DNA polymerases
11390857 · 2022-07-19
Assignee
Inventors
Cpc classification
Y02A90/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N9/1252
CHEMISTRY; METALLURGY
International classification
C12N9/12
CHEMISTRY; METALLURGY
Abstract
The present invention provides a DNA polymerase including the sequence of SEQ ID NO. 1 or a sequence which is at least 70% identical thereto, but wherein the aspartic acid residue at position 18 of SEQ ID NO. 1, or the equivalent aspartic acid residue in other sequences, has been replaced by a non-negatively charged amino acid residue. It further provides DNA polymerases comprising the amino acid sequences of SEQ ID NO. 2, 11 and 12 and variants thereof. The present invention also provides nucleic acids encoding the DNA polymerases, a method of producing said DNA polymerases, and compositions, expression vectors and host cells or viruses comprising said DNA polymerases. The present invention also provides uses of said DNA polymerases in nucleotide polymerisation, amplification and sequencing reactions.
Claims
1. A DNA polymerase comprising the amino acid sequence of SEQ ID NO:2 or a variant sequence which is at least 70% identical to SEQ ID NO:2, wherein an aspartic acid residue at position 422 of SEQ ID NO:2, or an equivalent aspartic acid residue at an equivalent position in the variant sequence, is replaced by alanine.
2. The DNA polymerase according to claim 1, wherein said DNA polymerase comprises an amino acid sequence which is at least 80% identical to SEQ ID NO:2, wherein the aspartic acid residue at position 422 of SEQ ID NO:2, or the equivalent aspartic acid residue in the variant sequence, is replaced by alanine.
3. The DNA polymerase according to claim 1, wherein said DNA polymerase comprises the amino acid sequence of SEQ ID NO: 2, or an amino acid sequence which is at least 90% identical to SEQ ID NO: 2, wherein the aspartic acid residue at position 422 of SEQ ID NO: 2, or the equivalent aspartic acid residue at the equivalent position in the variant sequence, is replaced by alanine.
4. The DNA polymerase according to claim 1, wherein said DNA polymerase comprises an amino acid sequence which is at least 70% identical to SEQ ID NO: 4, wherein an aspartic acid residue at position 719 of SEQ ID NO. 4, or an equivalent aspartic acid residue at an equivalent position in the variant sequence, is replaced by alanine.
5. The DNA polymerase according to claim 1, wherein said DNA polymerase has at least 30% greater strand displacement activity as compared to a DNA polymerase with SEQ ID NO:2 but with aspartic acid at position 422, relative to SEQ ID NO:2, or at the equivalent position in the variant sequence.
6. The DNA polymerase according to claim 1, wherein across a concentration range from 20 mM to 200 mM of NaCl, KCl, or a mixture thereof, said DNA polymerase exhibits at least 40% of its maximum polymerase activity.
7. A composition, comprising: the DNA polymerase according to claim 1, and a buffer.
8. A nucleic acid molecule, comprising: a nucleotide sequence encoding the DNA polymerase according to claim 1.
9. The nucleic acid molecule of claim 8, wherein the nucleotide sequence has at least 70% sequence identity to SEQ ID NO: 13.
10. An expression vector comprising the nucleic acid molecule of claim 8, and one or more regulatory sequences enabling transcription and translation of a protein encoded by said nucleic acid molecule.
11. A host cell or virus, comprising one or more expression vectors according to claim 10.
12. A host cell or virus, comprising one or more nucleic acid molecules according to claim 8.
13. A method of producing the DNA polymerase of claim 1, which comprises: (i) culturing a host cell in a growth medium, wherein the host cell comprises one or more recombinant expression vectors or one or more nucleic acid molecules encoding the DNA polymerase according to claim 1, under conditions suitable for expression of the encoded DNA polymerase; and optionally (ii) isolating the expressed DNA polymerase from the host cell or from the growth medium or supernatant of the growth medium.
14. A method of nucleotide polymerization, which comprises: (i) providing a reaction mixture comprising: the DNA polymerase according to claim 1, a template nucleic acid molecule, an oligonucleotide primer which is capable of annealing to a portion of the template nucleic acid molecule, and one or more species of nucleotide; and (ii) incubating said reaction mixture under conditions whereby the oligonucleotide primer anneals to the template nucleic acid molecule and said DNA polymerase extends said oligonucleotide primer by polymerizing one or more nucleotides.
