MODIFIED S2 SUBUNIT OF THE CORONAVIRUS SPIKE PROTEIN
20220213148 · 2022-07-07
Inventors
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2770/20034
CHEMISTRY; METALLURGY
C12N2770/20021
CHEMISTRY; METALLURGY
C12N2770/20022
CHEMISTRY; METALLURGY
A61K39/00
HUMAN NECESSITIES
International classification
Abstract
The present invention relates i.a. to a recombinant avian coronavirus spike protein or fragment thereof comprising a mutation at amino acid position 865. Further, the present invention relates to an immunogenic composition comprising an avian coronavirus with such spike protein.
Claims
1. An avian coronavirus spike protein comprising an aromatic amino acid at position 865, wherein the spike protein or fragment thereof is not from IBV strain M41.
2. An avian coronavirus spike protein, wherein at least a part of the S2 subunit is from an avian coronavirus with a restricted cell or tissue tropism, and wherein the amino acid at position 865 is an aromatic amino acid.
3. A recombinant avian coronavirus spike protein comprising a mutation at amino acid position 865.
4. The avian coronavirus spike protein of claim 1, wherein the avian coronavirus is IBV (infectious bronchitis virus).
5. The avian coronavirus spike protein of claim 1, wherein the aromatic amino acid at amino acid position 865 is introduced by a mutation.
6. The avian coronavirus spike protein of claim 3, wherein amino acid at amino acid position 865 is mutated to an aromatic amino acid; or a polar amino acid at amino acid position 865 is mutated to an aromatic amino acid; or a glutamine at amino acid position 865 is mutated into a histidine.
7. The avian coronavirus spike protein of claim 1, wherein the aromatic amino acid at amino acid position 865 is a histidine.
8. The avian coronavirus spike protein of claim 1, wherein the aromatic amino acid at amino acid at position 865 or said mutation at amino acid position 865 leads to an extended cell or tissue tropism of the avian coronavirus.
9. The avian coronavirus spike protein of claim 1, wherein the avian coronavirus is infecting and/or replicating in at least one cell line selected from the list consisting of: DF-1 (Douglas Foster), PBS-12, PBS-12SF (PBS-12 serum free), BHK21 (baby hamster kidney), HEK 293T (human embryonic kidney), Vero (Verda Reno), MA104, RK13 (rabbit kidney), LMH (leghorn male hepatoma), MDCK (Madin-Darby canine kidney), MDBK (Madin-Darby bovine kidney), PK15 (porcine kidney), PK2A (porcine kidney), SF9, SF21 and SF+(Spodoptera frugiperda).
10. The avian coronavirus spike protein or fragment thereof of claim 1, wherein the amino acid sequence of SEQ ID NO:1 is used for determining the position numbering in the spike protein.
11. The avian coronavirus spike protein or fragment thereof of claim 1, wherein the amino acid position 865 is within the S2 subunit of the spike protein.
12. The avian coronavirus spike protein or fragment thereof of claim 4, wherein the spike protein or fragment thereof is not from IBV strain M41.
13. The IBV spike protein or fragment thereof of claim 4, wherein the spike protein or fragment thereof is selected from a list of genotypes selected from the list of: GI-2 to 27, GII-1, GIII-1, GIV-1, GV-1, GVI-1.
14. The IBV spike protein or fragment thereof of claim 4, wherein the spike protein or fragment thereof is from an IBV with a genotype or serotype or a strain selected from the group consisting of: Arkansas, Brazil, California, Connecticut, Delaware, Dutch, Florida, Georgia, Gray, Holte, Iowa, Italy-02, JMK, LDT3, Maine, H52, H120, Pennsylvania, PL84084, Qu, QX, Q1, SE 17, Variant 2 and 4/91.
15. The IBV spike protein of claim 1, wherein the IBV spike protein or fragment thereof consists of or comprises an amino acid sequence as shown in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8 or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.
16. The avian coronavirus spike protein of claim 2, wherein the avian coronavirus or IBV with restricted cell or tissue tropism is restricted to infection and/or replication in embryonated chicken eggs and/or in primary chicken kidney cells.
17. A nucleotide sequence encoding the spike protein of claim 1.
18. A plasmid comprising the nucleotide sequence of claim 17.
19. A viral particle comprising a spike protein of claim 1.
20. An avian coronavirus comprising the spike protein of claim 1 or an IBV (infectious bronchitis virus) comprising the spike protein of claim 4.
