and incubated with secondary antibodies for 1 h at RT. Primary antibodies for GFAP (1:2000, DAKO, Z0334), S100μ (1:200, NOVUS, NB110-57478), ALDH1L1 (1:200, NeuroMab, 75-140), Synapsin (1:1000, SYSY, 106103), αB-crystallin (1:200, Enzo, ADI-SPA-223), MAP2 (1:500, GeneTex, GTX11268), Tuj1 (1:6,000, Covance, PRB-435P), NeuN (1:400, Millipore, MAB377), Pax6 (1:500, Covance, PRB-278P), Sox1 (1:500, Millipore, AB15766), Oligo2 (1:200, GeneTex, GTX62440), NG2 (1:500, Millipore, MAB5384), NKX2.2 (1:50, DSHB, 745A5) were used. Nuclei were stained with DAPI (1:6,000, Sigma, D9564).
(47) Cell sorting and microarray gene expression analysis. GFAP-GFP positive iAs were sorted using the FACSAria III cell sorter (BD Bioscience). Gene expression profiling was performed using Mouse Gene 2.0 ST array (Affymetrix). Microarray data analysis was performed using Partek® Genomics Suite™ (Partek, Inc.). Expression values were Robust Multi-array Average (RMA) normalized (Irizarry et al., 2003). Fold-change values represent the linear ratio between signal intensities when the ratio value is greater than 1 and −1/ratio when the ratio is less than 1. Genes were defined as differentially expressed if they showed a fold-change value >1.5. Heatmaps to visualize differentially expressed genes were produced in Partek using Euclidian distance for hierarchical clustering of standardized expression values. Gene Ontology enrichment was performed for functional enrichment of commonly affected genes, with p-values calculated via Fisher's exact test. Microarray data have been deposited to NCBI's GEO under accession number GSE81927.
(48) Real time PCR. Total RNA was extracted using Trizol reagent (Qiagen), cDNAs were prepared using Tetro cDNA synthesis kit (Bioline). Real time PCR was performed using DyNAmo Flash SYBR Green qPCR mix on a StepOnePlus system (Applied Biosciences) and normalized to β-Actin. Primers used are listed in Table 6 below.
(49) TABLE-US-00006 Gene Forward sequence Reverse sequence Gfap GAAGTTCGAGAACTCCGGGAG TTAGACCGATACCACTCCTCTG mS100B CCCTCATTGATGTCTTCCACCA CTTCGTCCAGCGTCTCCATCAC Aldh1L1 GGAAGACAGCAGCCTGCCTG CTTCACATTACTCAGGGCAC NFIA ACAGGTGGGGTTCCTCAATC GAGGCTTGGTGTCTGGCATG Ctnnal1 GGAGAAGGTCACGGAGATCG TGAAGTCCTCCACATCCTCC Ndp TGGACTCTCAACGCTGCATG GGACAGTGCTGAAGGACACC Lix1 GGAGTTCATCATGGAGAGTG CATTCCAGTGCAGTAGTTGG Sox6 CTTGCCGATGTGGTGGATAC CTCTGCAAGGCTCTCAGGTG TlrS TCACTTGCTCATTCTCCCTT GACCTCTCCATTCCTGGC Let7b TCGACTCGAGCCCTCTCACTGAACC GCGAATTCTTAATTAAAAACCACCC TCTGTCTCC AATCTGTGGCTCCA Col12a1 AGGAGTTGATGAGCAGCTTG GGTCACGAACATTGAGCGTG Col6a3 TCTTGAACGTGTGGCTAACC TCTCCAGAGCACTTGCATGG Col3a1 GCCCACAGCCTTCTACAC CCAGGGTCACCATTTCTC Col1a1 GCAACAGTCGCTTCACCTACA CAATGTCCAAGGGAGCCACAT P21 AATCCTGGTGATGTCCGACC CAAAGTTCCACCGTTCTCGG ATF4 GAGCTTCCTGAACAGCGAAGTG TGGCCACCTCCAGATAGTCATC P27 GCCTGACTCGTCAGACAATC CGTCTGCTCCACAGTGCCAG DCN TGAGCTTCAACAGCATCACC AAGTCATTTTGCCCAACTGC Gadd45b CCTGGCCATAGACGAAGAAG AGCCTCTGCATGCCTGATAC IFRD1 ACAGGCAGCTCTTGAAGGTC AGACAGCGCTCAATGCTATC TGFB1I1 GCCTCTGTGGCTCCTGCAATAAAC CTTCTCGAAGAAGCTGCTGCCTC TGFBI CCAAGTCACCCTACCAGCTG TCCTCTGGTACCACTGCTTG TSC22D1 GCTGCTGCTGCTGTCTGAAC ACATCCCTGCTCACTCTCTG FOXG1 