15. The method of claim 14, wherein said method is performed at a constant temperature.
16. The method of claim 15, wherein said constant temperature is from 0° C. to 42° C.
17. The method of claim 15, wherein said constant temperature is from 10° C. to 25° C.
Description
(1) The invention will now be described by way of a non-limiting Example with reference to the following figures in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
EXAMPLES
Example 1
(9) Cloning of Sequences
(10) PB Polymerase I Wild Type (Large Fragment) and D422A Mutant
(11) The gene (SEQ ID NO: 3) encoding the DNA polymerase I large fragment (i.e. omitting the 5′-3′ exonuclease domain of the protein) from the Psychrobacillus sp. was cloned into the vector pET151/D-TOPO®. The codon-optimised variant also containing the D422A mutation (SEQ ID NO: 13) was cloned into the vector pET-11a. In each case the construct encoded a His.sub.6 tag at the N-terminus of the polymerase followed by the recognition sequence for the TEV protease, thus allowing cleavage of the tag.
(12) Bst Polymerase I (Large Fragment) and Ubts Polymerase I (Large Fragment) and their D422A Mutant
(13) The codon-optimized genes encoding the polymerase I large fragment from Geobacillus stearothermophilus (Bst) and Ureibacillus thermosphaericus (Ubts, Genbank accession nr. WP_016837139) were purchased from the Invitrogen GeneArt Gene Synthesis service from Thermo Fisher Scientific. The genes (SEQ ID NOS: 14 and 15) were cloned into the vector pTrc99A encoding an N-terminal His.sub.6-tag by FastCloning (Li et al. (2011), BMC Biotechnology, 11:92). The corresponding mutation from Asp to Ala at position 422 (PB polymerase I large fragment) was introduced using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and confirmed by sequence analysis.
(14) Protein Production and Purification
(15) PB Polymerase I Wild Type (Large Fragment) and D422A Mutant
(16) Recombinant protein production was performed in Rosetta 2 (DE3) cells (Novagen®). The cells grew in Terrific Broth media and gene expression was induced at OD.sub.600 nm 1.0 by addition of 0.1 mM IPTG. Protein production was carried out at 15° C. for 6-8 h. For protein purification the pellet of a 1-I cultivation was resuspended in 50 mM HEPES, 500 mM NaCl, 10 mM imidazole, 5% glycerol, pH 7.5, 0.15 mg/ml lysozyme, 1 protease inhibitor tablet (cOmplete™, Mini, EDTA-free Protease Inhibitor Cocktail, Roche) and incubated on ice for 30 min. Cell disruption was performed by French press (1.37 kbar) and subsequently by sonication with the VCX 750 from Sonics® (pulse 1.0/1.0, 5 min, amplitude 25%). In the first step the soluble part of the His.sub.6-tagged protein present after centrifugation (48384 g, 45 min, 4° C.) was purified by immobilized Ni.sup.2+-affinity chromatography. After a wash step with 50 mM HEPES, 500 mM NaCl, 50 mM imidazole, 5% glycerol, pH 7.5 the protein was eluted at an imidazole concentration of 250 mM and further transferred into 50 mM HEPES, 500 mM NaCl, 10 mM MgCl.sub.2, 5% glycerol, pH 7.5 by use of a desalting column.
(17) The second step was cleavage of the tag by TEV protease performed over night at 4° C. in 50 mM Tris pH 8.0, 0.5 mM EDTA and 1 mM DTT. To separate the protein from the His.sub.6-tag and the His.sub.6-tagged TEV protease a second Ni.sup.2+-affinity chromatography has been performed in the third step by applying 50 mM HEPES, 500 mM NaCl, 5% glycerol, pH 7.5. Fourth and final step of the protein purification was size-exclusion chromatography on a HiLoad 16/600 Superdex 200 pg (GE Healthcare) in 50 mM HEPES, 500 mM NaCl, 5% glycerol, pH 7.5. The final protein solution was concentrated and stored with 50% glycerol at −20° C.