21. The avian coronavirus or IBV of claim 20, wherein the avian coronavirus or IBV is attenuated.
22. A cell comprising: the plasmid of claim 18, or the viral particle of claim 19, or the avian coronavirus or IBV of claim 20.
23. An immunogenic composition comprising: the spike protein of claim 1, or the viral particle of claim 19, or the avian coronavirus or IBV of claim 20.
24-26. (canceled)
27. A method for immunizing a subject comprising administering to the subject the immunogenic composition of claim 23.
28. A method of treating or preventing clinical signs caused by IBV in a subject of need, comprising administering to the subject a therapeutically effective amount of the immunogenic composition of claim 23.
29. A method of reducing the cilio stasis in a subject of need, in comparison to a subject of a non-immunized control group of the same species, the method comprises administering to the subject a therapeutically effective amount of the immunogenic composition of claim 23.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0513]
[0514]
[0515]
[0516]
SEQUENCES OVERVIEW
[0517] SEQ ID NO:1 IBV H52 spike protein
SEQ ID NO:2 IBV H52 spike protein with Q865H mutation
SEQ ID NO:3 IBV CR88 spike with Q867H mutation
SEQ ID NO:4 IBV QX spike protein with Q868H mutation
SEQ ID NO:5 IBV Q1 spike protein with Q869H mutation
SEQ ID NO:6 IBV Var 2 spike protein with Q868H mutation
SEQ ID NO:7 IBV BR-I spike protein with Q872H mutation
SEQ ID NO:8 IBV Ark spike protein with Q871H mutation
SED ID NO:9 pUC57-s H52 rIBV S Q865H donor plasmid
SEQ ID NO:10 pUC57-s H52 rIBV S donor plasmid
SEQ ID NO:11 IBV CR88 spike protein
SEQ ID NO:12 pUC57-s CR88 mIBV donor plasmid
SEQ ID NO:13 pGEM-T CR88 S
SEQ ID NO:14 pUC57-s CR88 rIBV S Q867H donor plasmid
SEQ ID NO:15 pGEM-T CR88 S Q867H
SEQ ID NO:16-31 primers
EXAMPLES
[0518] The following examples are set forth below to illustrate specific embodiments of the present invention. These examples are merely illustrative and are understood not to limit the scope or the underlying principles of the present invention.
Example 1
Generation of a Recombinant IBV H52 in which the Amino Acid 865 of the Spike Protein is Mutated to a Histidine
[0519] For the generation of recombinant IBV the method of targeted RNA recombination as described by van Beurden et al. (Virol J. 2017; 14(1):109) is applied.
Donor Plasmid Construction
[0520] The H52 spike protein sequence (SEQ ID NO:1) is amplified via PCR using primers 1044 and 1045 (table 1) and cloned into pGEM®-T vector system (Promega) yielding the plasmid pGEM-T IBV H52 spike. The QuikChangeMulti Site-Directed Mutagenesis Kit (Agilent Technologies) with primer PO2079 (table 1) is used according to kit protocol to introduce a mutation from glutamine to histidine at the position 865 in H52 spike S2 subunit (SEQ ID NO:2). Positive plasmids are identified via NcoI and NsiI restriction digest prepared from clonal bacterial cultures after transformation. To identify plasmids with the targeted mutation, Sanger sequencing of plasmids with the expected restriction pattern is performed using primers PO617 and PO634 (table 1).
TABLE-US-00001 TABLE 1 Primers for cloning, site directed mutagenesis and characterization of the pGEM-T IBV H52 spike plasmid. SEQ ID NO: Name Sequence 16 P01044 ttaattaagtgtggtaa gttgcttgtaagag atgttggtaacacc tc 17 P01045 ctcgagcgacttattcaat aaattcatcattaaa cagactttttagg 18 P02079 ccatacaagcaaatgct cacgtggatcgtc ttataactg 19 P0619 tgctgcttcctttaataag 20 P0634 aacactataccattaggtgc
[0521] To generate the H52 donor plasmid pUC57-s H52 rIBV S Q865H (SEQ ID NO:9) the NEBuilder HiFi DNA Assembly Cloning Kit (NEB) is used according to the kit protocol. For Gibson assembly, the H52 S Q865H sequence is amplified from the pGEM-T IBV H52 S Q865H plasmid via PCR. Further, two PCRs are performed to generate the flanking sequences of the spike in the context of the IBV H52 viral genome including a EcoRV and BlpI restriction site, respectively (table 2). For this, the pUC57-s IBV-5-1b-S-SIR-3T donor plasmid described by van Beurden et al., hereafter referred to as pUC57-s H52 rIBV donor plasmid (SEQ ID NO:10) is used as template. The correct size and purity of the PCR are products is determined via agarose gel, subsequently the PCR products are purified with the QIA quick PCR purification kit (QIAGEN). In parallel, the pUC57-s H52 rIBV donor plasmid is digested with EcoRV and BlpI to obtain the donor plasmid backbone sequence of roughly 7000 base pairs for Gibson assembly. Positive plasmids are identified by restriction digest with EcoRV and XbaI. Positive plasmids are sequences with primers PO619 and PO634 (table 1) to confirm the presence of the Q865H mutation in the spike S2 subunit.