TGGCAACACTGCCCATTCA GCATTTGCGCAACACAGGTTA Hoxb4 TTCACGTGAGCACGGTAAAC CACTTCATGCGCCGATTCTG NKX2.1 AAAACTGCGGGGATCTGAG TGCTTTGGACTCATCGACAT Pax3 ACTACCCAGACATTTACACCAGG AATGAGATGGTTGAAAGCCATCAG Sox1 CCAAGAGACTGCGCGCGCTG TGAGCAGCGTCTTGGTCTTG Pax6 ACCAAAGGGTCATCGCGCCC TGGCAGTCCTTGCGATCGGC Oct4 TAGGTGAGCCGTCTTTCCAC GCTTAGCCAGGTTCGAGGAT Nanog CAGGAGTTTGAGGGTAGCTC CGGTTCATCATGGTACAGTC AOP4 TTCTCTTCGGTGCTAGGAAAC AGGAAGCTTATGTCTCTGGTG Glast1 CTAGTTGTCTTCTCCATGTG AGGAGAGGCAGGACGATGAC Glt1 GCGCATGTGCGACAAGCTGG GCGATGCCAAGCGAAGCAGC 36B4 TGGTGCTGATGGGCAAGAA ATTCCCCCGGATATGAGGC Actin CCGGCGTGGCTACAGCTTC ACCTGGCCGTCAGGCAGCTC mGfap TTGTTGGTATGGAGTATAGGTTGTT CCTACCTTCCTCTACCCATACTTAA GTTAT ACT
(50) Astrocyte-neuron co-cultures. Mouse cortical neurons were isolated from E13.5 mouse embryo and cultured in neuronal culture media (neurobasal, 1× B27, 2 mM L-glutamine) alone or directly on a layer of induced astrocytes (iA), mouse primary astrocytes (pA) or MEF for 5 days. Mouse neurons, iA, pA or MEFs were plated at the same density of 10,000 cells/cm.sup.2. The co-cultured cells were stained for MAP2 and Synapsin. The Synapsin+puncta along the MAP2+ neurites were expressed as the number of puncta per 50 μm neurite length.
(51) Transplantation. Induced astrocytes labeled by GFP-expressing lentivirus were dissociated using trypsin-EDTA and resuspended in medium at 100,000 cells/μl density and kept on ice. Two μl cell suspensions were injected 1 mm from the midline between the Bregma and Lambda and 1 mm deep into the anterior lateral ventricles of immunodeficient neonatal NSG mice. After 6 weeks, mice were euthanized and perfused with 4% PFA for 5 min. Brain tissues were harvested for immunostaining. All animal work was performed under the IACUC protocol approved by the City of Hope IACUC Committee.
(52) Ca.sup.2+ imaging. Cells were seeded in 12-well plates at a density of 1×10.sup.5 cells per well and stimulated with 10 μM glutamic acid. Fluo-4 Calcium Imaging Kit (Invitrogen F10489) was used to monitor calcium waves following manufacturer's instructions. Calcium waves were captured using a Zeiss Observer Microscope. Wave intensity was analyzed using Image Pro Premier and the intensity was measured as ΔF/F0=(F−F0)/F0.
(53) Bisulfite sequencing. Genomic DNAs were isolated from MEF, FACS-sorted induced astrocytes and mouse primary astrocytes using a Genomic DNA Purification Kit (Qiagen). Bisulfite conversion of genomic DNAs was carried out using the EZ DNA Methylation-Gold Kit (Zymo Research). The bisulfite-modified DNA was then used as a template for PCR to amplify the promoter region of Gfap. The amplified products were cloned into the pCR2.1-TOPO cloning vector (Invitrogen), and 10 randomly selected clones were sequenced using T7 or M13R primers.
(54) Glutamate uptake assay. The glutamate uptake was measured using the Glutamate Assay Kit (BioVision). Induced astrocytes were plated at a concentration of 2×10.sup.4 cells per well in a 24-well plate. 100 μM L-glutamate was added to each well. After incubation for 6 h, the glutamate concentration in the media was measured and presented as nmol of glutamate per mg of total proteins.