(18) Bst Polymerase I and Ubts Polymerase I (Large Fragment) and their D422A Mutants
(19) Recombinant protein production for Bst and Ubts polymerase I (large fragment) and their D422A mutant was performed in Rosetta 2 (DE3) cells (Novagen®). Cells grew in Luria Bertani media at 37° C. and gene expression was induced at OD.sub.600 nm 0.5 by addition of 0.5 mM IPTG. Protein production was carried out at 37° C. for 4 h. For protein purification the pellet of a 0.5-I cultivation was resuspended in 50 mM Tris pH 8.0, 300 mM NaCl, 1 mM EDTA, 1 mM DTT, 10 mM imidazole, 0.15 mg/ml lysozyme, 1 protease inhibitor tablet (cOmplete™, Mini, EDTA-free Protease Inhibitor Cocktail, Roche) and incubated on ice for 30 min. Cell disruption was performed by sonication with the VCX 750 from Sonics® (pulse 1.0/1.0, 15 min, amplitude 25%). The soluble part of the His.sub.6-tagged protein present after centrifugation (48384 g, 45 min, 4° C.) was purified by immobilized Ni.sup.2+-affinity chromatography. After a wash step with 50 mM Tris pH 8.0, 300 mM NaCl, 1 mM EDTA, 1 mM DTT, 10 mM imidazole the protein was elution with gradually increasing the imidazole to 500 mM. Fractions containing the protein were collected and buffer exchange was performed into 20 mM Tris pH 7.1, 100 mM KCl, 2 mM DTT, 0.2 mM EDTA and 0.2 Triton X-100 by desalting. The final protein solution was concentrated and stored with 50% glycerol at −20° C.
(20) Activity Measurements
(21) Polymerase Activity
(22) The polymerase activity assay is based on a molecular beacon assay (modified from Summerer (2008), Methods Mol. Biol.; 429: 225-235). The molecular beacon template consists of a 23mer loop that is connected by a GC-rich 8mer stem region (sequence is indicated in italics) and a 43mer 3′ extension. Due to the stem-loop structure the FAM (donor) and Dabcyl (acceptor, non-fluorescent quencher) molecules are in close proximity and thus the FAM fluorescence signal is quenched. Upon primer extension by the DNA polymerase the stem is opened and the increase in distance of the two dyes is measured by the restoration of FAM fluorescence as relative fluorescence units in appropriate time intervals by exciting at 485 nm and recording emission at 518 nm. The measurement was performed in a SpectraMax® M2.sup.e Microplate Reader (Molecular Devices).
(23) TABLE-US-00002 molecular beacon template (SEQ ID NO: 16) 5′- GGCCCGT.sup.DabcylAGGAGGAAAGGACATCTTCTAGCAT.sup.FAMACGGGCCGTCAAG TTCATG GCCAGTCAAGTCGTCAGAAATTTCGCACCAC-3′ primer (SEQ ID NO: 17) 5′-GTGGTGCGAAATTTCTGAC-3′
(24) The molecular beacon substrate was produced by incubating 20 μl of 10 μM molecular beacon template and 15 μM primer in 10 mM Tris-HCl pH 8.0, 100 mM NaCl for 5 min at 95° C. The reaction was then let to cool down at room temperature for 2 h. The substrate solution was stored at −20° C. with a final concentration of 10 μM.
(25) Assay Set-Up for Analyzing Effect of Different [Salt] on Polymerase Activity of PB and Pb D422A
(26) Fifty microliter reactions consisted of 200 nM substrate and 200 μM dNTP (equimolar amounts of dATP, dGTP, dCTP and dTTP). The reaction further contained 5 mM MgCl.sub.2 in 50 mM BIS-Tris propane at pH 8.5, 1 mM DTT, 0.2 mg/ml BSA and 2% glycerol. Final salt concentration in the reaction buffer has been adjusted to 25 mM, 40 mM, 60 mM, 80 mM, 110 mM, 160 mM and 210 mM NaCl or KCl for PB and 20 mM, 40 mM, 60 mM, 80 mM, 100 mM, 150 mM and 200 mM NaCl or KCl for PB D422A. The activity assay was carried out at 25° C. in black 96-well fluorescence assay plates (Corning®). The reaction was initiated by addition of protein solution, i.e. addition of polymerase.
(27) Results are shown in
(28) Assay Set-Up for Analyzing Specific Polymerase Activity of PB and PB D422A at 100 mM, 150 mM and 200 mM NaCl
(29) Fifty microliter reactions consisted of 200 nM substrate and 200 μM dNTP (equimolar amounts of dATP, dGTP, dCTP and dTTP). The reaction further contained 5 mM MgCl.sub.2 in 50 mM BIS-Tris propane at pH 8.5, 1 mM DTT, 0.2 mg/ml BSA and 2% glycerol. Final salt concentration in the reaction buffer has been adjusted to 100 mM, 150 mM and 200 mM NaCl, respectively. The assay was carried out at 25° C. in black 96-well fluorescence assay plates (Corning®). The reaction was initiated by addition of protein solution, i.e. addition of polymerase.