TABLE-US-00002 TABLE 2 Setup for generation of PCR products to obtain the pUC57-s H52 rIBV S Q865H donor plasmid with Gibson HiFi assembly. SEQ ID Primer Primer PCR product Template NO: name sequence 1 5′ spike pUC57-s 21 P01783 cagagcacaagtttg flank H52 atcttgtgatatctg rIBV atatgtatacagaca atgattc 22 P01762 gtgttaccaacatct cttaccagtaactta cc 2 spike pGEM-T 23 P01765 ttactggtaagagat IBV gttggtaacacctct H52 S tttac Q865H 24 P01766 ggactttggatcatt aaacagactttttag gtctg 3 3′ spike pUC57-s 25 P01763 aaagtctgtttaatg flank H52 atccaaagtcccact rIBV ag 26 P01788 cttaactcctggaat tactaaccacgtgta ccaaaataaacaaca agc
Targeted RNA Recombination and Rescue of Recombinant IBV
[0522] The H52 murinized (m)IBV helper virus and recombinant IBV are generated as described by van Beurden et al. (Virol J. 2017; 14(1):109). Briefly, for the generation of H52 rIBV S Q865H, LR7 cells are infected with H52 mIBV and electroporated with an in vitro transcript generated from the pUC57-s H52 S Q865H donor plasmid (SEQ ID NO:9) and subsequently injected into 8-day-old embryonated SPF chicken eggs (VALO BioMedia). After up to eight days of incubation, the allantoic fluids of all eggs are analyzed separately for rescue of recombinant IBV after RNA isolation with the MagMAX™ Core Nucleic Acid Purification Kit (ThermoFisher) and the KingFisher™ Duo Prime Purification System (ThermoFisher) and by using SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (ThermoFisher). Primers PO765 and PO1324 (table 3) binding in H52 IBV lab and H52 IBV S spike are used to distinguish recombinant IBV from mIBV. The positive allantoic fluid of one egg inoculated with the infected and electroporated LR7 cells is used for an end-point dilution in 8-day-old embryonated SPF eggs. Nucleic acids isolation and sample analysis is conducted as described above. The same procedure is applied for a second end-point dilution procedure. Afterwards, one positive-tested allantoic fluid is used for propagation in 10-day-old embryonated SPF chicken eggs. The allantoic fluid is diluted 1:1000 in 1×PBS and 100 μl are injected per egg, which are subsequently incubated at 37.5° C. and 60% humidity. Allantoic fluid is harvested 48 hours post inoculation, pooled, cleared from debris by centrifugation and stored at −80° C.
TABLE-US-00003 TABLE 3 Primers for confirmation of H52 rIBV S Q865H rescue after targeted RNA recombination. SEQ ID NO: name sequence 27 P0765 tgacttggtttgaagatggc 28 P01324 ccccatgtaaatgccaacca
Conclusion Example 1: A Recombinant H52 IBV with a Mutation from Glutamine to Histidine at Position 865 of the Spike is Rescued
In Vitro and in Ovo Characterization of Recombinant IBV
Determination of Embryo Infectious Dose 50% (EID.SUB.50.)
[0523] An aliquot of the virus stock is thawed and 10-fold diluted in 1×PBS to determine the 50% embryo infectious dose (EID.sub.50) by inoculation of 100 μl into the allantoic cavity of five 8-day old embryonated chicken eggs per dilution. Eggs are incubated at 36.5° C., 60% humidity until 7 days post inoculation. Eggs with dead embryos after 24 hours are excluded from the experiment. All other eggs with dead embryos at 7 days post inoculation are considered positive. All eggs with living embryos are canceled from the bottom at 7 days post inoculation to identify dwarfs, which are considered positive. The EID.sub.50/ml is calculated with the formula of Reed and Muench (Am J Epidemiol, 1938; 27(3):493-497).