(55) Transfection into induced astrocytes. Induced astrocytes (iA) were seeded at 1×10.sup.5 cells per well in 12-well plates and incubated overnight. Then 2 μg plasmid of human wild type (WT) GFAP-GFP or AxD mutant GFAP-GFP with the R239C mutation (Bachetti et al., 2008) was transfected into iA using Lipofectamine® 2000 (Invitrogen). Forty eight hr after transfection, cells were assayed by immunostaining. For drug treatment, 24 hr after transfection, cells were treated with vehicle control or 100 μM ceftriaxone for 48 hr, followed by immunostaining.
(56) Inducing human fibroblasts for astrocytic conversion. Human fibroblasts were purchased from Millipore (SCC058) or Coriell (AG14048) and tested for lack of mycoplasm contamination. Human fibroblasts were seeded onto 6-well plates at the density of 10.sup.4 cells/cm.sup.2 and cultured in either FibroGRO complete medium (for SCC058) or Eagle's MEM with 15% non-inactivated fetal bovine serum (for AG14048) for 24 hr, then switched to induced astrocyte medium containing DMEM/F12 with 2 mM L-glutamine, 0.1 mM NEAA, 1×N2, 1×B27 and 100 ng/ml FGF. For SCC058, cells were treated with VCSTO compounds, including 500 nM VPA (Stemgent), 3 μM CHIR99021 (D&C chemicals), 10 μM SB-431542 (D&C chemicals), 10 μM Tranylcypromine (Stemgent), and 1 μM OAC1 (Li et al., 2012) for 20 days, replated onto Matrigel-coated plates and continued with compound treatment for another 20 days. Cells were then treated with 10 ng/ml CNTF for another 6 days. For AG14048, cells were treated with VCSTO compounds at the same concentration as described above for 30 days, then treated with VCSTO together with 10 ng/ml CNTF for another 10 days.
(57) FSP1 FACS analysis. MEFs were stained by FSP1 antibody (Millipore, ABF32). FACS analysis was performed on Flow Cytometry Analyzers BD Fortessa (BD Bioscience).
(58) Statistical analysis. Independent-samples t-test was used to compare means of two independent samples. A value of p<0.05 was considered statistically significant.
Example 2 A Compound Cocktail Induced the Conversion from MEFs to Astrocyte-Like Cells
(59) A compound combination including the histone deacetylase inhibitor VPA (V), the GSK3β inhibitor CHIR99021 (C), the TGFβ inhibitor 616452 (6), the lysine specific histone demethylase LSD1 inhibitor Tranylcypromine (T), the cyclic AMP inducer forskolin (F), and a histone methylation inhibitor DZNep (Z) was used to reprogram mouse embryonic fibroblasts (MEFs) into iPSCs (Hou et al., 2013). In this chemical cocktail, compounds F and Z were used together to induce the expression of Oct4, a factor critical for reprogramming. It was also reported that a small molecule OAC1 was used as an Oct4-activating compound (Li et al., 2012). In this example, the combination of VC6T with the OAC1 compound (together termed VC6TO) was tested to reprogram MEFs into iPSCs. MEFs were derived from mice harboring an Oct4 promoter-driven GFP (OG2) reporter. However, treatment with VC6TO for up to 25 days failed to induce any Oct4-GFP-positive iPSC colonies from the OG2 MEFs. Instead, cells with astrocyte-like morphology were observed (
(60) Subsequently, the VC6TO cocktail was tested to see if it could reprogram MEFs into astrocytes. Any neural tissues was excluded from the MEF preparation (
Example 3 A TGF Inhibitor was Critical for Astrocytic Conversion
(61) Compounds critical for astrocytic conversion were identified. The combination of VC6, V6, or 6 alone, was able to induce GFAP-positive cells from MEFs, although the efficiency of conversion decreased when the number of compounds was reduced. In contrast, subtraction of compound 6 from VC6TO led to failure of astrocytic conversion, as revealed by the lack of GFAP-positive cells (
(62) Since compound 6 is a transforming growth factor β (TGFβ) receptor 1 kinase inhibitor (Gellibert et al., 2004), other inhibitors of TGFβ receptor 1 were tested for inducing astrocytic reprogramming together with VCTO. Compound A-83-01 (A) or SB-431542 (S), two well-characterized inhibitors of TGFβ receptor 1 (Inman et al., 2002; Tojo et al., 2005) was tested. Treating MEFs with either the combination of VCTO with A (VCATO) or VCTO with S (VCSTO) induced a substantial increase in GFAP-positive cells with astrocyte morphology (