(30) Results are shown in Table 3 (at end of Example).
(31) Strand-Displacement Activity Assay
(32) An overview of the assay setup is shown in
(33) The substrate for the strand-displacement activity assay consists of a “cold” primer of 19 oligonucleotides (SEQ ID NO:18) and a reporter strand consisting of 20 oligonucleotides that is labeled with the TAMRA fluorophore (F) at its 3′ end (SEQ ID NO:19). The template strand consists of 40 oligonucleotides and is labeled with the Black Hole Quencher 2 (BHQ2) at its 5′ end (SEQ ID NO:20). The primers are annealed to the template strand leaving a one nucleotide gap at position 20 on the template strand. The labels are in close proximity and thus the fluorophore TAMRA is quenched by BHQ2. Upon strand-displacement activity of the DNA polymerase I the TAMRA labeled oligonucleotide is displaced from the template strand. As a consequence the fluorophore and the quencher are no longer in close proximity and an increase in TAMRA fluorescence can be measured as relative fluorescence units in appropriate time intervals (excitation 525 nm, emission 598 nm, SpectraMax® M2.sup.e Microplate Reader (Molecular Devices)).
(34) TABLE-US-00003 5′-TATCCACCAATACTACCCT CGATACTTTGTCCACTCAAT [TAMRA]-3′ 3′-ATAGGTGGTTATGATGGGATGCTATGAAACAGGTGAGTTA [BHQ2]-5′
(35) The substrate for the strand-displacement activity assay was produced by incubating 20 μl of 10 μM “cold” primer, 10 μM reporter strand and 10 μM template strand in 10 mM Tris-HCl pH 8.0, 100 mM NaCl at 95° C. for 5 min. The reaction was then let to cool down at room temperature for 2 h. The substrate solution was stored at −20° C. with a final concentration of 10 μM.
(36) Assay Set-Up for Comparison of the Specific Strand-Displacement Activity of PB, PB D422A and Commercially Known Polymerases
(37) Fifty microliter reactions consisted of 200 nM substrate and 200 μM dNTP (equimolar amounts of dATP, dGTP, dCTP and dTTP). For PB polymerase I the reaction further contained 5 mM MgCl.sub.2 in 50 mM BIS-TRIS propane at pH 8.5, 100 mM NaCl, 1 mM DTT, 0.2 mg/ml BSA and 2% glycerol. For the commercially known polymerase Is the respective reaction buffer supplied by New England Biolabs have been used. Final salt concentration in the reaction buffer has been adjusted to 100 mM according to the optimal salt for the respective polymerases. The activity assay was carried out at 25° C. in black 96-well fluorescence assay plates (Corning®). The reaction was initiated by addition of protein solution (i.e. addition of polymerase).
(38) Results are shown in
(39) Assay Set-Up for Specific Strand-Displacement Activity of PB and PB D422A at 100 mM, 150 mM and 200 mM NaCl
(40) Fifty microliter reactions consisted of 200 nM substrate and 200 μM dNTP (equimolar amounts of dATP, dGTP, dCTP and dTTP). The reaction further contained 5 mM MgCl.sub.2 in 50 mM BIS-Tris propane at pH 8.5, 1 mM DTT, 0.2 mg/ml BSA and 2% glycerol. Final salt concentration in the reaction buffer has been adjusted to 100 mM, 150 mM and 200 mM NaCl, respectively. The assay was carried out at 25° C. in black 96-well fluorescence assay plates (Corning®). The reaction was initiated by addition of protein solution, i.e. addition of polymerase.
(41) Results are shown in Table 2 below.
(42) Assay Set-Up for Analyzing Strand-Displacement Activity of Bst/BstD422A and Ubts/UbtsD422A
(43) Fifty microliter reactions consisted of 200 nM substrate and 200 μM dNTP (equimolar amounts of dATP, dGTP, dCTP and dTTP). The reaction further contained 20 mM Tris pH 7.9 (at 25°), 10 mM KCl, 10 mM (NH.sub.4).sub.2SO.sub.4, 2 mM MgSO.sub.4, 0.1% Triton X-100.