Tissue Culture Infectious Dose 50% (TCID.SUB.50.)
[0524] Eb66® cell viability is analyzed with BioRad TC20 and trypan blue with the gate set to 6-13 μm. Per 96 well 2×10.sup.6 living Eb66® cells/ml in EX-CELL® EBx™ GRO-I Serum-Free Media+2.5 mM L-Glutamine are seeded 1 day prior to inoculation and incubated at 37° C. and 7.5% CO2. A 10-fold serial dilution of the virus in Eb66® cell medium is performed and 100 μl per dilution (at least 4 replicates per dilution) are added to Eb66® cells after removing the culture medium. If allantoic fluid is used for infection it is passed though a 0.45 μm pore sized filter prior to dilution. Infected cells are incubated for 72 hours followed by immunofluorescence staining to identify positive wells. Medium is aspirated from all wells, which are subsequently washed with 1×PBS before the addition of 100 μl ethanol per well for cell fixation for 10 min at RT and subsequent air drying of the cells. The cells are incubated with 100 μl of primary chicken anti-IBV Mass serum (Boehringer Ingelheim), diluted 1:250 in 1×PBS, for 45 min at room temperature. After removal of the primary antibody each well is washed three times with 1×PBS. 100 μl of secondary Alexa Fluor 488 goat anti-chicken IgG antibody (ThermoFisher Scientific, 1:500 dilution in 1×PBS) are added and incubated for 45 min at room temperature in the dark. After removal of the secondary antibody, each well is washed three times with 1×PBS, leaving the final wash on the cells. Positive wells are identified by fluorescence microscopy and recorded to calculate the TCID.sub.50/ml with the formula of Reed and Muench (Am J Epidemiol, 1938; 27(3):493-497).
Passaging of rIBV in Eb66® Cells
[0525] To analyze if H52 rIBV S Q865H is able to replicate in cells, three consecutive blind passages are performed in EB66®. The cells are seeded at a density of 4×10.sup.5 cells/ml in EX-CELL® EBx™ GRO-I Serum-Free Media+2.5 mM L-Glutamine into T25 flasks with a total volume of 5 ml and are infected with a 1/100 dilution of H52 rIBV S Q865H. The cultures are incubated for 72 hours at 37° C. and 7.5% CO2 and shaking at 100 rpm. The culture is harvested and stored at −80° C. For passages 1, 2, and 3 virus replication is assessed via RT-qPCR for the For this, 250 μl of the cell suspension are removed directly after inoculation (time point 0 h) and after harvest (time point 72 h) for nucleic acid isolation. Nucleic acids are isolated with the MagMAX™ Core Nucleic Acid Purification Kit (ThermoFisher) and the KingFisher™ Duo Prime Purification System (ThermoFisher). The RT-qPCR to detect the relative amount of IBV RNA is performed with a protocol adapted from Callison et al. (J Virol Methods. 2006; 138 (1-2):60-5) as described above. Indeed the Q865H mutation in the spike of H52 IBV is sufficient to enable cell culture replication of the egg-restricted H52. The H52 rIBV S Q865H replicated efficiently in all three passages, as represented by the decrease in the ct value between time point of infection (0h) and harvest (72) as depicted in
[0526] In addition, the infectious titers for the allantoic fluid stock (10.sup.7.32 EID.sub.50/ml) and Eb66® passage P3 (10.sup.5.25 TCID.sub.50/ml, 10.sup.8.13 EID.sub.50/ml) are determined via immunofluorescence staining (
Infection of BHK Cells with H52 rIBV S Q865H
[0527] The ability to infect BHK cells is analyzed for the allantoic fluid stocks of H52 rIBV S Q865H and H52 rIBV or an uninfected negative control. BHK cells are seeded in MEM (SAFC)+5% FCS (SAFC)+25 μg/ml L-Gentamicin (Gibco) medium into 12-well plates to reach 80 to 90% confluence on the next day. The cells are incubated at 37° C. and 5% CO2. Before infection the allantoic fluid virus stocks are set to 10.sup.6 to 10.sup.7 EID.sub.50/ml and passed through a 0.45 μm pore sized filter. Afterwards, they are diluted 1/10 in medium and BHK cells are infected with 100 μl/well after aspiration of medium. After 72 hours the supernatant is taken off and the immunofluorescence assay as described for the TCID.sub.50 assay above is performed and the stained cells are analyzed by fluorescence microscopy (