(63) Individual compounds were subtracted from VCSTO to determine the effect of individual compounds on astrocytic conversion. Similar to removal of 6, subtraction of S from VCSTO led to almost complete loss of GFAP-positive cells (
(64) Since S was identified as a critical compound for astrocytic reprogramming, the dose response of compound S was determined. MEFs were treated with VCSTO at different concentrations of S from 0 to 10 μM, and observed increased GFAP-positive cells with elevated concentrations of S (
(65) Since S is an inhibitor of TGFβ receptor 1 (Inman et al., 2002), whether the TGFβ signaling is suppressed by VCSTO treatment was tested. After 24 hr VCSTO treatment of MEFs, dramatic inhibition of gene expression was observed for a set of TGFβ downstream effectors (
(66) To determine if astrocyte-like cells could also be converted from other cell types, mouse tail-tip fibroblasts (TTFs) were treated with VCSTO compounds. Twenty-five days after VCSTO treatment, GFAP-positive and S100β-positive cells with astrocyte morphology were detected (
Example 4 VCSTO-Induced Cells Express Astrocytic Genes and Exhibit Epigenetic Reprogramming
(67) To verify that the VCSTO-reprogrammed cells were indeed astrocytes, astrocytic marker expression in these cells was first determined. Double staining for GFAP and S100β revealed that the VCSTO-induced cells expressed both GFAP and S100β (
(68) Because astrocytes could be visualized by GFP fluorescence in the GFAP-GFP reporter mice (Zhuo et al., 1997), MEFs from these mice were derived and treated with VCSTO to monitor astrocytic conversion. GFAP-GFP-positive cells emerged around day 10 to day 15 after VCSTO treatment. The induced cells were visualized for GFAP-GFP fluorescence and immunostained for GFAP at day 25 after VCSTO treatment. Nearly all GFAP-GFP positive cells were also positive for GFAP immunostaining (
(69) Astrocytes express high levels of glutamate transporters, predominantly GLT-1 and GLAST (Chaudhry et al., 1995). Aquaporin 4 (AQP4), a member of the aquaporin family of membrane proteins, is also enriched in astrocytes (Simard and Nedergaard, 2004). Real time PCR revealed that the VCSTO-reprogrammed cells expressed high levels of Glt-1, Glast, and Aqp4, in addition to the astrocytic markers Gfap, S100β, and Aldh1l1 (
(70) An important aspect of reprogramming is epigenetic reprogramming. Demethylation of the Gfap promoter has been shown to be associated with astrocyte differentiation (Hatada et al., 2008). The Gfap promoter was tested to see if it is demethylated during astrocytic conversion from MEFs. VCSTO-induced cells were sorted for GFAP-positive cells after GFAP staining. The resultant cells were subjected to DNA methylation analysis. Bisulfite sequencing revealed that the Gfap promoter of VCSTO-induced cells was largely demethylated, similar to that in primary astrocytes (
(71) To determine the dynamic expression pattern of astrocytic genes during the conversion, MEFs were treated with VCSTO for various time periods and immunostaining and RT-PCR were performed at days 10, 15, 20 and 25. GFAP-positive cells were seen at day 10 after compound treatment, although the efficiency was low (
Example 5 Genome-Wide Remodeling and Regional Specification in VCSTO-Induced Astrocytes
(72) Genome-wide profiling was performed to compare gene expression pattern of VCSTO-induced astrocytes with that of primary astrocytes and MEFs. MEFs were derived from GFAP-GFP reporter mice and treated with VCSTO for 25 days. The reprogrammed cells were sorted for GFAP-GFP-positive cells and subjected to DNA microarray analysis, along with primary astrocytes and MEFs. A heatmap depicting all probe sets that were differentially expressed by at least 1.5-fold showed that the transcriptional program characteristic of MEFs was globally reprogrammed toward that of astrocytic lineage (
(73) Validation of differentially expressed genes revealed that the known fibroblast-related genes were down-regulated in both VCSTO-induced astrocytes and primary astrocytes, compared to MEFs (
(74) To determine the regional subtypes of VCSTO-induced astrocytes, real time PCR was performed to measure the expression levels of markers for forebrain (Foxg1, Otx1, Otx2), hindbrain (Hoxb4, Egr2, and Grx2), dorsal (Pax3, Trhr) and ventral (Nkx2.1, Lix1) brains (