(44) The assay was carried out at 37° C. in black 96-well fluorescence assay plates (Corning®). The reaction was initiated by addition of protein solution (20 ng for Bst and BstD422A, 100 ng for Ubts and UbtsD422A), i.e. addition of polymerase. For determination of the specific strand-displacement activity (mRFU/min/μg) at a higher KCl the final concentration has been set to 150 mM KCl. The increase in TAMRA fluorescence was measured as relative fluorescence units in appropriate time intervals by exciting at 525 nm and recording emission at 598 nm. The measurement was performed in a SpectraMax® M2.sup.e Microplate Reader (Molecular Devices).
(45) Results based on this strand-displacement activity assay are shown in
Tables
(46) TABLE-US-00004 TABLE 1 Summary of different enzymatic properties for wtPB and the D422A mutant (at 25° C.). Strand- displacement Polymerase activity activity NaCl KCl Variant (100 mM NaCl) (100 mM NaCl) T.sub.m MgCl.sub.2 (>80% activity) pH PB 310% 120% 44.8° C. 4-6 mM 25-200 mM 8.5 D422A 40-200 mM PB pol I 100% 100% 44.8° C. 3-8 mM 25-125 mM 8.5 wild type 25-115 mM
(47) TABLE-US-00005 TABLE 2 Strand-displacement activity of PB D422A mutant compared to wtPB in presence of 100-200 mM NaCl. Strand-displacement activity Activity [mRFU/min/μg] NaCl wtPB PBD422A Ratio (PB D422A/wtPB) 100 9.35E+04 28.8E+04 3.1 150 7.54E+04 20.5E+04 2.7 200 4.65E+04 18.1E+04 3.9
(48) TABLE-US-00006 TABLE 3 DNA polymerase activity of PB D422A mutant compared to wt PB in presence of 100-200 mM NaCl. Polymerase activity Activity [mRFU/min/μg] NaCl [mM] wtPB PBD422A Ratio (PB D422A/wtPB) 100 1.42E+06 1.66E+06 1.2 150 1.02E+06 1.50E+06 1.5 200 0.55E+06 1.37E+06 2.5
(49) TABLE-US-00007 TABLE 4 Strand-displacement activity of the D422A mutants of Bst and Ubts compared to wt enzymes in presence of 150 mM KCl. Ratio Ratio SDA(mRFU/min/μg) BstD422A/ SDA (mRFU/min/μg) UbtsD422A/ Bst (wt) BstD422A Bst Ubts(wt) UbtsD422A Ubts 3.52E+05 6.99E+05 2.0 0.59E+05 2.14E+05 3.6
Example 2
(50) Further Psychrobacillus sp. (PB) DNA polymerase mutants were also made and tested:
(51) Site-Directed Mutagenesis
(52) The corresponding mutation from Asp to Ser, Lys, Val, Leu and Asn, respectively, at position 422 was introduced using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies).
(53) D422V and D422L (hydrophobic residues of different lengths),
(54) D422S (small hydrophilic),
(55) D422N (larger hydrophilic) and
(56) D422K (positively charged).
(57) The starting point was the plasmid DNA of the D422A mutant. Mutations were confirmed by sequencing analysis.
(58) Protein Production and Protein Purification
(59) Recombinant protein production was performed in Rosetta 2 (DE3) cells (Novagen®). The cells grew in Terrific Broth media and gene expression was induced at OD.sub.600 nm 1.0 by addition of 0.1 mM IPTG. Protein production was carried out at 15° C. for 6-8 h. For protein purification the pellet of a 50-ml cultivation was resuspended in 1 ml 50 mM HEPES, 500 mM NaCl, 10 mM imidazole, 5% glycerol, pH 7.5, 0.15 mg/ml lysozyme and incubated on ice for 20 min. Cell disruption was performed by sonication with the VCX 750 from Sonics® (pulse 1.0/1.0, 1 min, amplitude 20%).
(60) The soluble part of the His.sub.6-tagged protein present after centrifugation (16000 g, 30 min, 4° C.) was purified with PureProteome™ Magnetic Beads (Millipore) and eluted in 50 μl 50 mM HEPES, 500 mM NaCl, 500 mM imidazole, 5% glycerol, pH 7.5.
(61) The strand-displacement assay was performed as described in Example 1.
(62) All these other mutants performed better in assays of strand displacement activity (data not shown) as compared to the wt PB polymerase, but not as well as the PB D422A mutant.