[0528] In a second experiment, the infection procedure described above is repeated. 72 hours post infection the supernatant is taken off and the cells are washed with 1×PBS and 50 μl TrypLE Select (ThermoFisher Scientific) are added to detach cells. Cells are resuspended in supernatant and transferred to a T25 flask with 80-90% confluent BHK cells and 5 ml fresh medium (P2), which is incubated for 72 hours. Again, the supernatant and cells are collected and transferred to a T75 flask with 80-90% confluent BHK cells and 10 ml fresh medium, which is incubated for 72 hours (P3). The supernatant is harvested. The cells are detached by trypsin treatment and seeded into 12 well plates at a ratio of 1 to 3 in fresh medium and incubated until the next day. Medium is aspirated, and the immunofluorescence assay as described above is performed (
[0529] Conclusion Example 1: The data show that the mutation to Histidine at the position 865 of the spike sequence (reference sequence for the numbering is SEQ ID NO:1) in an IBV leads to an extended cell culture and tissue tropism. An H52 recombinant IBV having the Q865H mutation in the spike protein can be efficiently cultured in different cell lines such as EB66 and BHK cells. It is assumed that said IBV can be cultured in other cell lines as well. Further, said mutation has no impact on in ovo replication of the virus.
Example 2
Generation of Recombinant IBV CR88 in which the Amino Acid 867 of the Spike Protein is Mutated to a Histidine
[0530] In order to determine if the change to a histidine at position 865 in the IBV spike can also be applied to other genotypes or serotypes, the spike amino acid sequence (SEQ ID NO:11) of the CR88 IBV strain is aligned to the H52 Spike amino acid sequence (SEQ ID NO:1) to determine the position equivalent to amino acid position 865 of H52 spike for IBV CR88 spike, which is determined as the glutamine at position 867 of the CR88 spike.
Construction of an IBV CR88 Murinized Donor Plasmid
[0531] To generate the CR88 murinized (m)IBV donor plasmid the donor sequence is synthesized by a commercial supplier: 497 nucleotides of the 5′ UTR of the CR88 genome are fused to the 3′ part of the lab region (752 bases) and the first 72 nucleotides coding for the CR88 IBV spike, followed by 3753 nucleotides of the MHV spike ectodomain, continuing with the terminal 210 nucleotides of the CR88 IBV spike and the following sequence until the 3′ end of the genome. In addition, a SacI restriction site and the sequence of the T7 promoter are added to the 5′ end of the donor region, as well as a 100×polyA sequence, followed by a Nod restriction site for linearization at the 3′ end, respectively. A silent A to C mutation at position 5634 of the assembled sequence is introduced to generate an XhoI restriction site. The synthesized sequence is inserted into pUC57-simple to yield the pUC57-s CR88 mIBV donor plasmid (SEQ ID NO:12).
Rescue of CR88 mIBV
[0532] CR88 mIBV is rescued in analogy to H52 mIBV (van Beurden et al. Virol J. 2017; 14(1):109) with some alterations: The virus allantoic fluid stock is concentrated via ultracentrifugation before isolation of the viral RNA for electroporation. 18 ml of viral allantoic fluid are centrifuged at 50,000×g for 2 hours through a 2 ml 20% Sucrose cushion in TNE (Tris, NaCl, EDTA) buffer. The supernatant is discarded and the pellet resuspended in 150 μl TNE buffer followed by RNA isolation with QIAamp viral RNA mini kit (Qiagen). Further, chicken embryo fibroblasts (CEFs) instead of BHK cells are used for electroporation (2 pulses 250 V/300 μF, 10 sec break) and 1.25% DMSO is added to the electroporation mixture.