Example 6 VCSTO-Induced Astrocytes are Functional
(75) To test if compound-induced astrocytes possess astrocyte function to promote neuronal maturation and synaptic formation, the induced astrocytes were co-cultured with mouse primary cortical neurons. Neuronal maturation was evaluated by immunostaining with a mature neuronal marker, MAP2, at day 5 after co-culture. Both total neurite length and neurite complexity were increased in neurons co-cultured with induced astrocytes or primary astrocytes, compared to that in neurons co-cultured with MEFs (
(76) Next, whether the compound-induced astrocytes were functional in glutamate uptake was determined. Primary astrocytes, induced astrocytes and parental MEFs were cultured in media containing glutamate for 6 hr, the concentration of glutamate in the media was measured to determine glutamate uptake. Both induced astrocytes and primary astrocytes exhibited substantial glutamate uptake, compared to MEFs (
(77) Calcium imaging analysis revealed that the VCSTO-induced astrocytes exhibited glutamate-induced calcium spikes, in a manner similar to primary astrocytes, whereas MEFs did not respond to glutamate stimulation with calcium spikes (
Example 7 VCSTO-Induced Astrocytes can Survive and Retain Astrocyte Identity In Vivo
(78) To determine if compound-induced astrocytes can survive and maintain their astrocytic identity in vivo, the VCSTO-induced astrocytes were labeled with a GFP reporter and transplanted into the lateral ventricles of immunodeficient neonatal NOD scid gamma (NSG) mice (
Example 8 Compound-Induced Astrocytes can be Used to Model Neurological Disease
(79) AxD is a neurological disease with astrocyte dysfunction and is caused by genetic mutation of the GFAP gene (Messing et al., 2012). Expression of AxD mutant GFAP induces the expression of αB-crystallin, a small heat shock protein, and the formation of protein aggregates containing GFAP and αB-crystallin in astrocytes (Messing et al., 2012). The compound-induced astrocytes were tested to see if they could be used to model AxD. Plasmid expressing GFP fusion of the wild type (WT) or AxD mutant GFAP containing the R239C mutation, a hotspot mutation for AxD (Hagemann et al., 2006), were transfected into VCSTO-induced astrocytes. Expression of the AxD mutant GFAP in induced astrocytes promoted the expression of αB-crystallin and the formation of protein aggregates immunoreactive for GFAP and αB-crystallin, whereas transfection of the same amount of WT GFAP-GFP did not induce detectable αB-crystallin expression and GFAP protein aggregation (
(80) Moreover, glutamate uptake assay revealed that VCSTO-induced astrocytes transduced with the AxD mutant GFAP exhibited reduced glutamate uptake, compared to VCSTO-induced astrocytes transduced with WT GFAP (
Example 9 VCSTO Could Induce Astrocytic Conversion from Human Fibrobasts
(81) To determine if human fibroblasts could be induced for astrocytic conversion using small molecule compounds, human foreskin fibroblasts were treated with VCSTO compounds. Forty days after compound treatment, a large number of cells with astroglial progenitor-like morphology were observed. Because S100β is a marker for human astroglial progenitor cells and astrocytes, the VCSTO-treated cells were stained for S100β and it was found that more than 30% of cells were S100β+ cells, whereas no S100β+ cells were detected in DMSO-treated cells (
(82) In a parallel experiment, robust induction of astrocyte marker genes, GFAP, S100β, AQP4 and EAAT2, was detected in VCSTO-reprogrammed cells (iA), to a level that is similar to or higher than that in human iPSC-derived astrocytes (hA) (
(83) To determine if adult human fibroblasts could be induced into astrocytes using small molecules, human fibroblasts derived from a 71 year-old donor were treated with the VCSTO compounds. After forty days of VCSTO compound treatment and ten days of CNTF-induced maturation, both S100β+ cells and GFAP+ cells were detected in VCSTO-treated cells, but not in DMSO-treated cells (
(84) All publications and patent documents cited herein are incorporated by reference.
REFERENCES
(85) Bachetti, T., Caroli, F., Bocca, P., Prigione, I., Balbi, P., Biancheri, R., Filocamo, M., Mariotti, C., Pareyson, D., Ravazzolo, R., et al. (2008). Mild functional effects of a novel GFAP mutant allele identified in a familial case of adult-onset Alexander disease. EurJ Hum Genet 16, 462-470. Bachetti, T., Di Zanni, E., Balbi, P., Bocca, P., Prigione, I., Deiana, G. A., Rezzani, A., Ceccherini, I., and Sechi, G. (2010). In vitro treatments with ceftriaxone promote elimination of mutant glial fibrillary acidic protein and transcription down-regulation. Experimental cell research 316, 2152-2165. Banker, G. A. (1980). Trophic interactions between astroglial cells and hippocampal neurons in culture. Science (New York, N.Y. 209, 809-810. Barres, B. A. (2008). The mystery and magic of glia: a perspective on their roles in health and disease. Neuron 60, 430-440. Bonaguidi, M. A., McGuire, T., Hu, M., Kan, L., Samanta, J., and Kessler, J. A. (2005). LIF and BMP signaling generate separate and discrete types of GFAP-expressing cells. Development (Cambridge, England) 132, 5503-5514. Caiazzo, M., Dell'Anno, M. T., Dvoretskova, E., Lazarevic, D., Taverna, S., Leo, D., Sotnikova, T. D., Menegon, A., Roncaglia, P., Colciago, G., et al. (2011). Direct generation of functional dopaminergic neurons from mouse and human fibroblasts. Nature 476, 224-227. Caiazzo, M., Giannelli, S., Valente, P., Lignani, G., Carissimo, A., Sessa, A., Colasante, G., Bartolomeo, R., Massimino, L., Ferroni, S., et al. (2015). Direct Conversion of Fibroblasts into Functional Astrocytes by Defined Transcription Factors. Stem Cell Reports. Calone, I., Souchelnytskyi S. (2012). Inhibition of TGFβ signaling and Its Implications in Anticancer Treatments. Exp. Oncol. 34, 9-16. Cassady, J. P., D'Alessio, A. C., Sarkar, S., Dani, V. S., Fan, Z. P., Ganz, K., Roessler, R., Sur, M., Young, R. A., and Jaenisch, R. (2014). Direct lineage conversion of adult mouse liver cells and B lymphocytes to neural stem cells. Stem Cell Reports 3, 948-956. Chaudhry, F. A., Lehre, K. P., van Lookeren Campagne, M., Ottersen, O. P., Danbolt, N. C., and Storm-Mathisen, J. (1995). Glutamate transporters in glial plasma membranes: highly differentiated localizations revealed by quantitative ultrastructural immunocytochemistry. Neuron 15, 711-720. Cheng, L., Hu, W., Qiu, B., Zhao, J., Yu, Y., Guan, W., Wang, M., Yang, W., and Pei, G. (2014). Generation of neural progenitor cells by chemical cocktails and hypoxia. Cell research 24, 665-679. Davis, R. L., Weintraub, H., and Lassar, A. B. (1987). Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell 51, 987-1000. Eroglu, C., and Barres, B. A. (2010). Regulation of synaptic connectivity by glia. Nature 468, 223-231. Gellibert, F., Woolven, J., Fouchet, M. H., Mathews, N., Goodland, H., Lovegrove, V., Laroze, A., Nguyen, V. L., Sautet, S., Wang, R., et al. (2004). Identification of 1,5-naphthyridine derivatives as a novel series of potent and selective TGF-beta type I receptor inhibitors. Journal of medicinal chemistry 47, 4494-4506. Gross, R. E., Mehler, M. F., Mabie, P. C., Zang, Z., Santschi, L., and Kessler, J. A. (1996). Bone morphogenetic proteins promote astroglial lineage commitment by mammalian subventricular zone progenitor cells. Neuron 17, 595-606. Hagemann, T. L., Connor, J. X., and Messing, A. (2006). Alexander disease-associated glial fibrillary acidic protein mutations in mice induce Rosenthal fiber formation and a white matter stress response. J Neurosci 26, 11162-11173. Hama, H., Hara, C., Yamaguchi, K., and Miyawaki, A. (2004). PKC signaling mediates global enhancement of excitatory synaptogenesis in neurons triggered by local contact with astrocytes. Neuron 41, 405-415. Han, D. W., Tapia, N., Hermann, A., Hemmer, K., Hoing, S., Arauzo-Bravo, M. J., Zaehres, H., Wu, G., Frank, S., Moritz, S., et al. (2012). Direct reprogramming of fibroblasts into neural stem cells by defined factors. Cell stem cell 10, 