Donor Plasmid Construction
[0533] The CR88 spike nucleic acid sequence with flanking sequences is synthesized by a commercial supplier and cloned into pGEM-T (SEQ ID NO:13). It is used as a template for site directed mutagenesis to change the glutamine at amino acid position 867 of the IBV CR88 spike (SEQ ID NO:11) into a histidine (SEQ ID NO:3). For this, the QuikChangeMulti Site-Directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer's protocol and the primer PO1884 (table 4) designed by the corresponding online tool are used. Positive plasmids are identified by restriction digest and analyzed for the presence of the desired mutation by Sanger sequencing with primer PO619 and PO634 (table 4). For the generation of the pUC57-s CR88 rIBV S Q867H donor plasmid (SEQ ID NO:14), the pGEM-T CR88 S Q867H plasmid containing the mutated CR88 spike sequence (SEQ ID NO:15) is digested with PacI, XhoI and PvuI. The band corresponding to the spike is cut from the gel and purified with the QIAquick gel extraction kit (Qiagen). Further, the CR88 mIBV donor plasmid (SEQ ID NO:12) is digested with PacI, XhoI and KpnI to obtain the donor plasmid backbone. The band with the highest molecular weight is cut from the gel and purified via QIAquick Gel Extraction Kit (Qiagen). The purified spike insert and CR88 donor plasmid backbone are ligated using T4 DNA ligase (ThermoFisher Scientific) at 16° C. over night. The ligation mixture is transformed into NEB 5-α competent E. coli (NEB) by heat shock. After GeneJET Plasmid Miniprep Kit (ThermoFisher Scientific), positive plasmids are identified by restriction digest and characterized for the targeted mutation by Sanger sequencing with primers PO619 and PO634 (table 4).
Targeted RNA Recombination and Rescue of Recombinant IBV
[0534] For rescue of CR88 rIBV S Q867H, LR7 cells are infected with CR88 mIBV and electroporated with in vitro transcript generated from the NotI linearized pUC57-s CR88 S Q867H donor plasmid, and subsequently injected into 8-day-old embryonated SPF chicken eggs (VALO BioMedia). After up to eight days of incubation, the allantoic fluids of all eggs are analyzed separately for the rescue of recombinant IBV after RNA isolation with the MagMAX™ Core Nucleic Acid Purification Kit (ThermoFisher) and the KingFisher™ Duo Prime Purification System (ThermoFisher) and by using SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (ThermoFisher). Primers PO1728 and PO1729 (Table 4) binding in CR88 IBV lab and CR88 IBV S spike are used to distinguish recombinant IBV from mIBV. The positive allantoic fluid of the egg inoculated with the highest dilution of LR7 cells is used for an end-point dilution in 8-day-old embryonated SPF eggs. Nucleic acid isolation is conducted as described above. Samples are analyzed via RT-qPCR conducted according to the protocol adapted from Callison et al. (J Virol Methods. 2006; 138(1-2):60-5). Briefly, the same primers and probe are used and the thermoprofile is adapted for the use of TaqMan® Fast Virus 1-Step Master Mix (ThermoFisher) and the StepOnePlus or the ABI7900 HT Fast Real-Time PCR Systems (ThermoFisher Scientific). Afterwards, one positive-tested allantoic fluid of a high dilution is used for propagation in 8-day-old embryonated SPF chicken eggs. The allantoic fluid is diluted 1:100 in 1×PBS and 100 μl is injected per egg which are subsequently incubated at 37.5° C. and 60% humidity. Allantoic fluid is harvested at 48 hours post inoculation, cleared from debris by centrifugation and stored at −80° C.
TABLE-US-00004 TABLE 4 SDM primer to obtain the CR88 S Q867H mutation and sequencing primers for confirmation of the targeted mutation and confirmation of CR88 rIBV rescue. SEQ ID NO: Name Sequence 29 P01884 ctattcaggcagatgctcat gttgatcgtcttattacag 19 P0619 tgctgcttcctttaataag 20 P0634 aacactataccattaggtgc 30 P01728 tcagcgtggacatgtggtta 31 P01729 ccccatataggtgccaacct
In Vitro and in Ovo Characterization of Recombinant IBV
[0535] The determination of EID50, TCID50 as well as the passaging procedure in Eb66 or BHK cells are performed as described in example 1 and similar results are obtained with CR88 rIBV S Q865H.
[0536] Conclusion example 2: The data show that the mutation to Histidine at the position 867 of the CR88 spike sequence (reference sequence for the numbering is SEQ ID NO:1) in an IBV leads to an extended cell culture and tissue tropism. An CR88 recombinant IBV having the Q867H mutation in the spike protein can be efficiently cultured in different cell lines such as EB66 and BHK cells. It is assumed that said IBV can be cultured in other cell lines as well. Further, said mutation has no impact on in ovo replication of the virus.