465-472. Hatada, I., Namihira, M., Morita, S., Kimura, M., Horii, T., and Nakashima, K. (2008). Astrocyte-specific genes are generally demethylated in neural precursor cells prior to astrocytic differentiation. PIoS one 3, e3189. Hawley, R. G. (2008). Does retroviral insertional mutagenesis play a role in the generation of induced pluripotent stem cells? Mol Ther 16, 1354-1355. Hou, P., Li, Y., Zhang, X., Liu, C., Guan, J., Li, H., Zhao, T., Ye, J., Yang, W., Liu, K., et al. (2013). Pluripotent stem cells induced from mouse somatic cells by small-molecule compounds. Science (New York, N.Y. 341, 651-654. Hu, W., Qiu, B., Guan, W., Wang, Q., Wang, M., Li, W., Gao, L., Shen, L., Huang, Y., Xie, G., et al. (2015). Direct Conversion of Normal and Alzheimer's Disease Human Fibroblasts into Neuronal Cells by Small Molecules. Cell stem cell 17, 204-212. Ichida, J. K., Blanchard, J., Lam, K., Son, E. Y., Chung, J. E., Egli, D., Loh, K. M., Carter, A. C., Di Giorgio, F. P., Koszka, K., et al. (2009). A small-molecule inhibitor of tgf-Beta signaling replaces sox2 in reprogramming by inducing nanog. Cell stem cell 5, 491-503. Inman, G. J., Nicolas, F. J., Callahan, J. F., Harling, J. D., Gaster, L. M., Reith, A. D., Laping, N. J., and Hill, C. S. (2002). SB-431542 is a potent and specific inhibitor of transforming growth factor-beta superfamily type I activin receptor-like kinase (ALK) receptors ALK4, ALK5, and ALK7. Mol Pharmacol 62, 65-74. Irizarry, R. A., Hobbs, B., Collin, F., Beazer-Barclay, Y. D., Antonellis, K. J., Scherf, U., and Speed, T. P. (2003). Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics 4, 249-264. Kim, J., Efe, J. A., Zhu, S., Talantova, M., Yuan, X., Wang, S., Lipton, S. A., Zhang, K., and Ding, S. (2011). Direct reprogramming of mouse fibroblasts to neural progenitors. Proceedings of the National Academy of Sciences of the United States of America 108, 7838-7843. Kohyama, J., Sanosaka, T., Tokunaga, A., Takatsuka, E., Tsujimura, K., Okano, H., and Nakashima, K. (2010). BMP-induced REST regulates the establishment and maintenance of astrocytic identity. The Journal of cell biology 189, 159-170. Li, W., Tian, E., Chen, Z. X., Sun, G., Ye, P., Yang, S., Lu, D., Xie, J., Ho, T. V., Tsark, W. M., et al. (2012). Identification of Oct4-activating compounds that enhance reprogramming efficiency. Proceedings of the National Academy of Sciences of the United States of America 109, 20853-20858. Li, X., Zuo, X., Jing, J., Ma, Y., Wang, J., Liu, D., Zhu, J., Du, X., Xiong, L., Du, Y., et al. (2015). Small-Molecule-Driven Direct Reprogramming of Mouse Fibroblasts into Functional Neurons. Cell stem cell 17, 195-203. Lin, T., Ambasudhan, R., Yuan, X., Li, W., Hilcove, S., Abujarour, R., Lin, X., Hahm, H. S., Hao, E., Hayek, A., et al. (2009). A chemical platform for improved induction of human iPSCs. Nature methods 6, 805-808. Lujan, E., Chanda, S., Ahlenius, H., Sudhof, T. C., and Wernig, M. (2012). Direct conversion of mouse fibroblasts to self-renewing, tripotent neural precursor cells. Proceedings of the National Academy of Sciences of the United States of America 109, 2527-2532. Maherali, N., and Hochedlinger, K. (2009). Tgfbeta signal inhibition cooperates in the induction of iPSCs and replaces Sox2 and cMyc. Curr Biol 19, 1718-1723. Messing, A., Brenner, M., Feany, M. B., Nedergaard, M., and Goldman, J. E. (2012). Alexander Disease. J Neurosci 32, 5017-5023. Molofsky, A. V., Krencik, R., Ullian, E. M., Tsai, H. H., Deneen, B., Richardson, W. D., Barres, B. A., and Rowitch, D. H. (2012). Astrocytes and disease: a neurodevelopmental perspective. Genes & development 26, 891-907. Najm, F. J., Lager, A. M., Zaremba, A., Wyatt, K., Caprariello, A. V., Factor, D. C., Karl, R. T., Maeda, T., Miller, R. H., and Tesar, P. J. (2013). Transcription factor-mediated reprogramming of fibroblasts to expandable, myelinogenic oligodendrocyte progenitor cells. Nature biotechnology 31, 426-433. Okita, K., Nakagawa, M., Hyenjong, H., Ichisaka, T., and Yamanaka, S. (2008). Generation of mouse induced pluripotent stem cells without viral vectors. Science (New York, N.Y. 322, 949-953. Pang, Z. P., Yang, N., Vierbuchen, T., Ostermeier, A., Fuentes, D. R., Yang, T. Q., Citri, A., Sebastiano, V., Marro, S., Sudhof, T. C., et al. (2011). Induction of human neuronal cells by defined transcription factors. Nature 476, 220-223. Rajan, P., and McKay, R. D. (1998). Multiple routes to astrocytic differentiation in the CNS. J Neurosci 18, 3620-3629. Ring, K. L., Tong, L. M., Balestra, M. E., Javier, R., Andrews-Zwilling, Y., Li, G., Walker, D., Zhang, W. R., Kreitzer, A. C., and Huang, Y. (2012). Direct reprogramming of mouse and human fibroblasts into multipotent neural stem cells with a single factor. Cell stem cell 11, 100-109. Schildge, S., Bohrer, C., Beck, K., and Schachtrup, C. (2013). Isolation and culture of mouse cortical astrocytes. J Vis Exp doi: 10.3791/50079. Simard, M., and Nedergaard, M. (2004). The neurobiology of glia in the context of water and ion homeostasis. Neuroscience 129, 877-896. Smith, J. R., Vallier, L., Lupo, G., Alexander, M., Harris, W. A., and Pedersen, R. A. (2008). Inhibition of Activin/Nodal signaling promotes specification of human embryonic stem cells into neuroectoderm. Developmental biology 313, 107-117. Sofroniew, M. V., and Vinters, H. V. (2010). Astrocytes: biology and pathology. Acta neuropathologica 119, 7-35. Song, H., Stevens, C. F., and Gage, F. H. (2002). Astroglia induce neurogenesis from adult neural stem cells. Nature 417, 39-44. Szabo, P. E., Hubner, K., Scholer, H., and Mann, J. R. (2002). Allele-specific expression of imprinted genes in mouse migratory primordial germ cells. Mechanisms of development 115, 157-160. Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676. Thier, M., Worsdorfer, P., Lakes, Y. B., Gorris, R., Herms, S., Opitz, T., Seiferling, D., Quandel, T., Hoffmann, P., Nothen, M. M., et al. (2012). Direct conversion of fibroblasts into stably expandable neural stem cells. Cell stem cell 10, 473-479. Tojo, M., Hamashima, Y., Hanyu, A., Kajimoto, T., Saitoh, M., Miyazono, K., Node, M., and Imamura, T. (2005). The ALK-5 inhibitor A-83-01 inhibits Smad signaling and epithelial-to-mesenchymal transition by transforming growth factor-beta. Cancer Sci 96, 791-800. Verkhratsky, A., Sofroniew, M. V., Messing, A., Delanerolle, N. C., Rempe, D., Rodriguez Arellano, J. J., and Nedergaard, M. (2012). Neurological diseases as primary gliopathies: A reassessment of neurocentrism. ASN neuro doi: 10.1042/AN20120010. Vierbuchen, T., Ostermeier, A., Pang, Z. P., Kokubu, Y., Sudhof, T. C., and Wernig, M. (2010). Direct conversion of fibroblasts to functional neurons by defined factors. Nature 463, 1035-1041. Wang, D. D., and Bordey, A. (2008). The astrocyte odyssey. Progress in neurobiology 86, 342-367. Xu, R. H., Sampsell-Barron, T. L., Gu, F., Root, S., Peck, R. M., Pan, G., Yu, J., Antosiewicz-Bourget, J., Tian, S., Stewart, R., et al. (2008). NANOG is a direct target of TGFbeta/activin-mediated SMAD signaling in human ESCs. Cell stem cell 3, 196-206. Yang, N., Zuchero, J. B., Ahlenius, H., Marro, S., Ng, Y. H., Vierbuchen, T., Hawkins, J. S., Geissler, R., Barres, B. A., and Wernig, M. (2013). Generation of oligodendroglial cells by direct lineage conversion. Nature biotechnology 31, 434-439. Yoo, A. S., Sun, A. X., Li, L., Shcheglovitov, A., Portmann, T., Li, Y., Lee-Messer, C., Dolmetsch, R. E., Tsien, R. W., and Crabtree, G. R. (2011). MicroRNA-mediated conversion of human fibroblasts to neurons. Nature 476, 228-231. Zhang, L., Yin, J. C., Yeh, H., Ma, N. X., Lee, G., Chen, X. A., Wang, Y., Lin, L., Chen, L., Jin, P., et al. (2015). Small Molecules Efficiently Reprogram Human Astroglial Cells into Functional Neurons. Cell stem cell 17, 735-747. Zhuo, L., Sun, B., Zhang, C. L., Fine, A., Chiu, S. Y., and Messing, A. (1997). Live astrocytes visualized by green fluorescent protein in transgenic mice. Developmental biology 187, 36-42.